CN108384805B - Promote application of the reagent of circular rna circRNF13 expression on preparation treatment Dendritic cell drug - Google Patents

Abstract

The invention discloses promote application of the reagent of circular rna circRNF13 expression on preparation treatment Dendritic cell drug.It confirms to be overexpressed circRNF13 in Tca8113 cells by studying, the proliferation of Tca8113 cells can be inhibited.Therefore, it is used for circRNF13 overexpression preparation to treat Dendritic cell, there is far-reaching clinical meaning and important popularization and application foreground.

Description

The reagent of circular rna circRNF13 expression is promoted to treat Dendritic cell drug in preparation On application

Technical field

The invention belongs to oncomolecularbiology fields, and in particular to promote the reagent of circular rna circRNF13 expression Application on preparation treatment Dendritic cell drug.

Background technique

The Human Genome Project and its subsequent DNA element encyclopedia plan (The Encyclopedia of DNA Elements Project, ENCODE) research achievement shows that protein coding gene sequence only accounts for the 1- of human genomic sequence 3%, and the transcribed sequence of the overwhelming majority is non-coding RNA (non-coding RNA, ncRNA) in human genome.Non- volume Code RNA is although non-coding protein, due to wide participation genes within cells expression regulation, in field of biomedical research one Directly it is concerned.Study more is linear ncRNA molecule, from RNA sequence length can be divided into Microrna (microRNA, MiRNA, 19-23nt) and long-chain non-coding RNA (long non-coding RNA, lncRNAs, > 200nt), they are including Important function is played in the occurrence and development of a variety of mankind's common diseases including malignant tumour.Recently, a kind of completely new NcRNA molecule, circular rna (circular RNA, circRNA) is due to its unique configuration and the important biomolecule increasingly found Function is learned, the new forward position of field of biomedicine and hot spot are had become.

CircRNA had once once been taken as the wrong product during genetic transcription post-processing.With the lines such as mRNA and lncRNA Property RNA process it is much like, the formation of circRNA is also raw when carrying out montage processing to RNA precursor by splicing complex At, only in this course, the loop-forming sequences of flank combine cyclization first, and subsequent splicing complex carries out montage, most Flanking sequence cuts off to form circRNA at last.Recently as new-generation sequencings technologies such as sequencing technologies especially RNA-seq Development, more and more circRNA are by it has been found that simultaneously having passed through research discloses part circRNA in numerous life It all plays an important role in activity.Additionally due to its unique structure causes circRNA insensitive to nuclease, in tumour CircRNA also has a clear superiority in terms of the development and application of marker, therefore very likely as a kind of important molecular marker The target spot of object and emerging drug development.But since this field has just emerged, most of circRNA is not yet found or there is no Research.

Squamous cell carcinoma of tongue (tongue squamous cell carcinoma, TSCC) is that the highest oral cavity of disease incidence is disliked Property tumour, Dendritic cell majority is squamous carcinoma, mostly occurs in lingual margin, is often ulcer type or leaching secondly for the tip of the tongue, back and root of the tongue etc. Profit type.General grade malignancy is higher, and growth is fast, and wellability is stronger, and ordinary wave and lingualis cause tongue limitation of movement, makes to speak, feed And it swallows and difficulty occurs.The chemotherapy that operative treatment is aided with based on suitable platinum medicine is Dendritic cell clinically main treatment side Case.However, finding that the therapeutic effect of Dendritic cell patient is often not satisfactory in clinic, survival rate is only 55-65% within 5 years, studies carefully it Reason essentially consists in the remaining cancer cell of operation, and (for example to have invaded the circulating tumor being transferred in blood vessel or lymphatic vessel thin Born of the same parents) generally existing drug resistance, oncogenic recurrence and transfer are led, treatment failure is caused.Therefore, Tca8113 cells are found out to chemotherapy The resistance mechanisms of drug screen new drug target, final to improve survival and life quality, are to be worth clinical section The important topic that the workers of grinding study.

In order to study circRNA in Tca8113 cells to the effect and mechanism in cis-platinum class Drug-resistant, we are used The circRNA genetic chip Arraystar Human Circular RNA Microarray V2.0 of Agilent company is to two The expression of circRNAs in Tca8113 cells strain (Tca8113 and Cal27) before and after cisplatin treated is analyzed.I Find circRNF13 expression variation it is the most significant, prompt circRNF13 may be related to the cisplatin resistance of Dendritic cell, and Up to the present, the biological function of circRNF13 and mechanism of action have no any report.

Since genetic chip can only be based on circRNA ring-type splicing site upstream and downstream sequence design probe, visited by these Needle specificity captures circRNA, to detect the gene expression abundance of circRNA in cell or tissue；Pass through particularly for us CircRNA chip discovery circRNF13 for, by genetic chip provide technical data we can find its corresponding spy The total 60bp of needle, the last period is the sequence of 8 exon, 3 ' the end 30bp of RNF13 gene, and latter section is then RNF13 gene 2 5 ' end 30bp of exon, prompting it is to be joined end to end to add by No. 2 of the precursor RNA of RNF13 genetic transcription and 8 exons Does work form, but specifically RNF13 which exon processing generates (whether 2~8 exons are included entirely within? whether Also include intron sequences? because some circRNA just include intron sequences) it does not know.Then, our design primers are simultaneously Pass through the PCR successful clone nested twice full length sequence of circRNF13, it was confirmed that circRNF13 is strictly by being located at dye The 2-8 extra of RNF13 gene (ring finger protein 13, NM_183381.2) on the region colour solid 3q25.1 is aobvious Subring is spliced to form, overall length 716bp.

In order to further study the biological function of circRNF13, it is dry that we devise the small molecule for circRNF13 The expression that RNA (siRNA) sequence-specific has struck circRNF13 low is disturbed, while successfully constructing circRNF13 over-express vector CircRNF13 is overexpressed in Tca8113 cells.MTT and flow cytometry detection confirm that up-regulation circRNF13 can be bright Aobvious to inhibit Tca8113 cells proliferation, mechanism is arresting cell cycle and induces cell apoptosis, and strikes low circRNF13 and then obtain Opposite result.Further, we successfully obtain Dendritic cell chemotherapy resistance cell strain, in real time by Fiber differentiation The expression of circRNF13 in quantitative PCR detection cell finds expression of the circRNF13 in drug-resistant cell strain and former Beginning cell strain is lowered compared to significant；And we are overexpressed circRNF13 in mdr cell, can obviously reverse Dendritic cell thin The drug-resistant phenotype of born of the same parents, and the expression of low circRNF13 is struck in initial cell strain, then Tca8113 cells can be significantly improved to suitable The tolerance of platinum.

Finally, we are had detected in Dendritic cell clinical sample by real-time fluorescence quantitative PCR and the method for in situ hybridization The expression of circRNF13, discovery circRNF13 expresses significant downward in Dendritic cell, and circRNF13 expresses low trouble Its life span of person is shorter than circRNF13 and expresses high patient, therefore can be used for tongue for the detection preparation of the lncRNA The auxiliary diagnosis and Index for diagnosis of squamous carcinoma.

Summary of the invention

The object of the present invention is to provide promote the reagent of circular rna circRNF13 expression to treat Dendritic cell drug in preparation On application, the sequence of the circular rna circRNF13 is as shown in SEQ NO:1.

The reagent for promoting circular rna circRNF13 expression is circRNF13 over-express vector.

The building process of the circRNF13 over-express vector is as follows:

(1) it according to the fundamentum of the Forming Mechanism of circRNA and eucaryote RNA montage, designs and is suitable for The loop-forming sequences of circRNA expression；According to the sequence information of commercial carrier pcDNA3.1, suitable multiple cloning sites are designed, It is as follows to obtain the DNA sequence dna for completely realizing that circRNA is overexpressed:

GTGCTGGGATTACAGGTGTGAGCTACCACCCCCGGCCCACTTTTTCTTAAGCTTGGTACCGAGCTCGG ATCCACATCGATTGGTGGAATTCTGCAGATATCCACCGCGGTGGCGGCCGCTCGAGTCTAGAGAAAAGAATTAGGC TCGGCACGGTAGCTCACACCTGTAATCCCAGCA, intermediate underscore part are multiple cloning sites, and both ends are respectively upper and lower Swim loop-forming sequences；

(2) above-mentioned synthesis is realized that NheI restriction enzyme site sequence is added in DNA sequence dna one end that circRNA is overexpressed, separately It adds ApaI restriction enzyme site sequence and obtains pcCirc by being built into pcDNA3.1 carrier after NheI and ApaI digestion in one end Empty plasmid, sequencing confirmation plasmid is correct, and sequence is as shown in SEQ NO:13；

(3) selection Cla I and Sac II restriction enzyme site is used for digestion pcCirc empty plasmid, and by circRNF13 sequence It is inserted between the upstream and downstream loop-forming sequences of carrier.

Detailed process is as follows for step (3):

1) using Tca8113 cells Tca8113cDNA as template, TaKaRa LA is utilizedEnzyme carries out PCR amplification overall length CircRNF13 sequence；CircRNF13 full length sequence amplimer is as follows:

Upstream primer: 5 '-GTGATTTTACAACGAGAT-3 '；

Downstream primer: 5 '-CTTTCTTGAATTTATGTA-3 '；

In upstream and downstream, 5 ' ends of primer are respectively plus restriction enzyme Cla I and Sac II recognition site and protection alkali After base, primer sequence is as follows:

Upstream primer: 5 '-AGGAATCGAT GTGATTTTACAACGAGAT-3 ', underscore part are that Cla I identifies position Point；

Downstream primer: 5 '-ATGCCCGCGG CTTTCTTGAATTTATGTA-3 ', underscore part are that Sac II identifies position Point；

2) PCR amplification, circRNF13 full length sequence, PCR reaction condition are as follows:

PCR reaction step

5 return to step 2, carry out 39 secondary response circulations altogether；

3) by, through Cla I and Sac II double digestion rear electrophoresis, glue returns again after PCR product electrophoresis, glue recycling target fragment It receives；

4) pcCirc empty plasmid recycles target fragment through Cla I and Sac II double digestion rear electrophoresis glue；

5) the carrier matter of overexpression circRNF13 3) is arrived with 4) step glue recovery product with the connection of T4 DNA ligase Grain；

6) by the eukaryon expression plasmid transformed competence colibacillus large intestine bar comprising circRNF13 full length sequence that 5) step obtains Bacterium, to expand plasmid.

After we transfect circRNF13 carrier for expression of eukaryon, had detected in cell by real-time fluorescence quantitative PCR The expression of circRNF13, discovery circRNF13 expression are significantly raised；And transfect the siRNA of targeting circRNF13 (siRNA) after, the expression of intracellular circRNF13 is obviously lowered；Compared with the cell of transfection empty carrier, it is overexpressed The speed of growth of the Tca8113 cells Tca8113 and Cal27 of circRNF13 significantly slow down, and are struck using siRNA interference sequence low After the expression of circRNF13, vitro growth rates are accelerated.Flow cytometry analysis shows to transfect in Tca8113 cells After circRNF13, G2/M phase cell proportion is dramatically increased, and S phase cell proportion is reduced, and shows that circRNF13 can be by Dendritic cell Cell block makes its cell division slow speed in the G2/M phase.Meanwhile apoptosis after circRNF13 is transfected in Tca8113 cells Cell proportion obviously increases, this is also one of the reason of circRNF13 inhibits Tca8113 cells growth.And strike low circRNF13 Opposite result is then obtained.Therefore, it is used for circRNF13 overexpression preparation to treat Dendritic cell, with far-reaching clinical meaning Adopted and important popularization and application foreground.

Detailed description of the invention

Fig. 1: circRNF13 is demonstrated by qRT-PCR and expresses significant up-regulation (left side), sequencing result card after cisplatin treated Real qRT-PCR detected is strictly circRNF13 (right side).Arrow represents splicing site, is 8 extra of RNF13 on the left of arrow Aobvious son 3 ' is held, and is 5 ' terminal sequences of 2 exon of RNF13 gene on the right side of arrow.

Fig. 2: being sequenced by nesting PCR- twice, for the first time the successful clone full length sequence of circRNF13 molecule, it was demonstrated that CircRNA is the 2-8 exon ring of the RNF13 gene transcripts NM_183381.2 by being located on the region chromosome 3q25.1 Change is spliced to form, overall length 716bp.

Fig. 3: design simultaneously successfully construct circRNF13 over-express vector, using pcDNA3.1 carrier as basic framework, by Two sections of loop-forming sequences and restriction enzyme site is added in its CMV promoter downstream, and the 2-8 exon of RNF13 is passed through PCR, digestion are connected in carrier (left side), are then transfected into Tca8113 cells, are successfully overexpressed in Tca8113 cells CircRNF13 (right side).

Fig. 4: it is devised for circRNF13 ring-type splicing site (exon 8 and exon 2 junction) selectively targeted The siRNA sequence (left side) of the circular rna, is then transfected into Tca8113 cells, successfully strikes in Tca8113 cells low The expression (right side) of circRNF13.

Fig. 5: MTT proliferation experiment shows compared with control group (NC), and being overexpressed circRNF13 (OE-circRNF13) can be with Inhibit the proliferation of Tca8113 cells, and the expression (si-circRNF13) for striking low circRNF13 can promote Tca8113 cells Proliferation.

Fig. 6: flow cytometry analysis is found compared with control group (NC), is overexpressed circRNF13 (OE-circRNF13) Tca8113 cells G2/M phase distribution proportion obviously increases afterwards, shows that cell-cycle arrest in the G2/M phase, and strikes low circRNF13's After expressing (si-circRNF13), the S phase, which is distributed, significantly increases, and shows that cell cycle progression accelerates.

Fig. 7: flow cytometry analysis Apoptosis situation is found compared with control group (NC), is overexpressed circRNF13 (OE-circRNF13) Tca8113 cells apoptosis ratio obviously increases afterwards, in the case of normal culture, apoptosis of tumor cells ratio compared with Low, so striking the expression of low circRNF13, apoptotic cell ratio is in a slight decrease.

Fig. 8: circRNF13 expression significantly reduces in chemotherapy resistance cell (CR) compared with control group (NC).

Fig. 9: the expression (si-circRNF13) of low circRNF13 is struck in original Tca8113 cells (NC) or in drug resistance After being overexpressed circRNF13 (OE-circRNF13) in cell (CR), with the cisplatin treated cell of same concentrations, then streaming is thin Born of the same parents' instrument detects Apoptosis situation, and the expression that low circRNF13 is struck in discovery can increase tolerance of the cell to cis-platinum, and (apoptosis subtracts It is few), and be overexpressed circRNF13 then and the drug resistance of mdr cell can be significantly reduced.

Figure 10: it is had detected in 28 pairs of fresh Dendritic cell biopsies (T) and cancer side control tissue (N) by qRT-PCR The expression of circRNF13, discovery circRNF13 express significant downward in Dendritic cell biopsy.

Figure 11: it is had detected in Dendritic cell (right side) and cancer the side control tissue (left side) of archive by hybridization in situ technique The expression of circRNF13 further demonstrates circRNF13 and expresses lower or do not express in Dendritic cell biopsy.

Figure 12: we have collected 88 Dendritic cell tissue specimens for having Clinical Follow-up data, and in situ hybridization has detected The expression of circRNF13, wherein 21 can't detect the expression (Negative) of circRNF13, the existence of these patients Time is shorter compared with other patients's (although circRNF13 expression is not high, can detecte to obtain, Positive), and prognosis is more Difference.

Specific embodiment

The present invention is further illustrated below in conjunction with specific embodiment, is not intended to limit the present invention.

Embodiment 1, PCR sequencing have determined the full length sequence of circRNF13 in Tca8113 cells

1. materials and methods

1.1 cell line

Tca8113 cells Tca8113 and Cal27 are purchased from Central South University's cell centre, and normal condition is cultivated.

1.2 reagents and kit

TRIZOL^TMReagent(Invitrogen)；Plastic recovery kit (OMEGA)；Reverse Transcriptase kit (Promega)；Proteinase K, DNase I, RNAsin, RNase A (GBICOL company)；LAEnzyme (Takara).

1.3 fluorescence quantitative PCR detection circRNF13 are expressed in Tca8113 cells

Extracted total RNA, 1 μ g RNA carry out real-time fluorescence quantitative PCR after reverse transcription is at cDNA.CircRNF13 forward direction is drawn Object is 5-GTCCAGGATAGACATAGAGC-3, as shown in SEQ NO:2 and reverse primer 5-GTGTAGACTTGTGTGGCTGA- 3.As shown in SEQ NO:3.

GAPDH forward primer for control is 5 '-ACCACAGTCCATGCCATCAC-3 ' as shown in SEQ NO:4, and Reverse primer 5 '-TCCACCACCCTGTTGCTGTA-3 ', as shown in SEQ NO:5.

Real-time fluorescence quantitative PCR reaction system

Real-time fluorescence quantitative PCR reaction step

5 Plate read

6 82℃ 30sec

7 Plate read

8 Go to step 2for more 39times

9 55.0 DEG C of from of Perform melting curve 95.0 DEG C of to, 0.2 DEG C of read every, hold for 1sec.

The amplification curve and melting curve of real-time fluorescence quantitative PCR, the expression intensity root of each gene are confirmed after reaction After CT value (threshold cycle values), reference gene (GAPDH) markization, using group t-test checking computation P value.

It is sequenced finally, real-time fluorescence quantitative PCR is amplified the segment come by us, sequence is carried out to the segment expanded Column compare, confirm we amplification be exactly circRNF13, and obtain circRNF13 cyclisation splice specific site.

1.4 reverse transcription PCRs obtain circRNF13 overall length

1) it using Tca8113 cells Tca8113 cDNA as template, by designing two pairs of primers, is overlapped mutually twice embedding The PCR amplification overall length circRNF13 sequence of set (sequence obtained by design of primers and PCR amplification is as shown in Figure 2).CircRNF13 is complete Long sequence amplification primer is as follows:

It expands for the first time, upstream primer: 5-GCTAGAAGAAACAGACTTCGTAAA-3；As shown in SEQ NO:6；

Downstream primer: 5-CTAATGAGGTCATCAGAATCAACA-3, such as SEQ NO:, shown in 7；

Second of amplification, upstream primer: 5-AATGTTGATTCTGATGACCT-3, as shown in SEQ NO:8,

Downstream primer: 5-AGATTGTGTAGACTTGTGTGG-3, as shown in SEQ NO:9.

2) PCR amplification, circRNF13 full length sequence, PCR reaction condition are as follows:

PCR reaction step

5 return to step 2, carry out 39 secondary response circulations altogether；

3) sequencing analysis is carried out after PCR product glue being recycled target fragment.

2. result

2.1 circRNF13 express significant raising in the Tca8113 cells after cisplatin treated

After cis-platinum (P) processing, we are had detected in cell Tca8113 cells by real-time fluorescence quantitative PCR The expression of circRNF13, discovery circRNF13 expression compared with negative control (NC) are significantly raised (Fig. 1, left)；We In order to which that confirm real-time fluorescence quantitative PCR detection is strictly circRNF13, we carry out real-time fluorescence quantitative PCR product Sequencing analysis, discovery amplified fragments are strictly that the 8 exons 3 ' end of RNF13 and 2 exons 5 ' end are spliced, strictly One new circRNA molecule.

2.2 we expand sequencing and confirm the full length sequence of circRNF13

Because circRNF13 is a new circular RNA molecule, specific sequence is especially expressed in Dendritic cell Transcript sequence need further confirmation.We design two pairs of primers and by PCR successful clones nested twice The full length sequence of circRNF13, it was confirmed that circRNF13 is strictly the RNF13 gene by being located on the region chromosome 3q25.1 The 2-8 exon cyclisation of (ring finger protein 13, NM_183381.2) is spliced to form (Fig. 2), and overall length is 716bp (as shown in SEQ NO:1).

Embodiment 2, circRNF13 inhibit Tca8113 cells Cycle Arrest, induce cell apoptosis

1. materials and methods

1.1 reagents and kit

Restriction enzyme Cla I and Sac II and T4DNA ligase etc. is purchased from TakaRa company；TRIZOL^TM Reagent(Invitrogen)；Plasmid extraction kit, plastic recovery kit (OMEGA)；Reverse Transcriptase kit (Promega)； Proteinase K, DNase I, RNAsin, RNase A (GBICOL company)；Methyl thiazoly tetrazolium assay (MTT, Sigma)；Antibiotic G418(Ameresc)；Cell cycle detection kit (Invitrogen), cell apoptosis detection kit (Invitrogene).

The Fiber differentiation of 1.2 Dendritic cell mdr cells

In cell culture medium, the cis-platinum of low dosage is added, and cis-platin concentrations are gradually increased, is trained by long-time induction It supports, is finally obtained the drug-resistant cell strain to cis-platinum tolerance.

The building of 1.3circRNF13 carrier for expression of eukaryon

We are inserted into upstream and downstream at multiple cloning sites in pcDNA3.1 carrier (deriving from Invitrogen company) first Loop-forming sequences, i.e. GTGCTGGGATTACAGGTGTGAGCTACCACCCCCGGCCCACTTTTT are as shown in SEQ NO:10, GAAA AGAATTAGGCTCGGCACGGTAGCTCACACCTGTAATCCCAGCA is as shown in SEQ NO:11) it is used to help Insert Fragment turn Record is processed as circular rna；Here it is circular rna eukaryotic expression blank expression vectors；Specific building process is as follows:

According to the fundamentum of the Forming Mechanism of circRNA and eucaryote RNA montage, design suitable for circRNA The loop-forming sequences of expression；According to the sequence information of commercial carrier pcDNA3.1, suitable multiple cloning sites are designed, to obtain The complete DNA sequence dna realizing circRNA and being overexpressed:

GTGCTGGGATTACAGGTGTGAGCTACCACCCCCGGCCCACTTTTTCTTAAGCTTGGTACCGAGCTCGG ATCCACATCGATTGGTGGAATTCTGCAGATATCCACCGCGGTGGCGGCCGCTCGAGTCTAGAGAAAAGAATTAGGC TCGGCACGGTAGCTCACACCTGTAATCCCAGCA, as shown in SEQ NO:12；

Intermediate underscore part is multiple cloning sites, and both ends are respectively upstream and downstream loop-forming sequences；

Above-mentioned synthesis is realized that NheI restriction enzyme site sequence, the other end are added in DNA sequence dna one end that circRNA is overexpressed It adds ApaI restriction enzyme site sequence and obtains pcCirc blank by being built into pcDNA3.1 carrier after NheI and ApaI digestion Plasmid (sequence is as shown in SEQ NO:13), sequencing confirmation plasmid are correct.

In order to construct circRNF13 over-express vector.We select Cla I and Sac II restriction enzyme site for digestion PcCirc empty plasmid (the i.e. above-mentioned pcDNA3.1 carrier for inserting upstream and downstream loop-forming sequences built), and will Between the upstream and downstream loop-forming sequences of circRNF13 sequence insertion vector (Fig. 3, left).

Constructing circRNF13 over-express vector (i.e. carrier for expression of eukaryon), steps are as follows:

1) using Tca8113 cells Tca8113cDNA as template, TaKaRa LA is utilizedEnzyme carries out PCR amplification overall length CircRNF13 sequence.CircRNF13 full length sequence amplimer is as follows:

Upstream primer: 5 '-GTGATTTTACAACGAGAT-3 ' are as shown in SEQ NO:14；

Downstream primer: 5 '-CTTTCTTGAATTTATGTA-3 ' are as shown in SEQ NO:15；

In upstream and downstream, 5 ' ends of primer are respectively plus restriction enzyme Cla I and Sac II recognition site and protection alkali After base, primer sequence is as follows:

Upstream: 5 '-AGGAATCGAT GTGATTTTACAACGAGAT-3 ' (underscore part is Cla I recognition site) is such as Shown in SEQ NO:16；

Downstream: 5 '-ATGCCCGCGG CTTTCTTGAATTTATGTA-3 ' (underscore part is Sac II recognition site) As shown in SEQ NO:17；

2) PCR amplification, circRNF13 full length sequence, PCR reaction condition are as follows:

PCR reaction step

5 return to step 2, carry out 39 secondary response circulations altogether；

3) by, through Cla I and Sac II double digestion rear electrophoresis, glue returns again after PCR product electrophoresis, glue recycling target fragment It receives；

4) pcCirc empty plasmid recycles target fragment through Cla I and Sac II double digestion rear electrophoresis glue；

5) it can be obtained 3) with 4) step glue recovery product with the connection of T4 DNA ligase and can be used for eukaryotic expression The vector plasmid of circRNF13；

6) by the eukaryon expression plasmid transformed competence colibacillus large intestine bar comprising circRNF13 full length sequence that 5) step obtains Bacterium, to expand plasmid.

1.4 circRNF13 tiny RNA interference sequences (siRNA)

The splice site that we are directed to circRNF13 devises specific siRNA, and (siRNA, Fig. 4, a left side are shown The position of siRNA) sequence is as follows:

5-AGAAAGGUGAUUUUACAACGA-3 as shown in SEQ NO:18,

Control of Scramble sequence of the simultaneous selection in human genomic sequence there is no target spot as siRNA:

Scramble sequence is as follows:

5'-GACACGCGACUUGUACCAC-3'.As shown in SEQ NO:19,

The sequence is synthesized by Invitrogen company.

1.5 prepare the coated nano silicon particles of poly-D-lysine

The coated nano silicon particles of poly-D-lysine are carried out with OP-10/ hexamethylene/ammonia microemulsion self-assembling technique The synthesis of nano silicon particles (silica nanoparticle, SiNP), and can and pass through ion using the surface of nano silicon particles Electrostatic interaction prepares the nano silicon particles of polylysine modification；The nano particle can be prepared by following methods:

1) OP-10 (nonylphenol polyoxyethylene ether), hexamethylene and ammonium hydroxide are mixed, positive silicic acid is added after being stirred at room temperature uniformly Different ester (TEOS), continue stirring to polymerization complete, be added equal-volume acetone, ultrasonic disperse, centrifugation, distilled water wash three times, from Heart collection is deposited in 80 DEG C of dryings, finely ground to obtain nano silicon particles (SiNP, particle size range 10-50nm).Wherein H₂O and OP-10 and H₂The molar ratio of O and TEOS is 2~10, ammonia concn is 1.6~28%, molar concentration of the TEOS in hexamethylene be 0.1~ 3mol/L。

2) SiNP is resuspended in 0.6M NaCO by 0.1~10mg/ml₃In solution, supernatant is abandoned in ultrasonic disperse, centrifugation, then Sediment is resuspended in PBS (pH 7.4) by 0.1~10mg/ml, ultrasonic disperse, add polylysine (final concentration of 4~ 15nmol/mL), it mixes well, room temperature is mixed to shake；Centrifugation, abandons supernatant, and precipitating is resuspended in distilled water by 0.1~10mg/ml, is obtained To the nano silicon particles of polylysine modification.

3) by modified nano silicon particles ultrasonic disperse, 10~50ug circRNF13 mistake is added in every milliliter of nano particle suspension Expression vector or 10-100pmol siRNA, mixing, are stored at room temperature and make it combine.

1.6 cell culture and transfection

The good Tca8113 cells Tca8113 and Cal27 of growth conditions or mdr cell are pressed 2 × 10⁵A cells/well It is inoculated in 6 orifice plates, 6 orifice plates is placed in 37 DEG C, 5%CO₂In incubator, cell to be cultivated grows to 50-70% density Start circRNF13 over-express vector or the transfection of siRNA；Transfection process is as follows:

The poly that carrying circRNF13 eukaryon expression plasmid or siRNA that 100 μ l are prepared are added in sterile EP tube relies The nano silicon particles suspension of propylhomoserin modification, mildly mixes with 100 μ l serum free mediums；It is washed cell 3 times with D-Hank's liquid； 800 μ l serum free mediums (antibiotic-free) will be added in said mixture, 1 hole in 6 orifice plates is added after mild mixing；It will 6 orifice plates are placed in CO₂In incubator, 37 DEG C are cultivated 6 hours, and supernatant is then abandoned, and complete medium is added and continues overnight incubation.With sky The nano silicon particles of carrier or the polylysine modification of Scramble sequence are as experiment contrast.1.7 real time fluorescent quantitative PCR detects the expression of intracellular circRNF13

After cell processing, in suitable time point collecting cell, extracted total RNA, 1 μ g RNA after reverse transcription is at cDNA, Carry out real-time fluorescence quantitative PCR.CircRNF13 forward primer is 5-GTCCAGGATAGACATAGAGC-3, such as SEQ NO:2 institute Show and reverse primer 5-GTGTAGACTTGTGTGGCTGA-3.As shown in SEQ NO:3.

GAPDH forward primer for control is 5 '-ACCACAGTCCATGCCATCAC-3 ' as shown in SEQ NO:4, and Reverse primer 5 '-TCCACCACCCTGTTGCTGTA-3 ', as shown in SEQ NO:5.

Real-time fluorescence quantitative PCR reaction system

Real-time fluorescence quantitative PCR reaction step

5 Plate read

6 82℃ 30sec

7 Plate read

8 Go to step 2for more 39times

9 55.0 DEG C of from of Perform melting curve 95.0 DEG C of to, 0.2 DEG C of read every, hold for 1sec.

The amplification curve and melting curve of real-time fluorescence quantitative PCR, the expression intensity root of each gene are confirmed after reaction After CT value (threshold cycle values), reference gene (GAPDH) markization, using group t-test checking computation P value.

1.8 MTT cell proliferation experiments

1) digest cell obtained in the previous step, cell counted with cell counter, will transfection circRNF13 and The cell inoculation of pcDNA3.1 empty carrier is in 96 orifice plates, and every hole is inoculated with 1000 cells, as a result every kind of 5 hole of cell inoculation takes Its mean value.

2) 37 DEG C, 5%CO₂Incubator culture 6 hours, after cell is adherent, every hole added 20 μ l of MTT liquid (5mg/ml).After It is continuous to be incubated for 4 hours, culture is terminated, culture solution is discarded.Every hole adds 150 μ l DMSO, vibrates 10 minutes, dissolves crystal.

3) 490nm wavelength is selected, zeroing hole is concurrently set, on enzyme-linked immunosorbent assay instrument, measures each hole absorbance value simultaneously Record result.

4) it is same as above every 24 hours repetition steps, detects 6 days altogether.Using absorbance value as ordinate, interval time is horizontal seat Plotting MTT curve.

5) it tests in triplicate.Using each time point as abscissa, absorbance value is ordinate, draws cell growth curve.

1.9 flow cytometry analysis cell cycles

1) trypsin digestion cell when culture cell reaches 85% fusion, 1200rpm/min are centrifuged 5min, and it is heavy to collect cell It forms sediment.

2) cell is resuspended in 1xPBS, and 1200rpm/min is centrifuged 5min, collects cell.Repeat this step 2 time.

3) cell is resuspended in 1xPBS, and the fixed cell pellet overnight of 70% ethyl alcohol of pre-cooling is added.

4) 1000rcf/min is centrifuged 5min, collects cell precipitation.

5) PH7.4PBS is washed cell 1 time, PBS is added after centrifugation, cell is resuspended, and adjust cell concentration to Ix 10⁶/ ml。

6) propidium iodide (PI) dyeing liquor (PI containing 50mg/L, 1g/L Triton X-100,100g/L RNase) is added It mixes, 4 DEG C are protected from light incubation 30min.

7) flow cytometer FACStar (U.S. company BD) is detected.Received signal is handled through Cellquest software, right The fluorescence intensity of detection cell is analyzed.Experiment is repeated 3 times.

1.10 flow cytometry analysis natural death of cerebral cells rates

1) when culture cell reaches 85% fusion, group of cells is digested with pancreatin and is collected in centrifuge tube, is collected simultaneously Each group supernatant suspension cell.Pay attention to gently blowing and beating cell, pancreatin is avoided excessively to digest.

2) merge group of cells respectively and be transferred in centrifuge tube, 1000rpm is centrifuged 5min, abandons supernatant and collects cell, PBS After being gently resuspended, cell count.

3) 5~100,000 resuspension cells are taken, 1000rpm is centrifuged 5min, abandons supernatant, and 195ul Annexin V-FITC knot is added It closes liquid and cell is gently resuspended.

4) 5ul Annexin V is added, mixes gently.It is protected from light incubation at room temperature 10min.

5) 1000rpm is centrifuged 5min, abandons supernatant, 190ul Annexin V-FITC combination liquid is added, cell is gently resuspended.

6) 10ul PI dyeing liquor is added, mixes gently, ice bath is protected from light.

7) flow cytomery is carried out immediately, and Annexin V-FITC is green fluorescence, and PI is red fluorescence.

2. result

The growth of 2.1 circRNF13 inhibition Tca8113 cells

After transfecting circRNF13 carrier for expression of eukaryon, we are had detected in cell by real-time fluorescence quantitative PCR The expression of circRNF13, discovery circRNF13 expression are significantly raised (Fig. 3)；And transfect the small dry of targeting circRNF13 After disturbing RNA (siRNA), the expression of intracellular circRNF13 obviously lowers (Fig. 4)；

Compared with the cell of transfection empty carrier, it is overexpressed the life of the Tca8113 cells Tca8113 and Cal27 of circRNF13 Long speed significantly slows down, and after striking the expression of low circRNF13 using siRNA interference sequence, vitro growth rates accelerate (figure 5)。

2.2 circRNF13 pass through arresting cell cycle, induce cell apoptosis the growth for inhibiting Tca8113 cells.

Flow cytometry analysis shows after transfecting circRNF13 in Tca8113 cells that G2/M phase cell proportion significantly increases Add, and S phase cell proportion is reduced, and shows that circRNF13 can block Tca8113 cells in the G2/M phase, make its cell division slow Speed (Fig. 6).Meanwhile apoptotic cell ratio obviously increases (Fig. 7) after transfection circRNF13 in Tca8113 cells, this is also CircRNF13 inhibits one of the reason of Tca8113 cells growth.And it strikes low circRNF13 and has then obtained opposite result.

2.3 circRNF13 express downward in Dendritic cell mdr cell

We by some months are cultivated, successfully induction obtains by being stepped up cis-platin concentrations in the medium Tca8113 and Cal27 has detected the expression of circRNF13 in cell to the cell of cisplatin resistance, real-time quantitative PCR, sends out Existing expression of the circRNF13 in drug-resistant cell strain is significant compared with initial cell strain to have lowered (Fig. 8).

2.4 overexpression circRNF13 can reverse Tca8113 cells drug-resistant phenotype

The expression (si-circRNF13) of low circRNF13 is struck in original Tca8113 cells (NC) or in mdr cell (CR) after being overexpressed circRNF13 (OE-circRNF13) in, with the cisplatin treated cell of same concentrations, then flow cytometer Apoptosis situation is detected, the tolerance (apoptosis reduction) that the expression of low circRNF13 can increase cell to cis-platinum is struck in discovery, and Being overexpressed circRNF13 then can be significantly reduced the drug resistance (Fig. 9) of mdr cell.

Embodiment 3, quantitative real-time PCR detection confirm that circRNF13 expresses downward in Dendritic cell

1. materials and methods:

Collect by 28 Dendritic cells and 28 Dendritic cell tissues, extracted total RNA, 1 μ g RNA after reverse transcription is at cDNA, into Row real-time fluorescence quantitative PCR.CircRNF13 forward primer is 5-GTCCAGGATAGACATAGAGC-3, as shown in SEQ NO:2, With reverse primer 5-GTGTAGACTTGTGTGGCTGA-3.As shown in SEQ NO:3.

GAPDH forward primer for control is 5 '-ACCACAGTCCATGCCATCAC-3 ' as shown in SEQ NO:4, and Reverse primer 5 '-TCCACCACCCTGTTGCTGTA-3 ', as shown in SEQ NO:5.

Real-time fluorescence quantitative PCR reaction system

Real-time fluorescence quantitative PCR reaction step

5 Plate read

6 82℃ 30sec

7 Plate read

8 Go to step 2for more 39times

9 55.0 DEG C of from of Perform melting curve 95.0 DEG C of to, 0.2 DEG C of read every, hold for 1sec

The amplification curve and melting curve of real-time fluorescence quantitative PCR, the expression intensity root of each gene are confirmed after reaction After CT value (threshold cycle values), reference gene (GAPDH) markization, using group t-test checking computation P value.

2. result

CircRNF13 expresses by the cancer higher in control tissue, and expression significantly reduces P < 0.01 in Dendritic cell tissue (Figure 10).

Embodiment 4, low expression of the in situ hybridization detection discovery circRNF13 in Dendritic cell are related to patient's poor prognosis

1. MATERIALS METHODS

1.1 design and synthesize hybridization probe

In order to which using the expression of in-situ hybridization method detection circRNF13, we are for circRNF13 cyclisation splicing Site (namely 2 exon of RNF13 gene and 8 exon stitching portions) devises oligonucleotide probe 1, and is used as The in situ hybridization oligonucleotide probe of positive control 3.

Oligonucleotide probe in situ hybridization detection circRNF13 expression: TCGTTGTAAAATCACCTTTCTTGAATTTAT as: shown in SEQ NO:20,

Positive control probe (detection house-keeping gene GAPDH):

GAPDH probe 1:5 '-CCACTTTACCAGAGTTAAAAGCAGCCCTGG-3 ', as shown in SEQ NO:21,

GAPDH probe 2:5 '-CAGTAGAGGCAGGGATGATGTTCTGGAGAG-3 ', as shown in SEQ NO:22,

GAPDH probe 3:5 '-GTCAGAGGAGACCACCTGGTGCTCAGTGTA-3 ', as shown in SEQ NO:23.

Each gene specific oligonucleotides probe sequence of above-mentioned design is synthesized using chemical synthesis process.

1.2 oligonucleotide probe labelling kits and in situ hybridization detection reagent

Digoxin oligonucleotides tailing reagent (Dig Oligonucleitide Tailing Kit 2^ndGeneration, Roche company), anti-digoxin-horseradish peroxidase complex detection kit (Anti-Digoxigenin-POD, Fab Fragments, Roche company), enhance the TSA signal amplifying system (TSA of detection of expression signal in situ^TMBiotin System, NEL700 kit, PerkinElmer company), DAB staining kit (Beijing Zhong Shan company), 20x sodium citrate buffer (saline sodium citrate, SSC), dextran sulfate (Dextran sulphate), deionized formamide (Deionized Formamide), polyadenylic acid (polyadenylic acid, Poly A), poly deoxyadenylic acid (polydeoxyadenylic acid, Poly dA) is denaturalized frog essence DNA (the denatured and sheared of shearing Salmon sperm DNA, ssDNA), yeast transfer RNA (yeast t-RNA, tRNA), dithiothreitol (DTT) (DTT), 50x Deng Han Family name's buffer (Denhardts ' s solution), phosphate buffer (PBS buffer), pepsin K, bovine serum albumin(BSA) (BSA), triethanolamine (TEA), TNB Buffer (0.1M Tris-HCl, pH7.5,0.15M NaCL, 0.5%Blocking Reagent), TNT Buffer (0.1M Tris-HCl, pH7.5,0.15M NaCL, 0.05%Tween 20), acetic anhydride, resistance Disconnected reagent (Blocking reagent agent, Roche company).

1.3 other main agents and material

Dehydrated alcohol, 90% alcohol, 70% alcohol, 50% alcohol, turpentine oil, distilled water, PBS buffer solution (pH7.2~ 7.4, NaCl 137mmol/L, KCl 2.7mmol/L, Na₂HPO₄4.3mmol/L, KH₂PO₄1.4mmol/L)；3% methanol- Hydrogen peroxide solution (80% methanol and the configuration of 30% hydrogen peroxide)；0.01mol/L citrate buffer (citrate buffer, CB, pH6.0 ± 0.1,9ml 0.1M citric acid solution and 41ml 0.1M sodium citrate solution are added interim in 450ml distilled water With postponing correction work liquid pH value again)；0.1% trypsase；Haematoxylin；1% hydrochloride alcohol (1ml concentrated hydrochloric acid+99ml70% wine Essence configuration)；Mounting glue (PTS Cure Mount II)；Dedicated coverslip (480 × 240mm²) customize in Zhengzhou Glassware Factory. Leica low melting point (58 DEG C) paraffin, domestic beeswax, absolute alcohol, dimethylbenzene, 10% neutrality paraformaldehyde (0.01mol/L, PH7.4, DEPC distilled water and PBS buffer solution are prepared), haematoxylin, Yihong, neutral mounting natural gum, coverslip, glass slide.

1.4 label probe

Oligonucleotide probe label is carried out using 3-tailing DIG Olignucleutide Kit, reaction system is such as Under.

100pmol oligonucleotide+ddH₂O=9 μ l (5 μ of control:control oligonucleutide l+ddH₂O4μl)

It mixes, is slightly centrifuged.37 DEG C of water-bath 30min add 2 μ l EDTA (0.2M, PH 8.0) stopped reactions.

1.5 being purified after oligonucleotide probe label

In order to increase the purity of label probe, marked probe need to be purified, concrete operations are as follows:

1) cold ethyl alcohol (- 20 DEG C) of+2.5 μ l 4M LiCL+75 μ l of probe reaction mixture (22 μ l) 100%

2) -70 DEG C of precipitatings 60min, or-20 DEG C of 2h.

3) 13.000 × g, 4 DEG C of centrifugation 15min.

4) supernatant is abandoned, with 70% (V/V) ethanol washing that 50 μ l are ice-cold.

5) 4 DEG C of 13.000xg are centrifuged 5min.

6) supernatant, 4 DEG C of dryings of vacuum are abandoned.

7) with the molten probe of aseptic double-distilled water weight.

1.6 in situ hybridizations detection achieves the expression of circRNF13 in paraffin section

Paraffin section hybridizes pre-treatment

1) paraffin section of 4 DEG C of preservations is placed in 58 DEG C of roasting piece 30min, melted surface paraffin.

2) dimethylbenzene successively dewaxes 3 × 5min.

3) step ethanol wash, 100% 1 × 5min of the alcohol of 2 × 2min of alcohol → 95% alcohol of 1 × 5min → 70% → 50% 1 × 5min of alcohol → 2 × 3min of DEPC water washing → DEPC-PBS washs 2 × 5min.

4) 300 μ l pepsin K (10 μ g/ml) are added dropwise on slice, 37 DEG C of digestion 20min.

5) it is sliced and washs 1min, stopped reaction into PBS (0.1M PBS+2mg/ml glutamic acid).

6) it is sliced into 0.2N HCL, in 37 DEG C of reaction 20-30min, increases the permeability of tissue.

7) slice fixes 10min, room temperature with 4% paraformaldehyde (0.1M PBS dissolution) afterwards.

8) in order to increase tissue positive intensity for hybridization, acetyl processing is carried out to slice.It is sliced into 0.25% acetic anhydride Buffer I (0.1M triethanolamine), room temperature 10min.

9) 1M PBS washs 2 × 5min.

Prehybridization and hybridization

Prehybridization: the prehybridization solution of -20 DEG C of preservations is first placed in 37 DEG C of incubation 60min, and the dosage of prehybridization solution is 50 μ l, Parafilm is carried out lid and is sliced, prehybridization 2 hours in 37 DEG C of wet box.(prehybridization solution composition includes: 2XSSC, 10%Dextran Sulphate, 1X Denhardt ' s solution, 50mM Phosphate Buffer (PH 7.0), 50mM DTT, 250 μ l, 100 μ g/ml poly A, 5 μ g/ml poly dA, 250 μ g/ml yeast t-RNA, 500 μ g/ml ssDNA, 47% Deionized formamide)。

1) parafilm is removed, prehybridization solution is got rid of, slice is placed in 5min in 2 × SSC.

2) hybridization reaction: 37 DEG C of hybridized overnights (18-20h).Each slice is added 250 μ l hybridization solutions and is carried out with parafilm Lid.Corresponding probe is added in prehybridization solution just becomes hybridization solution.Hybridization solution is prepared in prehybridization, is placed 37 DEG C of incubations, is made Probe is completely dissolved in hybridization solution, this experiment is mixed with a plurality of oligonucleotide probe, is matched by each probe 500ng/ml concentration Probe hybridization solution is made.Digoxin tailing labelling kit label probe concentration calculation foundation: the concentration of each probe by its with Colour developing is compared when detection reaction when positive quantitative probe and the naked probe of 30 bases of 100pmol marks reaction theory to visit Needle yield is that two kinds of standards of 900ng carry out the concentration that COMPREHENSIVE CALCULATING goes out label probe.

3) post-hybridization washing, slice immerse 2 × SSC, 10min, throw off parafilm.Successively washed in shake on shaking table, 2 × SSC (0.5%SDS), 2 × 15min → 0.25 × SSC (0.5%SDS), 2 × 15min.

Color developing detection is reacted after hybridization

1) digoxigenin-probe compound in conjunction with mRNA is detected using Anti-Digoxigenin-POD；TSA amplification system Enhance the positive signal of in situ hybridization reaction solution reaction, DAB colour developing.

2) slice is gone in TNT buffer, 3 × 5min.

3) TNB is added dropwise and blocks buffer, 300 μ l/TMAs, room temperature, 30min.

4) extra blocking agent, the diluted Anti-Digoxigenin-POD of 1:100 (TBS+0.1%Triton X- are sucked 100+1% blocking agent), room temperature 4 hours.

5) TNT Buffer (0.1M Tris-CL, pH7.5,0.15M NaCL, 0.05%Tween 20) is washed, 3x5min。

6) signal is added dropwise on slice and amplifies reagent Biotinyl Tyamid, 300 μ l/TMAs, (Biotinyl Tyramid Store liquid: Biotinyl Tyramid is dissolved in 0.2ml DMSO, Biotinyl Tyramid working solution: 1 × dilution, 1:50 Dilute Biotinyl Tyramid and store liquid), room temperature 10 minutes.

7) TNT is washed, 3 × 5min.

8) SA-HRP (strepto- avidin-horseradish peroxidase) is added dropwise in slice, 300 μ l/TMAs, room temperature 30min.

9) TNT is washed, 3 × 5min.

10) distilled water washing, 1 × 1min.

11) DAB develops the color, and controls chromogenic reaction under microscope.

12) haematoxylin is redyed,

13) alcohol step is dehydrated, chip drying.

14) mounting glue, the coverslip cover plate of dimension, crosslinking slice 1min under ultraviolet lamp is added dropwise.

The judgement of 1.7 results and standard

Application Optics microscope is observed under low power and high power lens respectively, looks first at the positive expression of target RNA The signal positioning intracellular in object observing: it is located at nucleus, cytoplasm or cell membrane.

It is carried out respectively with two kinds of standards of the intensity of the detection rna expression position positive signal and the cell number of positive expression again Comprehensive score, judgment criteria are as follows: (1) judge according to positive cell dyeing intensity: a. cell dye-free remembers 0 point；B. cell is dyed Light brown is weakly positive, remembers 1 point；C. cell dyes brown and dyes dark-brown without background coloration or cell and have light brown back Scape is moderate positive, remembers 2 points；D. cell dyes dark-brown and is strong positive without background coloration, remembers 3 points.(2) according to positive cell Express number score: the no positive cell expression of a. remembers 0 point；B. positive expression cell number≤25% remembers 1 point；C.25% < is positive thin Born of the same parents' number < 50% remembers 2 points；D. positive expression cell number >=50% remembers 3 points.

In order to reduce the subjective factor of appraisal result as far as possible, it is respective that You Liangwei pathology expert presses one of above-mentioned standard respectively Judged and scored, then the two is scored and is multiplied, as a result are as follows: 1. 0 point of person is finally calculated as 0 point, it is believed that feminine gender expression；2. 1 point 1 point is finally calculated as with 2 points of persons, it is believed that weakly positive expression；3. 3 points and 4 points of persons are finally calculated as 2 points, it is believed that moderate positive expression；④ 6, which assign to 9 points of persons, is finally calculated as 3 points, it is believed that strong positive expression.

1.8 analyses and statistical software

Statistical analysis is carried out to experimental result using SPSS13.0 statistical software, compares use χ two-by-two²Test or Fisher Exact test, correlation analysis use Spearmen correlation method；P < 0.05 is that difference is statistically significant. Survivorship curve analysis uses Kaplan-Meier method and log-rank test；Multi-variables analysis uses Cox ' s proportional hazards model；P < 0.05 is that difference is statistically significant.

2 results

Expression of 2.1 circRNF13 in Dendritic cell is significantly increased than the expression in normal control tissue

CircRNF13 is not expressed in Dendritic cell tissue or expression is lower, and the normal control by Dendritic cell cancer There is expression (Figure 11) in tissue, there is apparent statistical difference between the two.

Dendritic cell patient's prognosis of 2.2 circRNF13 low expressions is worse

Effect of follow-up visit by telephone has been carried out to 88 Dendritic cell patients, inquired in detail they start time, treatment condition, whether there is or not Recurrence, whether there is or not suffering from other diseases, recurrence and death time etc. again, and register life span and state, and to Dendritic cell tissue The survival analysis that the expression of middle circRNF13 and the life span of patient and state carry out finds not express in Dendritic cell tissue The patient of circRNF13 is significantly shorter than circRNF13 the mean survival time and expresses higher patient (Figure 12).Explanation CircRNF13 is a molecular labeling relevant to Dendritic cell prognosis, and circRNA expression is low or does not express, patient's poor prognosis.

Sequence table

<110>Central South University

<120>promote application of the reagent of circular rna circRNF13 expression on preparation treatment Dendritic cell drug

<160> 23

<170> SIPOSequenceListing 1.0

<210> 1

<211> 716

<212> RNA

<213>homo sapiens (Homo sapiens)

<400> 1

gugauuuuac aacgagaugc ugcucuccau agggaugcuc augcugucag ccacacaagu 60

cuacaccauc uugacugucc agcucuuugc auucuuaaac cuacugccug uagaagcaga 120

cauuuuagca uauaacuuug aaaaugcauc ucagacauuu gaugaccucc cugcaagauu 180

ugguuauaga cuuccagcug aagguuuaaa ggguuuuuug auuaacucaa aaccagagaa 240

ugccugugaa cccauagugc cuccaccagu aaaagacaau ucaucuggca cuuucaucgu 300

guuaauuaga agacuugauu guaauuuuga uauaaagguu uuaaaugcac agagagcagg 360

auacaaggca gccauaguuc acaauguuga uucugaugac cucauuagca ugggauccaa 420

cgacauugag guacuaaaga aaauugacau uccaucuguc uuuauuggug aaucaucagc 480

uaauucucug aaagaugaau ucacauauga aaaagggggc caccuuaucu uaguuccaga 540

auuuagucuu ccuuuggaau acuaccuaau ucccuuccuu aucauagugg gcaucugucu 600

caucuugaua gucauuuuca ugaucacaaa auuuguccag gauagacaua gagcuagaag 660

aaacagacuu cguaaagauc aacuuaagaa acuuccugua cauaaauuca agaaag 716

<210> 2

<211> 20

<212> DNA

<213>unknown (Unknown)

<400> 2

gtccaggata gacatagagc 20

<210> 3

<211> 20

<212> DNA

<213>unknown (Unknown)

<400> 3

gtgtagactt gtgtggctga 20

<210> 4

<211> 20

<212> DNA

<213>unknown (Unknown)

<400> 4

accacagtcc atgccatcac 20

<210> 5

<211> 20

<212> DNA

<213>unknown (Unknown)

<400> 5

tccaccaccc tgttgctgta 20

<210> 6

<211> 24

<212> DNA

<213>unknown (Unknown)

<400> 6

gctagaagaa acagacttcg taaa 24

<210> 8

<211> 24

<212> DNA

<213>unknown (Unknown)

<400> 8

ctaatgaggt catcagaatc aaca 24

<210> 8

<211> 20

<212> DNA

<213>unknown (Unknown)

<400> 8

aatgttgatt ctgatgacct 20

<210> 9

<211> 21

<212> DNA

<213>unknown (Unknown)

<400> 9

agattgtgta gacttgtgtg g 21

<210> 10

<211> 45

<212> DNA

<213>unknown (Unknown)

<400> 10

gtgctgggat tacaggtgtg agctaccacc cccggcccac ttttt 45

<210> 11

<211> 47

<212> DNA

<213>unknown (Unknown)

<400> 11

gaaaagaatt aggctcggca cggtagctca cacctgtaat cccagca 47

<210> 12

<211> 177

<212> DNA

<213>unknown (Unknown)

<400> 12

gtgctgggat tacaggtgtg agctaccacc cccggcccac tttttcttaa gcttggtacc 60

gagctcggat ccacatcgat tggtggaatt ctgcagatat ccaccgcggt ggcggccgct 120

cgagtctaga gaaaagaatt aggctcggca cggtagctca cacctgtaat cccagca 177

<210> 13

<211> 5515

<212> DNA

<213>unknown (Unknown)

<400> 13

gacggatcgg gagatctccc gatcccctat ggtgcactct cagtacaatc tgctctgatg 60

ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg 120

cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc 180

ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt 240

gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 300

tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 360

cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 420

attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt 480

atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 540

atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 600

tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg 660

actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 720

aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg 780

gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca 840

ctgcttactg gcttatcgaa attaatacga ctcactatag ggagacccaa gctggctagc 900

gtgctgggat tacaggtgtg agctaccacc cccggcccac ttttttttaa acttaagctt 960

ggtaccgagc tcggatccac atcgattggt ggaattctgc agatatccac cgcggtggcg 1020

gccgctcgag tctagagaaa agaattaggc tcggcacggt agctcacacc tgtaatccca 1080

gcagggcccg tttaaacccg ctgatcagcc tcgactgtgc cttctagttg ccagccatct 1140

gttgtttgcc cctcccccgt gccttccttg accctggaag gtgccactcc cactgtcctt 1200

tcctaataaa atgaggaaat tgcatcgcat tgtctgagta ggtgtcattc tattctgggg 1260

ggtggggtgg ggcaggacag caagggggag gattgggaag acaatagcag gcatgctggg 1320

gatgcggtgg gctctatggc ttctgaggcg gaaagaacca gctggggctc tagggggtat 1380

ccccacgcgc cctgtagcgg cgcattaagc gcggcgggtg tggtggttac gcgcagcgtg 1440

accgctacac ttgccagcgc cctagcgccc gctcctttcg ctttcttccc ttcctttctc 1500

gccacgttcg ccggctttcc ccgtcaagct ctaaatcggg ggctcccttt agggttccga 1560

tttagtgctt tacggcacct cgaccccaaa aaacttgatt agggtgatgg ttcacgtagt 1620

gggccatcgc cctgatagac ggtttttcgc cctttgacgt tggagtccac gttctttaat 1680

agtggactct tgttccaaac tggaacaaca ctcaacccta tctcggtcta ttcttttgat 1740

ttataaggga ttttgccgat ttcggcctat tggttaaaaa atgagctgat ttaacaaaaa 1800

tttaacgcga attaattctg tggaatgtgt gtcagttagg gtgtggaaag tccccaggct 1860

ccccagcagg cagaagtatg caaagcatgc atctcaatta gtcagcaacc aggtgtggaa 1920

agtccccagg ctccccagca ggcagaagta tgcaaagcat gcatctcaat tagtcagcaa 1980

ccatagtccc gcccctaact ccgcccatcc cgcccctaac tccgcccagt tccgcccatt 2040

ctccgcccca tggctgacta atttttttta tttatgcaga ggccgaggcc gcctctgcct 2100

ctgagctatt ccagaagtag tgaggaggct tttttggagg cctaggcttt tgcaaaaagc 2160

tcccgggagc ttgtatatcc attttcggat ctgatcaaga gacaggatga ggatcgtttc 2220

gcatgattga acaagatgga ttgcacgcag gttctccggc cgcttgggtg gagaggctat 2280

tcggctatga ctgggcacaa cagacaatcg gctgctctga tgccgccgtg ttccggctgt 2340

cagcgcaggg gcgcccggtt ctttttgtca agaccgacct gtccggtgcc ctgaatgaac 2400

tgcaggacga ggcagcgcgg ctatcgtggc tggccacgac gggcgttcct tgcgcagctg 2460

tgctcgacgt tgtcactgaa gcgggaaggg actggctgct attgggcgaa gtgccggggc 2520

aggatctcct gtcatctcac cttgctcctg ccgagaaagt atccatcatg gctgatgcaa 2580

tgcggcggct gcatacgctt gatccggcta cctgcccatt cgaccaccaa gcgaaacatc 2640

gcatcgagcg agcacgtact cggatggaag ccggtcttgt cgatcaggat gatctggacg 2700

aagagcatca ggggctcgcg ccagccgaac tgttcgccag gctcaaggcg cgcatgcccg 2760

acggcgagga tctcgtcgtg acccatggcg atgcctgctt gccgaatatc atggtggaaa 2820

atggccgctt ttctggattc atcgactgtg gccggctggg tgtggcggac cgctatcagg 2880

acatagcgtt ggctacccgt gatattgctg aagagcttgg cggcgaatgg gctgaccgct 2940

tcctcgtgct ttacggtatc gccgctcccg attcgcagcg catcgccttc tatcgccttc 3000

ttgacgagtt cttctgagcg ggactctggg gttcgaaatg accgaccaag cgacgcccaa 3060

cctgccatca cgagatttcg attccaccgc cgccttctat gaaaggttgg gcttcggaat 3120

cgttttccgg gacgccggct ggatgatcct ccagcgcggg gatctcatgc tggagttctt 3180

cgcccacccc aacttgttta ttgcagctta taatggttac aaataaagca atagcatcac 3240

aaatttcaca aataaagcat ttttttcact gcattctagt tgtggtttgt ccaaactcat 3300

caatgtatct tatcatgtct gtataccgtc gacctctagc tagagcttgg cgtaatcatg 3360

gtcatagctg tttcctgtgt gaaattgtta tccgctcaca attccacaca acatacgagc 3420

cggaagcata aagtgtaaag cctggggtgc ctaatgagtg agctaactca cattaattgc 3480

gttgcgctca ctgcccgctt tccagtcggg aaacctgtcg tgccagctgc attaatgaat 3540

cggccaacgc gcggggagag gcggtttgcg tattgggcgc tcttccgctt cctcgctcac 3600

tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta tcagctcact caaaggcggt 3660

aatacggtta tccacagaat caggggataa cgcaggaaag aacatgtgag caaaaggcca 3720

gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg tttttccata ggctccgccc 3780

ccctgacgag catcacaaaa atcgacgctc aagtcagagg tggcgaaacc cgacaggact 3840

ataaagatac caggcgtttc cccctggaag ctccctcgtg cgctctcctg ttccgaccct 3900

gccgcttacc ggatacctgt ccgcctttct cccttcggga agcgtggcgc tttctcatag 3960

ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca 4020

cgaacccccc gttcagcccg accgctgcgc cttatccggt aactatcgtc ttgagtccaa 4080

cccggtaaga cacgacttat cgccactggc agcagccact ggtaacagga ttagcagagc 4140

gaggtatgta ggcggtgcta cagagttctt gaagtggtgg cctaactacg gctacactag 4200

aagaacagta tttggtatct gcgctctgct gaagccagtt accttcggaa aaagagttgg 4260

tagctcttga tccggcaaac aaaccaccgc tggtagcggt ttttttgttt gcaagcagca 4320

gattacgcgc agaaaaaaag gatctcaaga agatcctttg atcttttcta cggggtctga 4380

cgctcagtgg aacgaaaact cacgttaagg gattttggtc atgagattat caaaaaggat 4440

cttcacctag atccttttaa attaaaaatg aagttttaaa tcaatctaaa gtatatatga 4500

gtaaacttgg tctgacagtt accaatgctt aatcagtgag gcacctatct cagcgatctg 4560

tctatttcgt tcatccatag ttgcctgact ccccgtcgtg tagataacta cgatacggga 4620

gggcttacca tctggcccca gtgctgcaat gataccgcga gacccacgct caccggctcc 4680

agatttatca gcaataaacc agccagccgg aagggccgag cgcagaagtg gtcctgcaac 4740

tttatccgcc tccatccagt ctattaattg ttgccgggaa gctagagtaa gtagttcgcc 4800

agttaatagt ttgcgcaacg ttgttgccat tgctacaggc atcgtggtgt cacgctcgtc 4860

gtttggtatg gcttcattca gctccggttc ccaacgatca aggcgagtta catgatcccc 4920

catgttgtgc aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca gaagtaagtt 4980

ggccgcagtg ttatcactca tggttatggc agcactgcat aattctctta ctgtcatgcc 5040

atccgtaaga tgcttttctg tgactggtga gtactcaacc aagtcattct gagaatagtg 5100

tatgcggcga ccgagttgct cttgcccggc gtcaatacgg gataataccg cgccacatag 5160

cagaacttta aaagtgctca tcattggaaa acgttcttcg gggcgaaaac tctcaaggat 5220

cttaccgctg ttgagatcca gttcgatgta acccactcgt gcacccaact gatcttcagc 5280

atcttttact ttcaccagcg tttctgggtg agcaaaaaca ggaaggcaaa atgccgcaaa 5340

aaagggaata agggcgacac ggaaatgttg aatactcata ctcttccttt ttcaatatta 5400

ttgaagcatt tatcagggtt attgtctcat gagcggatac atatttgaat gtatttagaa 5460

aaataaacaa ataggggttc cgcgcacatt tccccgaaaa gtgccacctg acgtc 5515

<210> 14

<211> 18

<212> DNA

<213>unknown (Unknown)

<400> 14

gtgattttac aacgagat 18

<210> 15

<211> 18

<212> DNA

<213>unknown (Unknown)

<400> 15

ctttcttgaa tttatgta 18

<210> 16

<211> 28

<212> DNA

<213>unknown (Unknown)

<400> 16

aggaatcgat gtgattttac aacgagat 28

<210> 17

<211> 28

<212> DNA

<213>unknown (Unknown)

<400> 17

atgcccgcgg ctttcttgaa tttatgta 28

<210> 18

<211> 21

<212> RNA

<213>unknown (Unknown)

<400> 18

agaaagguga uuuuacaacg a 21

<210> 19

<211> 19

<212> RNA

<213>unknown (Unknown)

<400> 19

gacacgcgac uuguaccac 19

<210> 20

<211> 30

<212> DNA

<213>unknown (Unknown)

<400> 20

tcgttgtaaa atcacctttc ttgaatttat 30

<210> 21

<211> 30

<212> DNA

<213>unknown (Unknown)

<400> 21

ccactttacc agagttaaaa gcagccctgg 30

<210> 22

<211> 30

<212> DNA

<213>unknown (Unknown)

<400> 22

cagtagaggc agggatgatg ttctggagag 30

<210> 23

<211> 30

<212> DNA

<213>unknown (Unknown)

<400> 23

gtcagaggag accacctggt gctcagtgta 30

Claims (3)

1. promoting application of the reagent of circular rna circRNF13 expression on preparation treatment Dendritic cell drug, the ring-type The sequence of RNA circRNF13 is as shown in SEQ NO:1；The reagent of the described promotion circular rna circRNF13 expression is CircRNF13 over-express vector.

2. application according to claim 1, which is characterized in that the building process of circRNF13 over-express vector is as follows:

(1) it according to the fundamentum of the Forming Mechanism of circRNA and eucaryote RNA montage, designs and is suitable for The loop-forming sequences of circRNA expression；According to the sequence information of commercial carrier pcDNA3.1, multiple cloning sites are designed, thus It is as follows to the complete DNA sequence for realizing that circRNA is overexpressed: GTGCTGGGATTACAGGTGTGAGCTACCACCCCCGG CCCACTTTTTCTTAAGCTTGGTACCGAGCTCGGATCCACATCGATTGGTGGAATTCTGCAGATATCCACCGCGGTG GCGGCCGCTCGAGTCTAGAGAAAAGAATTAGGCTCGGCACGGTAGCTCACACCTGTAATCCCAGCA, intermediate underscore Part is multiple cloning sites, and both ends are respectively upstream and downstream loop-forming sequences；

(2) above-mentioned synthesis is realized that NheI restriction enzyme site sequence is added in DNA sequence one end that circRNA is overexpressed, it is another End addition ApaI restriction enzyme site sequence obtains pcCirc by being built into pcDNA3.1 carrier after NheI and ApaI digestion Empty plasmid, sequencing confirmation plasmid is correct, and sequence is as shown in SEQ NO:13；

(3) selection Cla I and Sac II restriction enzyme site is used for digestion pcCirc empty plasmid, and circRNF13 sequence is inserted Enter between the upstream and downstream loop-forming sequences of carrier.

3. application according to claim 2, which is characterized in that detailed process is as follows for step (3):

1) using Tca8113 cells Tca8113 cDNA as template, PCR amplification overall length is carried out using TaKaRa LA Taq enzyme CircRNF13 sequence；CircRNF13 full length sequence amplimer is as follows:

Upstream primer: 5 '-GTGATTTTACAACGAGAT-3 '；

Downstream primer: 5 '-CTTTCTTGAATTTATGTA-3 '；

At 5 ' ends of upstream and downstream primer respectively plus restriction enzyme Cla I and Sac II recognition site and after protecting base, Primer sequence is as follows:

Upstream primer: 5 '-AGGAATCGAT GTGATTTTACAACGAGAT -3 ', underscore part are that Cla I identifies position Point；

Downstream primer: 5 '-ATGCCCGCGG CTTTCTTGAATTTATGTA -3 ', underscore part are that Sac II identifies position Point；

2) PCR amplification, circRNF13 full length sequence, PCR reaction condition are as follows:

1 μ l of TaKaRa LA Taq enzyme

10 μm of 0.4 μ l of upstream primer

10 μm of 0.4 μ l of downstream primer

2.0 μ l of cDNA template

dH₂O 12.2μl

4 μ l of 5x PCR reaction buffer

20 μ l of Total,

PCR reaction step

1 94℃ 5 min

2 95℃ 10 sec

3 58℃ 30 sec

4 72℃ 60 sec

5 return to step 2, carry out 39 secondary response circulations altogether；

3) by, through Cla I and Sac II double digestion rear electrophoresis, glue recycles again after PCR product electrophoresis, glue recycling target fragment；

4) pcCirc empty plasmid recycles target fragment through Cla I and Sac II double digestion rear electrophoresis glue；

5) vector plasmid of overexpression circRNF13 3) is arrived with 4) step glue recovery product with the connection of T4 DNA ligase；

6) by the eukaryon expression plasmid transformed competence colibacillus Escherichia coli comprising circRNF13 full length sequence that 5) step obtains, with Expand plasmid.