CN108277209A

CN108277209A - It is a kind of control rice cold tolerance gene and its application

Info

Publication number: CN108277209A
Application number: CN201710008580.2A
Authority: CN
Inventors: 林拥军; 刘瑜; 许纯珏; 张利娜; 周菲; 马伟华; 陈浩
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2017-01-05
Filing date: 2017-01-05
Publication date: 2018-07-13

Abstract

The invention belongs to field of plant genetic, and in particular to it is a kind of control rice cold tolerance gene and its application.A kind of gene OsCPK24 by induction of chilling stress, nucleotide sequence such as SEQ ID NO have been detached from rice：Shown in 1, the protein sequence such as SEQ ID NO of the gene code：Shown in 2.The CDS of OsCPK24 is cloned on pC1300s, overexpression vector is obtained；SEQ ID NO will be contained：3 sequence is cloned on pDS1301, is obtained RNAi and is inhibited expression vector, is transferred to respectively in rice varieties Nipponbare, is obtained OsCPK24 overexpression transgenosis systems and is inhibited expression system.Under cold stress, the overexpression transgenosis system survival rate of acquisition is higher than wild type, inhibits transgenosis system survival rate lower than wild type, shows that OsCPK24 genes have the function of adjusting rice cold tolerance.The present invention provides new resource for plant and rice cold-tolerance breeding.

Description

It is a kind of control rice cold tolerance gene and its application

Technical field

The invention belongs to field of plant genetic.More particularly to a kind of gene of control rice cold tolerance OsCPK24 and its application.

Background technology

Rice (Oryza sativa) is second-biggest-in-the-world cereal crops, and yield accounts for about the 1/3 of world food total yield.Rice Originating from the torrid zone or subtropical zone, belong to thermophilic crops, it is very sensitive to low temperature.Chilling injury is to influence rice steady production One of main adverse circumstance.There are about 15,000,000 hm every year in the whole world²Rice is by cold stress (Lou et al., 2007.Euphytica 158:87-89), in South Asia and Southeast Asia, there are about 7,000,000 hm²Area cannot plant modern rice varieties because of low temperature effect (Sthapit et al.,1998.Crop Sci 38:660-666), and China every year because damage to plants caused by sudden drop in temperature lose about 5,000,000,000 kg (Pan of paddy Quintessence etc., 2010, Chinese agronomy notification, 2010,26 (17)：54-59).Bud Bursting Period in Rice and seedling stage, which damage to plants caused by sudden drop in temperature, mostly occurs in China head River basin morning rice region and the high latitude such as cloud, expensive, river and rice region in one season of high hypo, these rice regions are in paddy growth Chang Yuhan early period Tide invasion, non-cold-resistant kind young shoot and seedling stop growing, and easily lead to seedling rot, dead seedling or weak seedling, heading dispersion, and the maturity period differs Phenomena such as cause, seriously affects rice yield (Andaya et al., 2003.J Exp Bot 54:2579-2585；Fujino et al.,2004.Theor Appl Genet 108:794-799；Koseki et al.,2010.Mol Genet Genom 284: 45-54).Moreover, the cold resistance of rice is also directly related to the expansion of rice cropping region and multiple cropping area.Therefore, it digs The endogenous anti-cold gene of rice is dug, its is studied and resists cold molecule mechanism, for cultivating cold-tolerant rice, raising rice yield has heavy Want directive significance (Zhou et al., 2012.Breeding Sci 62:196-201).

Ca²⁺As a kind of important second messenger, intracellular how species specific reaction response can be caused.In plant, The variation of calcium ion concentration regulates and controls the effector molecule in downstream, affects growth and development of plants, resists abiotic stress and biology Multiple significant process such as adverse circumstance (Harper et al., 2004.Annu Rev Plant Biol 55:263-288).Calcium relies on Protein kinase (Calcium-dependent protein kinases, CDPKs or CPKs) be exactly receive and transmit it is this Ca²⁺One of effector molecule of signal.CPKs is a kind of big protein kinase family, belongs to serine/threonine albuminoid kinases, Activity is directly by Ca²⁺Regulation and control without Calmodulin-dependent (CaM) and phosphatide (Harper et al., 2004.Annu Rev Plant Biol 55:263-288).This kind of protein kinase is found in soybean first, is proved to be widely present in later various In plant, green alga and protozoan, but depositing for they is not found in yeast, nematode, drosophila and the cell of mammal .The single polypeptide chain that typical CPK molecules are made of 4 structural domains, including the variable domains of N-terminal, kinase activity Structural domain inhibits structural domain and C-terminal calcium tune structural domain (Hrabak et al., 2003.Plant Physiol 132 certainly: 666-680. threonine kinase domain；From inhibiting structural domain to be also known as connection structure domain, sequence has the conservative of height；The ends C End calcium tune structural domain can combine Ca by 2-4²⁺EF palmistry structural domains composition.

Research has shown that CPKs plays an important role in plant abiotic Stress response.Find that CPKs participates in response earliest Abiotic stress process is Urao etc., they be isolated in the arabidopsis of dehydration 1h AtCPK10 (AtCDPK1) and Two genes of AtCPK11 (AtCDPK2) pass through the expression of Northern blot analytical proof AtCPK10 and AtCPK11 genes By arid and high Salt treatment, without by low temperature and high temperature induction (Urao et al., 1994.Mol Gen Genet 244:331- 340.).Zou etc. is studies have shown that be overexpressed the transfer-gen plant drought tolerance enhancing of AtCPK10, opposite Atcpk10 mutant is to dry The sensibility of drought stress increases.Further study show that AtCPK10 and heat shock protein HSP1 interactions, may pass through ABA and Ca²⁺ The stomata closing process of mediation participates in drought tolerance and adjusts (Zou et al., 2010.Plant J 24:445-458).Core and film are fixed The AtCPK3 forward directions of position participate in salt stress signal transduction pathway, under salt stress, the enhancing of AtCPK3 kinase activities and MAPK approach Mutant shows more obvious brine sensitivity (Mehlmer et al., 2010.Plant J 63 compared to cpk3 mutant: 484-498).The AtCPK27 that also has film positioning identical with this function, expression are sprouted by salt stress inducible up regulation in seed With (Zhao the et al., 2015.Gene 563 more sensitive to salt stress of cpk27 mutant during growth of seedling after sprouting: 203-214), and together with AtCPK3 the AtCPK6 of stomata closing is adjusted, expression is induced by salt and osmotic stress, although its Mutant does not have apparent phenotype, but it is overexpressed drought resistance in plants and salt tolerance enhancing (Xu et al., 2010.Planta 231:1251-1260.)。

One of mode crop as genomics research includes 31 OsCPKs in rice genome, removes a few Except gene function is reported, most gene function is also in unknown state.Based on CPKs in Genes For Plant Tolerance abiotic stress Critical role, the present invention utilize genetic engineering means, in conjunction with the methods of science of heredity and molecular biology, to OsCPK24 genes Function is studied, and discloses OsCPK24 and plays an important roll during Rice Resistance is cold, is carried to cultivate rice cold tolerance kind New genetic resources are supplied.

Invention content

The mesh of the present invention is to provide a kind of gene OsCPK24 of regulation and control plant especially rice cold tolerance, the gene from It is identified in rice varieties Nipponbare and detaches clone and obtained, which has SEQ ID NO:CDS sequences shown in 1, coding Protein sequence such as SEQ ID NO:Shown in 2.

It is a further object to provide application of the OsCPK24 genes in adjusting and controlling rice cold resistance, pass through CaMV35S promoters driving OsCPK24 genes overexpression in rice plant can reach improves n plant survival rate under cold stress Effect, to improve the resistance of reverse of rice varieties.

To achieve the goals above, the present invention uses following technical scheme：

(1) inventor selects from adverse circumstance chip expression spectrum by reverse-genetics approach and is cooled what inducible up regulation was expressed Gene OsCPK24 demonstrates OsCPK24 by cold-induced using qRT-PCR.

(2) applicant obtains a kind of adjusting and controlling rice cold resistance gene OsCPK24 by gene clone method：PCR reactions are expanded Increase, the total volume of reaction system is 20 μ L, and template is 1 μ L (about 10ng) of Nipponbare cDNA, 10 × ExTaq enzyme reaction buffer solutions 2 μ L, 2 μ L of 5mM dNTP, 5 μM of 0.2 μ L of forward primer, 5 μM of 0.2 μ L of reverse primer, 0.2 μ L ExTaq enzymes, add ddH₂O is (sterile Deionized water) to 20 μ L.

Response procedures are：94 DEG C of denaturation 5min, 94 DEG C of 40s, 60 DEG C of 40s, 72 DEG C of 1min 32 are recycled, 72 DEG C of extensions 10min。

Forward primer:ggatccCAAGGCAAGAAGTTGGGTG；

Reverse primer:ctgcagAGCACAATTCACTCTCTTCGGC；

It is final to obtain such as SEQ ID NO:Gene OsCPK24 (1-1542bp) shown in 1, the protein sequence of the gene code Row such as SEQ ID NO:Shown in 2.

(3) application of the OsCPK24 genes in adjusting and controlling rice cold resistance, including OsCPK24 overall lengths CDS is cloned into super table (pCAMBIA1300s vector modifications are from pCAMBIA1300 (http on up to carrier pCAMBIA1300s://www.cnki.net/, Ye Shuifeng, the cultivation and functional analysis of the expression pattern analysis of rice CDPKs genes and black algae Hvppc2 transgenic paddy rices.[doctor Academic dissertation].Wuhan：Library of Hua Zhong Agriculture University, 2009)), the structure figures of the carrier are as shown in Figure 2.By OsCPK24 (1238-1376bp) nucleotide sequence (such as SEQ ID NO:Shown in 3,138bp), it is cloned into RNAi and inhibits expression vector On pDS1301, two expression vectors of above-mentioned gained are transferred to respectively in rice varieties " Nipponbare ", biological function proof list Bright, it is higher than WT lines that overexpression transgenic paddy rice strain shows as n plant survival rate under cold stress, and inhibits expression It is lower than WT lines that transgenic paddy rice strain shows as n plant survival rate under cold stress, therefore can change through the invention The cold resistance of rice varieties.

Compared with prior art, advantages of the present invention is as follows：

(1) the cold-resistant molecular mechanism of rice is not known at present, and the OsCPK24 genes by induction of chilling stress are rice cold tolerance Study on Molecular Mechanism provides technical foundation.

(2) present invention enhances rice cold tolerance by raising OsCPK24 gene expressions, shows OsCPK24 gene expressions Amount is related to rice cold tolerance, this provides new screening-gene for the strong rice varieties of identification cold resistance.

(3) present invention can get the plant of rice cold tolerance enhancing by overexpressing OsCPK24 genes, this is strong resistance to cultivate The rice varieties of cold property provide a kind of new genetic germplasm.

Description of the drawings

Sequence table SEQ ID NO:1 is the nucleotide sequence for the OsCPK24 genes that the present invention clones, and sequence length is 1542bp。

Sequence table SEQ ID NO:2 be the protein sequence of OsCPK24 gene codes, encodes 513 amino acid residues.

Sequence table SEQ ID NO:3 be the core that the double-strand that the present invention is built inhibits RNAi carrier pDS1301-OsCPK24 Nucleotide sequence, sequence length 138bp.

Fig. 1：QRT-PCR verifies OsCPK24 by induction of chilling stress result.

Fig. 2：The collection of illustrative plates of initial carrier p1300s.

Fig. 3：The improved p1300s-OsCPK24 overexpression vectors structural schematic diagram of the present invention.

Fig. 4：Original double-strand inhibits carrier pDS1301 Vector maps.

Fig. 5：The present invention builds the collection of illustrative plates that pDS1301-OsCPK24 inhibits carrier.

Fig. 6：Overexpression and the relative expression quantity for inhibiting OsCPK24 in express transgenic rice.Reference sign, OE3, OE7 and OE9 is to turn pCAMBIA1300s-OsCPK24 to overexpress transgenosis system；R7, R13 and R14 are to turn pDS1301-OsCPK24 Inhibit express transgenic system.Fig. 7：Phenotype before and after the cold stress of multiple independent overexpressions and inhibition express transgenic system.It is attached Figure description of symbols, the A figures in Fig. 7 are the phenotype that transgenosis system is overexpressed before cold stress, and the B figures in Fig. 7 are to inhibit before cold stress The phenotype of express transgenic system, the C figures in Fig. 7 are the phenotype that transgenosis system is overexpressed after cold stress, and the D figures in Fig. 7 are the cold side of body Inhibit the phenotype of express transgenic system after compeling.

Fig. 8：The relative survival rate of express transgenic system is overexpressed and inhibited after cold stress.

Specific implementation mode

Technical solution of the present invention is if not otherwise specified the conventional scheme of this field, the reagent and biological material Material, if not otherwise specified, discloses.

Embodiment 1：A kind of acquisition of adjusting and controlling rice cold resistance gene OsCPK24

(1) clone of adjusting and controlling rice cold resistance gene OsCPK24 nucleotide sequences：

Reacted and obtained by PCR, the total volume of reaction system is 20 μ L, template be 1 μ L of " Nipponbare " cDNA (about 10ng), 10 × ExTaq enzyme reaction buffer solutions, 2 μ L, 2 μ L of 5mM dNTP, 5 μM of 0.2 μ L of forward primer, 5 μM of 0.2 μ of reverse primer L, 0.2 μ L ExTaq enzymes, add ddH₂O (i.e. aseptic deionized water) to 20 μ L.

Response procedures：94 DEG C of denaturation 5min, 94 DEG C of 40s, 60 DEG C of 40s, 72 DEG C of 1min 32cycles, 72 DEG C of extensions 10min。

Forward primer：ggatccCAAGGCAAGAAGTTGGGTG；

Reverse primer：ctgcagAGCACAATTCACTCTCTTCGGC；

Final obtain includes SEQ ID NO:The gene of the gene order of 1 nucleotide, the DNA encoding the protein is such as SEQ ID NO:Shown in 2.

(2) qRT-PCR verifies OsCPK24 by induction of chilling stress：

Will 2 weeks rice " Nipponbare " seedling of growth, at 4 DEG C processing 0h, 12h, for 24 hours, 36h, 48h and 72h when take RNA respectively Sample, using the Trizol extraction agent boxes extracting RNAs of Invitrogen companies, (concrete operation step is shown in the explanation of the kit Book), then utilize (the precious bioengineering Dalian Takara PrimeScript First-strand cDNA systhesis kit Co., Ltd) the first chain cDNA of synthesis, then utilize OsCPK24 in plant under the real-time quantitative PCR detection Different stress time Relative expression quantity.Real-time quantitative PCR primer is as follows：

Forward primer：TCGACAAAGATGGAAGTGGTTTC；

Reverse primer：GGTGAAGATCATCAAGGCCAAA；

The result shows that the gene OsCPK24 that the present invention clones is by induction of chilling stress.

Embodiment 2：Application of the OsCPK24 genes in adjusting and controlling rice cold resistance

It is as follows：

(1) structure plant expression vector p1300s-OsCPK24

According to ncbi database (http://www.ncbi.nlm.nih.gov) announce OsCPK24 full length genes cDNA Sequence, design primer PCR amplification genetic fragment.The OsCPK24 genetic fragments of acquisition such as SEQ ID NO:Shown in 1.

The total volume of pcr amplification reaction system is 20 μ L, and template is 1 μ L (about 10ng) of Nipponbare cDNA, 10 × ExTaq 2 μ L of enzyme reaction buffer solution, 2 μ L of 5mM dNTP, 5 μM of 0.2 μ L of forward primer, 5 μM of 0.2 μ L of reverse primer, 0.2 μ L ExTaq enzymes, Add ddH₂O (aseptic deionized water) to 20 μ L.

Response procedures：94 DEG C of denaturation 5min, 94 DEG C of 40s, 60 DEG C of 40s, 72 DEG C of 1min, 32 cycles, 72 DEG C of extensions 10min。

Forward primer：ggtaccCAAGGCAAGAAGTTGGGTG；

Reverse primer：ctgcagAGCACAATTCACTCTCTTCGGC.

Amplification is obtained such as SEQ ID NO:Segment shown in 1 is cloned into using KpnI/PstI restriction enzyme sites by segment is obtained On pCAMBIA1300s, plant expression vector p1300s-OsCPK24 (as shown in Figure 3) is obtained, which is transferred to rice In kind " Nipponbare ".

(2) structure plant expression vector pDS1301-OsCPK24

By PCR amplification obtain such as SEQ ID NO:The DNA fragmentation of sequence shown in 3.

The total volume of pcr amplification reaction system is 20 μ L, and template is that PCR amplification obtains in step (1) in the present embodiment 1 μ L (about 10ng) of segment, 10 × ExTaq enzyme reaction buffer solutions, 2 μ L, 2 μ L of 5mM dNTP, 5 μM of 0.2 μ L of forward primer, 5 μM it is anti- To 0.2 μ L of primer, 0.2 μ L ExTaq enzymes, add ddH₂O (aseptic deionized water) to 20 μ L.

Response procedures：94 DEG C of denaturation 5min, 94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 30s 32cycles, 72 DEG C of extension 10min.

Forward primer：ggtaccactagtCTCTCCACATGAATAAGC；

Reverse primer：ggatccgagctcGTGAAGATCATCAAGGCCAAA.

Amplification obtains such as SEQ ID NO:The DNA fragmentation of sequence shown in 3 utilizes KpnI/BamHI and SacI/SpeI digestions Site is cloned on RNAi carrier pDS1301 (as shown in Figure 4), obtains plant expression vector pDs1301-OsCPK24 (see figure 5) it, is transferred in rice varieties " Nipponbare ".

(3) genetic transformation of rice

Rice conversion in above-mentioned steps (1) and (2) is all made of the genetic transformation that Agrobacterium EHA105 is mediated, Agrobacterium The genetic transforming method of mediation is delivered referring especially to the applicant's State Key Laboratory of Crop Genetic Improvent The method of " Agrobacterium-mediated genetic transformation operation manual " report (woods is supported the army, and agriculture bacillus mediated Mudanjiang 8 is efficiently The foundation of transformation system, Acta Agronomica Sinica, 2002,28：294-300).It is as follows：

1. callus induction.By ripe " Nipponbare " rice paddy seed (Institute of Crop Science, Chinese Academy of Agricultural Science) Then decladding handles 1min, 0.15% mercury chloride (HgCl with the ethanol solution of 70% concentration successively₂) solution treatment 15min, Seed is transferred on callus inducing medium by aqua sterilisa after cleaning 4-5 times.Culture after inoculation is based on light culture 4 Week, 26 DEG C or so of cultivation temperature.

2. callus subculture.The embryo callus for selecting glassy yellow, consolidation and relatively dry, be put in callus after For light culture on culture medium 2 weeks, 26 DEG C or so of cultivation temperature.

3. preculture.The embryo callus for selecting consolidation and relatively dry is put in light culture 2 weeks on pre-culture medium, training Support 26 DEG C or so of temperature.

4. Agrobacterium is cultivated.In the LA culture mediums with corresponding resistance selection, (preparation of LA culture mediums is with reference to J. Sas first Nurse Brooker etc., Molecular Cloning:A Laboratory guide, the third edition, golden winter wild goose etc. (translating), Science Press, 2002, Beijing) on preculture Agrobacterium EHA105 (bacterial strain discloses the agrobacterium strains used from CAMBIA companies) 2d, 28 DEG C of cultivation temperature；Then, will Agrobacterium is transferred in suspension medium, and 2-3h is cultivated on 28 DEG C of shaking tables.

5. Agrobacterium is infected.Agrobacterium suspension is adjusted first to OD₆₀₀Value is 0.8-1.0, then by the callus of preculture It is transferred in agrobacterium suspension and impregnates 30min, callus is transferred on the filter paper to have sterilized and is blotted, be then placed within co-cultivation 3d, 19-20 DEG C of cultivation temperature are cultivated on base.

6. callus washs and selection culture.The water washing callus that sterilizes is to invisible Agrobacterium；It is immersed in and contains 400mg/l 30min in the aqua sterilisa of CN；It is blotted in transfer callus to the filter paper to have sterilized；It shifts callus and extremely contains 400mg/l carboxylic benzyls Selection culture for the first time is carried out on the Selective agar medium of penicillin (CN) and 50mg/l hygromycin (HN), incubation time is 2 weeks；With Choose afterwards and is not gone to containing 250mg/l carbenicillins (CN) and 50mg/l hygromycin by the callus that Agrobacterium pollutes (HN) second of selection culture, same culture 2 weeks are carried out on Selective agar medium；Picking is not cured by what Agrobacterium polluted again Injured tissue, which is gone on the Selective agar medium for containing only 50mg/l hygromycin (HN), carries out third time selection culture, until growing light yellow Until resistant calli.

7. the differentiation of callus.Resistant calli is transferred on pre- differential medium at dark and cultivates 5-7d； On the callus to differential medium for retransferring pre- differentiation culture, 30-40d, culture temperature are cultivated in illumination (1500-2000lx) Degree is 26 DEG C.

8. taking root.The root generated when differentiation is cut, is then transferred in root media in illumination (1500- It 2000lx) cultivates 2-3 weeks, cultivation temperature is 26 DEG C.

Used culture medium prescription is as follows in genetic transformation：

1. callus inducing medium

Add distilled water to 900ml, the pH value of culture medium is adjusted to 5.9 with 1N potassium hydroxide；1000ml is boiled and is settled to, 50ml triangular flasks (25ml/ bottles) are dispensed into, sterilize according to a conventional method after sealing (such as the 25min that sterilizes at 121 DEG C, following trainings It is identical as the sterilizing methods of basal culture medium to support base sterilizing methods).

2. callus subculture medium

Add distilled water to 900ml, 1000ml is boiled and be settled to the pH value for adjusting culture medium with 1N potassium hydroxide to 5.9, 50ml triangular flasks (25ml/ bottles) are dispensed into, seals, sterilizes as stated above.

3. pre-culture medium

Add distilled water to 250ml, the pH value for adjusting culture medium with 1N potassium hydroxide is sealed, gone out as stated above to 5.6 Bacterium.

Using preceding heating for dissolving culture medium and 5ml glucose storages liquid and 250 μ l AS storage liquid is added, training is poured into packing It supports in ware (25ml/ wares).

4. co-culturing base

Using preceding heating for dissolving culture medium and 5ml glucose storages liquid and 250 μ l AS storage liquid is added, training is poured into packing It supports in ware (25ml/ is per ware).

5. suspension medium

Distilled water is added to be dispensed into the triangle of two 100ml with the pH value of 1N potassium hydroxide tune culture mediums to 5.4 to 100ml In bottle, sealing sterilizes as stated above.

Liquid is stored using preceding addition 1ml sterile dextroses and 100 μ l AS store liquid.

6. Selective agar medium

Add distilled water to 250ml, the pH value for adjusting culture medium with 1N potassium hydroxide is sealed, gone out as stated above to 6.0 Bacterium.

Using preceding dissolving culture medium, 250 μ l HN (50mg/ml) and 400 μ l CN (250mg/ml) packing is added and pours into training It supports in ware (25ml/ wares).(note：A concentration of 400mg/l of carbenicillin in first time Selective agar medium, second and choosing later Select a concentration of 250mg/l of carbenicillin in culture medium).

7. differential medium

Add distilled water to 900ml, the pH value of culture medium is adjusted to 6.0 with 1N potassium hydroxide.It boils and uses distilled water constant volume To 1000ml, 50ml triangular flasks (50ml/ bottles) are dispensed into, seals, sterilizes as stated above.

8. root media

Add distilled water to 900ml, the pH value of culture medium is adjusted to 5.8 with 1N potassium hydroxide.It boils and uses distilled water constant volume It to 1000ml, is dispensed into taking root pipe (25ml/ pipes or so), seals, sterilize as stated above.

Main solution formula：

1. N6max mother liquors (are prepared) according to 10 × concentrate：

Mentioned reagent is dissolved one by one, is then settled to 1000ml with distilled water at room temperature.

2. N6min mother liquors (are prepared) according to 100 × concentrate

Mentioned reagent is dissolved at room temperature and is settled to 1000ml with distilled water.

3. molysite (Fe²⁺EDTA liquid (being prepared according to 100 × (again) concentrates)) is stored

By 3.73g b diammonium disodium edtas (Na₂EDTA·2H₂) and 2.78g FeSO O₄·7H₂O dissolves respectively, mixing It is used in combination distilled water to be settled to 1000ml, until 70 DEG C of warm bath 2h, 4 DEG C save backup.

4. vitamins stock liquid (is prepared) according to 100 × concentrate

Distilled water is added to be settled to 1000ml, 4 DEG C save backup.

5. MSmax mother liquors (are prepared) according to 10 × concentrate

Mentioned reagent is dissolved at room temperature, distilled water is used in combination to be settled to 1000ml.

6. MSmin mother liquors (are prepared) according to 100 × concentrate

7. 2,4-D stores the preparation of liquid (1mg/ml)：

2,4-D 100mg are weighed, dissolve 5min with 1ml 1N potassium hydroxide, then plus 10ml distillations water dissolution is completely fixed afterwards Hold to 100ml, preserves at room temperature.

8. 6-BA stores the preparation of liquid (1mg/ml)：

6-BA 100mg are weighed, dissolve 5min with 1ml 1N potassium hydroxide, then plus 10ml distillations water dissolution is completely fixed afterwards Hold to 100ml, room temperature preservation.

9. methyl α-naphthyl acetate (NAA) stores the preparation of liquid (1mg/ml)：

NAA 100mg are weighed, dissolve 5min with 1ml 1N potassium hydroxide, then plus 10ml distills constant volume after water dissolution completely To 100ml, 4 DEG C save backup.

10. heteroauxin (IAA) stores the preparation of liquid (1mg/ml)：

IAA 100mg are weighed, dissolve 5min with 1ml 1N potassium hydroxide, then plus 10ml distills constant volume after water dissolution completely To 100ml, 4 DEG C save backup.

The preparation of glucose storage liquid (0.5g/ml)：

Glucose 125g is weighed, is then settled to 250ml with distillation water dissolution, is saved backup for 4 DEG C after sterilizing.

AS stores the preparation of liquid：

AS 0.392g are weighed, DMSO 10ml dissolvings are added, dispense to 1.5ml centrifuge tubes, 4 DEG C save backup.

1N potassium hydroxide stores liquid

Potassium hydroxide 5.6g is weighed, is settled to 100ml with distillation water dissolution, room temperature preservation is spare.

Reagent and solution abbreviation：

The abbreviation of plant hormone in the present invention used in culture medium indicates as follows：6-BA(6- BenzylaminoPurine, 6-benzyladenine)；CN (Carbenicillin, carbenicillin)；KT (Kinetin, excitement Element)；NAA (Napthalene acetic acid, methyl α-naphthyl acetate)；IAA (Indole-3-acetic acid, heteroauxin)；2, 4-D (2,4-Dichlorophenoxyacetic acid, 2,4- dichlorphenoxyacetic acids)；AS (Acetosringone, acetyl fourth Ketone musk)；CH (Casein Enzymatic Hydrolysate, caseinhydrolysate)；HN (Hygromycin B, hygromycin)； DMSO (Dimethyl Sulfoxide, dimethyl sulfoxide (DMSO))；N6max (N6 a great number of elements ingredient solution)；N6mix (the micro members of N6 Plain ingredient solution)；MSmax (MS a great number of elements ingredient solution)；MSmix (MS Trace Elements solution).

(4) transplanting, expression quantity identification and phenotypic analysis

The each hereditary system of the transfer-gen plant taken root is built into 50 familys, is then transplanted in greenhouse and cultivates, from Blade is taken to do the identification of realtime-PCR expression quantity on transgenic lines plant.It is each to choose 3 overexpressions and inhibit expression heredity System carries out cold stress and analyzes, and the results are shown in Figure 6 for the relative expression quantity of OsCPK24 in selection Genetic Families.

After cold stress conditions are 10 DEG C of processing 5d, then 4 DEG C of processing 12d.The result shows that：A figures in Fig. 7 are to surpass before cold stress The phenotype of express transgenic system, the B figures in Fig. 7 are the phenotype for inhibiting express transgenic system before cold stress；C figures in Fig. 7 are cold The phenotype of transgenosis system is overexpressed after stress, the D figures in Fig. 7 are the phenotype of inhibition express transgenic system after cold stress.

The statistical result of n plant survival rate is as shown in Figure 8 after stress.

(5) beneficial effects of the present invention

1) OsCPK24 overall lengths CDS is cloned on pCAMBIA1300s by the present invention, is transferred in " Nipponbare ", is obtained It is higher than wild type (Fig. 8) that transgenic line shows as survival rate under cold stress.Show that OsCPK24 genes have adjusting and controlling rice resistance to The function of cold property.

2) OsCPK24 (1238-1376bp) sequence is cloned on RNAi carrier pDS1301 by the present invention, in rice " Japan It is fine " in be RNAi (RNA interference) experiment, as a result succeed by RNAi transgenic paddy rice under cold stress survival rate Less than wild type (Fig. 8).

3) present invention passes through multiple independent p1300s-OsCPK24 and pDS1301-OsCPK24 transgenic lines of acquisition Phenotype and expression analysis show that the expression quantity of OsCPK24 genes is strong and weak related to the cold resistance of rice.

SEQUENCE LISTING

<110>Hua Zhong Agriculture University

<120>It is a kind of control rice cold tolerance gene and its application

<130>

<141> 2017-01-04

<160> 3

<170> PatentIn version 3.1

<210> 1

<211> 1542

<212> DNA

<213>Rice（Oryza sativa）

<220>

<221> gene

<222> (1)..(1542)

<223>

<220>

<221> CDS

<222> (1)..(1542)

<223>

<400> 1

atg cag ccg gac ccg agc ggg agc ggc ggc gac gac aac gcc aat gcg 48

Met Gln Pro Asp Pro Ser Gly Ser Gly Gly Asp Asp Asn Ala Asn Ala

1 5 10 15

aag gcg aag ctg gcg ccg ccg ccg gtg acg gcg gcg gga ggt cgg ccg 96

Lys Ala Lys Leu Ala Pro Pro Pro Val Thr Ala Ala Gly Gly Arg Pro

20 25 30

gtg tcg gtg ctg ccg cac aag acg gcg aac gtg cgc gac cac tac cgc 144

Val Ser Val Leu Pro His Lys Thr Ala Asn Val Arg Asp His Tyr Arg

35 40 45

atc ggg aag aag ctc ggg cag ggg cag ttc ggg acg acg tac ctg tgc 192

Ile Gly Lys Lys Leu Gly Gln Gly Gln Phe Gly Thr Thr Tyr Leu Cys

50 55 60

gtg gac aag gcg agc ggc ggc gag ttc gcg tgc aag tcc atc ccc aag 240

Val Asp Lys Ala Ser Gly Gly Glu Phe Ala Cys Lys Ser Ile Pro Lys

65 70 75 80

cgg aag ctg ctg tgc cgg gag gac tac gag gac gtg tgg cgc gag atc 288

Arg Lys Leu Leu Cys Arg Glu Asp Tyr Glu Asp Val Trp Arg Glu Ile

85 90 95

cag atc atg cac cac ctc tcc gag cac ccc aac gtc gtc cgc atc cgc 336

Gln Ile Met His His Leu Ser Glu His Pro Asn Val Val Arg Ile Arg

100 105 110

ggc gcc tac gag gac gcg ctg ttc gtc cac atc gtc atg gag ctc tgc 384

Gly Ala Tyr Glu Asp Ala Leu Phe Val His Ile Val Met Glu Leu Cys

115 120 125

gcc ggc ggc gag ctc ttc gac cgc atc gtc gcc aag ggc cac tac acc 432

Ala Gly Gly Glu Leu Phe Asp Arg Ile Val Ala Lys Gly His Tyr Thr

130 135 140

gag cgc gcc gcc gcg cag ctc atc cgc acc atc gtc gcc gtc gtc gag 480

Glu Arg Ala Ala Ala Gln Leu Ile Arg Thr Ile Val Ala Val Val Glu

145 150 155 160

gga tgc cac tcg ctc ggc gtc atg cac cgg gac ctc aag ccc gag aac 528

Gly Cys His Ser Leu Gly Val Met His Arg Asp Leu Lys Pro Glu Asn

165 170 175

ttc ctc ttc gcc agc gcc gcc gag gac gcc ccc ctc aag gcc act gat 576

Phe Leu Phe Ala Ser Ala Ala Glu Asp Ala Pro Leu Lys Ala Thr Asp

180 185 190

ttc ggc ctc tcc atg ttc tac aag cct ggt gat aag ttc tct gat gtt 624

Phe Gly Leu Ser Met Phe Tyr Lys Pro Gly Asp Lys Phe Ser Asp Val

195 200 205

gtt ggg agc ccc tat tat gtt gca cct gag gta ctt cag aaa tgc tat 672

Val Gly Ser Pro Tyr Tyr Val Ala Pro Glu Val Leu Gln Lys Cys Tyr

210 215 220

ggt cca gaa tct gat gtc tgg agt gct ggg gta att ctt tac att ttg 720

Gly Pro Glu Ser Asp Val Trp Ser Ala Gly Val Ile Leu Tyr Ile Leu

225 230 235 240

cta tgt ggt gtt cca cca ttt tgg gca gaa act gaa gct gga att ttc 768

Leu Cys Gly Val Pro Pro Phe Trp Ala Glu Thr Glu Ala Gly Ile Phe

245 250 255

agg cag att cta cga ggc aaa ctt gat ttt gaa tct gaa ccc tgg cct 816

Arg Gln Ile Leu Arg Gly Lys Leu Asp Phe Glu Ser Glu Pro Trp Pro

260 265 270

agc atc tct gac agt gct aaa gat cta gtc cgt aat atg ctt tgc cgg 864

Ser Ile Ser Asp Ser Ala Lys Asp Leu Val Arg Asn Met Leu Cys Arg

275 280 285

gat cct aca aag aga ctt aca gcc cat gag gtt ctc tgt cat cca tgg 912

Asp Pro Thr Lys Arg Leu Thr Ala His Glu Val Leu Cys His Pro Trp

290 295 300

att gtt gat gat gct gtg gca cct gac aag cct att gat tct gct gtt 960

Ile Val Asp Asp Ala Val Ala Pro Asp Lys Pro Ile Asp Ser Ala Val

305 310 315 320

ttg tca aga ctg gag cac ttt tcg gca atg aac aag ctc aag aag atg 1008

Leu Ser Arg Leu Glu His Phe Ser Ala Met Asn Lys Leu Lys Lys Met

325 330 335

gca ttg agg gtt att gct gaa agc ctg tct gag gaa gag att gga gga 1056

Ala Leu Arg Val Ile Ala Glu Ser Leu Ser Glu Glu Glu Ile Gly Gly

340 345 350

cta aag gag cta ttc aaa atg att gat act gac gat agt gga act ata 1104

Leu Lys Glu Leu Phe Lys Met Ile Asp Thr Asp Asp Ser Gly Thr Ile

355 360 365

act ttt gat gag ctg aaa gag ggc ttg aaa agg gtg ggt tca gaa tta 1152

Thr Phe Asp Glu Leu Lys Glu Gly Leu Lys Arg Val Gly Ser Glu Leu

370 375 380

aca gaa cat gaa atc cag gct tta atg gaa gcg gct gat atc gac aac 1200

Thr Glu His Glu Ile Gln Ala Leu Met Glu Ala Ala Asp Ile Asp Asn

385 390 395 400

agt gga acc atc gac tat ggt gaa ttc att gct gct act ctc cac atg 1248

Ser Gly Thr Ile Asp Tyr Gly Glu Phe Ile Ala Ala Thr Leu His Met

405 410 415

aat aag cta gag agg gag gaa aac tta gta tca gca ttc tca ttt ttc 1296

Asn Lys Leu Glu Arg Glu Glu Asn Leu Val Ser Ala Phe Ser Phe Phe

420 425 430

gac aaa gat gga agt ggt ttc ata act att gat gag ctg tca caa gca 1344

Asp Lys Asp Gly Ser Gly Phe Ile Thr Ile Asp Glu Leu Ser Gln Ala

435 440 445

tgc cgc gaa ttt ggc ctt gat gat ctt cac ctt gag gat atg att aaa 1392

Cys Arg Glu Phe Gly Leu Asp Asp Leu His Leu Glu Asp Met Ile Lys

450 455 460

gat gtt gat caa aac aat gac gga caa att gac tac agc gag ttc acg 1440

Asp Val Asp Gln Asn Asn Asp Gly Gln Ile Asp Tyr Ser Glu Phe Thr

465 470 475 480

gcg atg atg aga aag ggc aat gct ggt gga gct gga agg aga acc atg 1488

Ala Met Met Arg Lys Gly Asn Ala Gly Gly Ala Gly Arg Arg Thr Met

485 490 495

agg aac agc ttg cag ttg aat ctt ggt gag atc ttg aac ccc agc aac 1536

Arg Asn Ser Leu Gln Leu Asn Leu Gly Glu Ile Leu Asn Pro Ser Asn

500 505 510

agc taa 1542

Ser

<210> 2

<211> 513

<212> PRT

<213>Rice（Oryza sativa）

<400> 2

Met Gln Pro Asp Pro Ser Gly Ser Gly Gly Asp Asp Asn Ala Asn Ala

1 5 10 15

Lys Ala Lys Leu Ala Pro Pro Pro Val Thr Ala Ala Gly Gly Arg Pro

20 25 30

Val Ser Val Leu Pro His Lys Thr Ala Asn Val Arg Asp His Tyr Arg

35 40 45

Ile Gly Lys Lys Leu Gly Gln Gly Gln Phe Gly Thr Thr Tyr Leu Cys

50 55 60

Val Asp Lys Ala Ser Gly Gly Glu Phe Ala Cys Lys Ser Ile Pro Lys

65 70 75 80

Arg Lys Leu Leu Cys Arg Glu Asp Tyr Glu Asp Val Trp Arg Glu Ile

85 90 95

Gln Ile Met His His Leu Ser Glu His Pro Asn Val Val Arg Ile Arg

100 105 110

Gly Ala Tyr Glu Asp Ala Leu Phe Val His Ile Val Met Glu Leu Cys

115 120 125

Ala Gly Gly Glu Leu Phe Asp Arg Ile Val Ala Lys Gly His Tyr Thr

130 135 140

Glu Arg Ala Ala Ala Gln Leu Ile Arg Thr Ile Val Ala Val Val Glu

145 150 155 160

Gly Cys His Ser Leu Gly Val Met His Arg Asp Leu Lys Pro Glu Asn

165 170 175

Phe Leu Phe Ala Ser Ala Ala Glu Asp Ala Pro Leu Lys Ala Thr Asp

180 185 190

Phe Gly Leu Ser Met Phe Tyr Lys Pro Gly Asp Lys Phe Ser Asp Val

195 200 205

Val Gly Ser Pro Tyr Tyr Val Ala Pro Glu Val Leu Gln Lys Cys Tyr

210 215 220

Gly Pro Glu Ser Asp Val Trp Ser Ala Gly Val Ile Leu Tyr Ile Leu

225 230 235 240

Leu Cys Gly Val Pro Pro Phe Trp Ala Glu Thr Glu Ala Gly Ile Phe

245 250 255

Arg Gln Ile Leu Arg Gly Lys Leu Asp Phe Glu Ser Glu Pro Trp Pro

260 265 270

Ser Ile Ser Asp Ser Ala Lys Asp Leu Val Arg Asn Met Leu Cys Arg

275 280 285

Asp Pro Thr Lys Arg Leu Thr Ala His Glu Val Leu Cys His Pro Trp

290 295 300

Ile Val Asp Asp Ala Val Ala Pro Asp Lys Pro Ile Asp Ser Ala Val

305 310 315 320

Leu Ser Arg Leu Glu His Phe Ser Ala Met Asn Lys Leu Lys Lys Met

325 330 335

Ala Leu Arg Val Ile Ala Glu Ser Leu Ser Glu Glu Glu Ile Gly Gly

340 345 350

Leu Lys Glu Leu Phe Lys Met Ile Asp Thr Asp Asp Ser Gly Thr Ile

355 360 365

Thr Phe Asp Glu Leu Lys Glu Gly Leu Lys Arg Val Gly Ser Glu Leu

370 375 380

Thr Glu His Glu Ile Gln Ala Leu Met Glu Ala Ala Asp Ile Asp Asn

385 390 395 400

Ser Gly Thr Ile Asp Tyr Gly Glu Phe Ile Ala Ala Thr Leu His Met

405 410 415

Asn Lys Leu Glu Arg Glu Glu Asn Leu Val Ser Ala Phe Ser Phe Phe

420 425 430

Asp Lys Asp Gly Ser Gly Phe Ile Thr Ile Asp Glu Leu Ser Gln Ala

435 440 445

Cys Arg Glu Phe Gly Leu Asp Asp Leu His Leu Glu Asp Met Ile Lys

450 455 460

Asp Val Asp Gln Asn Asn Asp Gly Gln Ile Asp Tyr Ser Glu Phe Thr

465 470 475 480

Ala Met Met Arg Lys Gly Asn Ala Gly Gly Ala Gly Arg Arg Thr Met

485 490 495

Arg Asn Ser Leu Gln Leu Asn Leu Gly Glu Ile Leu Asn Pro Ser Asn

500 505 510

Ser

<210> 3

<211> 138

<212> DNA

<213>Rice（Oryza sativa）

<220>

<221> gene

<222> (1)..(138)

<223>

<400> 3

tctccacatg aataagctag aggggaggaa aacttagtat cagcattctc atttttcgac 60

aaagatggaa gtggtttcat aactattgat gagctgtcac aagcatgccg cgaatttggc 120

cttgatgatc ttcacctt 138

Claims

1. a kind of albumen of separation, protein sequence such as SEQ ID NO：Shown in 2.

2. encoding the gene of albumen described in claim 1, nucleotide sequence such as SEQ ID NO：1-1542 bit bases institute in 1 The sequence shown.

3. an overexpression carrier p1300s-OsCPK24, which is characterized in that the carrier contains the base described in claim 2 Cause.

4. application of the albumen described in claim 1 in adjusting and controlling rice cold resistance.

5. the application of gene yield in the case where improving rice cold tolerance and improving Rice Cold stress described in claim 2.

6. a kind of method improving plant cold tolerance, which is characterized in that by improving gene OsCPK24 described in claim 2 Expression quantity improves the cold resistance of purpose plant.

7. method as claimed in claim 6, which is characterized in that the purpose plant includes monocotyledon or dicotyledonous plant Object.

8. method as claimed in claims 6 or 7, which is characterized in that the monocotyledon includes rice, corn, wheat And turfgrass.

9. the method as described in claim 6,7 or 8, which is characterized in that the monocotyledon is rice.

10. method as claimed in claims 6 or 7, which is characterized in that the dicotyledon includes rape, willow, soybean And cotton.