CN108342403A - Eucalyptus urophylla COMT genes and its application - Google Patents
Eucalyptus urophylla COMT genes and its application Download PDFInfo
- Publication number
- CN108342403A CN108342403A CN201810218856.4A CN201810218856A CN108342403A CN 108342403 A CN108342403 A CN 108342403A CN 201810218856 A CN201810218856 A CN 201810218856A CN 108342403 A CN108342403 A CN 108342403A
- Authority
- CN
- China
- Prior art keywords
- comt
- plant
- gene
- eucalyptus urophylla
- expression vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1003—Transferases (2.) transferring one-carbon groups (2.1)
- C12N9/1007—Methyltransferases (general) (2.1.1.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/8255—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving lignin biosynthesis
Abstract
The invention discloses a kind of Eucalyptus urophyllasCOMTGene and its application, Eucalyptus urophyllaCOMTGene nucleotide series as shown in SEQ ID NO.1, can by the gene be applied to transfer-gen plant in, and demonstrate the gene have the function of raising G lignin synthesis.By to Eucalyptus urophyllaCOMTThe research of gene function contributes to the genetic engineering breeding for pushing Eucalyptus urophylla transgenosis orientation regulation and control lignin synthesis.
Description
Technical field
The invention belongs to field of plant genetic, and in particular to be related to Eucalyptus urophyllaCOMTGene and its application.
Background technology
Eucalyptus is the general name of Myrtaceae eucalyptus plant, and source area is Australia.The research of Eucalypt in Guangxi is at China
In leading position, phase early 1970s begins to introduce a fine variety, by for many years introduction and Experiment and selection cross, obtained multiple
Fine tree species, fine provenance and superior families.Eucalyptus is fast, material is good, and Guangxi whole district eucalyptus area ranks first in the country,
As the Major Tree Species Planted of short cycle raw material forest.Eucalyptus urophylla GLU4 clones（Eucalyptus urophylla clone
GLU4）It is the eucalyptus breeding that Guangxi is planted extensively, because the slurrying index such as its content of cellulose, fiber length is significantly better than other
Eucalypt species become the preferred seeds of pulpwood afforestation.From pulpwood production requirement, it is desirable to which the content of lignin in timber is more
It is low or be easier to remove.However lignin maintain plant normal growth development, defence invading pathogens in terms of still have can not
Or scarce significance, the lignin range of decrease is excessive to have potential adverse effect to plant, so orientation regulation and control lignin monomer
Synthesis, improves its S/G ratio, becomes the main research strategy of pulpwood quality-improving.
COMT（Caffeic acid, caffeic-acid-O- methyltransferase）It is plant lignin
One of key gene in monomer synthesis.ForCOMTGene the study found that inhibit expressCOMT2 years raw transgenosis willows
In branch millet,COMTTranscriptional level, content of lignin and G/S are significantly reduced than wild type, and the change of composition reduces timber
Difficulty is removed, improves sugared release rate, this is highly beneficial to biomass energy.RNAi is used in rye grass and two fringe false bromegrass
InhibitCOMTIt expresses, G, S lignin reduce in transfer-gen plant.It is lowered in cloverCOMT, G content of lignin declines and S is wooden
Quality almost all disappears.The above result shows that G lignin monomer biosynthesis blocks in the transfer-gen plant of inhibition expression COMT,
Illustrate that the synthesis of COMT gene pairs G lignin monomers is most important, can be synthesized by gene regulation G lignin monomers.At present
In Eucalyptus urophylla there has been noCOMTGene identification comes out, and it is even more nothing to carry out genetic engineering regulation using gene order therein
Method is carried out.Eucalyptus urophylla disclosed by the inventionCOMTSequence and its application in genetic engineering, help to go deep into Eucalyptus urophyllaCOMT
The research of gene function, and push the genetic engineering breeding of Eucalyptus urophylla transgenosis orientation regulation and control lignin synthesis.
Invention content
The purpose of the present invention is to provide a kind of Eucalyptus urophyllasCOMTGene and its plant expression vector, host cell and
Application in plant lignin's monomer synthesis regulation improves the synthesis of plant G lignin monomers, in lignin list to be effectively directed
Playing a significant role in the genetic engineering of body synthesis regulation.
The present invention can be achieved through the following technical solutions：
A kind of Eucalyptus urophyllaCOMTGene, cDNA sequence have following feature：With DNA sequence dna shown in SEQ ID NO.1；Or
Its coding of person has the polypeptide of amino acid sequence shown in SEQ ID NO.2.
The present invention also provides a kind of plant expression vector, the Eucalyptus urophylla stated is wrappedCOMTGene or its segment.
As the preferred of technical solution, the plant expression vector is pBI121.
Preferably, the plant expression vector is recombinant vector pBI121- to another kind as technical solutionCOMT。
The present invention also provides a kind of host cells, and it includes Eucalyptus urophyllas as described aboveCOMTGene or its segment or plant
Object expression vector.
As the preferred of technical solution, the host cell is selected from Escherichia coli, Agrobacterium or plant cell, such as Escherichia coli
JM109 bacterial strains, Agrobacterium LBA4404 bacterial strain.
The Eucalyptus urophylla of the present inventionCOMTApplication of the gene in terms of regulating and controlling plant lignin monomer synthesis, can be by Eucalyptus urophyllaCOMTGene or its segment are transformed into plant, also can the plant expression vector be transformed into plant, it is also possible to which the host is thin
Born of the same parents infect plant, and detailed step can refer to specific implementation mode.
Beneficial effects of the present invention：
1, present invention firstly discovers that the important gene for participating in lignin monomer synthesis in Eucalyptus urophyllaCOMT, and exist to the gene
Genetic engineering application in lignin monomer synthesis regulation is studied.
2, present invention conversion expression Eucalyptus urophylla in tobaccoCOMTObtained transgenic tobacco plant demonstrates Eucalyptus urophyllaCOMTHave the function of promoting the synthesis of G lignin monomers, can reach the effect of orientation regulation and control lignin monomer synthesis.
3, Eucalyptus urophylla disclosed by the inventionCOMTGene order and its application in genetic engineering, help to go deep into caudal lobe
EucalyptusCOMTThe research of gene function, and push the genetic engineering breeding of Eucalyptus urophylla transgenosis orientation regulation and control lignin synthesis.
4, the present invention is to Eucalyptus urophyllaCOMTGene infects the lignin monomer content detection of tobacco plant：Show transgenosis cigarette
G content of lignin improves 15% or more than wild-type tobacco in careless plant, demonstrates geneCOMTG lignin monomers are synthesized
To regulating and controlling effect.
Description of the drawings
Fig. 1：Wild-type tobacco xylem M ule colored graphs.
Fig. 2：Transgenic tobacco xylem M ule colored graphs.
Specific implementation mode
Embodiment below facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments
Method is unless otherwise specified conventional method.Test material as used in the following examples is unless otherwise specified certainly
What routine biochemistry reagent shop was commercially available.% in following embodiments is unless otherwise specified mass percentage.Below
Quantitative test in embodiment, is respectively provided with three repeated experiments, and results are averaged.
Embodiment 1：Eucalyptus urophyllaCOMTThe cDNA sequence of gene is cloned
It has been reported in NCBI retrieves other plantCOMTGene order, blast analyzes gene conserved region, with Vector NTI
Software for Design obtains target gene special primerCOMT-F/COMT- R, sequence are as follows：
COMT-F：GGAGAGGAGAGAATGGGTTC；
COMT-R：GAGCAGATCAAGCAGTCTTC.
The Eucalyptus urophylla GLU4 clonal tissue culture seedlings stem tissue that transplanting cultivates 3~4 weeks is taken, it is more using RNA prep Pure
Sugared polyphenol plant total RNA extraction reagent box（TAKARA）Total serum IgE is extracted, RNA LA PCR reverse transcription reagent box is used in combination（TAKARA）
CDNA is synthesized, the above kit specification of pressing operates, and DNA sample is in -80 DEG C of preservations.
Using cDNA as template, with target gene special primerCOMT-F/COMT- R uses Ex-Taq polymerases
（TAKARA）Amplification gene cDNA segments.Pcr amplification product respectively through 0.8% agarose gel electrophoresis detection after, with common DNA
Product Purification Kit（Tiangeng）Purifying recycling, connect with 16 DEG C of cloning vector pMD18-T carriers it is overnight after convert Escherichia coli
JM109 carries out plate screening using antibiotic.Random picking resistance clone target gene special primerCOMT-F/COMT-R
After carrying out PCR verifications, takes PCR verification positive colony extraction plasmids and be sequenced with the universal primer on carrier, acquisition has complete
Code areaCOMTGene cDNA sequence（SEQ ID NO. 1）, utilize the ORF Finder couple of NCBICOMTGene coding region into
Row translation, the amino acid sequence for obtaining its coding protein are SEQ ID NO. 2.Recombinant plasmid is named as pCOMT。
Embodiment 2, Eucalyptus urophyllaCOMTGene sense expression vector is built
Digestion, target fragment recycling and connection are carried out by using toolenzyme, it willCOMTIt is cloned into plant expression vector, such as
PBI121 so that the gene is located under the control of promoter such as CaMV 35S promoters.
Implement according to following operating method, detailed step can modify according to method known to those skilled in the art：
According to Eucalyptus urophyllaCOMTGene order design primerCOMT-F1/COMT- R1, upstream and downstream primer attachedXbaI digestions
Site, sequence are as follows.
COMT-F1：GGGTCTAGAGGAGAGGAGAGAATGGGTTC；
COMT-R1：GGGTCTAGAGAGCAGATCAAGCAGTCTTC.
Use the small extraction reagent kit of centrifugal column type ordinary plasmids（Tiangeng）It extracts and contains from the Escherichia coli of above-mentioned conversionCOMTRecombinant plasmid pCOMT, with pCOMTFor template,COMT-F1/COMT- R1 is primer, is usedEx-TaqEnzyme（TAKARA）It is rightCOMTGene carries out PCR amplification.Amplified production uses common DNA product purification kit（Tiangeng）By specification is purified,
WithXbaI（TAKARA）Carry out digestion, the common DNA product purification kit of product（Tiangeng）Recycling.
PBI121 plasmids separately are taken, are usedXbaI carries out digestion.Digestion products carry out 0.8% agarose gel electrophoresis, and use is general
Logical DNA product purification kit（Tiangeng）Recycle the linear pBI121 skeletons band after single endonuclease digestion.
By above-mentioned two segment according toCOMT:The molar ratio of pBI121 is 3:1 mixing, uses T4 DNA ligases
（promega）E. coli jm109 is converted after being attached, and plate screening is carried out using antibiotic.Select resistant clones at random
With target gene special primerCOMTUniversal primer 35S on-R1 and pBI121 carries out PCR verifications, and PCR is taken to verify positive colony
It is sequenced with the universal primer 35S on pBI121, chooses and correct single bacterium colony is sequenced, carried using centrifugal column type ordinary plasmids are small
Kit（Tiangeng）Plasmid is extracted, the plasmid of gained is recombinant vector pBI121-COMT。
Embodiment 3：Utilize Eucalyptus urophyllaCOMTGene regulation tobacco lignin monomer synthesizes
Using conventional method, by pBI121-COMTRecombinant vector imports Agrobacterium LBA4404, through antibiotic plate screening, PCR
Identification and sequencing identification obtain positive strain.Conventionally Agrobacterium bacterium solution infects tobacco leaf, through co-culturing, divides
After change, the culture in stages such as strong sprout, take root, transplant, transgene tobacco seedling is obtained.
After transplanting 8 weeks, small seedling leaf extraction total DNA is acquired, specific primer is usedCOMT-F/COMT- R carries out seedling
PCR identifies that the corresponding plant of sample that energy Successful amplification goes out about 1100 bp bands can be identified as positive transgenic plant.
Positive plant is growing upper and wild type there is no notable difference, and plant leaf is unfolded, and leaf color jade green, stem is endured
Directly, height of seedling reaches 1.7 m or so when September age, and when 11 monthly age blossoms and bears fruit.Sample is acquired when September age is used for Phenotypic examination, including
Following several respects detection：
（1）Target gene expression detects
Using tobaccoactinGene（EU938079）As reference gene, Eucalyptus urophyllaCOMTFor gene as target gene, design is glimmering
Light quantifies detection primer, and sequence is as follows：
P-actin-F CTGGAATCCATGAGACTACTTACAA；
P-actin-R AACCGCCACTGAGCACAATA；
P-EuCOMT-F：AGAAGATACTGGAAACATACAAGGG；
P-EuCOMT-R：TTTGGAACGCTGACGAACAT.
Leaf tissue is acquired at the downward Section 5 of transgenic tobacco plant stem apex, with wild-type tobacco as control, is used
RNA prep Pure polysaccharide polyphenol plant total RNA extraction reagent boxes carry out RNA extractions, are tried afterwards using RNA LA PCR reverse transcriptions
Agent box synthesizes cDNA.Using ABI SybrGreen PCR Master Mix（2X）Kit carries out fluorescence to gene expression dose
Quantitative PCR detection.
When being detected to wild-type tobacco, house-keeping geneactinGene can be detected normally, but by 40 cycles
Fluorogenic quantitative detection, Eucalyptus urophyllaCOMTGene still can't detect signal, it was demonstrated that in wild-type tobacco and said gene is not present
Expression, eliminates interference of the endogenous gene to testing result.
When being detected to transfer-gen plant, except can normally detectactinOutside gene, Eucalyptus urophylla also can detectCOMTThe expression signal of gene illustrates that the gene being transferred to can be expressed in plant body.
（2）Stem's Fiber and lignin concentration detection
Control and transgenic tobacco plant are chosen respectively, are selected stem top to count Section 3 downwards to Section 15, are plucked leaf, it will
Cane is cut into segment, is placed on after being dried 24 hours in 60 DEG C of baking ovens, crushed 150 mesh sieve, contains for lignin and cellulose
Amount detection.Content of lignin is measured to be measured using Klason methods, and content of cellulose is measured using nitrate method.
As a result, it has been found that content of lignin and wild type difference is not notable in transfer-gen plant, content of cellulose reduces by 4.64%
（Table 1）.
Table 1：Lignin, content of cellulose in transgene tobacco
| Plant is numbered | Content of lignin（%） | Content of cellulose（%） |
| Wild type | 13.26±0.07 a | 34.03±0.07 b |
| Transfer-gen plant | 12.94±0.17 a | 35.61±0.05 a |
Note：Different letters are indicated in p in homologous series<0.05 horizontal upper significant difference.
（3）Stem's anatomical structure observation
It chooses transfer-gen plant and WT lines stem Section 5 and Section 7 is crosscutting, paraffin section is made simultaneously using conventional method
The fast green dyeing of sarranine-is carried out, the slice made is observed with Nikon researchs with light microscope, NIS-Elements softwares
It takes pictures and measures.
Diameter crosscutting to stem first is measured（Table 2）, transformed plant is compared with wild type, in Section 5 diameter
Difference is not notable, and for average diameter at 6200 μm or so, the same difference of Section 7 is not notable, and average diameter is at 8200 μm or so, explanation
Genetic transformation does not have an impact the growth and development of stem.
It is shown in the xylem measurement result being sliced to stem（Table 2）, difference is not notable at Section 5 of transformed plant,
At Section 7, xylem thickness is only increased slightly than wild type, illustrates influence of the genetic transformation to lignin total amount and little.
Table 2：Transfer-gen plant stem diameter, xylem thickness change
Note：Different letters are indicated in p in same row<0.05 horizontal upper significant difference.
M ule dyeing is carried out after taking stem's Section 7 sample that slice is made, with Nikon research light microscopes in high power
Microscopic observation tracheid anatomical structure, NIS-Elements softwares take pictures and measure cell area, cell wall thickness（Such as figure
1, shown in 2）.
The most oval or close rectangle of tracheid is found from Fig. 1,2, is arranged closely, distribution of being scattered therebetween is several
The conduit of oval or polygon.This close structure of arrangement, stronger enabling capabilities, transfer-gen plant are provided for plant
In in cellular morphology with wild type no significant difference, measurement data also show stem tissue cell area and cell wall thickness
Difference is not notable（Table 3）, illustrate that the conversion of foreign gene does not have a significant impact the growth of cell wall, formed, also do not influence
The mechanical support function of plant stem, and the observation of actual plant strain growth does not also find the difference of transfer-gen plant and wild type
It is different.
Table 3：Transfer-gen plant tracheid wall thickness and cell area
| Plant is numbered | Cell area（µm2） | Cell wall thickness（µm2） |
| Wild type | 135.46±42.30 a | 2.29±0.44 a |
| Transfer-gen plant | 140.53±53.92 a | 2.33±0.61 a |
Note：Different letters are indicated in p in same row<0.05 horizontal upper significant difference.
（4）Lignin monomer content detection
Control and transgenic tobacco plant are chosen respectively, are selected stem top to count Section 3 downwards to Section 15, are plucked leaf, it will
Cane is cut into segment, is placed on after drying 24 h in 60 DEG C of baking ovens, after being crushed with hypervelocity pulverizer, crosses 150 mesh sieve.
By powder after thio acidolysis reaction treatment, using Trace-GC Ultra and Trace-DSQ GC-MS
(Thermo-Finnigan）It is detected, chromatographic column uses DB-5 ms (mm of 30m × 0.25 i.d., 0.25 μm of film
thickness, Agilent).Internal standard n-tetracosane chooses three characteristic ions 57,71,85, G lignin monomers selection spy
Ion 269 is levied, S monomer selected characteristics ion 299 is scanned.Using 2.0 work stations of calibur carry out data acquisition and
Analysis.
In table 4 the results show that in transfer-gen plant G content of lignin than wild type improve 17.77%, S lignin then with open country
Raw type difference is not notable.
Table 4：Transgene tobacco stem lignin monomer content analysis
| Plant is numbered | G lignin monomer contents | S lignin monomer contents |
| Wild type | 9.23±0.60 b | 8.03±0.49 a |
| Transfer-gen plant | 10.87±0.10 a | 7.75±0.45 a |
Note：Different letters are indicated in p in same column<0.05 horizontal upper significant difference.
Sequence table
<110>Inst. of Forestry Science, Guangxi Zhuang Autonomous Region
<120>Eucalyptus urophylla COMT genes and its application
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1120
<212> DNA
<213>Eucalyptus urophylla (Eucalyptus urophylla)
<400> 1
ggagaggaga gaatgggttc gaccggatcc gagacccaga tgaccccgac ccaagtctcg 60
gacgaggagg cgaacctctt cgccatgcag ctggcgagcg cctccgtgct ccccatggtc 120
ctcaaggccg ccatcgagct cgacctcctc gagatcatgg ccaaggccgg gccgggcgcg 180
ttcctctccc cgggggaagt cgcggcccag ctcccgaccc agaaccccga ggcacccgtc 240
atgctcgacc ggatcttccg gctgctggcc agctactccg tgctcacgtg caccctccgc 300
gacctccccg atggcaaggt cgagcggctc tacggcttag cgccggtgtg caagttcttg 360
gtcaagaacg aggacggggt ctccatcgcc gcactcaact tgatgaacca ggacaaaatc 420
ctcatggaaa gctggtatta cctgaaagat gcggtccttg aaggcggaat cccattcaac 480
aaggcgtacg ggatgaccgc gttcgagtat catggcaccg acccgcgatt caacaagatc 540
tttaaccggg gaatgtctga tcactccacc attactatga agaagatact ggaaacatac 600
aagggcttcg agggcctcga gaccgtggtc gatgtcggag gcggcactgg ggccgtgctc 660
agcatgatcg ttgccaaata cccatcgatg aaagggatca acttcgacct gcctcacgtg 720
attgaagacg ctccacccct tcccggtgtc aagcacgtcg gaggcgacat gttcgtcagc 780
gttccaaagg gagatgccat tttcatgaag tggatatgcc atgactggag tgacgaccat 840
tgcgcgaagt tcctcaagaa ctgctacgat gcgcttccca acaatggaaa ggtgatcgtt 900
gcagagtgcg tactccctgt gtacccagac acgagcctag cgaccaagga tgtgatccac 960
atcgactgca tcatgttggc ccacaaccca ggcgggaaag agaggacaca gaaggagttc 1020
gaggcattgg ccaaaggggc cggatttcag ggcttccaag tcatgtgctg cgctttcggc 1080
actcacgtca tggagttcct gaagactgct tgatctgctc 1120
<210> 2
<211> 366
<212> PRT
<213>Eucalyptus urophylla (Eucalyptus urophylla)
<400> 2
Met Gly Ser Thr Gly Ser Glu Thr Gln Met Thr Pro Thr Gln Val Ser
1 5 10 15
Asp Glu Glu Ala Asn Leu Phe Ala Met Gln Leu Ala Ser Ala Ser Val
20 25 30
Leu Pro Met Val Leu Lys Ala Ala Ile Glu Leu Asp Leu Leu Glu Ile
35 40 45
Met Ala Lys Ala Gly Pro Gly Ala Phe Leu Ser Pro Gly Glu Val Ala
50 55 60
Ala Gln Leu Pro Thr Gln Asn Pro Glu Ala Pro Val Met Leu Asp Arg
65 70 75 80
Ile Phe Arg Leu Leu Ala Ser Tyr Ser Val Leu Thr Cys Thr Leu Arg
85 90 95
Asp Leu Pro Asp Gly Lys Val Glu Arg Leu Tyr Gly Leu Ala Pro Val
100 105 110
Cys Lys Phe Leu Val Lys Asn Glu Asp Gly Val Ser Ile Ala Ala Leu
115 120 125
Asn Leu Met Asn Gln Asp Lys Ile Leu Met Glu Ser Trp Tyr Tyr Leu
130 135 140
Lys Asp Ala Val Leu Glu Gly Gly Ile Pro Phe Asn Lys Ala Tyr Gly
145 150 155 160
Met Thr Ala Phe Glu Tyr His Gly Thr Asp Pro Arg Phe Asn Lys Ile
165 170 175
Phe Asn Arg Gly Met Ser Asp His Ser Thr Ile Thr Met Lys Lys Ile
180 185 190
Leu Glu Thr Tyr Lys Gly Phe Glu Gly Leu Glu Thr Val Val Asp Val
195 200 205
Gly Gly Gly Thr Gly Ala Val Leu Ser Met Ile Val Ala Lys Tyr Pro
210 215 220
Ser Met Lys Gly Ile Asn Phe Asp Leu Pro His Val Ile Glu Asp Ala
225 230 235 240
Pro Pro Leu Pro Gly Val Lys His Val Gly Gly Asp Met Phe Val Ser
245 250 255
Val Pro Lys Gly Asp Ala Ile Phe Met Lys Trp Ile Cys His Asp Trp
260 265 270
Ser Asp Asp His Cys Ala Lys Phe Leu Lys Asn Cys Tyr Asp Ala Leu
275 280 285
Pro Asn Asn Gly Lys Val Ile Val Ala Glu Cys Val Leu Pro Val Tyr
290 295 300
Pro Asp Thr Ser Leu Ala Thr Lys Asp Val Ile His Ile Asp Cys Ile
305 310 315 320
Met Leu Ala His Asn Pro Gly Gly Lys Glu Arg Thr Gln Lys Glu Phe
325 330 335
Glu Ala Leu Ala Lys Gly Ala Gly Phe Gln Gly Phe Gln Val Met Cys
340 345 350
Cys Ala Phe Gly Thr His Val Met Glu Phe Leu Lys Thr Ala
355 360 365
Claims (9)
1. a kind of Eucalyptus urophyllaCOMTGene, which is characterized in that its cDNA sequence has following feature：With SEQ ID NO.1 institutes
The DNA sequence dna shown；Or its coding has the polypeptide of amino acid sequence shown in SEQ ID NO.2.
2. a kind of plant expression vector, it is characterised in that：Including Eucalyptus urophylla as described in claim 1COMTGene or its piece
Section.
3. plant expression vector according to claim 2, which is characterized in that the plant expression vector is pBI121.
4. plant expression vector according to claim 3, which is characterized in that the plant expression vector is recombinant vector p
pBI121-COMT。
5. a kind of host cell, it is characterised in that：Including Eucalyptus urophylla as described in claim 1COMTGene or its segment or
Plant expression vector as described in any one of claim 2 ~ 4.
6. host cell according to claim 5, it is characterised in that：The host cell is selected from Escherichia coli, Agrobacterium
Or plant cell.
7. a kind of Eucalyptus urophylla as described in claim 1COMTApplication of the gene in terms of regulating and controlling plant lignin monomer synthesis,
It is characterized in that, the gene or its segment are transformed into plant.
8. a kind of plant expression vector as described in claim 2 to 4 is any is in terms of regulating and controlling plant lignin monomer synthesis
Using, which is characterized in that the plant expression vector is transformed into plant.
9. a kind of such as application of the host cell described in claim 5 or 6 in terms of regulating and controlling plant lignin monomer synthesis, spy
Sign is, infects plant with the host cell.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810218856.4A CN108342403A (en) | 2018-03-16 | 2018-03-16 | Eucalyptus urophylla COMT genes and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810218856.4A CN108342403A (en) | 2018-03-16 | 2018-03-16 | Eucalyptus urophylla COMT genes and its application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108342403A true CN108342403A (en) | 2018-07-31 |
Family
ID=62956763
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810218856.4A Pending CN108342403A (en) | 2018-03-16 | 2018-03-16 | Eucalyptus urophylla COMT genes and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108342403A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111454955A (en) * | 2020-04-27 | 2020-07-28 | 广西壮族自治区林业科学研究院 | RNAi fragment derived from eucalyptus urophylla CAD gene sequence and application thereof |
| CN111518803A (en) * | 2020-04-27 | 2020-08-11 | 广西壮族自治区林业科学研究院 | RNAi fragment and application thereof in regulating and controlling lignin synthesis |
| CN111621520A (en) * | 2020-06-22 | 2020-09-04 | 南京林业大学 | Application of masson pine PmCOMT gene |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101410515A (en) * | 2004-09-22 | 2009-04-15 | 阿博根有限公司 | Compositions and methods for modulating lignin of a plant |
-
2018
- 2018-03-16 CN CN201810218856.4A patent/CN108342403A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101410515A (en) * | 2004-09-22 | 2009-04-15 | 阿博根有限公司 | Compositions and methods for modulating lignin of a plant |
Non-Patent Citations (2)
| Title |
|---|
| LIU,H.L.等: "KF467169.1", 《GENBANK》 * |
| WILLIAM P. BEWG等: "RNAi downregulation of three key lignin genes in sugarcane improves glucose release without reduction in sugar production", 《BIOTECHNOLOGY FOR BIOFUELS》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111454955A (en) * | 2020-04-27 | 2020-07-28 | 广西壮族自治区林业科学研究院 | RNAi fragment derived from eucalyptus urophylla CAD gene sequence and application thereof |
| CN111518803A (en) * | 2020-04-27 | 2020-08-11 | 广西壮族自治区林业科学研究院 | RNAi fragment and application thereof in regulating and controlling lignin synthesis |
| CN111621520A (en) * | 2020-06-22 | 2020-09-04 | 南京林业大学 | Application of masson pine PmCOMT gene |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109369789B (en) | ZmDRR206 protein and application of coding gene thereof in regulation and control of plant disease resistance and growth development | |
| CN109161550A (en) | A kind of the SlbHLH59 gene and application method of regulation tamato fruit ascorbic acid content | |
| CN108342403A (en) | Eucalyptus urophylla COMT genes and its application | |
| CN103613649A (en) | Paddy rice leaf color control gene OscpSRP54 and protein encoded by same | |
| CN108588098A (en) | Eucalyptus urophylla CAD genes and its application | |
| CN115873086A (en) | Tomato transcription factor SlWOX13 gene and protein and application thereof | |
| CN114195873B (en) | Application of PtrbHLH186 gene of populus tomentosa in regulation and control of tree secondary xylem development | |
| CN109234286B (en) | Rice leaf senescence regulation gene ELS6, protein coded by gene ELS6 and application of gene ELS6 | |
| CN104087561A (en) | White green leaf gene WGL1 of rice and application thereof | |
| CN107326033B (en) | Application of the OsROC4 gene in the synthesis of adjusting and controlling rice epicutile wax | |
| CN108410887A (en) | Eucalyptus urophylla CCoAOMT genes and its application | |
| CN109575113A (en) | Application of the rice Os PEX1 gene in regulation of lignin metabolism | |
| CN107326035B (en) | Deubiquitinating enzyme gene UBP5 for regulating rice grain shape and leaf color and application thereof | |
| CN111454955B (en) | RNAi fragment derived from Eucalyptus urophylla CAD gene sequence and application thereof | |
| CN111518803B (en) | RNAi fragment and application thereof in regulation and control of lignin synthesis | |
| CN107937358A (en) | A kind of GAP-associated protein GAP TaPaO1 for inducing plant pollen abortion and its encoding gene and application | |
| CN108342399A (en) | Eucalyptus urophylla F5H genes and its application | |
| CN106967736B (en) | Rice OsMts1 gene and encoding protein and application thereof | |
| CN104031927A (en) | Gene OsPRO related to content of fragrance of fragrant rice and application of encoding protein of gene OsPRO | |
| CN114606248A (en) | Litchi sucrose non-fermented protein kinase 1 alpha gene and application thereof | |
| JP6121942B2 (en) | Genes for increasing the biomass content of plants and methods for using the same | |
| CN110128517B (en) | Primula forbesii flower fragrance related gene PfLIS/NES and application thereof | |
| CN104017781B (en) | Agipanthus Plant hormones regulators,gibberellins synthesis dioxygenase APGA20ox albumen and encoding gene and probe | |
| CN113699163A (en) | Rice premature senility dwarfing gene ESD1 and application thereof | |
| CN113151315A (en) | Tobacco polyphenol metabolic pathway protein gene NtPOE and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20180731 |