WO2022217696A1

WO2022217696A1 - Method for preparing nucleoside of nicotinic acid or derivative thereof, nicotinate adenine dinucleotide, and nicotinic acid mononucleotide, enzyme composition, and application

Info

Publication number: WO2022217696A1
Application number: PCT/CN2021/094855
Authority: WO
Inventors: 潘永强; 卢锦春; 王骏
Original assignee: 百瑞全球有限公司; 潘永强
Priority date: 2021-04-13
Filing date: 2021-05-20
Publication date: 2022-10-20
Also published as: CN113151378A; CN113151378B

Abstract

A method for preparing nucleoside of nicotinic acid or a derivative thereof, nicotinate adenine dinucleotide, and nicotinic acid mononucleotide, an enzyme composition, and an application. The method for preparing nucleoside of nicotinic acid or a derivative thereof comprises: using 5'-nucleotidase to react with mononucleotide or a salt thereof of nicotinic acid or a derivative thereof as a substrate, wherein the amino acid sequence of the 5'-nucleotidase is as shown in SEQ ID NO. 1. The method is safer and more reliable than a chemical synthesis process, and since use of an organic solvent can be avoided, the method is more environment-friendly. Nicotinamide nucleoside can be more efficiently produced to cope with increasing demands.

Description

Method, enzyme composition and application for preparing nucleoside, nicotinic acid adenine dinucleotide and nicotinic acid mononucleotide of nicotinic acid or its derivatives

technical field

The invention belongs to the field of biomedicine, and in particular relates to a method, an enzyme composition and an application for preparing nucleosides, nicotinic acid adenine dinucleotide and nicotinic acid mononucleotide of nicotinic acid or its derivatives.

Background technique

With the development of science and technology in recent years, the scientific community has made major breakthroughs in pathology, genetics and other disciplines, and developed various treatment plans for the "terminal diseases" considered by the public in the last century, such as cancer and AIDS, thus effectively prolonging the life of the patient. life expectancy, improved quality of life and even full recovery. As a result, the public's perception of such "terminal illnesses" has changed over the years, and they are no longer seen as the yoke of death, and the hope of life for patients and their families has been rekindled. At the same time, the scientific community has gained a deeper understanding of life sciences, understanding the causes of human aging in the fields of cellular signaling and epigenetics. Scientists believe that human aging can be delayed and the impact of aging on the body can be reduced. Some of them put forward the theory that aging is just a disease of the human body rather than an inevitable natural phenomenon: aging can be solved through newly developed solutions, just like some years ago. The so-called "terminal illness" has now been treated with countermeasures and numerous successful cases. Numerous scientific literature and multiple studies have suggested that levels of nicotinamide adenine dinucleotide are important substances for slowing aging and improving bodily functions. Nicotinamide adenine dinucleotide is involved in many biochemical functions of metabolism and oxygen molecule transfer in the body, and is important for maintaining the normal functioning of cells and organs. However, many studies have reported that levels of nicotinamide adenine dinucleotide found in mice and humans decrease with age, leading to various diseases.

As the application research of nicotinamide adenine dinucleotide matures, the use of nicotinamide adenine dinucleotide supplements has received extensive attention and recognition in recent years. Nicotinamide riboside is the precursor of nicotinamide mononucleotide, which was discovered and extracted from milk in the early years. It is the first generation substance used to increase the level of nicotinamide adenine dinucleotide in the body.

At present, the industrial production of nicotinamide riboside mainly relies on pure chemical processes, using tetraacetyl ribose as the initial substrate and chemical synthesis using organic solvents such as acetonitrile, methanol and tributylamine. With the increase of research on nicotinamide adenine dinucleotide at home and abroad in recent years, especially the breakthrough progress made in its basic function research, it has been confirmed that maintaining the in vivo level of nicotinamide adenine dinucleotide is essential for health and anti-aging is essential. As a result, the public's demand for nicotinamide riboside has gradually increased, but the current production process is too focused on a single material as the raw material, especially when the normal supply of tetraacetyl ribose is bound to affect the production of nicotinamide riboside. The inability to maintain the normal supply and stable price of nicotinamide riboside will have a certain impact on the public demand for nicotinamide adenine dinucleotide. Furthermore, the production process of nicotinamide riboside is a chemical process, and a large number of different organic solvents need to be used in the production process, which will have a serious impact on the environment. In the foreseeable future, with the increase in demand for nicotinamide riboside, increasing production capacity will also cause increasing environmental pressure on production areas.

SUMMARY OF THE INVENTION

In order to solve the problems existing in the above-mentioned prior art, the present invention develops a method for producing nicotinamide riboside by a whole biological enzyme method, and specifically, provides a riboside for preparing nicotinic acid or its derivatives, nicotinic acid adenosine. Methods, enzyme compositions and uses of purine dinucleotides, nicotinic acid mononucleotides.

Specifically, the present invention provides:

(1) A method for preparing a nucleoside of nicotinic acid or a derivative thereof, comprising using a 5'-nucleotidase to react with a mononucleotide of nicotinic acid or a derivative thereof or a salt thereof as a substrate, wherein the The amino acid sequence of the 5'-nucleotidase is shown in SEQ ID NO.1.

(2) The method according to (1), wherein the riboside of nicotinic acid or a derivative thereof is selected from at least one of nicotinamide riboside and nicotinic acid riboside; wherein the nicotinamide riboside comprises an oxidized Alpha-nicotinamide riboside, oxidized beta-nicotinamide riboside, reduced alpha-nicotinamide riboside and reduced beta-nicotinamide riboside, including oxidized alpha-nicotinamide riboside , oxidized β-nicotinic acid riboside, reduced α-nicotinic acid riboside and reduced β-nicotinic acid riboside.

(3) The method according to (1), wherein the mononucleotide of nicotinic acid or a derivative thereof is selected from at least one of nicotinamide mononucleotide and nicotinic acid mononucleotide; wherein the Nicotinamide mononucleotide includes oxidized alpha-nicotinamide mononucleotide, oxidized beta-nicotinamide mononucleotide, reduced alpha-nicotinamide mononucleotide and reduced beta-nicotinamide mononucleotide , the nicotinic acid mononucleotide includes oxidized alpha-nicotinic acid mononucleotide, oxidized beta-nicotinic acid mononucleotide, reduced alpha-nicotinic acid mononucleotide and reduced beta-nicotinic acid mononucleotide Nucleotides.

(4) The method according to (1), wherein the method further comprises using nicotinamide adenine dinucleotide diphosphatase with adenine dinucleotide of nicotinic acid or a derivative thereof or a salt thereof as a substrate Carry out a reaction, wherein the amino acid sequence of the nicotinamide adenine dinucleotide diphosphatase is shown in SEQ ID NO.2.

(5) The method according to (4), wherein the adenine dinucleotide of nicotinic acid or a derivative thereof is selected from at least the group consisting of nicotinamide adenine dinucleotide and nicotinic acid adenine dinucleotide One; wherein the nicotinamide adenine dinucleotide includes oxidized α-nicotinamide adenine dinucleotide, oxidized β-nicotinamide adenine dinucleotide, and reduced α-nicotinamide adenine dinucleotide Nucleotides and reduced β-nicotinamide adenine dinucleotides, the nicotinic acid adenine dinucleotides including oxidized α-nicotinic acid adenine dinucleotides, oxidized β-nicotinic acid adenine dinucleotides Nucleotides, reduced alpha-nicotinic adenine dinucleotide, and reduced beta-nicotinic adenine dinucleotide.

(6) The method according to (4), wherein the method further comprises performing nicotinamide adenine dinucleotide kinase with adenine dinucleotide phosphate of nicotinic acid or a derivative thereof or a salt thereof as a substrate reaction, wherein the amino acid sequence of the nicotinamide adenine dinucleotide kinase is shown in SEQ ID NO.3.

(7) The method according to (6), wherein the adenine dinucleotide phosphate of nicotinic acid or a derivative thereof is selected from the group consisting of nicotinamide adenine dinucleotide phosphate and nicotinic acid adenine dinucleotide phosphate At least one of; wherein the nicotinamide adenine dinucleotide phosphate includes oxidized alpha-nicotinamide adenine dinucleotide phosphate, oxidized beta-nicotinamide adenine dinucleotide phosphate, reduced alpha -Nicotinamide adenine dinucleotide phosphate and reduced beta-nicotinamide adenine dinucleotide phosphate, said nicotinamide adenine dinucleotide phosphate including oxidized alpha-nicotinamide adenine dinucleotide phosphate , oxidized β-nicotinic acid adenine dinucleotide phosphate, reduced α-nicotinic acid adenine dinucleotide phosphate and reduced β-nicotinic acid adenine dinucleotide phosphate.

(8) The method according to (1), comprising combining nicotinamide adenine dinucleotide kinase, nicotinamide adenine dinucleotide diphosphatase and 5'-nucleotidase with nicotinamide adenine dinucleotide The phosphoric acid or its salt is mixed, and the reaction is carried out for 1.5-8 hours, wherein the amino acid sequences of the nicotinamide adenine dinucleotide kinase and the nicotinamide adenine dinucleotide diphosphatase are respectively as SEQ ID NO.3 and SEQ ID NO.2.

(9) The method according to (1), comprising mixing nicotinamide adenine dinucleotide diphosphatase and 5'-nucleotidase with nicotinamide adenine dinucleotide or a salt thereof, and allowing the reaction to proceed 1.5-8 hours, wherein the amino acid sequence of the nicotinamide adenine dinucleotide diphosphatase is shown in SEQ ID NO.2.

(10) The method according to (1), comprising the following steps:

1) Mixing nicotinamide adenine dinucleotide kinase with nicotinamide adenine dinucleotide phosphate or its salt, and making it react to produce nicotinamide adenine dinucleotide or its salt;

2) When the amount of the nicotinamide adenine dinucleotide phosphate or its salt drops below 20-100% of the initial reaction in step 1), the nicotinamide adenine dinucleotide or Its salt is mixed with nicotinamide adenine dinucleotide diphosphatase to react to produce nicotinamide mononucleotide or its salt;

3) When the amount of the nicotinamide adenine dinucleotide or its salt drops to below 10-100% of the initial reaction in step 2), mix the nicotinamide mononucleotide or its salt with 5'-nucleotidase is mixed to react to produce nicotinamide riboside;

Wherein the amino acid sequences of nicotinamide adenine dinucleotide kinase and nicotinamide adenine dinucleotide diphosphatase are shown in SEQ ID NO.3 and SEQ ID NO.2 respectively.

(11) The method according to (1), comprising the following steps:

1) mixing nicotinamide adenine dinucleotide or its salt with nicotinamide adenine dinucleotide diphosphatase, and making it react to produce nicotinamide mononucleotide or its salt;

II) When the amount of the nicotinamide adenine dinucleotide or its salt drops below 10-100% of the initial reaction of the step I), mixing the nicotinamide mononucleotide or its salt with 5'-nucleotidase is mixed to react to produce nicotinamide riboside;

Wherein the amino acid sequence of the nicotinamide adenine dinucleotide diphosphatase is shown in SEQ ID NO.2.

(12) The method according to any one of (3), (10) and (11), wherein the weight ratio of the 5'-nucleotidase to the nicotinamide mononucleotide or a salt thereof is (0.01-10): 1.

(13) The method according to any one of (5), (10), (11), wherein the nicotinamide adenine dinucleotide diphosphatase and the nicotinamide adenine dinucleotide or The weight ratio of its salt is (0.01-10):1.

(14) The method according to (7) or (10), wherein the weight ratio of the nicotinamide adenine dinucleotide kinase and the nicotinamide adenine dinucleotide phosphate or a salt thereof is (0.01- 10):1.

(15) Use of nicotinamide adenine dinucleotide kinase, nicotinamide adenine dinucleotide diphosphatase and/or 5'-nucleotidase in the preparation of nucleosides of nicotinic acid or derivatives thereof, wherein The amino acid sequences of the nicotinamide adenine dinucleotide kinase, the nicotinamide adenine dinucleotide diphosphatase and the 5'-nucleotidase are respectively as SEQ ID NO.3, SEQ ID NO. 2 and SEQ ID NO.1.

(16) The use according to (15), wherein the riboside of nicotinic acid or a derivative thereof is selected from at least one of nicotinamide riboside and nicotinic acid riboside; wherein the nicotinamide riboside comprises an oxidized Alpha-nicotinamide riboside, oxidized beta-nicotinamide riboside, reduced alpha-nicotinamide riboside and reduced beta-nicotinamide riboside, including oxidized alpha-nicotinamide riboside , oxidized β-nicotinic acid riboside, reduced α-nicotinic acid riboside and reduced β-nicotinic acid riboside.

(17) An enzyme composition comprising:

Nicotinamide adenine dinucleotide kinase, nicotinamide adenine dinucleotide diphosphatase and 5'-nucleotidase, wherein the molar ratio of the three enzymes is (0.01-2):(0.01-2 ):(0.01-1); or

Nicotinamide adenine dinucleotide diphosphatase and 5'-nucleotidase, wherein the molar ratio of the two enzymes is (0.01-9):(0.01-9); and

Wherein the amino acid sequences of the nicotinamide adenine dinucleotide kinase, the nicotinamide adenine dinucleotide diphosphatase and the 5'-nucleotidase are as shown in SEQ ID NO.3 and SEQ ID NO, respectively. .2 and SEQ ID NO.1.

(18) Use of the enzyme composition according to (17) in the preparation of nucleosides of nicotinic acid or derivatives thereof.

(19) The use according to (18), wherein the riboside of nicotinic acid or a derivative thereof is selected from at least one of nicotinamide riboside and nicotinic acid riboside; wherein the nicotinamide riboside comprises an oxidized Alpha-nicotinamide riboside, oxidized beta-nicotinamide riboside, reduced alpha-nicotinamide riboside and reduced beta-nicotinamide riboside, including oxidized alpha-nicotinamide riboside , oxidized β-nicotinic acid riboside, reduced α-nicotinic acid riboside and reduced β-nicotinic acid riboside.

(20) The method according to (1), comprising combining nicotinamide adenine dinucleotide kinase, nicotinamide adenine dinucleotide diphosphatase and 5'-nucleotidase with nicotinic acid adenine dinucleotide The phosphoric acid or its salt is mixed, and the reaction is carried out for 1.5-8 hours, wherein the amino acid sequences of the nicotinamide adenine dinucleotide kinase and the nicotinamide adenine dinucleotide diphosphatase are respectively as SEQ ID NO.3 and SEQ ID NO.2.

(21) The method according to (1), comprising mixing nicotinamide adenine dinucleotide diphosphatase and 5'-nucleotidase with nicotinic acid adenine dinucleotide or a salt thereof, and allowing the reaction to proceed 1.5-8 hours, wherein the amino acid sequence of the nicotinamide adenine dinucleotide diphosphatase is shown in SEQ ID NO.2.

(22) method according to (1), comprises the following steps:

1) mixing nicotinamide adenine dinucleotide kinase with nicotinic acid adenine dinucleotide phosphate or its salt, and making it react to produce nicotinic acid adenine dinucleotide or its salt;

2) When the amount of the nicotinic acid adenine dinucleotide phosphate or its salt drops to below 30-100% of the initial reaction in step 1), the nicotinic acid adenine dinucleotide or Its salt is mixed with nicotinamide adenine dinucleotide diphosphatase to react to produce nicotinic acid mononucleotide or its salt;

3) When the amount of the nicotinic acid adenine dinucleotide or its salt drops to below 20-100% of the initial reaction in step 2), mix the nicotinic acid mononucleotide or its salt with 5'-nucleotidase is mixed to react to produce nicotinic acid riboside;

(23) The method according to (1), comprising the following steps:

1) mixing nicotinic acid adenine dinucleotide or its salt with nicotinamide adenine dinucleotide diphosphatase, and making it react to produce nicotinic acid mononucleotide or its salt;

II) When the amount of the nicotinic acid adenine dinucleotide or its salt drops below 20-100% of the initial reaction of the step I), mixing the nicotinic acid mononucleotide or its salt with 5'-nucleotidase is mixed to react to produce nicotinic acid riboside;

(24) The method according to any one of (3), (22), and (23), wherein the weight ratio of the 5'-nucleotidase to the nicotinic acid mononucleotide or a salt thereof is (0.01-10): 1.

(25) The method according to any one of (5), (22), (23), wherein the nicotinamide adenine dinucleotide diphosphatase and the nicotinic acid adenine dinucleotide or The weight ratio of its salt is (0.01-10):1.

(26) The method according to any one of (7), (22), (23), wherein the nicotinamide adenine dinucleotide kinase and the nicotinic acid adenine dinucleotide phosphate or its The weight ratio of salt is (0.01-10):1.

(27) A method for preparing nicotinic acid adenine dinucleotide by an enzymatic method, comprising using nicotinamide adenine dinucleotide kinase to react with nicotinic acid adenine dinucleotide phosphate or a salt thereof as a substrate, The amino acid sequence of the nicotinamide adenine dinucleotide kinase is shown in SEQ ID NO. 3; wherein the nicotinic acid adenine dinucleotide includes oxidized α-nicotinic acid adenine dinucleotide, oxidized β-Nicotinic acid adenine dinucleotide, reduced α-nicotinic acid adenine dinucleotide and reduced β-nicotinic acid adenine dinucleotide, the niacin adenine dinucleotide phosphates include Oxidized α-nicotinic adenine dinucleotide phosphate, oxidized β-nicotinic adenine dinucleotide phosphate, reduced α-nicotinic adenine dinucleotide phosphate and reduced β-nicotinic adenine phosphate Dinucleotide Phosphate.

(28) The method according to (27), wherein the weight ratio of the nicotinamide adenine dinucleotide kinase and the nicotinic acid adenine dinucleotide phosphate or its salt is (0.01-10):1 .

(29) A method for preparing nicotinic acid mononucleotide by enzymatic method, comprising using nicotinamide adenine dinucleotide diphosphatase to react with nicotinic acid adenine dinucleotide or a salt thereof as a substrate, wherein The amino acid sequence of the nicotinamide adenine dinucleotide diphosphatase is shown in SEQ ID NO.2; wherein the nicotinic acid mononucleotide includes oxidized α-nicotinic acid mononucleotide, oxidized β- Niacin mononucleotide, reduced alpha-nicotinic acid mononucleotide and reduced beta-nicotinic acid mononucleotide, said nicotinic acid adenine dinucleotide including oxidized alpha-nicotinic acid adenine dinucleus Glycosides, oxidized beta-nicotinic adenine dinucleotide, reduced beta-nicotinic adenine dinucleotide, and reduced beta-nicotinic adenine dinucleotide.

(30) The method according to (29), wherein the method further comprises using nicotinamide adenine dinucleotide kinase to react with nicotinamide adenine dinucleotide phosphate or a salt thereof as a substrate, wherein the The amino acid sequence of nicotinamide adenine dinucleotide kinase is shown in SEQ ID NO.3; wherein the nicotinic acid adenine dinucleotide phosphate includes oxidized α-nicotinic acid adenine dinucleotide phosphate, oxidized β-Nicotinic acid adenine dinucleotide phosphate, reduced α-nicotinic acid adenine dinucleotide phosphate, and reduced β-nicotinic acid adenine dinucleotide phosphate.

(31) The method according to (29), comprising mixing nicotinamide adenine dinucleotide kinase and nicotinamide adenine dinucleotide diphosphatase with nicotinamide adenine dinucleotide phosphate or a salt thereof, The reaction is carried out for 1.5-8 hours, wherein the amino acid sequences of the nicotinamide adenine dinucleotide kinase and the nicotinamide adenine dinucleotide diphosphatase are shown in SEQ ID NO.3 and SEQ ID NO.2, respectively .

(32) The method according to (29), comprising the steps of:

2) When the amount of the nicotinic acid adenine dinucleotide phosphate or its salt drops to below 30-100% of the initial reaction in step 1), the nicotinic acid adenine dinucleotide or Its salt is mixed with nicotinamide adenine dinucleotide diphosphatase to react to produce nicotinic acid mononucleotide;

(33) The method according to (29), wherein the weight ratio of the nicotinamide adenine dinucleotide diphosphatase and the nicotinic acid adenine dinucleotide or a salt thereof is (0.01-10): 1.

(34) The method according to (30), wherein the weight ratio of the nicotinamide adenine dinucleotide kinase and the nicotinic acid adenine dinucleotide phosphate or a salt thereof is (0.01-10):1 .

(35) The method according to any one of (1)-(34), wherein each reaction is carried out at 25-40°C, pH 5-10.

(36) The method of any one of (1)-(34), wherein each reaction is carried out in the presence of 0.01 ppm to 100,000 ppm of one or more ions.

(37) The method of (36), wherein the ions include metal ions, chloride ions, carbonate ions, sulfite ions, and phosphorus ions.

(38) The method according to any one of (1) to (34), wherein the nicotinamide adenine dinucleotide kinase, the nicotinamide adenine dinucleotide diphosphatase, and the 5 '-Nucleotidase is obtained by bioengineering and microbial fermentation.

(39) The method according to any one of (1) to (34), wherein the nicotinamide adenine dinucleotide kinase, the nicotinamide adenine dinucleotide diphosphatase, and the 5 '-nucleotidase is provided as immobilized enzyme/cell.

(40) Use of nicotinamide adenine dinucleotide kinase and/or nicotinamide adenine dinucleotide diphosphatase in the preparation of nicotinic acid adenine dinucleotide and nicotinic acid mononucleotide, wherein the The amino acid sequences of nicotinamide adenine dinucleotide kinase, said nicotinamide adenine dinucleotide diphosphatase and said 5'-nucleotidase are respectively as SEQ ID NO.3, SEQ ID NO.2 and SEQ ID NO.1; wherein the nicotinic acid mononucleotide includes oxidized alpha-nicotinic acid mononucleotide, oxidized beta-nicotinic acid mononucleotide, and reduced alpha-nicotinic acid mononucleotide and reduced beta-nicotinic acid mononucleotides, the nicotinic acid adenine dinucleotides include oxidized alpha-nicotinic acid adenine dinucleotides, oxidized beta-nicotinic acid adenine dinucleotides, and Prototype alpha-nicotinic acid adenine dinucleotide and reduced beta-nicotinic acid adenine dinucleotide.

(41) The use of the enzyme composition according to (17) in the preparation of nicotinic acid adenine dinucleotide and nicotinic acid mononucleotide; wherein the nicotinic acid mononucleotide comprises oxidized α-nicotine Acid mononucleotides, oxidized beta-nicotinic acid mononucleotides, reduced alpha-nicotinic acid mononucleotides and reduced beta-nicotinic acid mononucleotides, said nicotinic acid adenine dinucleotides include Oxidized alpha-nicotinic adenine dinucleotide, oxidized beta-nicotinic adenine dinucleotide, reduced alpha-nicotinic adenine dinucleotide, and reduced beta-nicotinic adenine dinucleotide acid.

Compared with the prior art, the present invention has the following advantages and positive effects:

The present invention proposes for the first time the production of riboside (including nicotinamide riboside and nicotinic acid riboside) of nicotinic acid or its derivatives by using a pure biological enzyme method. In the reaction process of the enzyme and the substrate, the reaction can be carried out effectively only by using common ions and an easily controlled physical environment, which is safer and more reliable than the method of chemical synthesis. It is more environmentally friendly as organic solvents can be avoided.

The method of the present invention can utilize different substances (nicotinamide adenine dinucleotide phosphate or its salt, nicotinamide adenine dinucleotide or its salt, and nicotinamide mononucleotide or its salt) as initial reaction substrates It is not a single substance, and the preparation method and conditions do not require major changes due to changes in the substrate. Such a design can not only improve the flexibility of production, but also avoid the impact on production capacity and costs due to fluctuations in the supply of raw materials. The above advantages can facilitate more efficient production of nicotinamide riboside to meet the increasing demand.

In addition to preparing riboside of nicotinic acid or its derivatives (including nicotinamide riboside and nicotinic acid riboside), the method of the present invention can also utilize the enzyme or a combination of the enzyme to prepare niacin with different substrates Adenine dinucleotide and niacin mononucleotide. These substances are all involved in metabolism and protein regulation in the body, and are very important for scientific research, especially epigenetic research.

The preparation method proposed in the present invention takes biological enzyme method as the main process, instead of producing nicotinamide riboside by chemical synthesis method, brings a new direction in the production process in this field, and also brings about problems encountered in industrial production The solution combines the advantages of energy saving, environmental protection and sustainable development at the same time.

Detailed ways

The present invention will be further described below through the description of the specific embodiments, but this is not a limitation of the present invention. Those skilled in the art can make various modifications or improvements according to the basic idea of the present invention, but as long as they do not depart from the basic idea of the present invention ideas, are within the scope of the present invention.

The term "nicotinamide adenine dinucleotide" in the present invention includes oxidized β-nicotinamide adenine dinucleotide, namely NAD ⁺ , and reduced β-nicotinamide adenine dinucleotide, namely NADH; Also included are oxidized alpha-nicotinamide adenine dinucleotides and reduced alpha-nicotinamide adenine dinucleotides; the term "nicotinamide adenine dinucleotide" includes oxidized alpha-nicotinamide adenine dinucleotides Purine dinucleotides, oxidized beta-nicotinic adenine dinucleotides, reduced alpha-nicotinic adenine dinucleotides, and reduced beta-nicotinic adenine dinucleotides.

The term "nicotinamide riboside" in the present invention includes oxidized α-nicotinamide riboside, oxidized β-nicotinamide riboside, reduced α-nicotinamide riboside and reduced β-nicotinamide riboside; the The term "nicotinic acid riboside" includes oxidized alpha-nicotinic acid riboside, oxidized beta-nicotinic acid riboside, reduced alpha-nicotinic acid riboside, and reduced beta-nicotinic acid riboside.

The term "nicotinamide mononucleotide" in the present invention includes oxidized alpha-nicotinamide mononucleotide, oxidized beta-nicotinamide mononucleotide, reduced alpha-nicotinamide mononucleotide and reduced beta - nicotinamide mononucleotide; the term "nicotinic acid mononucleotide" oxidized alpha-nicotinic acid mononucleotide, oxidized beta-nicotinic acid mononucleotide, reduced alpha-nicotinic acid mononucleotide Acid and reduced beta-nicotinic acid mononucleotides.

The term "nicotinamide adenine dinucleotide phosphate" in the present invention includes oxidized α-nicotinamide adenine dinucleotide phosphate, oxidized β-nicotinamide adenine dinucleotide phosphate, reduced α-nicotinamide adenine dinucleotide phosphate Amide adenine dinucleotide phosphate and reduced beta-nicotinamide adenine dinucleotide phosphate; the term "nicotinic acid adenine dinucleotide phosphate" includes oxidized alpha-nicotinic acid adenine dinucleotide Phosphoric acid, oxidized β-nicotinic acid adenine dinucleotide phosphate, reduced α-nicotinic acid adenine dinucleotide phosphate, and reduced β-nicotinic acid adenine dinucleotide phosphate.

The inventors of the present invention recognize the importance of maintaining the level of nicotinamide adenine dinucleotide in the body, and the use of oral supplements supplemented with nicotinamide adenine dinucleotide is the most convenient method. In the foreseeable future, Demand for nicotinamide riboside, one of oral nicotinamide adenine dinucleotide supplements, will increase. Therefore, the inventor of the present invention has carried out in-depth research on its production process, and found that the current production of nicotinamide riboside mainly uses chemical methods, which will have a certain impact on the environment, and only rely on the supply of a single raw material, tetraacetyl ribose, Unstable factors will be encountered in further mass production. In order to solve the above problems, the present invention proposes a new method for preparing nicotinamide riboside, which uses a biological enzyme method to produce nicotinamide riboside, and the used enzyme and the combination of enzymes can also be used to produce other important products .

1. Preparation of nicotinamide riboside

Specifically, the present invention provides a method for preparing nicotinamide riboside by an enzymatic method, comprising using a 5'-nucleotidase to react with nicotinamide mononucleotide or a salt thereof as a substrate, wherein the 5'-nucleotidase is used for the reaction. The amino acid sequence of '-nucleotidase is shown in SEQ ID NO.1.

5'-nucleotidase reacts with nicotinamide mononucleotide to generate nicotinamide riboside and inorganic phosphate. When the nicotinamide mononucleotide is in the oxidized form, the generated nicotinamide riboside is also in the oxidized form; when the nicotinamide mononucleotide is in the reduced form, the generated nicotinamide riboside is also in the reduced form. Taking oxidized β-nicotinamide mononucleotide as an example, the chemical reaction structural formula involved in the above reaction is as follows:

The weight ratio of the 5'-nucleotidase to the nicotinamide mononucleotide or its salt is preferably (0.01-10):1.

The above method may further comprise using nicotinamide adenine dinucleotide diphosphatase to react with nicotinamide adenine dinucleotide or a salt thereof as a substrate, wherein the nicotinamide adenine dinucleotide diphosphatase The amino acid sequence is shown in SEQ ID NO.2.

Nicotinamide adenine dinucleotide diphosphatase reacts with nicotinamide adenine dinucleotide or a salt thereof to generate nicotinamide mononucleotide and AMP. When nicotinamide adenine dinucleotide is oxidized, the generated nicotinamide mononucleotide is also oxidized, and when nicotinamide adenine dinucleotide is reduced, the generated nicotinamide mononucleotide is also Reductive type. Taking oxidized β-nicotinamide adenine dinucleotide as an example, the chemical reaction structure involved in the reaction is as follows:

The weight ratio of the nicotinamide adenine dinucleotide diphosphatase to the nicotinamide adenine dinucleotide or its salt is preferably (0.01-10):1.

The nicotinamide mononucleotide can supply the 5'-nucleotidase reaction described above.

The method may further comprise using nicotinamide adenine dinucleotide kinase to react with nicotinamide adenine dinucleotide phosphate or a salt thereof as a substrate, wherein the amino acid sequence of the nicotinamide adenine dinucleotide kinase As shown in SEQ ID NO.3.

Nicotinamide adenine dinucleotide kinase reacts with nicotinamide adenine dinucleotide phosphate or a salt thereof to generate nicotinamide adenine dinucleotide and phosphate. When nicotinamide adenine dinucleotide phosphate is an oxidized form, the generated nicotinamide adenine dinucleotide is an oxidized form, and vice versa. Taking the oxidized β-form as an example, the chemical reaction structure involved in the reaction is as follows:

The weight ratio of the nicotinamide adenine dinucleotide kinase and the nicotinamide adenine dinucleotide phosphate or its salt is preferably (0.01-10):1.

The nicotinamide adenine dinucleotide can supply the nicotinamide adenine dinucleotide diphosphatase reaction described above.

The substrates nicotinamide mononucleotide or its salt, nicotinamide adenine dinucleotide or its salt, and nicotinamide adenine dinucleotide phosphate or its salt involved in the method of the present invention can also be obtained commercially, or It can be produced by itself using known production methods. The salts may be sodium salts, disodium salts, lithium salts, monophosphates, diphosphates, sulfates, carbonates, acetates, borates, and the like.

In the present invention, only 5'-nucleotidase can be used to produce nicotinamide riboside using nicotinamide mononucleotide or its salt as a substrate. For some specific reasons, such as cost considerations or when the supply of nicotinamide mononucleotide or its salts is insufficient, nicotinamide adenine dinucleotide diphosphatase can be used first. or its salt as a substrate to produce nicotinamide mononucleotide, and then carry out the reaction of the 5'-nucleotidase. Further, for some specific reasons, such as cost considerations or when the supply of nicotinamide adenine dinucleotide or its salt is insufficient, nicotinamide adenine dinucleotide kinase can be used first to nicotinamide adenine dinucleotide. The nucleotide phosphate or its salt is used as a substrate to produce nicotinamide adenine dinucleotide, and then the reaction of the nicotinamide adenine dinucleotide diphosphatase is carried out.

In the case of producing nicotinamide riboside from nicotinamide mononucleotide or its salt substrate using only 5'-nucleotidase, the 5'-nucleotidase and nicotinamide mononucleotide or salt thereof can be combined Mixed and detected the amount of nicotinamide mononucleotide and nicotinamide riboside in the reaction system by HPLC at specific time points, when the content of nicotinamide mononucleotide has been consumed more than 10-100% and the amount of nicotinamide riboside has been depleted. When the content is relatively increased, the reaction can be terminated.

In the case of using the above two enzymes or three enzymes to prepare nicotinamide riboside in combination, the required enzymes can be separately added in separate steps to carry out the enzymatic reaction; the required enzymes can also be mixed and added at the same time. to carry out the enzymatic reaction.

In some embodiments utilizing three enzymes, the method comprises combining nicotinamide adenine dinucleotide kinase, nicotinamide adenine dinucleotide diphosphatase, and 5'-nucleotidase with nicotinamide adenine The dinucleotide phosphates or salts thereof are mixed and the reaction is allowed to proceed for 1.5-8 hours.

In the above embodiment, preferably, based on the initial total volume of the reaction system, the amount of nicotinamide adenine dinucleotide kinase is 0.01-20% (w/v), and the amount of nicotinamide adenine dinucleotide diphosphatase is 0.01-20% (w/v). The amount of nicotinamide adenine dinucleotide phosphate or its salt is 0.01-20% (w/v), the amount of 5'-nucleotidase is 0.01-20% (w/v), the amount of nicotinamide adenine dinucleotide phosphate or its salt is 0.01- 10% (w/v).

The term "initial total volume of the reaction system" refers to the total volume of the reaction system when all required reactants are added. As the reaction proceeds, the volume of the reaction system may change, therefore, the amounts of the above-mentioned reactants are based on the volume of the initial reaction system when all the required reactants are added.

In the above-mentioned embodiment, firstly, nicotinamide adenine dinucleotide kinase is reacted with nicotinamide adenine dinucleotide phosphate or its salt, and nicotinamide adenine dinucleotide or its salt is generated along with nicotinamide adenine dinucleotide or its salt. Purine dinucleotide diphosphatase catalyzes the conversion of nicotinamide adenine dinucleotide or its salt into nicotinamide mononucleotide or its salt, and then nicotinamide mononucleotide or its salt is converted by 5'-nucleotidase Converted to nicotinamide riboside.

When the reaction time is less than 1.5 hours, the reaction is insufficient, and sufficient nicotinamide riboside cannot be obtained; when the reaction time is greater than 8 hours, the reaction solution will be contaminated by microorganisms without adding antibiotics or other bacteriostatic chemicals. The liquid will start to be viscous and have peculiar smell, which is difficult to handle, the content of substrate and product in the reaction liquid will also decrease at the same time, and the unforeseeable by-product will increase with time, which will eventually lead to the reaction Cannot proceed and scrap.

In some embodiments utilizing two enzymes, the method comprises admixing nicotinamide adenine dinucleotide diphosphatase and 5'-nucleotidase with nicotinamide adenine dinucleotide or a salt thereof such that The reaction proceeds for 1.5-8 hours.

In the above embodiment, preferably, based on the initial total volume of the reaction system, the amount of nicotinamide adenine dinucleotide diphosphatase is 0.01-10% (w/v), and the amount of 5'-nucleotidase is 0.01-10% (w/v), and the amount of nicotinamide adenine dinucleotide or its salt is 0.01-10% (w/v).

In the above embodiment, firstly, nicotinamide adenine dinucleotide diphosphatase catalyzes the conversion of nicotinamide adenine dinucleotide or a salt thereof into nicotinamide mononucleotide or a salt thereof, followed by nicotinamide mononucleotide In the production of its salt, 5'-nucleotidase converts nicotinamide mononucleotide or its salt to nicotinamide riboside.

When the above reaction time is less than 1.5 hours, the reaction is insufficient, and sufficient nicotinamide riboside cannot be obtained; when the reaction time is more than 8 hours, the reaction solution will not add antibiotics or other bacteriostatic chemicals. In the case of microbial contamination, the liquid will start to be thicker and emit peculiar smell, which is difficult to handle. The content of substrate and product in the reaction liquid will also decrease at the same time, and the unforeseeable by-products will increase with the extension of time. will result in the reaction not proceeding and scrapping.

In other embodiments, the method includes the steps of:

3) When the amount of the nicotinamide adenine dinucleotide or its salt drops to below 10-100% of the initial reaction in step 2), mix the nicotinamide mononucleotide or its salt with The 5'-nucleotidase mixes and reacts to produce nicotinamide riboside.

In the above embodiment, preferably, based on the initial total volume of the reaction system in step 1), the amount of nicotinamide adenine dinucleotide kinase is 0.01-10% (w/v), and the amount of nicotinamide adenine dinucleotide is 0.01-10% (w/v). The amount of phosphoric acid or its salt is 0.01-10% (w/v); based on the initial total volume of the reaction system in step 2), the amount of nicotinamide adenine dinucleotide diphosphatase is 0.1-10% (w/v) ); based on the initial total volume of the reaction system in step 3), the amount of 5'-nucleotidase is 0.1-10% (w/v).

The amount of product in each step can be monitored by HPLC to carry out the next reaction at an appropriate time point.

In other embodiments, the method includes the steps of:

II) When the amount of the nicotinamide adenine dinucleotide or its salt drops below 10-100% of the initial reaction of the step I), mixing the nicotinamide mononucleotide or its salt with The 5'-nucleotidase mixes and reacts to produce nicotinamide riboside.

In the above embodiment, preferably, based on the initial total volume of the reaction system in step I), the amount of nicotinamide adenine dinucleotide diphosphatase is 0.1-10% (w/v), and the amount of nicotinamide adenine dinuclear The amount of glucoside or its salt is 0.1-10% (w/v); based on the initial total volume of the reaction system in step II), the amount of 5'-nucleotidase is 0.1-10% (w/v).

All the above-mentioned reactions involved in the present invention can be carried out at 25-40° C. and pH 5-10. Among them, the preferred reaction temperature is 30-40°C, more preferably 32-40°C. Among them, the preferred pH is pH 6-9, more preferably pH 6.5-8.5.

Preferably, the above reaction requires the assistance of ions. Each of the reactions is preferably carried out in the presence of 0.01 ppm to 100,000 ppm of one or more ions. The ions preferably include various metal ions, chloride ions, magnesium ions, calcium ions, potassium ions, sodium ions, zinc ions, fluoride ions, sulfur ions, carbonate ions, sulfite ions, various phosphorus-containing ions. Preferably, sodium ions, magnesium ions, potassium ions, carbonate ions, sulfite ions and various phosphorus-containing ions are included.

Preferably, the 5'-nucleotidase, the nicotinamide adenine dinucleotide diphosphatase, and the nicotinamide adenine dinucleotide kinase are obtained by bioengineering and microbial fermentation .

The gene for 5'-nucleotidase can be from Vibrio cholerae (EC 3.1.3.5); the gene for nicotinamide adenine dinucleotide diphosphatase can be from Saccharomyces cerevisiae (EC 3.6.1) .22); the gene for nicotinamide adenine dinucleotide kinase may be derived from Clostridioides difficile (EC 2.7.1.23).

The three enzymes can be used to express the recombinases individually by using expression vectors respectively, or they can be constructed into the same vector to express the recombinases of the three enzymes. The expression vector can be an expression vector commonly used in the field of molecular biology, and the host cell can also be a bacterial species commonly used in the field of molecular biology, such as Escherichia coli, yeast and the like.

The biological enzymatic reaction can be carried out by using cells expressing the recombinase, cell fragmentation liquid, supernatant liquid or purified enzyme liquid; the above-mentioned recombinases can also be made into immobilized by any form of immobilization method and carrier in a single or mixed manner. Enzyme/cell preparations for enzymatic reactions.

In some embodiments, the nicotinamide adenine dinucleotide kinase, the nicotinamide adenine dinucleotide diphosphatase, and the 5'-nucleotidase are provided as immobilized enzymes/cell .

In some specific embodiments, the method of the present invention uses recombinase technology to express nicotinamide adenine dinucleotide kinase, nicotinamide adenine dinucleotide diphosphatase and 5'-nucleoside respectively in Escherichia coli as a host The supernatant enzyme liquid was extracted, and a part of the supernatant enzyme liquid was used to prepare the immobilized enzyme. Then, prepare 100ml of reaction solution in the reaction tank, add 1.21g of tris as buffer (buffer can also use any type of phosphate, carbonate, sulfate and amino acid), 78.7mg Oxidized nicotinamide adenine dinucleotide phosphate disodium salt and 406 mg of magnesium chloride hexahydrate were added to 80 ml of pure water, and the pH was adjusted to 7.8-8.0 with 0.1 M hydrochloric acid/sodium hydroxide. The reaction solution was maintained at 37°C and stirred at pH 8.0, and 10 ml of the supernatant enzyme solutions of nicotinamide adenine dinucleotide kinase, nicotinamide adenine dinucleotide diphosphatase and 5'-nucleotidase were added, The concentrations of oxidized nicotinamide adenine dinucleotide phosphate disodium salt, nicotinamide adenine dinucleotide, β-nicotinamide mononucleotide and nicotinamide riboside in the reaction solution were detected by high performance liquid chromatography. The concentration of oxidized nicotinamide adenine dinucleotide phosphate disodium salt decreased to 0.3 mM in the reaction solution after 2 hours, while the concentration of nicotinamide riboside increased in the reaction solution, reaching a concentration of 0.6 after two hours mM, the enzymatic reaction can end.

In other specific embodiments, nicotinamide adenine dinucleotide is used as the reaction substrate, and the configuration of the reaction solution is 1.21 g of tris, 66.3 mg of nicotinamide adenine dinucleotide and 406 mg of hexamethylene Magnesium chloride in water, after adding 80ml of pure water, adjust the pH to 7.8-8.0 with 0.1M hydrochloric acid/sodium hydroxide; the reaction solution is maintained at 37°C and stirred at pH 8.0, and nicotinamide adenine dinucleotide diphosphatase and 5 '-Nucleotidase 10ml each, and the concentration changes of nicotinamide adenine dinucleotide, β-nicotinamide mononucleotide and nicotinamide riboside in the reaction solution were detected by high performance liquid chromatography. After 2 hours of reaction, nicotinamide The concentration of adenine dinucleotide decreased to 0.24 mM in the reaction solution, while the concentration of nicotinamide riboside increased in the reaction solution, and the concentration reached 0.57 mM after two hours, and the enzymatic reaction could be terminated.

In other specific embodiments, β-nicotinamide mononucleotide is used as the raw material for the reaction, and the configuration of the reaction solution is, for example, 1.21 g of tris, 33.4 mg of β-nicotinamide mononucleotide and 406 mg of hexamethylene Water magnesium chloride, add 80ml pure water, adjust the pH to 7.8-8.0 with 0.1M hydrochloric acid/sodium hydroxide; maintain the reaction solution at 37°C and stir at pH 8.0, add 10ml 5'-nucleotidase, and use high performance liquid chromatography The concentration changes of β-nicotinamide mononucleotide and nicotinamide riboside in the reaction solution were analyzed. After 2 hours of reaction, the concentration of β-nicotinamide mononucleotide decreased to 0.07mM in the reaction solution, while the The concentration in the reaction solution reached 0.91 mM after two hours, and the enzyme reaction could be terminated.

In the method of the present invention, the method of adding enzymes simultaneously has the same or even higher conversion rate than the method of adding enzymes in steps.

The present invention also provides the use of nicotinamide adenine dinucleotide kinase, nicotinamide adenine dinucleotide diphosphatase and/or 5'-nucleotidase in the preparation of nicotinamide riboside, wherein the nicotinamide riboside Amino acid sequences of amide adenine dinucleotide kinase, said nicotinamide adenine dinucleotide diphosphatase and said 5'-nucleotidase are respectively as SEQ ID NO.3, SEQ ID NO.2 and SEQ ID NO.2 ID NO.1.

The present invention also provides an enzyme composition, comprising:

The present invention also provides the application of the enzyme composition in the preparation of nicotinamide riboside.

2. Preparation of nicotinic acid riboside, nicotinic acid adenine dinucleotide and nicotinic acid mononucleotide

The nicotinamide adenine dinucleotide kinase, nicotinamide adenine dinucleotide diphosphatase and 5'-nucleotidase of the present invention can also be used to prepare nicotinic acid riboside, nicotinic acid adenine dinucleoside Glycosides and Niacin Mononucleotides.

Specifically, the present invention also provides a method for preparing nicotinic acid riboside by an enzymatic method, comprising using 5'-nucleotidase to react with nicotinic acid mononucleotide or its salt as a substrate, wherein the The amino acid sequence of 5'-nucleotidase is shown in SEQ ID NO.1.

5'-nucleotidase reacts with nicotinic acid mononucleotide or its salt to generate nicotinic acid riboside and inorganic phosphate. When the nicotinic acid mononucleotide is in the oxidized form, the generated nicotinic acid riboside is also in the oxidized form, and vice versa. Taking the oxidized β-form as an example, the chemical reaction structural formula involved in the above reaction is as follows:

The weight ratio of the 5'-nucleotidase to the nicotinic acid mononucleotide or its salt is preferably (0.01-10):1.

Nicotinamide adenine dinucleotide diphosphatase reacts with nicotinic acid adenine dinucleotide or its salt to generate nicotinic acid mononucleotide or its salt and AMP. When the nicotinic acid adenine dinucleotide is in the oxidized form, the generated nicotinic acid mononucleotide is also in the oxidized form, and vice versa. Taking the oxidized β-form as an example, the chemical reaction structure involved in the reaction is as follows:

The weight ratio of the nicotinamide adenine dinucleotide diphosphatase to the nicotinic acid adenine dinucleotide or its salt is preferably (0.01-10):1.

The nicotinic acid mononucleotide or its salt can be used for the reaction of the above-mentioned 5'-nucleotidase with nicotinic acid mononucleotide or its salt.

Nicotinamide adenine dinucleotide kinase reacts with nicotinic acid adenine dinucleotide phosphate or a salt thereof to generate nicotinic acid adenine dinucleotide or a salt thereof and an inorganic phosphate. When niacin adenine dinucleotide phosphate is an oxidized form, the generated niacin adenine dinucleotide is also an oxidized form, and vice versa. Taking the oxidized β-form as an example, the chemical reaction structure involved in the reaction is as follows:

The weight ratio of the nicotinamide adenine dinucleotide kinase and the nicotinic acid adenine dinucleotide phosphate is preferably (0.01-10):1.

The nicotinic acid adenine dinucleotide or a salt thereof can be used for the reaction of the nicotinamide adenine dinucleotide diphosphatase described above with nicotinic acid adenine dinucleotide or a salt thereof.

Each of the above reactions can be carried out at 25-40°C and pH 5-10. Among them, the preferred reaction temperature is 30-40°C, more preferably 32-40°C. Among them, the preferred pH is pH 6-9, more preferably pH 6.5-8.5.

The substrates nicotinic acid mononucleotide or its salt, nicotinic acid adenine dinucleotide or its salt, and nicotinic acid adenine dinucleotide phosphate or its salt involved in the method of the present invention can also be obtained commercially, or It can be produced by itself using known production methods. The salts can be sodium salts, disodium salts, lithium salts, monophosphates, diphosphates, sulfates, carbonates, acetates, borates, and the like.

In the case of preparing nicotinic acid riboside, the present invention can use only 5'-nucleotidase to produce nicotinic acid riboside using nicotinic acid mononucleotide or its salt as a substrate. For some specific reasons, such as cost considerations or when the supply of niacin mononucleotide or its salt is insufficient, nicotinamide adenine dinucleotide diphosphatase can be used first to nicotinate adenine dinucleotide. The nicotinic acid mononucleotide or its salt is produced as a substrate, and then the 5'-nucleotidase reaction is carried out. Further, for some specific reasons, such as cost considerations or when the supply of nicotinic acid adenine dinucleotide or its salt is insufficient, nicotinamide adenine dinucleotide kinase can be used first to convert nicotinic acid adenine dinucleotide to nicotinic acid adenine dinucleotide. The nucleotide phosphate or its salt is used as a substrate to produce nicotinic acid adenine dinucleotide or its salt, and then the reaction of the nicotinamide adenine dinucleotide diphosphatase is carried out.

Similarly, in the case of preparing nicotinic acid mononucleotide, nicotinic acid mononucleoside can be produced using only nicotinamide adenine dinucleotide diphosphatase using nicotinic acid adenine dinucleotide or its salt as a substrate acid. For some specific reasons, such as cost considerations or when the supply of nicotinic acid adenine dinucleotide or its salt is insufficient, nicotinamide adenine dinucleotide kinase can be used first to generate nicotinic acid adenine dinucleotide. Phosphoric acid or a salt thereof is used as a substrate to produce nicotinic acid adenine dinucleotide or a salt thereof, and then the reaction of the nicotinamide adenine dinucleotide diphosphatase is carried out.

In the above reaction process, the amount of substrate and product in the reaction system can be detected by HPLC at a specific time point. When the amount of substrate has been consumed more than 10-100% and the amount of product is relatively increased, the reaction can be made. Finish.

In the case of preparing nicotinic acid riboside using the above-mentioned two enzymes or three enzymes in combination, and in the case of using the above-mentioned two enzymes in combination to prepare nicotinic acid mononucleotide, it is possible to separately add the desired amount in separate steps. enzyme to carry out the enzymatic reaction; the desired enzymes can also be mixed and added at the same time to carry out the enzymatic reaction.

In some embodiments in which three enzymes are mixed simultaneously to prepare nicotinic riboside, the method comprises combining nicotinamide adenine dinucleotide kinase, nicotinamide adenine dinucleotide diphosphatase, and 5'-nucleotide The enzyme is mixed with niacin adenine dinucleotide phosphate or a salt thereof and the reaction is allowed to proceed for 1.5-8 hours.

In the above embodiment, preferably, based on the initial total volume of the reaction system, the amount of nicotinamide adenine dinucleotide kinase is 0.1-10% (w/v), and the amount of nicotinamide adenine dinucleotide diphosphatase is 0.1-10% (w/v). The amount of nicotinic acid adenine dinucleotide phosphate or its salt is 0.1-10% (w/v), the amount of 5'-nucleotidase is 0.1-10% (w/v), the amount of niacin adenine dinucleotide phosphate or its salt is 0.1- 5% (w/v).

In the above embodiment, first, nicotinamide adenine dinucleotide kinase is reacted with nicotinic acid adenine dinucleotide phosphate or its salt, and nicotinamide adenine dinucleotide or its salt is generated along with the generation of nicotinamide adenine dinucleotide Purine dinucleotide diphosphatase catalyzes the conversion of nicotinic acid adenine dinucleotide or its salt into nicotinic acid mononucleotide or its salt, and then nicotinic acid mononucleotide or its salt is converted by 5'-nucleotidase Converted to nicotinic acid riboside.

When the reaction time is less than 1.5 hours, the reaction is not sufficient, and sufficient nicotinic acid riboside cannot be obtained; when the reaction time is greater than 8 hours, the reaction solution will appear microbial contamination without adding antibiotics or other bacteriostatic chemicals The liquid will start to be viscous and have peculiar smell, which is difficult to handle, the content of substrate and product in the reaction liquid will also decrease at the same time, and the unforeseeable by-product will increase with time, which will eventually lead to the reaction Cannot proceed and scrap.

When preparing nicotinic acid mononucleotide, the above method does not introduce 5'-nucleotidase and the reaction time is correspondingly shortened (for example, shortened to 1.5-6 hours).

In some embodiments in which the two enzymes are combined to produce nicotinic riboside simultaneously, the method comprises combining nicotinamide adenine dinucleotide diphosphatase and 5'-nucleotidase with nicotinic acid adenine dinucleotide The acid or its salt is mixed and the reaction is allowed to proceed for 1.5-8 hours.

In the above embodiment, preferably, based on the initial total volume of the reaction system, the amount of nicotinamide adenine dinucleotide diphosphatase is 0.1-10% (w/v), and the amount of 5'-nucleotidase is 0.1-10% (w/v), and the amount of niacin adenine dinucleotide or its salt is 0.1-10% (w/v).

In the above embodiment, first nicotinamide adenine dinucleotide diphosphatase catalyzes the conversion of nicotinic acid adenine dinucleotide or a salt thereof into nicotinic acid mononucleotide or a salt thereof, followed by nicotinic acid mononucleotide or its salt. In the production of its salts, 5'-nucleotidase converts nicotinic acid mononucleotides or salts thereof to nicotinic acid ribosides.

When the above reaction time is less than 1.5 hours, the reaction is insufficient, and sufficient nicotinamide riboside cannot be obtained; when the reaction time is greater than 8 hours, the reaction solution will appear without adding antibiotics or other bacteriostatic chemicals. In the case of microbial contamination, the liquid will start to be viscous and emit peculiar smell, which is difficult to handle, the content of substrate and product in the reaction liquid will also decrease at the same time, and the unpredictable by-products will increase with time. As a result, the reaction cannot proceed and is scrapped.

When preparing nicotinic acid mononucleotide, the above method does not introduce 5'-nucleotidase and the reaction time is correspondingly shortened (for example, shortened to 1.5-4 hours).

In some embodiments of the stepwise preparation of nicotinic acid riboside, the method comprises the steps of:

1) nicotinamide adenine dinucleotide kinase is mixed with nicotinic acid adenine dinucleotide phosphate or its salt, and its reaction produces nicotinic acid adenine dinucleotide or its salt;

2) When the amount of the niacin adenine dinucleotide phosphate or its salt drops to below 20-100% of the initial reaction in step 1), the niacin adenine dinucleotide or Its salt is mixed with nicotinamide adenine dinucleotide diphosphatase to react to produce nicotinic acid mononucleotide or its salt;

3) When the amount of the nicotinic acid adenine dinucleotide or its salt drops below 10-100% of the initial reaction time in step 2), mix the nicotinic acid mononucleotide or its salt with The 5'-nucleotidase mixes and reacts to produce nicotinic riboside.

In the above embodiment, preferably, based on the initial total volume of the reaction system in step 1), the amount of nicotinamide adenine dinucleotide kinase is 0.1-10% (w/v), the amount of nicotinic acid adenine dinucleotide is 0.1-10% (w/v) The amount of phosphoric acid or its salt is 0.1-10% (w/v); based on the initial total volume of the reaction system in step 2), the amount of nicotinamide adenine dinucleotide diphosphatase is 0.1-10% (w/v) ); based on the initial total volume of the reaction system in step 3), the amount of 5'-nucleotidase is 0.1-10% (w/v).

In the preparation of nicotinic acid mononucleotide, the above method does not introduce 5'-nucleotidase and when the amount of the nicotinic acid adenine dinucleotide or its salt is reduced to that at the beginning of the reaction described in step 2) When it is below 10-100%, the reaction can be terminated.

In other embodiments of stepwise preparation of nicotinic acid riboside, the method comprises the steps of:

II) When the amount of the nicotinic acid adenine dinucleotide or its salt drops below 10-100% of the initial reaction of the step I), mixing the nicotinic acid mononucleotide or its salt with The 5'-nucleotidase mixes and reacts to produce nicotinic riboside.

In the above embodiment, preferably, based on the initial total volume of the reaction system in step I), the amount of nicotinamide adenine dinucleotide diphosphatase is 0.1-10% (w/v), the amount of nicotinamide adenine dinucleotide is 0.1-10% (w/v) The amount of nucleotides is 0.1-10% (w/v); the amount of 5'-nucleotidase is 0.1-10% (w/v) based on the initial total volume of the reaction system in step II).

In the preparation of nicotinic acid mononucleotide, the above method does not introduce 5'-nucleotidase and when the amount of said nicotinic acid adenine dinucleotide or its salt is reduced to that at the beginning of the reaction described in step I) When it is below 10-100%, the reaction can be terminated.

The gene for 5'-nucleotidase may be derived from Salmonella enterica (EC 3.1.3.5); the gene for nicotinamide adenine dinucleotide diphosphatase may be derived from Saccharomyces cerevisiae (EC 3.6.1) .22); the gene for nicotinamide adenine dinucleotide kinase may be derived from Clostridioides difficile (EC 2.7.1.23).

The recombinases of the three enzymes can be separately expressed by the expression vectors, or the recombinases of two or three enzymes can be expressed in the same vector. The expression vector can be an expression vector commonly used in the field of molecular biology, and the host cell can also be a bacterial species commonly used in the field of molecular biology, such as Escherichia coli, yeast and the like.

In a specific embodiment, when producing nicotinic acid adenine dinucleotide, the raw material is nicotinic acid adenine dinucleotide phosphate, and the configuration of the reaction solution is 1.21 g of tris, 74.4 mg of nicotinic acid Adenine dinucleotide phosphate and 406 mg of magnesium chloride hexahydrate were added to 80 ml of pure water, and then adjusted to pH 7.8-8.0 with 0.1 M hydrochloric acid/sodium hydroxide; the reaction solution was maintained at 37°C and stirred at pH 8.0, and 10 ml of nicotinamide was added. The supernatant of adenine dinucleotide kinase was analyzed by high performance liquid chromatography for the concentration of nicotinic acid adenine dinucleotide phosphate and nicotinic acid adenine dinucleotide in the reaction solution. After 2 hours of reaction, nicotinic acid adenine dinucleotide The concentration of nucleotide phosphate in the reaction solution decreased to 0.28 mM, the concentration of nicotinic acid adenine dinucleotide in the reaction solution reached 0.66 mM after two hours, and the enzymatic reaction could be terminated.

When preparing nicotinic acid mononucleotide, the above method can continue to add 10 ml of nicotinamide adenine dinucleotide diphosphatase supernatant for reaction, and nicotinic acid mononucleotide is converted and synthesized by nicotinic acid adenine dinucleotide , 0.55mM nicotinic acid mononucleotide was obtained after 2 hours of reaction.

When preparing nicotinic acid riboside, the above method can continue to add 10 ml of 5'-nucleotidase to further convert nicotinic acid mononucleotide to nicotinic acid riboside, and obtain 0.47 mM nicotinic acid riboside after 2 hours of reaction.

The whole reaction process mentioned above can also be mixed and added with the desired enzymes at the same time to convert the selected raw materials to the desired products in a one-step manner.

Nicotinamide riboside and nicotinic acid riboside can be produced individually or simultaneously using the enzymatic reactions described in the present invention.

The present invention also provides nicotinamide adenine dinucleotide kinase, nicotinamide adenine dinucleotide diphosphatase and/or 5'-nucleotidase in the preparation of nicotinic acid riboside, nicotinic acid adenine dinucleotide Use of acid and nicotinic acid mononucleotides, wherein the amino acids of said nicotinamide adenine dinucleotide kinase, said nicotinamide adenine dinucleotide diphosphatase and said 5'-nucleotidase The sequences are shown in SEQ ID NO.3, SEQ ID NO.2 and SEQ ID NO.1, respectively.

The present invention also provides an enzyme composition, comprising:

The present invention also provides the application of the enzyme composition in the preparation of nicotinic acid riboside, nicotinic acid adenine dinucleotide and nicotinic acid mononucleotide.

The following examples are used to further explain or illustrate the content of the present invention, but these examples should not be construed as limiting the protection scope of the present invention.

example

Unless otherwise specified, the experimental methods used in the following examples are all carried out using conventional experimental procedures, operations, materials and conditions in the art.

Descriptions of the materials and equipment used in the examples are as follows:

Reaction regulation tank: from Gene Harbor (Hong Kong) Biotechnology Co., Ltd., BR-1L;

Adjustable flow suction pump: purchased from SURGEFLO company, FL-32;

pH control device: from Gene Harbor (Hong Kong) Biotechnology Co., Ltd., AR-1;

Magnesium chloride hexahydrate: purchased from Guangxi Donglong Chemical Co., Ltd.;

Tris: purchased from Merck, USA;

Oxidized Nicotinamide Adenine Dinucleotide Phosphate Disodium Salt: from Gene Harbor (Hong Kong) Biotechnology Co., Ltd., Hong Kong, China;

Oxidized β-nicotinamide adenine dinucleotide and oxidized β-nicotinamide adenine dinucleotide sodium salt: from Gene Harbor (Hong Kong) Biotechnology Co., Ltd., Hong Kong, China;

Oxidized β-nicotinamide mononucleotide: from Gene Harbor (Hong Kong) Biotechnology Co., Ltd., Hong Kong, China;

Oxidized β-nicotinic acid adenine dinucleotide phosphate sodium salt: purchased from Merck, USA;

Oxidized β-niacin adenine dinucleotide: from Gene Harbor (Hong Kong) Biotechnology Co., Ltd., Hong Kong, China;

Oxidized β-nicotinic acid mononucleotide: from Gene Harbor (Hong Kong) Biotechnology Co., Ltd., Hong Kong, China;

Oxidized β-nicotinic acid riboside: from Gene Harbor (Hong Kong) Biotechnology Co., Ltd., Hong Kong, China;

Unless otherwise specified, the substrates for the enzymes used in the following examples are both oxidized and β-chiral.

Example 1: Preparation of Nicotinamide Adenine Dinucleotide Kinase (EC 2.7.1.23)

PCR primers were designed according to the DNA sequence (SEQ ID NO.4) (gene bank accession number ARC14363.1) encoding nicotinamide adenine dinucleotide kinase in the genome of Clostridioides difficile, specifically:

Upstream primer NADK1:

5'-CTGACC GGATCC ATGAAAAGAATTATAACTATAAAT-3' (SEQ ID NO. 5)

Downstream primer NADK2:

5'-TATGCG GAATTC CTATAAAAATTTTTCAGATACTCT-3' (SEQ ID NO. 6)

Take the genomic DNA of Clostridium difficile (Clostridioides difficile) as a template, carry out PCR amplification with the above primers to obtain the nicotinamide adenine dinucleotide kinase gene, utilize restriction endonucleases BamHI and EcoRI to process the PCR product and connect it into pET-21a, resulting in pET-NADK. The recombinant expression vector was transformed into Escherichia coli HB101 to obtain a recombinant expression strain of nicotinamide adenine dinucleotide kinase.

A single colony of the above-mentioned strains was selected and inoculated into 4mL LB medium (containing 100 μg/ml ampicillin), cultivated for 16 hours in a shaker at 37°C and 200rpm as primary seeds, and received 100mL LB medium by 1% inoculation ratio after completion. (containing 100 μg/ml ampicillin), cultured in a shaker at 37°C and 200 rpm for 10 hours as secondary seeds, and then received 60L LB medium (containing 100 μg/ml ampicillin) at a 1% inoculation ratio after completion. cultured in a 100L fermenter. The initial fermentation conditions were 37°C, 200 rpm, pH 7.0. Fermentation was carried out for 9 hours, IPTG was added to a final concentration of 1 mM, and the fermentation was completed at 20 hours. The fermentation broth was centrifuged at 12,500 rpm for 10 minutes at 4° C. to obtain 1.34 kg of E. coli cells containing nicotinamide adenine dinucleotide kinase. The obtained Escherichia coli cells containing nicotinamide adenine dinucleotide kinase were prepared into an enzyme solution, and the preparation method of the enzyme solution was as follows: sodium phosphate buffer solution (PBS 100mM pH 7.5) was added to every 1 g of cells to make a slurry (that is, mix evenly) After that, use a pressure cell crusher at the setting of 700-800MPa to crush the cell crushed liquid, and centrifuge it with a tube centrifuge at the setting of 10,000rpm and 100L/hr, take the supernatant, every 1ml The enzyme solution contains 0.2 g of cells. The enzyme activity was detected according to its enzymatic reaction. The method was as follows: adding 1 mg of total protein to 1 ml of reaction solution (200 mM PBS pH 8.0, 20 mM oxidized nicotinamide adenine dinucleotide phosphate disodium salt) The enzyme solution was reacted at a temperature of 37 degrees Celsius for 5 minutes, and after completion, the content of nicotinamide adenine dinucleotide produced in the enzyme reaction in the sample was analyzed by high performance liquid chromatography. According to the above method, the enzyme activity of the enzyme solution is about 0.6 nmol/min/mg.

Example 2: Preparation of Nicotinamide Adenine Dinucleotide Diphosphatase (EC 3.6.1.22)

PCR primers were designed based on the DNA sequence (PJP11175.1) (SEQ ID NO.7) encoding nicotinamide adenine dinucleotide diphosphatase in the genome of Saccharomyces cerevisiae, specifically:

Upstream primer NDP1:

5'-CTGACC GGATCC ATGTCCACTGCAGTGACTTTTTTT-3' (SEQ ID NO. 8)

Downstream primer NDP2:

5'-TATGCG GAATTC CTATAGATGGCTCGATGAGGTCTT-3' (SEQ ID NO. 9)

Take the genomic DNA of Saccharomyces cerevisiae as substrate, carry out PCR amplification with above-mentioned primers to obtain nicotinamide adenine dinucleotide diphosphatase gene, utilize restriction endonuclease BamHI and EcoR I to process PCR product and This was ligated into pET-21a to give pET-NDP. The recombinant expression vector was transformed into Escherichia coli HB101 to obtain a recombinant expression strain of nicotinamide adenine dinucleotide diphosphatase.

A single colony of the above-mentioned strains was selected and inoculated into 4mL LB medium (containing 100 μg/ml ampicillin), cultivated for 16 hours in a shaker at 37°C and 200rpm as primary seeds, and received 100mL LB medium by 1% inoculation ratio after completion. (containing 100 μg/ml ampicillin), cultured at 37°C, 200 rpm shaker for 10 hours as secondary seeds, and then received 60L LB medium (containing 100 μg/ml ampicillin) at a 1% inoculation ratio after completion. Cultured in a 100L fermenter. The initial fermentation conditions were 37°C, 200 rpm, pH 7.0. Fermentation was carried out for 9 hours, IPTG was added to a final concentration of 1 mM, and the fermentation was completed at 20 hours. The fermentation broth was centrifuged at 12,500 rpm for 10 minutes at 4° C. to obtain 1.74 kg of Escherichia coli cells containing nicotinamide adenine dinucleotide diphosphatase. The obtained Escherichia coli cells containing nicotinamide adenine dinucleotide diphosphatase were prepared into an enzyme solution. The preparation method of the enzyme solution is as follows: after adding sodium phosphate buffer (PBS 100mM, pH 7.5) to each 1g of cells for beating, use a pressure cell breaker to break at a setting of 700-800MPa, and obtain a cell breakage liquid and use The tube centrifuge was centrifuged at 10,000 rpm and 100 L/hr, and the supernatant was taken, containing 0.2 g of cells per 1 ml of enzyme solution. The enzyme activity was detected according to its enzymatic reaction. The method was as follows: adding an enzyme solution containing 1 mg of total protein to 1 ml of reaction solution (200 mM PBS pH 8.0, 10 mM nicotinamide adenine dinucleotide sodium salt) , under the temperature control of 37 degrees Celsius, the reaction was carried out for 5 minutes, and the β-nicotinamide mononucleotide produced in the enzyme reaction in the sample was analyzed by high performance liquid chromatography after completion. The enzyme activity is about 0.71nmol/min/mg.

Example 3: Preparation of 5'-nucleotidase (EC 3.1.3.5)

PCR primers were designed based on the DNA sequence (AVB07708.1) (SEQ ID NO.10) encoding 5'-nucleotidase in the genome of Salmonella enterica, specifically:

Upstream primer NUCL1:

5'-CTGACC GGATCC ATGAAAGTAAAACTGCTTGCTGCC-3' (SEQ ID NO. 11)

Downstream primer NUCL2:

5'- TATGCGGAATTCTTACTTCTTCACATCCGCAACGCG -3' (SEQ ID NO. 12)

Using the genomic DNA of Salmonella enterica as the substrate, the 5'-nucleotidase gene was obtained by PCR amplification with the above-mentioned primers, and the PCR products were processed with restriction enzymes BamHI and EcoR I and connected. into pET-21a, resulting in pET-USHA. The recombinant expression vector was transformed into Escherichia coli HB101 to obtain a 5'-nucleotidase recombinant expression strain.

A single colony of the above-mentioned strains was selected and inoculated into 4mL LB medium (containing 100 μg/ml ampicillin), cultivated for 16 hours in a shaker at 37°C and 200rpm as primary seeds, and received 100mL LB medium by 1% inoculation ratio after completion. (containing 100 μg/ml ampicillin), cultured at 37°C, 200 rpm shaker for 10 hours as secondary seeds, and then received 60L LB medium (containing 100 μg/ml ampicillin) at a 1% inoculation ratio after completion. Cultured in a 100L fermenter. The initial fermentation conditions were 37°C, 200 rpm, pH 7.0. Fermentation was carried out for 9 hours, IPTG was added to a final concentration of 1 mM, and the fermentation was completed at 20 hours. The fermentation broth was centrifuged at 12,500 rpm for 10 minutes at 4°C to obtain 1.55 kg of E. coli cells containing 5'-nucleotidase. The obtained Escherichia coli cells containing 5'-nucleotidase were prepared into an enzyme solution. The preparation method of the enzyme solution is as follows: add sodium phosphate buffer (PBS 100mM pH 7.5) to each 1g of cells and beat, and then use a pressure cell disruptor to break the cell broken solution at the setting of 700-800MPa to obtain a cell broken solution. Centrifuge was performed at 10,000 rpm and 100 L/hr, and the supernatant was taken, containing 0.2 g of cells per 1 ml of enzyme solution. The enzyme activity was tested according to its enzymatic reaction. The method was as follows: add an enzyme solution containing 1 mg of total protein to 1 ml of the reaction solution (200 mM PBS pH 8.0, 10 mM β-nicotinamide mononucleotide), and the solution was heated in degrees Celsius. The reaction was carried out under the temperature control of 37 degrees for 5 minutes, and after completion, the content of nicotinamide riboside produced in the enzymatic reaction in the sample was analyzed by high performance liquid chromatography. According to the above method, the enzyme activity of the enzyme solution is about 0.62 nmol/min/mg.

Embodiment 4: take oxidized nicotinamide adenine dinucleotide phosphate disodium salt as substrate and use enzyme liquid to carry out step-by-step enzymatic reaction to prepare nicotinamide riboside

The enzyme supernatants of nicotinamide adenine dinucleotide kinase, nicotinamide adenine dinucleotide diphosphatase and 5'-nucleotidase were prepared according to Examples 1-3 for subsequent use. Use a 2L experimental beaker to prepare the reaction solution. In the beaker, weigh 12.1g of tris, 0.24g of oxidized nicotinamide adenine dinucleotide phosphate disodium salt and 4.1g of hexahydrate in the following order. Magnesium chloride and 600ml of pure water were added, and the external stirring device was started until all the raw materials were completely dissolved. Adjust the pH value of the solution to pH 8.0 with 0.1M hydrochloric acid/sodium hydroxide, and dissolve it to 1L with pure water, connect the beaker to a constant temperature device and keep it warm for 30 minutes until the temperature of the solution is stabilized at 37°C, take a sample with a high-efficiency liquid The concentration and content of oxidized nicotinamide adenine dinucleotide phosphate and nicotinamide adenine dinucleotide in the reaction solution were analyzed by gas chromatography. Add 100 ml of nicotinamide adenine dinucleotide kinase supernatant enzyme solution under stirring at 50-100 rpm, use a pH control device to monitor the pH change during the reaction in real time and adjust it with 0.1M hydrochloric acid/sodium hydroxide solution. 30 minutes of sampling and analysis of the content of oxidized nicotinamide adenine dinucleotide phosphate and nicotinamide adenine dinucleotide by the method of Experimental Example 1; after 2 hours of reaction, oxidized nicotinamide adenine dinucleotide The content of nucleotide phosphoric acid has been consumed more than 80% and the content of nicotinamide adenine dinucleotide has increased (see table below), 2-5 ml of 5M hydrochloric acid solution was added dropwise to adjust to pH 3.0 to complete the first step reaction.

After the reaction solution is stirred for 30 minutes, the nicotinamide adenine dinucleotide kinase can be removed by filtration with medium-speed filter paper or the next enzymatic reaction can be carried out directly. In the reaction solution, 1-3 ml of 5M sodium hydroxide solution was added dropwise to adjust the pH to 8.0 and the reaction conditions were maintained to carry out the second-step reaction. Add 100ml of nicotinamide adenine dinucleotide diphosphatase supernatant enzyme solution to the reaction solution, use the pH control device to monitor the pH change during the reaction in real time and adjust it with 0.1M hydrochloric acid/sodium hydroxide solution, every 30 minutes A sample was taken and analyzed for the content of oxidized nicotinamide adenine dinucleotide phosphate, nicotinamide adenine dinucleotide and β-nicotinamide mononucleotide by the method of Experimental Example 1. Reaction to 2hr, the content of nicotinamide adenine dinucleotide has been consumed more than 90% and the content of β-nicotinamide mononucleotide has increased (see the table below), and 2-5ml of 5M hydrochloric acid solution is added dropwise to adjust to pH3. 0 to end the second step reaction.

Start the next step of the reaction, add 100ml of 5'-nucleotidase supernatant enzyme solution, use the pH control device to monitor the pH change in the reaction process in real time and adjust it with 0.1M hydrochloric acid/sodium hydroxide solution, take samples every 30 minutes and The sample was analyzed for the content of β-nicotinamide mononucleotide and nicotinamide riboside by the method of Experimental Example 1. After 2 hours of the reaction, the content of β-nicotinamide mononucleotide has been consumed by more than 90% and the content of nicotinamide riboside has been increased correspondingly (see the table below), and the enzymatic preparation of nicotinamide riboside can be completed. A total of 79.5 mg of nicotinamide riboside was produced.

反应时间(分钟)Response time (minutes)	β-烟酰胺单核苷酸(μM)β-Nicotinamide mononucleotide (μM)	烟酰胺核苷(μM)Nicotinamide Riboside (μM)
00	224224	00
3030	140140	8787
6060	5757	169169
9090	3131	199199
120120	1717	231231

Embodiment 5: take oxidized nicotinamide adenine dinucleotide phosphate disodium salt as substrate and use enzyme liquid to carry out mixed enzymatic reaction to prepare nicotinamide riboside

The enzyme supernatants of nicotinamide adenine dinucleotide kinase, nicotinamide adenine dinucleotide diphosphatase and 5'-nucleotidase were prepared according to Examples 1-3 for subsequent use. Use a 2L experimental beaker to prepare the reaction solution. In the beaker, weigh 12.1g of tris, 0.24g of oxidized nicotinamide adenine dinucleotide phosphate disodium salt and 4.1g of hexahydrate in the following order. Magnesium chloride and 600ml of pure water were added, and the external stirring device was started until all the raw materials were completely dissolved. Adjust the pH value of the solution to pH 8.0 with 0.1M hydrochloric acid/sodium hydroxide, and dissolve it to 1L with pure water, connect the beaker to a constant temperature device and keep it warm for 30 minutes until the temperature of the solution is stabilized at 37°C, take a sample with a high-efficiency liquid The concentration and content of oxidized nicotinamide adenine dinucleotide phosphate, nicotinamide adenine dinucleotide, β-nicotinamide mononucleotide and nicotinamide riboside in the reaction solution were analyzed by gas chromatography (see table below). Under stirring at 50-100rpm, 100ml of nicotinamide adenine dinucleotide kinase, nicotinamide adenine dinucleotide diphosphatase and 5'-nucleotidase were added simultaneously, and the pH control device was used to monitor the reaction process in real time. The pH of the sample was changed and adjusted with 0.1M hydrochloric acid/sodium hydroxide solution, sampling every 60 minutes and analyzing the content of oxidized nicotinamide adenine dinucleotide phosphate and nicotinamide riboside by the method of Experimental Example 1 (see table below). After 3 hours of the reaction, the content of oxidized nicotinamide adenine dinucleotide phosphate has been consumed by more than 80% and the content of nicotinamide riboside has been relatively increased. The whole set of mixed enzymatic method for preparing nicotinamide riboside can be completed. Even other processes lasted 3.5 hours, and a total of 73.6 mg of nicotinamide riboside was produced. The production efficiency of the mixed enzyme group was higher than that of the step-by-step enzyme reaction.

Embodiment 6: take nicotinamide adenine dinucleotide as substrate and use enzyme supernatant to carry out mixed enzymatic reaction to prepare nicotinamide riboside

The enzyme supernatants of nicotinamide adenine dinucleotide diphosphatase and 5'-nucleotidase were prepared according to Example 2-3 for use. Use a 2L experimental beaker to prepare the reaction solution, weigh 12.1g of tris, 0.21g of nicotinamide adenine dinucleotide and 4.1g of magnesium chloride hexahydrate in the beaker in the following order, add 600ml of pure water, Start the external stirring device until all the raw materials are completely dissolved, adjust the pH of the solution to pH 8.0 with 0.1M hydrochloric acid/sodium hydroxide, and dissolve it to 1L with pure water, connect the beaker to the thermostat and keep it warm for 30 minutes until the solution is reached The temperature was stabilized at 37°C, and samples were taken to analyze the concentration and content of nicotinamide adenine dinucleotide and nicotinamide riboside in the reaction solution by high performance liquid chromatography. Add 100 ml of nicotinamide adenine dinucleotide diphosphatase and 5'-nucleotidase enzyme supernatant at the same time under stirring at 50-100 rpm, and use a pH control device to monitor the pH change during the reaction in real time and use 0.1M hydrochloric acid/sodium hydroxide solution was adjusted, and samples were taken every 60 minutes, and the content of nicotinamide adenine dinucleotide and nicotinamide riboside was analyzed on the sample by the method of Experimental Example 1. After 3 hours of reaction, the content of nicotinamide adenine dinucleotide has been consumed by more than 90% and the content of nicotinamide riboside has a corresponding increase (see the table below). The reaction can be completed, and it lasted for 3.5 hours together with other procedures, and produced a total of 72.6 mg of nicotinamide riboside. The preparation method, conditions and process are the same as in Example 5. It can be seen that the change of the substrate does not affect the production equipment and process, which shows the diversification and flexibility of the production process of the present invention.

Embodiment 7: take β-nicotinamide mononucleotide as substrate and use enzyme supernatant to carry out enzymatic reaction to prepare nicotinamide riboside

The enzyme supernatant of 5'-nucleotidase was prepared according to Example 3 for later use. Use a 2L experimental beaker to prepare the reaction solution, weigh 12.1g of tris, 0.1g of β-nicotinamide mononucleotide and 4.1g of magnesium chloride hexahydrate in the beaker in the following order and add 600ml of pure water, Start the external stirring device until all the raw materials are completely dissolved, adjust the pH of the solution to pH 8.0 with 0.1M hydrochloric acid/sodium hydroxide, and dissolve it to 1L with pure water, connect the beaker to the thermostat and keep it warm for 30 minutes until the solution is reached The temperature was stabilized at 37°C, and samples were taken to analyze the concentration and content of β-nicotinamide mononucleotide and nicotinamide riboside in the reaction solution by high performance liquid chromatography (see the table below). Add 100ml of 5'-nucleotidase supernatant at the same time under stirring at 50-100rpm, use the pH control device to monitor the pH change during the reaction in real time and adjust it with 0.1M hydrochloric acid/sodium hydroxide solution, sampling every 60 minutes The sample was analyzed for the content of β-nicotinamide mononucleotide and nicotinamide riboside by the method of Experimental Example 1; when the reaction was 3 hours, the content of β-nicotinamide mononucleotide had been consumed by more than 90% and the nicotinamide The content of nicotinamide riboside has a corresponding increase (see the table below), and the enzymatic preparation of nicotinamide riboside by the entire mixed enzyme group is completed, and a total of 75.1 mg of nicotinamide riboside is produced. The process flow is the same as that of Example 5-6.

反应时间(分钟)Response time (minutes)	β-烟酰胺单核苷酸(μM)β-Nicotinamide mononucleotide (μM)	烟酰胺核苷(μM)Nicotinamide Riboside (μM)
00	270270	00
6060	182182	9191
120120	8888	192192
180180	21twenty one	268268

Embodiment 8: take oxidized nicotinamide adenine dinucleotide phosphate disodium salt as substrate and use immobilized enzyme to carry out the enzymatic reaction of mixed enzyme group to prepare nicotinamide riboside

According to the method of Example 3 of Chinese Patent CN1982445B (the entire content of which is incorporated herein by reference), a mixture containing nicotinamide adenosine dinucleoside was prepared on a solid-phase carrier in the weight ratio of the total protein of the enzyme solution shown in the table below. Immobilized enzymes of acid kinase, nicotinamide adenine dinucleotide diphosphatase and 5'-nucleotidase; the shapes of the carriers are all strips: length 25cm, width 5cm, thickness 5mm, the weight of the finished immobilized enzyme 37.4g, 2420ml of nicotinamide adenine dinucleotide kinase enzyme supernatant, 2165ml of nicotinamide adenine dinucleotide diphosphatase enzyme supernatant and 698ml of 5'-nucleotidase enzyme supernatant. The total enzymatic activity of the immobilized enzyme was 1.2 nmol/min/g. The method for determining the enzymatic activity is: add a total of 20 mg to 1 ml of the reaction solution (200 mM tris-hydrochloric acid pH 8.0, 20 mM oxidized nicotinamide adenine dinucleotide phosphate disodium salt, 16 mM magnesium chloride hexahydrate). Use scissors to cut the above-mentioned immobilized enzyme product into rectangular particles with a length of 3mm x width 3mm x height 5mm, and carry out the reaction for 5 minutes under the temperature control of 37 degrees Celsius and the shaking of 1000rpm. The content of nicotinamide riboside produced in the enzymatic reaction was analyzed.

The immobilized enzyme carrier prepared above was installed in an immobilized enzyme reactor. The reactor is a cylinder made of plexiglass, with a height of 7 cm and a radius of 4.5 cm. Use a knife to neatly shave off about 3 cm of the head and tail ends of the above-mentioned carrier with a slope of 45°, and roll it tightly into a homogeneous cylinder with a height of 5 cm and a radius of 2.5 cm, and the weight is 7.8 g. The cylinder was inserted into the reactor so that its tightness conformed to the level 3 standard described in Table 1 in the Chinese patent application for invention CN106032520A (the entire contents of which are incorporated herein by reference), and its sidewall was No gaps were left between the inner walls of the reactor. After the installation is completed, the installation procedure of other equipment is carried out according to CN106032520A Figure 1, in which the capacity of the reaction control tank is 1L; the high flow pump is an adjustable flow suction pump with a flow rate of 0.5L/min; the pH control device adopts 0.1M hydrochloric acid/ The pH of the sodium hydroxide solution is regulated, and the flow rate of the dosing pump is 1ml per minute.

In the reaction control tank, add 9.68g of tris(hydroxymethyl)aminomethane, 2.36g of oxidized nicotinamide adenine dinucleotide phosphate disodium salt and 3.3g of magnesium chloride hexahydrate in the following order and add 550ml of pure water, start Stirring device until all raw materials are completely dissolved, adjust the pH value of the solution to pH 8.0 with 0.1M hydrochloric acid/sodium hydroxide, and dissolve to 800ml with pure water, connect the reaction control tank to a high-flow water pump and install the above three kinds of fixed The reaction was started in the reactor of the enzyme, and the samples were taken every 60 minutes, and the content changes of oxidized nicotinamide adenine dinucleotide phosphate and nicotinamide riboside in the reaction solution were analyzed by high performance liquid chromatography in Experimental Example 1. , after 1.5hr reaction, the concentration of oxidized nicotinamide adenine dinucleotide phosphate has been reduced to 0.3mM and the content of nicotinamide riboside has a corresponding increase in the reaction solution (see the table below), the reaction is over to produce a total of 550mg Nicotinamide Riboside. Since the three supernatant enzyme solutions are evenly immobilized on the same carrier, the enzymatic reaction is more compact, which improves the reaction speed and conversion rate, and at the same time saves the production process and makes the operation easier. The immobilized enzyme has the advantage of being reusable, and will be more beneficial to industrialization in terms of technology and cost.

Example 9: Preparation of nicotinic acid adenine dinucleotide, nicotinic acid mononucleotide and nicotinic acid nucleoside by step-by-step enzymatic reaction with nicotinic acid adenine dinucleotide phosphate sodium salt as substrate and supernatant enzyme solution glycosides

The enzyme supernatants of nicotinamide adenine dinucleotide kinase, nicotinamide adenine dinucleotide diphosphatase and 5'-nucleotidase were prepared according to Examples 1-3 for subsequent use. Use a 25 ml laboratory beaker to prepare the reaction solution, weigh 120 mg of tris, 0.74 mg of niacin adenine dinucleotide phosphate sodium salt and 41 mg of magnesium chloride hexahydrate in the following order and add 5 ml of pure Water, use magnetic stirring until all raw materials are completely dissolved, adjust the pH of the solution to pH 8.0 with 0.01M hydrochloric acid/sodium hydroxide, and dissolve to 10ml with pure water, place the beaker in a constant temperature water bed and keep it warm for 30 Minutes until the temperature of the solution stabilized at 37 ° C, sampling and analyzing the nicotinic acid adenine dinucleotide phosphate, nicotinic acid adenine dinucleotide, and nicotinic acid mononucleoside in the reaction solution by the high performance liquid chromatography method of Experimental Example 1 Acid and nicotinic riboside concentrations and content (see table below). Add 1ml of nicotinamide adenine dinucleotide kinase supernatant enzyme solution under stirring at 50-100rpm, use a pH control device to monitor the pH change during the reaction in real time and adjust it with 0.1M hydrochloric acid/sodium hydroxide solution. A sample was taken at 60 minutes and analyzed for the content of niacin adenine dinucleotide phosphate, niacin adenine dinucleotide, nicotinic acid mononucleotide and nicotinic acid riboside. After 2 hours of reaction, the content of niacin adenine dinucleotide phosphate has been consumed by more than 70%, and the content of niacin adenine dinucleotide has a corresponding increase, and 0.1-0.3 ml of 5M hydrochloric acid solution is added dropwise to adjust to pH3 .0 to end the first step reaction to obtain the target product nicotinic acid adenine dinucleotide. If nicotinic acid mononucleotide or nicotinic acid riboside is used as the target product, a second step reaction is required. After filtering the reaction solution, use 0.1M sodium hydroxide to adjust to pH 8.0, add 1ml of nicotinamide adenine dinucleotide diphosphatase supernatant enzyme solution; react the content of nicotinamide adenine dinucleotide for 2hr More than 80% has been consumed and the content of niacin mononucleotide has been increased accordingly. 0.1-0.3 ml of 5M hydrochloric acid solution is added dropwise to adjust the pH to 3.0 to complete the second step reaction to obtain the target product nicotinic acid mononucleotide. Taking nicotinic acid riboside as the target product, the third step reaction is required. After repeating the above treatment, 1 ml of 5'-nucleotidase supernatant enzyme solution is added. The content of nicotinic acid riboside has a corresponding increase, which can end the whole set of reactions (see table below).

The use of enzymes can also be converted to nicotinic acid riboside from nicotinic acid adenine dinucleotide and nicotinic acid mononucleotide as substrates in the manner of Examples 6-7, respectively.

Embodiment 10: take oxidized nicotinamide adenine dinucleotide phosphate disodium salt as substrate and use enzyme liquid to carry out mixed enzymatic reaction at 25 degrees Celsius to prepare nicotinamide riboside

The enzyme supernatants of nicotinamide adenine dinucleotide kinase, nicotinamide adenine dinucleotide diphosphatase and 5'-nucleotidase were prepared according to Examples 1-3 for subsequent use. Use a 2L experimental beaker to prepare the reaction solution. In the beaker, weigh 12.1g of tris, 0.24g of oxidized nicotinamide adenine dinucleotide phosphate disodium salt and 4.1g of hexahydrate in the following order. Magnesium chloride and 600ml of pure water were added, and the external stirring device was started until all the raw materials were completely dissolved. Adjust the pH value of the solution to pH 8.0 with 0.1M hydrochloric acid/sodium hydroxide, and dissolve it to 1L with pure water, connect the beaker to a constant temperature device and keep it warm for 30 minutes until the temperature of the solution is stable at 25°C, take a sample with high-efficiency liquid The concentration and content of oxidized nicotinamide adenine dinucleotide phosphate, nicotinamide adenine dinucleotide, β-nicotinamide mononucleotide and nicotinamide riboside in the reaction solution were analyzed by gas chromatography (see table below). Under stirring at 50-100rpm, 100ml of nicotinamide adenine dinucleotide kinase, nicotinamide adenine dinucleotide diphosphatase and 5'-nucleotidase were added simultaneously, and the pH control device was used to monitor the reaction process in real time. The pH of the sample was changed and adjusted with 0.1M hydrochloric acid/sodium hydroxide solution, sampling every 60 minutes and analyzing the content of oxidized nicotinamide adenine dinucleotide phosphate and nicotinamide riboside by the method of Experimental Example 1 (see table below). After 8 hours of the reaction, the content of oxidized nicotinamide adenine dinucleotide phosphate has been consumed by more than 20% and the content of nicotinamide riboside has been relatively increased. The whole set of mixed enzymatic method for preparing nicotinamide riboside can be completed. Even other processes lasted for 10 hours, and a total of 16.2 mg of nicotinamide riboside was produced.

Embodiment 11: take oxidized nicotinamide adenine dinucleotide phosphate disodium salt as substrate and use enzyme liquid to carry out mixed enzymatic reaction at 40 degrees Celsius to prepare nicotinamide riboside

The enzyme supernatants of nicotinamide adenine dinucleotide kinase, nicotinamide adenine dinucleotide diphosphatase and 5'-nucleotidase were prepared according to Examples 1-3 for subsequent use. Use a 2L experimental beaker to prepare the reaction solution. In the beaker, weigh 12.1g of tris, 0.24g of oxidized nicotinamide adenine dinucleotide phosphate disodium salt and 4.1g of hexahydrate in the following order. Magnesium chloride and 600ml of pure water were added, and the external stirring device was started until all the raw materials were completely dissolved. Adjust the pH value of the solution to pH 8.0 with 0.1M hydrochloric acid/sodium hydroxide, and dissolve it to 1L with pure water, connect the beaker to a constant temperature device and keep it warm for 30 minutes until the temperature of the solution is stable at 40°C, and take a high-efficiency solution for sampling. Analysis of the concentration and content of oxidized nicotinamide adenine dinucleotide phosphate, nicotinamide adenine dinucleotide, β-nicotinamide mononucleotide and nicotinamide riboside in the reaction solution by phase chromatography (see table below) . Under stirring at 50-100rpm, 100ml of nicotinamide adenine dinucleotide kinase, nicotinamide adenine dinucleotide diphosphatase and 5'-nucleotidase were added simultaneously, and the pH control device was used to monitor the reaction process in real time. The pH of the sample was changed and adjusted with 0.1M hydrochloric acid/sodium hydroxide solution, sampling every 60 minutes and analyzing the content of oxidized nicotinamide adenine dinucleotide phosphate and nicotinamide riboside by the method of Experimental Example 1 (see table below). After 8 hours of reaction, the content of oxidized nicotinamide adenine dinucleotide phosphate has been consumed by more than 40% and the content of nicotinamide riboside has been relatively increased, and the whole set of mixed enzymatic method for preparing nicotinamide riboside can be completed. Even other processes lasted for 10 hours, and a total of 16.2 mg of nicotinamide riboside was produced.

Embodiment 12: take oxidized nicotinamide adenine dinucleotide phosphate disodium salt as substrate and use enzyme supernatant to carry out mixed enzymatic reaction under pH5 regulation to prepare nicotinamide riboside

The enzyme supernatants of nicotinamide adenine dinucleotide kinase, nicotinamide adenine dinucleotide diphosphatase and 5'-nucleotidase were prepared according to Examples 1-3 for subsequent use. Use a 2L experimental beaker to prepare the reaction solution. In the beaker, weigh 12.1g of tris, 0.24g of oxidized nicotinamide adenine dinucleotide phosphate disodium salt and 4.1g of hexahydrate in the following order. Magnesium chloride and 600ml of pure water were added, and the external stirring device was started until all the raw materials were completely dissolved. Adjust the pH value of the solution to pH 5.0 with 0.1M hydrochloric acid/sodium hydroxide, and dissolve it to 1L with pure water, connect the beaker to a constant temperature device and keep it warm for 30 minutes until the temperature of the solution is stabilized at 37°C, take a sample with high-efficiency liquid The concentration and content of oxidized nicotinamide adenine dinucleotide phosphate, nicotinamide adenine dinucleotide, β-nicotinamide mononucleotide and nicotinamide riboside in the reaction solution were analyzed by gas chromatography (see table below). Under stirring at 50-100rpm, 100ml of nicotinamide adenine dinucleotide kinase, nicotinamide adenine dinucleotide diphosphatase and 5'-nucleotidase were added simultaneously, and the pH control device was used to monitor the reaction process in real time. The pH of the sample was changed and adjusted with 0.1M hydrochloric acid/sodium hydroxide solution, sampling every 60 minutes and analyzing the content of oxidized nicotinamide adenine dinucleotide phosphate and nicotinamide riboside by the method of Experimental Example 1 (see table below). After 8 hours of the reaction, the content of oxidized nicotinamide adenine dinucleotide phosphate has been consumed by more than 20% and the content of nicotinamide riboside has been relatively increased. The whole set of mixed enzymatic method for preparing nicotinamide riboside can be completed. Even other processes lasted for 8 hours, and a total of 14.1 mg of nicotinamide riboside was produced.

Embodiment 13: take oxidized nicotinamide adenine dinucleotide phosphate disodium salt as substrate and use enzyme supernatant to carry out mixed enzymatic reaction under pH10 regulation to prepare nicotinamide riboside

The enzyme supernatants of nicotinamide adenine dinucleotide kinase, nicotinamide adenine dinucleotide diphosphatase and 5'-nucleotidase were prepared according to Examples 1-3 for subsequent use. Use a 2L experimental beaker to prepare the reaction solution. In the beaker, weigh 12.1g of tris, 0.24g of oxidized nicotinamide adenine dinucleotide phosphate disodium salt and 4.1g of hexahydrate in the following order. Magnesium chloride and 600ml of pure water were added, and the external stirring device was started until all the raw materials were completely dissolved. Adjust the pH of the solution to pH 10.0 with 0.1M hydrochloric acid/sodium hydroxide, and dissolve it to 1L with pure water. Connect the beaker to a constant temperature device and keep it warm for 30 minutes until the temperature of the solution is stable at 37°C. Liquid chromatography analysis of the concentration and content of oxidized nicotinamide adenine dinucleotide phosphate, nicotinamide adenine dinucleotide, β-nicotinamide mononucleotide and nicotinamide riboside in the reaction solution (see table below) . Under stirring at 50-100rpm, 100ml of nicotinamide adenine dinucleotide kinase, nicotinamide adenine dinucleotide diphosphatase and 5'-nucleotidase were added simultaneously, and the pH control device was used to monitor the reaction process in real time. The pH of the sample was changed and adjusted with 0.1M hydrochloric acid/sodium hydroxide solution, sampling every 60 minutes and analyzing the content of oxidized nicotinamide adenine dinucleotide phosphate and nicotinamide riboside by the method of Experimental Example 1 (see table below). After 8 hours of reaction, the content of oxidized nicotinamide adenine dinucleotide phosphate has been consumed by more than 30% and the content of nicotinamide riboside has been relatively increased, and the whole set of mixed enzymatic method for preparing nicotinamide riboside can be completed. Even other processes lasted for 8 hours, and a total of 22.3 mg of nicotinamide riboside was produced.

Experimental Example 1: High Performance Liquid Chromatography Analysis Parameters

时间(min)time (min)	流速(ml/min)Flow rate (ml/min)	％流动相A% mobile phase A	％流动相B% Mobile Phase B
00	0.80.8	100100	00

11	0.80.8	100100	00
1313	0.80.8	90.590.5	9.59.5
1616	0.80.8	8585	1515
1818	0.80.8	6161	3939
2626	0.80.8	6161	3939
2828	0.80.8	5050	5050
3131	0.80.8	5050	5050
3232	0.80.8	100100	00
3333	0.80.8	100100	00
3535	1.01.0	100100	00
38.538.5	1.01.0	100100	00
39.539.5	0.80.8	100100	00

Claims

A method for preparing a nucleoside of nicotinic acid or a derivative thereof, comprising using a 5'-nucleotidase to react with a mononucleotide of nicotinic acid or a derivative thereof or a salt thereof as a substrate, wherein the 5'-nucleotidase - The amino acid sequence of the nucleotidase is shown in SEQ ID NO.1.
The method of claim 1, wherein the riboside of nicotinic acid or a derivative thereof is selected from at least one of nicotinamide riboside and nicotinic acid riboside; wherein the nicotinamide riboside comprises an oxidized alpha- Nicotinamide riboside, oxidized beta-nicotinamide riboside, reduced alpha-nicotinamide riboside and reduced beta-nicotinamide riboside, said nicotinic acid riboside including oxidized alpha-nicotinic acid riboside, oxidized Beta-nicotinic acid riboside, reduced alpha-nicotinic acid riboside, and reduced beta-nicotinic acid riboside.
The method of claim 1, wherein the mononucleotide of nicotinic acid or a derivative thereof is selected from at least one of nicotinamide mononucleotide and nicotinic acid mononucleotide; wherein the nicotinamide mononucleotide Nucleotides include oxidized alpha-nicotinamide mononucleotide, oxidized beta-nicotinamide mononucleotide, reduced alpha-nicotinamide mononucleotide and reduced beta-nicotinamide mononucleotide, the Niacin mononucleotide includes oxidized alpha-nicotinic acid mononucleotide, oxidized beta-nicotinic acid mononucleotide, reduced alpha-nicotinic acid mononucleotide and reduced beta-nicotinic acid mononucleotide .
The method according to claim 1, wherein the method further comprises using nicotinamide adenine dinucleotide diphosphatase to react with adenine dinucleotide of nicotinic acid or a derivative thereof or a salt thereof as a substrate, Wherein the amino acid sequence of the nicotinamide adenine dinucleotide diphosphatase is shown in SEQ ID NO.2.
The method of claim 4, wherein the adenine dinucleotide of nicotinic acid or a derivative thereof is selected from at least one of nicotinamide adenine dinucleotide and nicotinic acid adenine dinucleotide; Wherein the nicotinamide adenine dinucleotide includes oxidized α-nicotinamide adenine dinucleotide, oxidized β-nicotinamide adenine dinucleotide, and reduced α-nicotinamide adenine dinucleotide and reduced β-nicotinamide adenine dinucleotides, the nicotinic acid adenine dinucleotides include oxidized α-nicotinic acid adenine dinucleotides, oxidized β-nicotinic acid adenine dinucleotides , reduced α-nicotinic acid adenine dinucleotide and reduced β-nicotinic acid adenine dinucleotide.
The method of claim 4, wherein the method further comprises using nicotinamide adenine dinucleotide kinase to react with adenine dinucleotide phosphate or a salt thereof of nicotinic acid or a derivative thereof as a substrate, wherein The amino acid sequence of the nicotinamide adenine dinucleotide kinase is shown in SEQ ID NO.3.
The method of claim 6, wherein the adenine dinucleotide phosphate of nicotinic acid or a derivative thereof is selected from at least the group consisting of nicotinamide adenine dinucleotide phosphate and nicotinic acid adenine dinucleotide phosphate One; wherein the nicotinamide adenine dinucleotide phosphate includes oxidized α-nicotinamide adenine dinucleotide phosphate, oxidized β-nicotinamide adenine dinucleotide phosphate, reduced α-nicotinamide Adenine dinucleotide phosphate and reduced beta-nicotinamide adenine dinucleotide phosphate, said nicotinic acid adenine dinucleotide phosphate including oxidized alpha-nicotinic acid adenine dinucleotide phosphate, oxidized form β-Nicotinic acid adenine dinucleotide phosphate, reduced α-nicotinic acid adenine dinucleotide phosphate, and reduced β-nicotinic acid adenine dinucleotide phosphate.
The method of claim 1, comprising combining nicotinamide adenine dinucleotide kinase, nicotinamide adenine dinucleotide diphosphatase, and 5'-nucleotidase with nicotinamide adenine dinucleotide phosphate or its salts are mixed, and the reaction is carried out for 1.5-8 hours, wherein the amino acid sequences of the nicotinamide adenine dinucleotide kinase and the nicotinamide adenine dinucleotide diphosphatase are respectively as SEQ ID NO.3 and SEQ ID NO.2 is shown.
The method of claim 1, comprising mixing nicotinamide adenine dinucleotide diphosphatase and 5'-nucleotidase with nicotinamide adenine dinucleotide or a salt thereof, allowing the reaction to proceed for 1.5-8 hours, wherein the amino acid sequence of the nicotinamide adenine dinucleotide diphosphatase is shown in SEQ ID NO.2.
The method of claim 1, comprising the steps of:

1) nicotinamide adenine dinucleotide kinase is mixed with nicotinamide adenine dinucleotide phosphate or its salt, and its reaction produces nicotinamide adenine dinucleotide or its salt;

2) When the amount of the nicotinamide adenine dinucleotide phosphate or its salt drops below 20-100% of the initial reaction in step 1), the nicotinamide adenine dinucleotide or Its salt is mixed with nicotinamide adenine dinucleotide diphosphatase to react to produce nicotinamide mononucleotide or its salt;

3) When the amount of the nicotinamide adenine dinucleotide or its salt drops to below 10-100% of the initial reaction in step 2), mix the nicotinamide mononucleotide or its salt with 5'-nucleotidase is mixed to react to produce nicotinamide riboside;

Wherein the amino acid sequences of nicotinamide adenine dinucleotide kinase and nicotinamide adenine dinucleotide diphosphatase are shown in SEQ ID NO.3 and SEQ ID NO.2 respectively.
The method of claim 1, comprising the steps of:

1) mixing nicotinamide adenine dinucleotide or its salt with nicotinamide adenine dinucleotide diphosphatase, and making it react to produce nicotinamide mononucleotide or its salt;

II) When the amount of the nicotinamide adenine dinucleotide or its salt drops below 10-100% of the initial reaction of the step I), mixing the nicotinamide mononucleotide or its salt with 5'-nucleotidase is mixed to react to produce nicotinamide riboside;

Wherein the amino acid sequence of the nicotinamide adenine dinucleotide diphosphatase is shown in SEQ ID NO.2.
The method according to any one of claims 3, 10, 11, wherein the weight ratio of the 5'-nucleotidase and the nicotinamide mononucleotide or a salt thereof is (0.01-10): 1 .
The method according to any one of claims 5, 10, 11, wherein the weight ratio of the nicotinamide adenine dinucleotide diphosphatase and the nicotinamide adenine dinucleotide or a salt thereof is ( 0.01-10):1.
The method according to claim 7 or 10, wherein the weight ratio of the nicotinamide adenine dinucleotide kinase and the nicotinamide adenine dinucleotide phosphate or a salt thereof is (0.01-10):1.
Use of nicotinamide adenine dinucleotide kinase, nicotinamide adenine dinucleotide diphosphatase and/or 5'-nucleotidase in the preparation of nucleosides of nicotinic acid or derivatives thereof, wherein the nicotinic acid Amino acid sequences of amide adenine dinucleotide kinase, said nicotinamide adenine dinucleotide diphosphatase and said 5'-nucleotidase are respectively as SEQ ID NO.3, SEQ ID NO.2 and SEQ ID NO.2 ID NO.1.
The use according to claim 15, wherein the riboside of nicotinic acid or a derivative thereof is selected from at least one of nicotinamide riboside and nicotinic acid riboside; wherein the nicotinamide riboside comprises oxidized α- Nicotinamide riboside, oxidized beta-nicotinamide riboside, reduced alpha-nicotinamide riboside and reduced beta-nicotinamide riboside, said nicotinic acid riboside including oxidized alpha-nicotinic acid riboside, oxidized Beta-nicotinic acid riboside, reduced alpha-nicotinic acid riboside, and reduced beta-nicotinic acid riboside.
An enzyme composition comprising:

Nicotinamide adenine dinucleotide kinase, nicotinamide adenine dinucleotide diphosphatase and 5'-nucleotidase, wherein the molar ratio of the three enzymes is (0.01-2):(0.01-2 ):(0.01-1); or

Nicotinamide adenine dinucleotide diphosphatase and 5'-nucleotidase, wherein the molar ratio of the two enzymes is (0.01-9):(0.01-9); and

Wherein the amino acid sequences of the nicotinamide adenine dinucleotide kinase, the nicotinamide adenine dinucleotide diphosphatase and the 5'-nucleotidase are as shown in SEQ ID NO.3 and SEQ ID NO, respectively. .2 and SEQ ID NO.1.
Use of the enzyme composition according to claim 17 in the preparation of nucleosides of nicotinic acid or its derivatives.
The use according to claim 18, wherein the riboside of nicotinic acid or a derivative thereof is selected from at least one of nicotinamide riboside and nicotinic acid riboside; wherein the nicotinamide riboside comprises oxidized α- Nicotinamide riboside, oxidized beta-nicotinamide riboside, reduced alpha-nicotinamide riboside and reduced beta-nicotinamide riboside, said nicotinic acid riboside including oxidized alpha-nicotinic acid riboside, oxidized Beta-nicotinic acid riboside, reduced alpha-nicotinic acid riboside, and reduced beta-nicotinic acid riboside.
The method of claim 1, comprising combining nicotinamide adenine dinucleotide kinase, nicotinamide adenine dinucleotide diphosphatase and 5'-nucleotidase with nicotinamide adenine dinucleotide phosphate or its salts are mixed, and the reaction is carried out for 1.5-8 hours, wherein the amino acid sequences of the nicotinamide adenine dinucleotide kinase and the nicotinamide adenine dinucleotide diphosphatase are respectively as SEQ ID NO.3 and SEQ ID NO.2 is shown.
The method of claim 1, comprising mixing nicotinamide adenine dinucleotide diphosphatase and 5'-nucleotidase with nicotinic acid adenine dinucleotide or a salt thereof, allowing the reaction to proceed for 1.5-8 hours, wherein the amino acid sequence of the nicotinamide adenine dinucleotide diphosphatase is shown in SEQ ID NO.2.
The method of claim 1, comprising the steps of:

1) mixing nicotinamide adenine dinucleotide kinase with nicotinic acid adenine dinucleotide phosphate or its salt, and making it react to produce nicotinic acid adenine dinucleotide or its salt;

2) When the amount of the nicotinic acid adenine dinucleotide phosphate or its salt drops to below 30-100% of the initial reaction in step 1), the nicotinic acid adenine dinucleotide or Its salt is mixed with nicotinamide adenine dinucleotide diphosphatase to react to produce nicotinic acid mononucleotide or its salt;

3) When the amount of the nicotinic acid adenine dinucleotide or its salt drops to below 20-100% of the initial reaction in step 2), mix the nicotinic acid mononucleotide or its salt with 5'-nucleotidase is mixed to react to produce nicotinic acid riboside;

Wherein the amino acid sequences of nicotinamide adenine dinucleotide kinase and nicotinamide adenine dinucleotide diphosphatase are shown in SEQ ID NO.3 and SEQ ID NO.2 respectively.
The method of claim 1, comprising the steps of:

1) mixing nicotinic acid adenine dinucleotide or its salt with nicotinamide adenine dinucleotide diphosphatase, and making it react to produce nicotinic acid mononucleotide or its salt;

II) When the amount of the nicotinic acid adenine dinucleotide or its salt drops below 20-100% of the initial reaction of the step I), mixing the nicotinic acid mononucleotide or its salt with 5'-nucleotidase is mixed to react to produce nicotinic acid riboside;

Wherein the amino acid sequence of the nicotinamide adenine dinucleotide diphosphatase is shown in SEQ ID NO.2.
The method according to any one of claims 3, 22, 23, wherein the weight ratio of the 5'-nucleotidase and the nicotinic acid mononucleotide or a salt thereof is (0.01-10): 1 .
The method according to any one of claims 5, 22, 23, wherein the weight ratio of the nicotinamide adenine dinucleotide diphosphatase and the nicotinic acid adenine dinucleotide or a salt thereof is ( 0.01-10):1.
The method according to any one of claims 7, 22, 23, wherein the weight ratio of the nicotinamide adenine dinucleotide kinase and the nicotinic acid adenine dinucleotide phosphate or a salt thereof is (0.01 -10):1.
A method for preparing nicotinic acid adenine dinucleotide by an enzymatic method, comprising using nicotinamide adenine dinucleotide kinase to react with nicotinic acid adenine dinucleotide phosphate or a salt thereof as a substrate, wherein the The amino acid sequence of nicotinamide adenine dinucleotide kinase is shown in SEQ ID NO.3; wherein the nicotinic acid adenine dinucleotide includes oxidized α-nicotinic acid adenine dinucleotide, oxidized β- Niacin adenine dinucleotide, reduced alpha-nicotinic acid adenine dinucleotide and reduced beta-nicotinic adenine dinucleotide, said niacin adenine dinucleotide phosphate including oxidized alpha -Nicotinic acid adenine dinucleotide phosphate, oxidized β-nicotinic acid adenine dinucleotide phosphate, reduced α-nicotinic acid adenine dinucleotide phosphate, and reduced β-nicotinic acid adenine dinucleotide phosphate acid phosphoric acid.
The method of claim 27, wherein the weight ratio of the nicotinamide adenine dinucleotide kinase and the nicotinic acid adenine dinucleotide phosphate or a salt thereof is (0.01-10):1.
A method for preparing nicotinic acid mononucleotide by an enzymatic method, comprising using nicotinamide adenine dinucleotide diphosphatase to react with nicotinic acid adenine dinucleotide or a salt thereof as a substrate, wherein the nicotinic acid The amino acid sequence of amide adenine dinucleotide diphosphatase is shown in SEQ ID NO.2; wherein said nicotinic acid mononucleotide includes oxidized alpha-nicotinic acid mononucleotide, oxidized beta-nicotinic acid mononucleotide Nucleotides, reduced alpha-nicotinic acid mononucleotides and reduced beta-nicotinic acid mononucleotides, said nicotinic acid adenine dinucleotides including oxidized alpha-nicotinic acid adenine dinucleotides, Oxidized beta-nicotinic adenine dinucleotide, reduced beta-nicotinic adenine dinucleotide, and reduced beta-nicotinic adenine dinucleotide.
The method of claim 29, wherein the method further comprises reacting using nicotinamide adenine dinucleotide kinase with nicotinamide adenine dinucleotide phosphate or a salt thereof as a substrate, wherein the nicotinamide adenine dinucleotide kinase The amino acid sequence of purine dinucleotide kinase is shown in SEQ ID NO.3; wherein the nicotinic acid adenine dinucleotide phosphate includes oxidized alpha-nicotinic acid adenine dinucleotide phosphate, oxidized beta-nicotinic acid adenine dinucleotide phosphate acid adenine dinucleotide phosphate, reduced alpha-nicotinic acid adenine dinucleotide phosphate and reduced beta-nicotinic acid adenine dinucleotide phosphate.
The method of claim 29, comprising mixing nicotinamide adenine dinucleotide kinase and nicotinamide adenine dinucleotide diphosphatase with nicotinamide adenine dinucleotide phosphate or a salt thereof to allow the reaction to proceed 1.5-8 hours, wherein the amino acid sequences of the nicotinamide adenine dinucleotide kinase and the nicotinamide adenine dinucleotide diphosphatase are respectively shown in SEQ ID NO.3 and SEQ ID NO.2.
The method of claim 29, comprising the steps of:

1) mixing nicotinamide adenine dinucleotide kinase with nicotinic acid adenine dinucleotide phosphate or its salt, and making it react to produce nicotinic acid adenine dinucleotide or its salt;

2) When the amount of the nicotinic acid adenine dinucleotide phosphate or its salt drops to below 30-100% of the initial reaction in step 1), the nicotinic acid adenine dinucleotide or Its salt is mixed with nicotinamide adenine dinucleotide diphosphatase to react to produce nicotinic acid mononucleotide;

Wherein the amino acid sequences of nicotinamide adenine dinucleotide kinase and nicotinamide adenine dinucleotide diphosphatase are shown in SEQ ID NO.3 and SEQ ID NO.2 respectively.
The method of claim 29, wherein the weight ratio of the nicotinamide adenine dinucleotide diphosphatase and the nicotinic acid adenine dinucleotide or a salt thereof is (0.01-10):1.
The method of claim 30, wherein the weight ratio of the nicotinamide adenine dinucleotide kinase and the nicotinic acid adenine dinucleotide phosphate or a salt thereof is (0.01-10):1.
The method of any one of claims 1-34, wherein each reaction is carried out at 25-40°C, pH 5-10.
34. The method of any one of claims 1-34, wherein each reaction is carried out in the presence of 0.01 ppm to 100,000 ppm of one or more ions.
37. The method of claim 36, wherein the ions include metal ions, chloride ions, carbonate ions, sulfite ions, and phosphorus ions.
The method of any one of claims 1-34, wherein the nicotinamide adenine dinucleotide kinase, the nicotinamide adenine dinucleotide diphosphatase, and the 5'-nucleotide Enzymes are obtained by bioengineering and microbial fermentation.
The method of any one of claims 1-34, wherein the nicotinamide adenine dinucleotide kinase, the nicotinamide adenine dinucleotide diphosphatase, and the 5'-nucleotide Enzymes are provided as immobilized enzymes/cells.
Use of nicotinamide adenine dinucleotide kinase and/or nicotinamide adenine dinucleotide diphosphatase in the preparation of nicotinamide adenine dinucleotide and nicotinic acid mononucleotide, wherein the nicotinamide adenine dinucleotide The amino acid sequences of the purine dinucleotide kinase, the nicotinamide adenine dinucleotide diphosphatase and the 5'-nucleotidase are respectively as SEQ ID NO.3, SEQ ID NO.2 and SEQ ID NO .1; wherein said nicotinic acid mononucleotide includes oxidized alpha-nicotinic acid mononucleotide, oxidized beta-nicotinic acid mononucleotide, reduced alpha-nicotinic acid mononucleotide and reduced form β-nicotinic acid mononucleotide, the nicotinic acid adenine dinucleotide includes oxidized α-nicotinic acid adenine dinucleotide, oxidized β-nicotinic acid adenine dinucleotide, reduced α- Nicotinic acid adenine dinucleotide and reduced beta-nicotinic acid adenine dinucleotide.
The application of the composition of the enzyme according to claim 17 in the preparation of nicotinic acid adenine dinucleotide and nicotinic acid mononucleotide; wherein said nicotinic acid mononucleotide comprises oxidized α-nicotinic acid mononuclear Niacin, oxidized beta-nicotinic acid mononucleotide, reduced alpha-nicotinic acid mononucleotide, and reduced beta-nicotinic acid mononucleotide, said nicotinic acid adenine dinucleotide including oxidized alpha -Nicotinic acid adenine dinucleotide, oxidized beta-nicotinic acid adenine dinucleotide, reduced alpha-nicotinic acid adenine dinucleotide and reduced beta-nicotinic acid adenine dinucleotide.