CN108330136A - A kind of method and its application of the engineered strain of structure production flavin mononucleotide - Google Patents

A kind of method and its application of the engineered strain of structure production flavin mononucleotide Download PDF

Info

Publication number
CN108330136A
CN108330136A CN201710310871.7A CN201710310871A CN108330136A CN 108330136 A CN108330136 A CN 108330136A CN 201710310871 A CN201710310871 A CN 201710310871A CN 108330136 A CN108330136 A CN 108330136A
Authority
CN
China
Prior art keywords
flavin
fad
adenine dinucleotide
riboflavin
mononucleotide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201710310871.7A
Other languages
Chinese (zh)
Inventor
王�华
杨昀
郭林
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beihang University
Original Assignee
Beihang University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beihang University filed Critical Beihang University
Priority to CN201710310871.7A priority Critical patent/CN108330136A/en
Publication of CN108330136A publication Critical patent/CN108330136A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/26—Preparation of nitrogen-containing carbohydrates
    • C12P19/28—N-glycosides
    • C12P19/30—Nucleotides
    • C12P19/32—Nucleotides having a condensed ring system containing a six-membered ring having two N-atoms in the same ring, e.g. purine nucleotides, nicotineamide-adenine dinucleotide
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/101—Plasmid DNA for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a kind of method and its application of the engineered strain of structure production flavin mononucleotide.The method of the engineered strain of structure production flavin mononucleotide, using synthetic biology technology, in new structure or existing riboflavin fermentation bacterium, adjust cell endocrocin pond component and inner membrance secretion, the enzymatic step of cell membrane interstitial is added to novelty, realizes the flavin mononucleotide of microbial fermentation production of high purity.Specific method is (1) in riboflavin fermentation bacterium, introduces bifunctional enzyme --- flavokinase/flavin adenine dinucleotide (FAD) generates enzyme, converts cell endocrocin pond component to flavin adenine dinucleotide (FAD) from riboflavin；(2) flavin adenine dinucleotide (FAD) membrane transport albumen is introduced, intracellular flavin adenine dinucleotide (FAD) is transported to cell membrane interstitial；(3) 5' nucleotidases are introduced, convert the flavin adenine dinucleotide (FAD) cracking of cell membrane interstitial to flavin mononucleotide.Under conditions of flask fermentation, the fermentation purity (accounting for total flavin compound) of flavin mononucleotide is up to 92.4%.

Description

A kind of method and its application of the engineered strain of structure production flavin mononucleotide
Technical field
The present invention relates to technical field of bioengineering, in particular to a kind of engineering of structure production flavin mononucleotide The method and its application of bacterium.
Background technology
Flavin mononucleotide (flavinmononucleotide, abbreviation FMN) is a kind of widely used expensive compounds. In vivo, coenzyme of the flavin mononucleotide as flavoprotein (flavoprotein), the redox for participating in cell are anti- It answers, plays an important role in basic metabolism.Many microorganisms and plant can itself synthesis flavin compound, and higher mammal It can only be absorbed from food, when it lacks, the illnesss such as alopecia, chafing, visual impairment can be caused.Thus, flavine monokaryon Thuja acid is used frequently as clinical medicine, food and feed additive, food coloring etc. as water soluble vitamin.
In addition, flavin mononucleotide has redox active centre, it is a kind of important electron transmission carrier, in environment It produces electricity and plays a significant role in the extracellular electron transmission of bacterium.As the electron transmission mechanism of electricity production bacterium discloses, researcher has found yellow Plain mononucleotide is a kind of universal cytochromes coenzyme, determines the electron transport rate of electricity production bacterium.Huang in increase system The concentration of plain mononucleotide can effectively accelerate to produce electricity bacterium in biomass power generation, sewage disposal, soil remediation and purification process Catalysis Rate.
However, the commercial product of flavin mononucleotide is at high price at present, purity is low, such as the flavine of Sigma-Aldrich Mononucleotide product：Purity >=70%, about 10,000 yuan/gram of price, seriously constrains it in biological medicine, food, environmental project etc. The extensive use in field.
The industrialized production of flavin mononucleotide at present, mainly in such a way that microbe fermentation method is combined with chemical process It realizes.By microbe fermentation method from carbon source riboflavin biosynthesis (riboflavin, abbreviation RF) --- the generation of flavin mononucleotide Precursor.The phosphorylation of riboflavin to generate flavin mononucleotide is completed by chemical process.The chemical process energy consumption is big, and With isomerism chemical combination object, flavine-diphosphonic acid, the flavine-polyphosphoric acid of a variety of byproducts build-ups, such as flavin mononucleotide； The shortcomings of remaining reactant is mixed in product.Flavin mononucleotide is purified from these by-products and is come out, complex process, It is expensive, cause nearly 1000 times of the surge of price from precursor compound riboflavin to flavin mononucleotide, and production height The technical bottleneck of purity flavin mononucleotide.
However, not having been reported that the work of microbial fermentation production flavin mononucleotide at present, this is mainly following difficulty Caused by point.Traditional metabolic engineering bacterium, with " intracellular excess accumulation secretes final product in turn " for general categories, however should Strategy is difficult to be applicable in bacterium production flavin mononucleotide.Flavine pond (flavinpool) in bacterium is containing there are three types of chemical constitution is non- Normal similar, the adjacent compound of metabolic pathway, including riboflavin, flavin mononucleotide, flavin adenine dinucleotide (FAD) (flavin Adenine dinucleotide, abbreviation FAD).There are a kind of bifunctional enzyme, (RF kinases/FAD is closed in most protokaryon bacterium At enzyme, encoded by ribC or ribF), first convert riboflavin to flavin mononucleotide, it is flavin adenine to be further continued for catalysis Dinucleotides so that it is difficult to specific to accumulate flavin mononucleotide into the cell.And think according to traditional metabolic engineering Road --- the excess accumulation space before being secreted as target product using cytoplasm, flavin mononucleotide are difficult to the accumulation of specificity, nothing What method avoided other flavin compounds accumulates and is formed by-product jointly, and final to reduce secretion pure to extracellular product Degree.At the same time, the transport protein of energy specific secretion flavin mononucleotide is not had been reported that at present yet.Therefore, " intracellular excessive The conventional gene Ideas of accumulation, secretion " is difficult to realize the microbial fermentation production of flavin mononucleotide.
Invention content
It is an object of the invention to build the method for the engineered strain of production flavin mononucleotide, flavine list is established in bacterium The production flavin mononucleotide engineered strain of the de novo formation metabolic pathway of nucleotide, structure is realized from riboflavin to flavine monokaryon The synthesis of thuja acid and specific exocytosis.
To achieve the above object, the following technical scheme of use：
A method of the engineered strain of structure production flavin mononucleotide, the specific steps of this method include:
(1) in riboflavin fermentation bacterium, the bifunctional enzyme that flavokinase/flavin adenine dinucleotide (FAD) generates enzyme is introduced Flavokinase/flavin adenine dinucleotide (FAD) of gene, generation generates enzyme, and cell endocrocin pond component is converted from riboflavin For flavin adenine dinucleotide (FAD)；
(2) in the riboflavin fermentation bacterium with bifunctional enzyme that step (1) obtains, flavin adenine dinucleotide (FAD) is introduced Membrane transport protein gene, the flavin adenine dinucleotide (FAD) membrane transport albumen of generation is by intracellular two core of flavin adenine Thuja acid is transported to cell membrane interstitial；
(3) in the riboflavin fermentation bacterium with flavin adenine dinucleotide (FAD) membrane transport albumen that step (2) obtains, 5'-nucleotidase gene is introduced, the 5'-nucleotidase of generation cracks the flavin adenine dinucleotide (FAD) of cell membrane interstitial Catalysis is flavin mononucleotide.
Method as described above, it is preferable that the structure of the riboflavin fermentation bacterium is as follows：It is introduced through overstocked in host cell The genetic fragment of riboflavin synthetic proteins RibA, RibD, RibE, RibH of the hay bacillus of numeral optimization, and opened by composing type Mover or the control expression of inducible promoter.
Method as described above, it is preferable that the nucleotide sequence of the genetic fragment of described RibA, RibD, RibE, RibH is such as Shown in SEQ ID No.1,2,3,4.
Method as described above, it is preferable that the nucleotide sequence of the inducible promoter is as shown in SEQ ID No.5.
Method as described above, it is preferable that the host cell is selected from Escherichia coli (Escherichia coli), withered grass bud Spore bacillus (Bacillus subtilis), brevibacterium ammoniagene (Corynebacterium ammoniagenes), Pseudomonas Bacterium (Pseudomonasfluorescens), Ashbya gossypii (Ashbya gossypii), E. ashbyii (Eremothecium ashbyii), Pichia guilliermondii (Pichiaguilliermondii), Candida famate.
Method as described above, it is preferable that the flavokinase/flavin adenine dinucleotide (FAD) generates enzyme gene and comes from The ribC genes of bacillus subtilis (Bacillus subtilis), the nucleotide sequence such as SEQ ID of the ribC genes Shown in No.6.
Method as described above, it is preferable that the flavin adenine dinucleotide (FAD) membrane transport protein gene comes from uncommon The flavin adenine dinucleotide (FAD) membrane transport enzyme gene SO_0702 of watt Salmonella (Shewanella oneidensis), nucleosides Acid sequence is as shown in SEQ ID No.7.
Method as described above, it is preferable that the 5'-nucleotidase gene source is in Shewanella (Shewanella Oneidensis ushA genes), nucleotide sequence is as shown in SEQ ID No.8.
Method as described above, it is preferable that control the flavin adenine dinucleotide (FAD) membrane transport protein gene and 5'- cores The promoter sequence of the expression of thuja acid enzyme gene such as SEQ ID No.9.A kind of method of riboflavin biosynthesis mononucleotide, the side The engineered strain of the production flavin mononucleotide of method construct as above is carried out fermented and cultured by method under aerobic conditions, produces core yellow Plain mononucleotide.It is known that any aerobic fermentation pattern be suitable for realize the present invention, as batch fermentation, batch feeding send out Ferment or continuous fermentation method etc..In fermentation, conventional culture medium will be suitable for realizing the present invention, contain carbon source, nitrogen in culture medium Other various compositions needed for source, vitamin, inorganic salts and strain growth.
A kind of fermentation medium, work of the fermentation medium for the production flavin mononucleotide of method construct as described above Journey bacterial strain riboflavin biosynthesis mononucleotide, the formula of the fermentation medium are to contain 12gNa in every liter of solution2HPO4、6g KH2PO4、0.5gNaCl、1gNH4Cl、0.24g MgSO4、11.1mg CaCl2, 2g urea, 15g xyloses, 10mL vitamin solutions, 10mL trace element solutions, 1g casein hydrolysates, 50mg kanamycins, 34mg chloramphenicol, 2.4mg isopropylthio galactolipins Glycosides, 4.6 μ g anhydrotetracyclines；Wherein, the formula of the trace element solution is to contain three second of 1.5g nitrilo-s in every liter of solution Acid, 0.1g MnCl2·4H2O、0.3g FeSO4·7H2O、0.17g CoCl2·6H2O、0.1g ZnCl2、0.04g CuSO4· 5H2O、0.005gAlK(SO4)2·12H2O、0.005g H3BO3、0.09gNa2MoO4、0.12g NiCl2；The vitamin solution Formula be in every liter of solution containing 0.002g biotins, 0.002g folic acid, 0.02g pyridoxine HCls, 0.005g thiamines, 0.005g niacin, 0.005g pantothenic acid, 0.0001g vitamin B12s, 0.005g p-aminobenzoic acid, 0.005g lipoic acids.
A kind of engineered strain of structure production flavin mononucleotide, it is preferable that it contains the core as shown in SEQ ID No.1-9 Acid fragments.
Present invention employs a kind of completely new metabolic engineering synthesis strategies to be drawn in bacterium using synthetic biology means Heterologous cytoplasm enzyme, membrane transport albumen, cell membrane interstitial catalytic protein are entered, by the excess accumulation of flavin mononucleotide Remove the production for the flavin mononucleotide that high-purity can be realized to cell membrane interstitial in space.For the first time with cell membrane interstitial (periplasm) as the excess accumulation space of target product, by the excess accumulation of target product and other flavin compounds Production space thoroughly keep apart, so as to fundamentally realize eliminate by-product, produce high-purity flavin mononucleotide, Under the conditions of shaking flask aerobic fermentation, the fermentation purity (accounting for total flavin compound) of flavin mononucleotide is up to 92.4%.
The method of the present invention builds, realizes the de novo formation fermentation of flavin mononucleotide for the first time, can apply to major part Some riboflavin industrial production bacterium effectively and rapidly develop the industrial production bacterium of flavin mononucleotide, realize the fermentation output value Be doubled, and greatly reduce the production cost of flavin mononucleotide.
Description of the drawings
Fig. 1 is the flavin mononucleotide synthetic route design diagram that the present invention is built.
Fig. 2 is that the composition of biological brick and joining method illustrate schematic diagram in a preferred embodiment example of the invention.
Fig. 3 is the schematic diagram of plasmid contained by the recombinant bacterial strain that is built in an of the invention preferred embodiment example.
Fig. 4 is that the present invention one preferably selects the bacterial strain built in embodiment to produce flavin mononucleotide proportion.
Specific implementation mode
The de novo formation metabolic pathway that flavin mononucleotide is established in bacterium, is especially established in riboflavin fermentation bacterium From riboflavin to the synthesis of flavin mononucleotide, and specific exocytosis is current research bottleneck.It is asked to solve the technology Topic, the present invention design a kind of completely new metabolic engineering synthesis strategy, are produced for the first time using cell membrane interstitial (periplasm) as target The excess accumulation space of object thoroughly keeps apart the excess accumulation of target product and the production space of other flavin compounds, So as to fundamentally realize the possibility of elimination by-product, the flavin mononucleotide for producing high-purity.The structure in bacterium for the first time Build, realize the de novo formation fermentation strategies of flavin mononucleotide.The strategy utilizes synthetic biology means, introduces heterologous thin Cytoplasm enzyme, membrane transport albumen, cell membrane interstitial catalytic protein, the space of the excess accumulation of flavin mononucleotide is removed to cell Film interstitial realizes the production of the flavin mononucleotide of high-purity.
As shown in Figure 1, the present invention is firstly introduced into difunctional in new structure or existing riboflavin fermentation bacterium Enzyme --- flavokinase/flavin adenine dinucleotide (FAD) generates enzyme, converts cell endocrocin pond component to Huang from riboflavin Plain adenine-dinucleotide.Through experimental results demonstrate the enzyme gene may come from bacillus subtilis (ribC of Bacillussubtilis) etc..Then, flavin adenine dinucleotide (FAD) membrane transport albumen is introduced, it will be intracellular Flavin adenine dinucleotide (FAD) is transported to cell membrane interstitial.Through experimental results demonstrate the enzyme gene may come from Xi Washi Bacterium (SO_0702 of Shewanella oneidensis) etc..In turn, 5'-nucleotidase is introduced, by the Huang of cell membrane interstitial Plain adenine-dinucleotide cracking and catalyzing is flavin mononucleotide.Through experimental results demonstrate, the 5'-nucleotidase gene source in Shewanella (ushA of Shewanella oneidensis) etc..Finally, flavin mononucleotide secreted from Outer membrane protein to Extracellularly.Wherein, the host cell of riboflavin fermentation bacterium is selected from Escherichia coli, bacillus subtilis, brevibacterium ammoniagene, fluorescence Any one of pseudomonad, Ashbya gossypii, E. ashbyii, Pichia guilliermondii or Candida famate, Realize that flavin mononucleotide is secreted from Outer membrane protein to extracellular.
The present invention establishes the reaction step of design and rational and expands living things catalysis space, develops by riboflavin to flavine monokaryon The novel catalysis route of thuja acid.Using flavin adenine dinucleotide (FAD) as intracellular excess accumulation object and across membrane transport, innovation Property cell membrane interstitial is established as flavin mononucleotide finally synthesize and accumulation place, finally secreted to outside cell membrane high-purity The flavin mononucleotide of degree.
With reference to the accompanying drawings and examples come illustrate production flavin mononucleotide engineering bacteria preparation method, and using system The method of standby strain fermentation production flavin mononucleotide.It is to be understood that these embodiments are only intended to illustrate the present invention, and And it is not in any way limit the scope of the present invention.Method used below, reagent are not specified, and it is normal to be all made of this field Rule method, reagent.
Embodiment 1
1. building the plasmid of riboflavin synthesis path：
The riboflavin synthetic proteins RibA, RibD for the hay bacillus that introducing codon optimizes in Escherichia coli, RibE, RibH build the recombination bacillus coli of excessive production riboflavin.
As shown in a in Fig. 2, each foreign gene design synthesizes biological brick form.In each gene coded sequence The upstream of (coding sequence) is designed with EcoRI, XbaI enzyme cutting site and ribosome bind site (ribosome successively Binding site, abbreviation RBS).Wherein, RBS sequences are：AAAGAGGA GAAA.Ribosome bind site range coding sequence The sites ATG 6bp.It is designed with SpeI, PstI restriction enzyme site in the coding sequence downstream of each gene.It is serviced in gene chemical synthesis public Department orders gene ribA, ribD, ribE, ribH (sequence is as shown in SEQ ID No.1-4) of the synthesis biological brick form, and It is individually connected into the compatible middle copy expression vector pSB3C5 (p15A replicons) of biological brick.The specific method is as follows：Gene Composite service company is provided containing the Escherichia coli for ordering gene ribA plasmids, the aerobic culture 8 in LB culture mediums by the bacterial strain ~12 hours, plasmid is extracted with plasmid purification kit.The plasmid of acquisition two kinds of digestion with restriction enzyme of EcoRI, PstI (specific reaction system refers to the silent winged generation that FastDigest specifications of match, and reaction system is reacted~1 hour in 37 DEG C of waters).Enzyme Reaction solution is cut after agarose gel electrophoresis, the DNA fragmentation (1257bp) that there is ribA gene pairs to answer length is recycled, is recycled by glue Kits.Likewise, the pSB3C5 carriers that will be obtained via plasmid purification kit extraction, also use EcoRI, PstI two Kind digestion with restriction enzyme, the digestion system after reaction run agarose gel electrophoresis, and recycling pSB3C5 carriers correspond to length DNA fragmentation (2697bp), is purified with plastic recovery kit.By after EcoRI, PstI double digestion, recovery purifying ribA genes and With the connection of T4 ligases, (specific reaction system refers to the silent winged generation that T4DNA ligase specifications of match to pSB3C5 carriers, instead at 22 DEG C It answers~1 hour).The linked system is transferred in Competent Bacillus coli cells by thermal shock method (competent cell purchase from Beijing Quanshijin Biotechnology Co., Ltd, thermal shock method transformation experiment step refer to Trans109 Competent cell explanations Book), screening positive clone obtains recombinant plasmid ribA-pSB3C5.RibD-pSB3C5, ribE- are obtained in the same way pSB3C5、r ibH-pSB3C5。
Next the riboflavin synthesis path plasmid that structure is expressed by the control of inducible promoter lac promoters.Induction type Lac promoter sequences are (plac) SEQ ID NO.5：AATTGTGAGCGGATAACAATT GACATTGTGAGCGGATAACAAGATACTGAGCACA is also ordered and is synthesized biological brick form, and is connected into above-mentioned method Plac-pSB3C5 recombinant plasmids are obtained in pSB3C5.Two biological brick D NA modules, according to digestion connection side shown in Fig. 2 b Method, the longer DNA fragmentation that obtained recombinant plasmid contains still exist with biological brick form, are convenient for and other biological brick DNA Segment continues to splice.Specifically, as being placed in the Gene A of upstream in Fig. 2 b, the both ends of Gene A be respectively EcoRI, XbaI and Its plasmid SpeI, PstI double digestion is recycled entire plasmid by the restriction enzyme site of SpeI, PstI.It is placed in the gene B in downstream, base Because the both ends of B are the restriction enzyme site of EcoRI, XbaI and SpeI, PstI respectively, with XbaI, PstI double digestion, gene piece is recycled Section.Plasmid after recycling is connected with gene with T4 ligases, obtains the recombination that A-B is connected into pSB3C5 carriers with biological brick form Plasmid A-B-pSB3C5.A-B-C splicings step according to this analogize by method, finally obtain the successful plac, ribA of splicing, ribD, Plac, ribE, ribH segment are sequentially located in pSB3C5.Constructed plasmid is named as pSB3C5-A4 (as shown in Figure 3).
2. the flavin adenine dinucleotide (FAD) for introducing hay bacillus generates enzyme, it is fast to convert intracellular nucleic flavine to flavine gland Nicotinamide adenine dinucleotide：
The first step to riboflavin fermentation bacterium upgrading is to convert intracellular riboflavin to two core of flavin adenine Thuja acid, introduce hay bacillus RibC proteins carries this reaction.By codon optimization, simultaneously same design is biological brick shape The ribC genes (nucleotide sequence is as shown in SEQ ID No.6) of formula, in the method for above-mentioned biological brick splicing as shown in Figure 2 b, It is connected into pSB3C5-A4 plasmids, the plasmid constituted is named as pSB3C5-A5.
3. introducing flavin adenine dinucleotide (FAD) transport protein, the 5'-nucleotidase of Shewanella：
The flavin adenine dinucleotide (FAD) of Shewanella transports enzyme SO_0702, specifically will can excessively be accumulated in cytoplasm Tired flavin adenine dinucleotide (FAD) is transported in cell membrane interstitial.Make in the catalysis of cell membrane interstitial 5'-nucleotidase UshA Under, flavin adenine dinucleotide (FAD) is cracked into flavin mononucleotide.It is introduced from Shewanella in Escherichia coli SO_0702, ushA gene (nucleotide sequence sequence is as shown in SEQ IDNO.7 and 8), with induction type tet promoters control this two The sequence of the expression of a gene, induction type tet promoters (ptet) is SEQ ID No.9： TCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCAC.Codon optimizes and with biology After the form synthesis of brick, in the method for above-mentioned biological brick splicing as shown in Figure 2 b, respectively successively by ptet, SO_0702, ushA It is connected on the low copy carrier pSB4K5 of the compatible suitable memebrane protein expression of biological brick (pSC101 replicons), the plasmid constituted It is named as pSB4K5-B2.Two kinds of plasmids of pSB3C5-A5, pSB4K5-B2 are transferred in e. coli bl21-Gold (DE3), are obtained The engineering bacteria of flavin mononucleotide must be produced.Compare to analyze, present example constructs other two kinds of recombinant bacteriums simultaneously.It will The two empty carriers without containing expressing gene of plac-pSB3C5, ptet-pSB4K5 are transferred to e. coli bl21-Gold (DE3) In, obtain wild-type e. coli control group.By pSB3C5-A4, ptet-pSB4K5, the two plasmids are transferred to Escherichia coli In BL21-Gold (DE3), the engineering bacteria of production flavin mononucleotide is obtained.
4. aerobic cultivation and fermentation condition：
The engineering bacteria that pSB3C5-A5, pSB4K5-B2 are named as with plasmid of above-mentioned preparation is carried out under aerobic conditions Culture, it is known that any aerobic fermentation pattern can be suitble to the engineering bacteria containing pSB3C5-A5, pSB4K5-B2 produce flavine monokaryon Thuja acid, such as batch fermentation, fed batch fermentation or continuous fermentation method.In fermentation, conventional culture medium will be suitable for realizing The present invention contains other various compositions needed for carbon source, nitrogen source, vitamin, inorganic salts and strain growth in culture medium.
But in order to obtain best expression effect, the engineering bacteria containing pSB3C5-A5, pSB4K5-B2 is inoculated in optimization In fermentation medium afterwards, the formula of fermentation medium is as shown in table 1, is cultivated 48 hours in 37 degree of shaking tables with small flasks, Shaking speed is 200rpm.
1. fermentative medium formula of table
Wherein, the formula of trace element solution is as shown in table 2.
The formula of 2. trace element solution of table
The formula of vitamin solution is as shown in table 3 in table 1.
The formula of 3. vitamin solution of table
5. fermentation results
In order to verify the validity of riboflavin mononucleotide synthesis path in the specific example, by 3 kinds of Escherichia coli：It is wild Type Escherichia coli, riboflavin-produced Escherichia coli, production flavin mononucleotide Escherichia coli (as shown in Figure 3), are respectively connected to shown in table 1 In fermentation medium.Compared to wild-type e. coli (containing plac-pSB3C5, ptet-pSB4K5 empty carrier) and production core yellow Plain Escherichia coli (containing pSB3C5-A4, ptet-pSB4K5 plasmid), the production flavine monokaryon built in specific example of the invention Thuja acid Escherichia coli (contain pSB3C5-A5, pSB4K5-B2 plasmid), and the flavin mononucleotide concentration of fermenting and producing can reach 70.77mg/L, purity (accounting for flavin compound) are up to 92.4%.Concrete outcome is shown in Table 4 and Fig. 4.Wherein, Fig. 4 is described in detail Three kinds of bacterial strains produce respectively riboflavin (RF), flavin mononucleotide (FMN), flavin compound (flavin, riboflavin with it is yellow The summation of plain mononucleotide) concentration and flavin mononucleotide account for the ratio (FMN%) of flavin compound total weight.
The result of constructed bacterial strain production flavin mononucleotide in 4. specific implementation method of table
In conclusion compared with the prior art, in the fermentation results of the present invention, realize for the first time high-purity (>90%) Flavin mononucleotide microbial fermentation production.
SEQUENCE LISTING
<110>Beijing Space aviation university
<120>A kind of method and its application of the engineered strain of structure production flavin mononucleotide
<130>
<160> 9
<170> PatentIn version 3.5
<210> 1
<211> 1197
<212> DNA
<213>It is artificial synthesized
<400> 1
atgttccacc cgatcgaaga agctctggac gctctgaaaa aaggtgaagt tatcatcgtt 60
gttgacgacg aagaccgtga aaacgaaggt gacttcgttg ctctggctga acacgctacc 120
ccggaagtta tcaacttcat ggctacccac ggtcgtggtc tgatctgcac cccgctgtct 180
gaagaaatcg ctgaccgtct ggacctgcac ccgatggttg aacacaacac cgactctcac 240
cacaccgctt tcaccgtttc tatcgaccac cgtgaaacca aaaccggtat ctctgctcag 300
gaacgttctt tcaccgttca ggctctgctg gactctaaat ctgttccgtc tgacttccag 360
cgtccgggtc acatcttccc gctgatcgct aaaaaaggtg gtgttctgaa acgtgctggt 420
cacaccgaag ctgctgttga cctggctgaa gcttgcggtt ctccgggtgc tggtgttatc 480
tgcgaaatca tgaacgaaga cggtaccatg gctcgtgttc cggaactgat cgaaatcgct 540
aaaaaacacc agctgaaaat gatcaccatc aaagacctga tccagtaccg ttacaacctg 600
accaccctgg ttgaacgtga agttgacatc accctgccga ccgacttcgg taccttcaaa 660
gtttacggtt acaccaacga agttgacggt aaagaacacg ttgctttcgt tatgggtgac 720
gttccgttcg gtgaagaacc ggttctggtt cgtgttcact ctgaatgcct gaccggtgac 780
gttttcggtt ctcaccgttg cgactgcggt ccgcagctgc acgctgctct gaaccagatc 840
gctgctgaag gtcgtggtgt tctgctgtac ctgcgtcagg aaggtcgtgg tatcggtctg 900
atcaacaaac tgaaagctta caaactgcaa gaacagggtt acgacaccgt tgaagctaac 960
gaagctctgg gtttcctgcc ggacctgcgt aactacggta tcggtgctca gatcctgcgt 1020
gacctgggtg ttcgtaacat gaaactgctg accaacaacc cgcgtaaaat cgctggtctg 1080
gaaggttacg gtctgtctat ctctgaacgt gttccgctgc aaatggaagc taaagaacac 1140
aacaaaaaat acctgcaaac caaaatgaac aaactgggtc acctgctgca cttctaa 1197
<210> 2
<211> 1086
<212> DNA
<213>It is artificial synthesized
<400> 2
atggaagaat actacatgaa actggctctg gacctggcta aacagggtga aggtcagacc 60
gaatctaacc cgctggttgg tgctgttgtt gttaaagacg gtcagatcgt tggtatgggt 120
gctcacctga aatacggtga agctcacgct gaagttcacg ctatccacat ggctggtgct 180
cacgctgaag gtgctgacat ctacgttacc ctggaaccgt gctctcacta cggtaaaacc 240
ccgccgtgcg ctgaactgat catcaactct ggtatcaaac gtgttttcgt tgctatgcgt 300
gacccgaacc cgctggttgc tggtcgtggt atctctatga tgaaagaagc tggtatcgaa 360
gttcgtgaag gtatcctggc tgaccaggct gaacgtctga acgaaaaatt cctgcacttc 420
atgcgtaccg gtctgccgta cgttaccctg aaagctgctg cttctctgga cggtaaaatc 480
gctacctcta ccggtgactc taaatggatc acctctgaag ctgctcgtca ggacgctcag 540
cagtaccgta aaacccacca gtctatcctg gttggtgttg gtaccgttaa agctgacaac 600
ccgtctctga cctgccgtct gccgaacgtt accaaacagc cggttcgtgt tatcctggac 660
accgttctgt ctatcccgga agacgctaaa gttatctgcg accagatcgc tccgacctgg 720
atcttcacca ccgctcgtgc tgacgaagaa aaaaaaaaac gtctgtctgc tttcggtgtt 780
aacatcttca ccctggaaac cgaacgtatc cagatcccgg acgttctgaa aatcctggct 840
gaagaaggta tcatgtctgt ttacgttgaa ggtggttctg ctgttcacgg ttctttcgtt 900
aaagaaggtt gcttccagga aatcatcttc tacttcgctc cgaaactgat cggtggtacc 960
cacgctccgt ctctgatctc tggtgaaggt ttccagtcta tgaaagacgt tccgctgctg 1020
caattcaccg acatcaccca gatcggtcgt gacatcaaac tgaccgctaa accgaccaaa 1080
gaataa 1086
<210> 3
<211> 648
<212> DNA
<213>It is artificial synthesized
<400> 3
atgttcaccg gtatcatcga agaaaccggt accatcgaat ctatgaaaaa agctggtcac 60
gctatggctc tgaccatcaa atgctctaaa atcctggaag acgttcacct gggtgactct 120
atcgctgtta acggtatctg cctgaccgtt accgacttca ccaaaaacca gttcaccgtt 180
gacgttatgc cggaaaccgt taaagctacc tctctgaacg acctgaccaa aggttctaaa 240
gttaacctgg aacgtgctat ggctgctaac ggtcgtttcg gtggtcactt cgtttctggt 300
cacgttgacg gtaccgctga aatcacccgt atcgaagaaa aatctaacgc tgtttactac 360
gacctgaaaa tggacccgtc tctgaccaaa accctggttc tgaaaggttc tatcaccgtt 420
gacggtgttt ctctgaccat cttcggtctg accgaagaca ccgttaccat ctctctgatc 480
ccgcacacca tctctgaaac catcttctct gaaaaaacca tcggttctaa agttaacatc 540
gaatgcgaca tgatcggtaa atacatgtac cgtttcctgc acaaagctaa cgaaaacaaa 600
acccagcaga ccatcaccaa agctttcctg tctgaaaacg gtttctaa 648
<210> 4
<211> 465
<212> DNA
<213>It is artificial synthesized
<400> 4
atgaacatca tccagggtaa cctggttggt accggtctga aaatcggtat cgttgttggt 60
cgtttcaacg acttcatcac ctctaaactg ctgtctggtg ctgaagacgc tctgctgcgt 120
cacggtgttg acaccaacga catcgacgtt gcttgggttc cgggtgcttt cgaaatcccg 180
ttcgctgcta aaaaaatggc tgaaaccaaa aaatacgacg ctatcatcac cctgggtacc 240
gttatccgtg gtgctaccac ccactacgac tacgtttgca acgaagctgc taaaggtatc 300
gctcaggctg ctaacaccac cggtgttccg gttatcttcg gtatcgttac caccgaaaac 360
atcgaacagg ctatcgaacg tgctggtacc aaagctggta acaaaggtgt tgactgcgct 420
gtttctgcta tcgaaatggc taacctgaac cgttctttcg aataa 465
<210> 5
<211> 55
<212> DNA
<213>It is artificial synthesized
<400> 5
aattgtgagc ggataacaat tgacattgtg agcggataac aagatactga gcaca 55
<210> 6
<211> 951
<212> DNA
<213>It is artificial synthesized
<400> 6
gtgaaaacca tccacatcac ccacccgcac cacctgatca aagaagaaca ggctaaatct 60
gttatggctc tgggttactt cgacggtgtt cacctgggtc accagaaagt tatcggtacc 120
gctaaacaga tcgctgaaga aaaaggtctg accctggctg ttatgacctt ccacccgcac 180
ccgtctcacg ttctgggtcg tgacaaagaa ccgaaagacc tgatcacccc gctggaagac 240
aaaatcaacc agatcgaaca gctgggtacc gaagttctgt acgttgttaa attcaacgaa 300
gttttcgctt ctctgtctcc gaaacagttc atcgaccagt acatcatcgg tctgaacgtt 360
cagcacgctg ttgctggttt cgacttcacc tacggtaaat acggtaaagg taccatgaaa 420
accatgccgg acgacctgga cggtaaagct ggttgcacca tggttgaaaa actgaccgaa 480
caggacaaaa aaatctcttc ttcttacatc cgtaccgctc tgcaaaacgg tgacgttgaa 540
ctggctaacg ttctgctggg tcagccgtac ttcatcaaag gtatcgttat ccacggtgac 600
aaacgtggtc gtaccatcgg tttcccgacc gctaacgttg gtctgaacaa ctcttacatc 660
gttccgccga ccggtgttta cgctgttaaa gctgaagtta acggtgaagt ttacaacggt 720
gtttgcaaca tcggttacaa accgaccttc tacgaaaaac gtccggaaca gccgtctatc 780
gaagttaacc tgttcgactt caaccaggaa gtttacggtg ctgctatcaa aatcgaatgg 840
tacaaacgta tccgttctga acgtaaattc aacggtatca aagaactgac cgaacagatc 900
gaaaaagaca aacaggaagc tatccgttac ttctctaacc tgcgtaaata a 951
<210> 7
<211> 1359
<212> DNA
<213>It is artificial synthesized
<400> 7
atgaaagacc gtcacggtct gctgtctgct ccgatcggtc gtgttctgct gaacatgtct 60
ctgccgaacc tgatcggtat catgaccatc ctgggtttct ctctggctga caccttcttc 120
atctctcagc tgggtaccga agctctggct gctatctctt tcaccttccc ggttaccctg 180
atcatctctt ctatcgctat cggtgttggt gctggtgttt ctaccaacct gggtcgtctg 240
atcggttctg gtaacgctcc gcaggctaaa gttttcctgc acgacgctct gctgctgacc 300
ttcatcctga tcgcttctct gtctgctctg ggttctatct tcatcgaacc gctgttctct 360
ctgctgggtg ctaacgaaac ctctctgccg ctgatccacg actacatgat gtactggtac 420
gttggtgctc cgctgctggt tctgctgatg gttggtaacc agggtctgcg ttctaccggt 480
gacacccgtt ctccggctat gatcatgacc ctggctgcta tcatcaacct gatcctggac 540
ccgctgctga tcttcggtat cggtccgttc ccgcgtctgg aaatccaggg tgctgctatc 600
gctaccctgt tctcttggct ggttgctctg tctctgtctg gttacctgct gatcatcaaa 660
caccgtatgc tggaacgtgc tgctttcgac atcgaccgta tgcgtgctaa ctggtctaaa 720
ctggctcaca tcgctcagcc ggctgctctg atgaacctga tcaacccgct ggctaacgct 780
gttatcatgg ctatgctggc tcacatcgac cactctgctg ttgctgcttt cggtgctggt 840
acccgtctgg aatctgttct gctgatcgtt gttatggctc tgtcttcttc tctgatgccg 900
ttcatcgctc agaacctggg tgctggtcag ccgcagcgtg ctaaacaggc tctgctgctg 960
tctctgaaat tcatcctggt tttccagacc ctgctgtaca tcccgctggc tttcttcgct 1020
cagccgctgg cttctctgtt ctctaccgac ccgcaggttc tggaatggct gtctttctac 1080
atcctggttc tgccgtgcgc ttacggtccg ctgggtatcg ttatcatctt cgctaccgct 1140
ctgaacgctt accaccgtcc gatgtcttct ctggttatca acctgtgccg tctggttctg 1200
ctgatgctgc cgctggctgc tctgggttct tacatcgacg gtgttaaagg tctgctgctg 1260
gctctgccga tcaccaacct gctgatgggt atcgcttgct actacctggc tcagcgtatc 1320
tgcgaaccgg ttaaagctac caccgctgac accctgtaa 1359
<210> 8
<211> 1710
<212> DNA
<213>It is artificial synthesized
<400> 8
atgaccaaca tgctgatcaa aggtctgatc gctaccgctg ttctgaccgc tctggctggt 60
tgcaactctg acgacgacaa agttccgacc acctgcgctg aagctggtgc tgcttgcaaa 120
accttcacca tcctgcacac caacgacaac cacggtcgtt tctgggaaaa caaagacggt 180
gaatacggtc tggctgctca gaaaaccctg gttgaccaga tccgtgctga agtttctaaa 240
aaaggtggtc agaccctgct gctgtctggt ggtgacatca acaccggtgt tccggaatct 300
gacctgcaag acgctatccc ggacttcacc ggtatgaaca aaatcggtta cgacgctatg 360
gctgttggta accacgaatt tgacaacccg ctgtctgttg ttgacatgca gcgttctctg 420
gctgaatttc cgatgctggc tgctaacatc tacaaagctg acggtacccg ttacttcgac 480
gcttacaaaa tcttcgacgt taacggtgtt aaaatcgctg ttatcggtct gaccaccgaa 540
gacaccgcta aaatcggtaa cccggaatac atctctgaac tggaatttcg tgacccgaaa 600
aaagaagttg ctaacgttat caaagaaatc aaagaagcta aatctgctga catcatcttc 660
gctgttaccc acatgggtca ctacgctgac ggtcagaacg gttctaacgc tccgggtgac 720
gttgctctgg ctcgttctct gaaagaaggt gacctgcaag ttgttatcgg tggtcactct 780
cagaacccgg tttgcatgga accgggtaac aaagcttacg ctgctttcaa accgggtgac 840
gcttgcgctc cggaccagca gaacggtacc tggatcatgc aggctcacga atggggtaaa 900
tacgttggtc gtgctgactt cgaatacttc aacggtgaac tgcacctggc ttcttacaaa 960
ctggttccgg ttaacctggt taaagaagtt accgacgaag ctggtaacaa aaaaaaagtt 1020
ctggttggtg aaaaaatcga accggacacc gaactgaaag aactgctgtc ttactaccag 1080
gaaaaaggtc aggctaaact ggacgaagtt atcgctacca ccgacgctct gctggacggt 1140
gaacgtgcta acgttcgtaa caaacagacc aacctgggtc gtatgctggc tatggctcag 1200
tctggtaaag tttctgctga cttcggtgtt atgaactctg gtggtgttcg tgcttctatc 1260
aaagctggta acatcaccta ccgtgacgtt ctgaccgttc agccgttcgg taacatggtt 1320
accctgaacg aaatgaccgg tgctgctgct gctgactacc tgggtgctgt tggttctctg 1380
caaatcggtt ctggtggtta cgctcagatc accggtgtta aaatgaccgt tgactgcgtt 1440
gctaaaaaag ctaccgttca cgaaatcaac ggtaaagctt tctctgctac cgctacctac 1500
aaattcaccg ttccgtcttt caacgctgct ggtggtgacg gttacccgaa actggtttct 1560
ccgatccaga ccggttacgt tgacgctgac ctgctgtaca ccttcctgaa agaaaaacag 1620
tctatcgttg ctgctgacta caacccggtt ggtgacatcg tttacgaaaa ctctgactct 1680
gttgaaggtt gcaaaatcac cgctaaataa 1710
<210> 9
<211> 54
<212> DNA
<213>It is artificial synthesized
<400> 9
tccctatcag tgatagagat tgacatccct atcagtgata gagatactga gcac 54

Claims (10)

1. a kind of method of the engineered strain of structure production flavin mononucleotide, which is characterized in that the specific steps of this method include:
(1) in riboflavin fermentation bacterium, the bifunctional enzyme base that flavokinase/flavin adenine dinucleotide (FAD) generates enzyme is introduced Flavokinase/flavin adenine dinucleotide (FAD) of cause, generation generates enzyme, converts cell endocrocin pond component to from riboflavin Flavin adenine dinucleotide (FAD)；
(2) in the riboflavin fermentation bacterium with bifunctional enzyme that step (1) obtains, flavin adenine dinucleotide (FAD) inner membrance is introduced Transporter gene, the flavin adenine dinucleotide (FAD) membrane transport albumen of generation is by intracellular flavin adenine dinucleotide (FAD) It is transported to cell membrane interstitial；
(3) it in the riboflavin fermentation bacterium with flavin adenine dinucleotide (FAD) membrane transport albumen that step (2) obtains, introduces 5'-nucleotidase gene, the 5'-nucleotidase of generation, by the flavin adenine dinucleotide (FAD) cracking and catalyzing of cell membrane interstitial For flavin mononucleotide.
2. the method as described in claim 1, which is characterized in that the structure of the riboflavin fermentation bacterium is as follows：In host cell The genetic fragment of riboflavin synthetic proteins RibA, RibD, RibE, RibH of the interior hay bacillus for introducing codon optimization, And by constitutive promoter or inducible promoter control expression.
3. method as claimed in claim 2, which is characterized in that the core of the genetic fragment of described RibA, RibD, RibE, RibH Nucleotide sequence is as shown in SEQ ID No.1,2,3,4.
4. method as claimed in claim 2, which is characterized in that the nucleotide sequence of the inducible promoter such as SEQ ID Shown in No.5.
5. method as claimed in claim 2, which is characterized in that the host cell be selected from Escherichia coli, bacillus subtilis, Brevibacterium ammoniagene, Pseudomonas fluorescens, Ashbya gossypii, E. ashbyii, Pichia guilliermondii or Candida famate Any one of.
6. the method as described in claim 1, which is characterized in that the flavokinase/flavin adenine dinucleotide (FAD) generates Enzyme gene comes from the ribC genes of bacillus subtilis, and the nucleotide sequence of the ribC genes is as shown in SEQ ID No.6.
7. the method as described in claim 1, which is characterized in that the flavin adenine dinucleotide (FAD) membrane transport albumen base Because coming from flavin adenine dinucleotide (FAD) the membrane transport enzyme gene SO_0702, nucleotide sequence such as SEQ of Shewanella Shown in ID No.7, the 5'-nucleotidase gene source is in the ushA genes of Shewanella, nucleotide sequence such as SEQ Shown in ID No.8.
8. the method for claim 7, which is characterized in that control the flavin adenine dinucleotide (FAD) membrane transport albumen The promoter sequence of the expression of gene and 5'-nucleotidase gene such as SEQ ID No.9.
9. a kind of method of riboflavin biosynthesis mononucleotide, the production that the method constructs such as claim 1-8 either method is yellow The engineered strain of plain mononucleotide carries out fermented and cultured under aerobic conditions, produces riboflavin mononucleotide.
10. a kind of fermentation medium, which is characterized in that the fermentation medium is used for such as any the methods of claim 1-8 The engineered strain riboflavin biosynthesis mononucleotide of the production flavin mononucleotide of construction, formula are to contain 12g in every liter of solution Na2HPO4、6g KH2PO4、0.5g NaCl、1g NH4Cl、0.24g MgSO4、11.1mg CaCl2, 2g urea, 15g xyloses, 10mL vitamin solutions, 10mL trace element solutions, 1g casein hydrolysates, 50mg kanamycins, 34mg chloramphenicol, 2.4mg Isopropylthiogalactoside, 4.6 μ g anhydrotetracyclines；Wherein, the formula of the trace element solution is to contain in every liter of solution There are 1.5g nitrilotriacetic acid, 0.1g MnCl2·4H2O、0.3g FeSO4·7H2O、0.17g CoCl2·6H2O、0.1g ZnCl2、0.04g CuSO4·5H2O、0.005gAlK(SO4)2·12H2O、0.005g H3BO3、0.09g Na2MoO4、0.12g NiCl2；The formula of the vitamin solution is in every liter of solution containing 0.002g biotins, 0.002g folic acid, 0.02g pyridoxines Hydrochloride, 0.005g thiamines, 0.005g niacin, 0.005g pantothenic acid, 0.0001g vitamin B12s, 0.005g p-aminophenyl first Acid, 0.005g lipoic acids.
CN201710310871.7A 2017-05-05 2017-05-05 A kind of method and its application of the engineered strain of structure production flavin mononucleotide Pending CN108330136A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710310871.7A CN108330136A (en) 2017-05-05 2017-05-05 A kind of method and its application of the engineered strain of structure production flavin mononucleotide

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710310871.7A CN108330136A (en) 2017-05-05 2017-05-05 A kind of method and its application of the engineered strain of structure production flavin mononucleotide

Publications (1)

Publication Number Publication Date
CN108330136A true CN108330136A (en) 2018-07-27

Family

ID=62923015

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710310871.7A Pending CN108330136A (en) 2017-05-05 2017-05-05 A kind of method and its application of the engineered strain of structure production flavin mononucleotide

Country Status (1)

Country Link
CN (1) CN108330136A (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110702762A (en) * 2019-10-25 2020-01-17 中国科学技术大学 Application of tungsten trioxide as biological electron medium in nano probe detection solution
CN113151378A (en) * 2021-04-13 2021-07-23 百瑞全球有限公司 Method for preparing nucleoside, nicotinic acid adenine dinucleotide and nicotinic acid mononucleotide of nicotinic acid or derivative thereof, enzyme composition and application
CN114591999A (en) * 2020-12-03 2022-06-07 上海市农业科学院 Application and method for increasing VB2 content in rice with RibAS, RibBS, RibGS and RibHS genes
CN114990087A (en) * 2022-04-29 2022-09-02 西北工业大学 Immobilized FAD synthetase and method for preparing flavin adenine dinucleotide through catalysis
CN116463305A (en) * 2023-06-15 2023-07-21 北京易醒生物科技有限公司 Method for improving expression level of alcohol oxidase for ethanol oxidation and optimized riboflavin biosynthesis gene

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103757000A (en) * 2008-11-07 2014-04-30 帝斯曼知识产权资产管理有限公司 Improved production of riboflavin

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103757000A (en) * 2008-11-07 2014-04-30 帝斯曼知识产权资产管理有限公司 Improved production of riboflavin

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
ELIZABETH D. COVINGTO等: "An essential role for UshA in processing of extracellular flavin electron shuttles by Shewanella oneidensis", 《MOLECULAR MICROBIOLOGY》 *
NICHOLAS J. KOTLOSKI等: "Flavin Electron Shuttles Dominate Extracellular Electron Transfer by Shewanella oneidensis", 《MICROBIOLOGY》 *
宋辉: "ribR基因在枯草芽胞杆菌中表达的研究", 《万方数据知识服务平台》 *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110702762A (en) * 2019-10-25 2020-01-17 中国科学技术大学 Application of tungsten trioxide as biological electron medium in nano probe detection solution
CN114591999A (en) * 2020-12-03 2022-06-07 上海市农业科学院 Application and method for increasing VB2 content in rice with RibAS, RibBS, RibGS and RibHS genes
CN113151378A (en) * 2021-04-13 2021-07-23 百瑞全球有限公司 Method for preparing nucleoside, nicotinic acid adenine dinucleotide and nicotinic acid mononucleotide of nicotinic acid or derivative thereof, enzyme composition and application
WO2022217696A1 (en) * 2021-04-13 2022-10-20 百瑞全球有限公司 Method for preparing nucleoside of nicotinic acid or derivative thereof, nicotinate adenine dinucleotide, and nicotinic acid mononucleotide, enzyme composition, and application
CN113151378B (en) * 2021-04-13 2023-06-06 百瑞全球有限公司 Method for preparing nucleoside, nicotinic acid adenine dinucleotide and nicotinic acid mononucleotide of nicotinic acid or derivative thereof, enzyme composition and application
CN114990087A (en) * 2022-04-29 2022-09-02 西北工业大学 Immobilized FAD synthetase and method for preparing flavin adenine dinucleotide through catalysis
CN114990087B (en) * 2022-04-29 2024-03-12 陕西永磊生物科技有限公司 Immobilized FAD synthetase and method for preparing flavin adenine dinucleotide by catalysis
CN116463305A (en) * 2023-06-15 2023-07-21 北京易醒生物科技有限公司 Method for improving expression level of alcohol oxidase for ethanol oxidation and optimized riboflavin biosynthesis gene
CN116463305B (en) * 2023-06-15 2023-10-17 北京易醒生物科技有限公司 Method for improving expression level of alcohol oxidase for ethanol oxidation and optimized riboflavin biosynthesis gene

Similar Documents

Publication Publication Date Title
CN108330136A (en) A kind of method and its application of the engineered strain of structure production flavin mononucleotide
Liang et al. Synechocystis PCC 6803 overexpressing RuBisCO grow faster with increased photosynthesis
US8846369B2 (en) Cyanobacterium sp. host cell and vector for production of chemical compounds in cyanobacterial cultures
US10570424B2 (en) Recombinant methanotrophic bacterium and a method of production of succinic acid from methane or biogas thereof
CN105112436B (en) A kind of full biological synthesis method of adipic acid
CN107686850B (en) Method for producing alpha-ketoglutaric acid by converting co-expression recombinant strain
CN105441497A (en) Method for coupled production of cadaverine by using microbial fermentation and microbial conversion
CA1187011A (en) Method for making genetically modified micro- organisms
Meng et al. Enhancement of heterologous protein production in Corynebacterium glutamicum via atmospheric and room temperature plasma mutagenesis and high-throughput screening
CN114672525B (en) Biosynthesis method and application of N-acetyl-5-methoxy tryptamine
CN112646830A (en) Universal plasmid and construction method thereof and novel method for synechocystis to express exogenous gene
US20160168598A1 (en) Genetically modified organisms
CN103966249B (en) A kind of carrier and application thereof for building without screening label cyanobacteria
KR102473375B1 (en) Recombinant microorganisms, their preparation methods and their use in the production of coenzyme Q10
JP2019524076A (en) Cells and methods for producing hydroxytyrosol
JP6991897B2 (en) Nucleic acids and vectors for controlling gene expression in non-phototrophic C1 metabolizing microorganisms, and transformants thereof
CN116286931A (en) Double-plasmid system for rapid gene editing of Ralstonia eutropha and application thereof
CN115806926A (en) Genetically engineered strain for producing pseudouridine and construction method and application thereof
CN114806991A (en) Engineering escherichia coli for improving yield of fucosyllactose and production method
CN113930376A (en) Engineering bacterium for catalytic production of D-p-hydroxyphenylglycine, high-density culture method and catalytic production method
CN101633690B (en) Hydrogen production associated protein, coding genes thereof and application thereof
CN105209597A (en) Genetically modified bacteria
JP6778870B2 (en) Cyanobacteria mutant strain and succinic acid and D-lactic acid production method using it
CN110066821B (en) Method for constructing random protein expression library based on random expression element multiplication mode
CN104371964A (en) Strain capable of improving performance of recombinant protein under aerobic condition

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
AD01 Patent right deemed abandoned

Effective date of abandoning: 20211221

AD01 Patent right deemed abandoned