CN108220481B - Nucleic acid, kit and method for simultaneously detecting congo fever virus, kubo fever virus 1 and 2 types - Google Patents
Nucleic acid, kit and method for simultaneously detecting congo fever virus, kubo fever virus 1 and 2 types Download PDFInfo
- Publication number
- CN108220481B CN108220481B CN201810099377.5A CN201810099377A CN108220481B CN 108220481 B CN108220481 B CN 108220481B CN 201810099377 A CN201810099377 A CN 201810099377A CN 108220481 B CN108220481 B CN 108220481B
- Authority
- CN
- China
- Prior art keywords
- fever virus
- seq
- kubo
- virus type
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a group of nucleic acids, a kit and a detection method for simultaneously detecting three viruses including congo fever virus, kubo fever virus type 1 and kubo fever virus type 2, wherein the nucleic acids for simultaneously detecting the three viruses by multiplex PCR comprise upstream and downstream primers of the three viruses including congo fever virus, kubo fever virus type 1 and kubo fever virus type 2; the nucleic acid for simultaneously detecting the three viruses by the fluorescent quantitative PCR also comprises probes corresponding to all pathogens. The invention also establishes a detection method which is relatively efficient and sensitive and can simultaneously detect the congo fever virus, the kubo fever virus type 1 and the kubo fever virus type 2. The method can effectively improve the detection sensitivity, avoid the occurrence of false negative results and provide an effective detection technical means for effectively preventing the input viral hemorrhagic fever.
Description
Technical Field
The invention belongs to the technical field of biological detection, and particularly relates to nucleic acid, a kit and a method for simultaneously detecting congo fever virus, kubo fever virus type 1 and kubo fever virus type 2.
Background
The Shanghai inspection and quarantine center laboratory carries out overnight detection on suspected yellow fever infected persons from Angora, and excludes infection of various entomopathogenic agents such as yellow fever virus, rift valley fever virus, chikungunya virus, dengue virus, plasmodium and the like and infection of pathogenic agents such as influenza A virus, influenza B virus, hepatitis virus and the like from the Guangdong office P3 laboratory. In order to further find out the cause of fever, the Shanghai entry-exit inspection and quarantine bureau and the Chinese military medical science college apply a metagenome sequencing technology, and the homology of a fragment sequence and the kubo fever virus is up to 96.5 percent through detection and analysis. And then carrying out follow-up tracking investigation again by combining with Jiangsu entry-exit inspection and quarantine bureau, collecting samples, carrying out whole gene sequencing, and obtaining a virus whole genome in 2 months and 21 days. The whole length of the viral genome is 12639bp, and the homology with the kubo fever virus type 2 (EKV2) in Nigeria is 96 percent through sequence comparison. And further performing virus sequence evolutionary tree analysis, and finally confirming that the virus is the kubo fever virus.
The kubo fever virus (EKV) is a virus newly found in West Nigeria in 2015, is divided into two subtypes, namely type 1 (EKV-1) and type 2 (EKV-2), mainly infects cattle, is mediated by culicoides, and is only reported for 1 time in the world. Meanwhile, the virus is highly homologous with another Congo fever virus (BCV) which causes high hemorrhagic fever death rate, and the shape of a disease-causing organism is unknown due to few cases.
At present, no effective and rapid identification of which type of kubo fever virus the pathogenic bacteria causing fever may be, or congo fever virus is available, which needs to be determined through tissue culture and whole genome comparison, and is very long in time consumption, labor-consuming and high in cost.
Disclosure of Invention
Technical problem to be solved
In order to solve the technical problems, the invention provides a nucleic acid, a kit and a detection method for simultaneously detecting congo fever virus, kubo fever virus type 1 and kubo fever virus type 2 by fluorescence quantitative PCR.
(II) technical scheme
In order to achieve the purpose, the invention adopts the main technical scheme that:
a group of nucleic acids for simultaneously detecting three viruses by fluorescent quantitative PCR comprises upstream and downstream primers for detecting congo fever virus, kubo fever virus type 1 and kubo fever virus type 2, wherein the upstream primer sequence of the congo fever virus is shown as SEQ ID No.1, the downstream primer sequence is shown as SEQ ID No.2, and the probe sequence is shown as SEQ ID No. 3;
the sequence of the upstream primer of the kubo fever virus type 1 is shown as SEQ ID No.4, the sequence of the downstream primer is shown as SEQ ID No.5, and the sequence of the probe is shown as SEQ ID No. 6;
the sequence of the upstream primer of the kubo fever virus type 2 is shown as SEQ ID No.7, the sequence of the downstream primer is shown as SEQ ID No.8, and the sequence of the probe is shown as SEQ ID No. 9.
The nucleic acid as described above, preferably, the set of nucleic acids further comprises a positive control comprising detection of congo fever virus, kubo fever virus type 1 and kubo fever virus type 2, wherein,
the positive control for detecting the congo fever virus comprises a sequence shown as SEQ ID No. 10;
the positive control for detecting the kubo fever virus type 1 comprises a sequence shown as SEQ ID No. 11;
the positive control for detecting the kubo fever virus type 2 comprises a sequence shown as SEQ ID No. 12.
A kit for simultaneous detection of three viruses by fluorescent quantitative PCR, the kit comprising: the three viral upstream and downstream primers of Congo fever virus, kubo fever virus type 1 and kubo fever virus type 2 and the corresponding probes of claim 2, wherein the 5 'end and the 3' end of each probe correspond to the markers TEXRED-BHQ2, FAM-TAMRA and CY5-BHQ3, respectively.
The kit as described above, preferably, further comprising a positive control for detecting congo fever virus, kubo fever virus type 1 and kubo fever virus type 2, wherein,
the positive control for detecting the congo fever virus contains a sequence shown as SEQ ID No. 10;
the positive control for detecting the kubo fever virus type 1 contains a sequence shown as SEQ ID No. 11;
the positive control for detecting the kubo fever virus type 2 contains a sequence shown as SEQ ID No. 12.
The kit as described above, preferably, further comprises 2 XTR-PCR buffer, 25 XTR-PCR Enzyme Mix and nuclease-free water.
A detection method for simultaneously detecting three viruses by fluorescent quantitative PCR is used for detecting three viruses of Congo fever virus, kubo fever virus type 1 and kubo fever virus type 2, and specifically comprises the following steps:
(1) extracting RNA from the sample;
(2) performing fluorescent quantitative PCR amplification on the extracted RNA; wherein, during fluorescent quantitative PCR amplification, in a reaction system, the nucleotide sequences of the upstream primer, the downstream primer and the probe of the congo fever virus are shown as SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3, and the 5 'end and the 3' end of the probe are respectively and correspondingly marked with TEXRED and BHQ 2; the nucleotide sequences of the upstream primer and the downstream primer of the kubo fever virus type 1 and the probe are shown as SEQ ID No.4, SEQ ID No.5 and SEQ ID No.6, and the 5 'end and the 3' end of the probe are respectively and correspondingly marked with FAM and TAMRA; the nucleotide sequences of the upstream primer and the downstream primer of the kubo fever virus type 2 and the probe are shown as SEQ ID No.7, SEQ ID No.8 and SEQ ID No.9, and the 5 'end and the 3' end of the probe are respectively corresponding to markers CY5 and BHQ 3;
(3) collecting fluorescence signals, selecting a fluorescence detection mode of the fluorescent group in the step (2), adjusting a base line, taking 3-15 circulating fluorescence signals, and setting a threshold line by the highest point of the threshold line just exceeding the normal negative control;
(4) and (4) judging a result: and if the fluorescence increase curve of the sample to be detected exceeds a threshold value line and shows good logarithmic increase, judging the sample to be detected to be positive, and if no typical amplification curve exists, judging the sample to be detected to be negative.
In the detection method, preferably, the reaction system for the fluorescent quantitative PCR amplification in step (2) is specifically as follows:
2×RT-PCR buffer 12.5μL，
primer MIX: 2.0. mu.L
And (3) a probe MIX: 1.0 μ L
25×RT-PCR Enzyme Mix：1.0μL
Nuclease-free water: 3.5 μ L
RNA：5.0μL
The primer MIX is a mixture of upstream and downstream primers of Congo fever virus, kubo fever virus type 1 and kubo fever virus type 2 with final concentration of 3.3 mu mol/L respectively;
the probe MIX is a mixture of probes of Congo fever virus, Cobo fever virus type 1 and Cobo fever virus type 2 with the final concentration of 1.0 mu mol/L respectively;
meanwhile, setting water without nuclease as a negative control;
meanwhile, the primer set comprises a sequence shown as SEQ ID No.10, a sequence shown as SEQ ID No.11 and a sequence shown as SEQ ID No.12 as positive controls.
In the detection method as described above, preferably, the reaction procedure of the fluorescent quantitative PCR amplification in step (2) is: the reverse transcription step is at 45 ℃ for 30 min; the denaturation step is at 95 ℃ for 10 min; the amplification cycle steps were 95 ℃ for 15 sec; 40 cycles were performed at 60 ℃ for 45sec, and fluorescence signals were collected at 60 ℃.
In the detection method described above, preferably, in the determination of the result in the step (4), the threshold is 35, and when the Ct value is less than or equal to 35, an obvious amplification curve is a positive result; if the Ct value is more than 35 and less than or equal to 40, repeating the experiment once, if an obvious amplification curve is a positive result, otherwise, obtaining a negative result; ct values > 40 are negative results.
(III) advantageous effects
The invention has the beneficial effects that:
the invention provides a nucleic acid group for fluorescence quantitative detection of Congo fever virus, kubo fever virus type 1 and kubo fever virus type 2, which can be used for detection of a single pathogen and multiplex amplification of synchronous detection of the three viruses. When the kit is used for synchronously detecting the three viruses, cross reaction does not occur among the viruses after verification, and the kit has high detection sensitivity and strong specificity.
The invention also provides a kit and a method for simultaneously detecting the Congo fever virus, the kubo fever virus type 1 and the kubo fever virus type 2 by fluorescent quantitative PCR, and simultaneously establishes a detection method which is relatively efficient, sensitive and strong in specificity and can simultaneously detect the three viruses. The method can effectively improve the detection sensitivity and avoid the occurrence of false negative results. The provided detection kit is convenient to use, simple and convenient to operate, high in automation degree, and capable of effectively replacing traditional pathogen separation culture to obtain a detection result, the kit is few in used reagent and low in cost, the operation process is greatly simplified, the repeated operation process is reduced, the pollution in the operation process is reduced, excessive labor force caused by repeated operation is avoided, time is saved, cost is effectively saved, rapid screening is realized, the detection effect of the used kit is good, the specificity is strong, and the sensitivity is high. The nucleic acid, the kit and the detection method provided by the invention are used for solving the technical problem that congo fever virus, kubo fever virus type 1 and kubo fever virus type 2 cannot be detected simultaneously in the prior art.
The detection method provided by the invention adopts the operation of completely closing the tube, is simple, convenient and quick to operate, obtains a quantitative result by directly detecting the change of a fluorescent signal in the PCR process, does not need common PCR post-treatment or electrophoresis detection, overcomes the defects of easy pollution and false positive occurrence of the conventional PCR technology, can effectively avoid the difficulty of nonspecific amplification, and is suitable for screening and detecting large-batch samples.
Drawings
FIG. 1 is a sensitivity amplification curve of single real-time fluorescent quantitative PCR for detecting Congo fever virus.
FIG. 2 is a graph of the sensitivity amplification curve of single real-time fluorescent quantitative PCR for detecting Kupffer virus type 1.
FIG. 3 is a graph of the sensitivity amplification curve of singleplex real-time fluorescent quantitative PCR for detecting Couloviral type 2.
FIG. 4 is a graph showing the sensitivity amplification curves of real-time fluorescent quantitative PCR of the present invention for simultaneous detection of Congo fever virus, Kubo fever virus type 1 and Kubo fever virus type 2.
FIG. 5 is an amplification curve of the specific detection of the real-time fluorescent quantitative PCR of the present invention for simultaneous detection of congo fever virus, kubo fever virus type 1 and kubo fever virus type 2.
FIG. 6 is a comparison of the standard curve for simultaneous detection of Congo fever virus, Kubo fever virus type 1 and Kubo fever virus type 2 by real-time fluorescent quantitative PCR of the present invention with the corresponding detection of each virus reaction.
FIG. 7 is a graph showing the amplification curves of real-time fluorescent quantitative PCR of the present invention for simultaneous detection of Congo fever virus, Cubo fever virus type 1 and Cubo fever virus type 2 in mosquito-mediated assays.
Detailed Description
For the purpose of better explaining the present invention and to facilitate understanding, the present invention will be described in detail by way of specific embodiments with reference to the accompanying drawings. The embodiments of the present invention are not limited thereto, and the complementary sequences of the nucleotide sequences provided by the present invention can also implement the present invention, and the reagents used are conventional reagents unless otherwise specified, and therefore all equivalent substitutions in the art made in accordance with the present disclosure are within the scope of the present invention.
Example 1 design of primers and probes
The fluorescent quantitative PCR detection is based on the common PCR detection, and further passes through a specific fluorescent probe which is an oligonucleotide, and two ends of the probe are respectively marked with a reporter fluorescent group and a quenching fluorescent group. When the probe is complete, the fluorescent signal emitted by the reporter group is absorbed by the quenching group; during PCR amplification, the 5 '-3' exonuclease activity of Taq enzyme cuts and degrades the probe, so that the reporter fluorescent group and the quenching fluorescent group are separated, a fluorescence monitoring system can receive a fluorescence signal, namely, one fluorescent molecule is formed when one RNA chain is amplified, and the accumulation of the fluorescence signal and the formation of a PCR product are completely synchronous. Therefore, the precondition of the fluorescent quantitative PCR detection is to perform PCR amplification reactions, cross reactions between primers and products of the amplification reactions need to be avoided as much as possible, and cross reactions between the specific probe and each amplification product and each primer are further ensured. In addition, because the invention is a multiplex fluorescence quantification, the selection of the probe label is more critical, and not only the probes designed by software need to be screened, but also the probe signals of the three genes can not interfere with each other.
Firstly, respectively screening specific target genes of pathogens of Congo fever virus, Cubo fever virus type 1 and Cubo fever virus type 2, downloading a plurality of pathogen gene sequences from GenBank for each pathogen according to the detection purpose, carrying out comparison analysis, selecting a conserved sequence, and designing an amplification primer and a hybridization probe suitable for a fluorescent quantitative PCR reaction system in the conserved sequence.
Because the invention is a multiple fluorescence quantification, firstly, the selection of primers and probes is more critical, secondly, the probes designed by software are screened, the probe signals of three genes can not interfere with each other, and therefore, the three pairs of primers and the three probes can not interfere with each other when the probes are designed.
Respectively designing a plurality of primer sequences and hybridization probe sequences specific to three viruses including Congo fever virus, kubo fever virus type 1 and kubo fever virus type 2, analyzing and evaluating sequence homology and adaptability of a probe and a primer combination to be selected, verifying through a large number of detection tests, and finally selecting the primer and the probe combination which are specific and are suitable for a multiple fluorescence quantitative reaction system.
It should be noted that, in the design, the design principle of the ordinary PCR primer is not suitable for the design of the fluorescent quantitative PCR primer, and the design requirement of the fluorescent quantitative PCR primer is more strict than that of the ordinary PCR primer, but the fluorescent quantitative PCR primer is certainly applicable to the ordinary PCR amplification reaction.
The amplification primers designed for each pathogen firstly carry out amplification detection of a single pathogen, and then carry out amplification of multiple pathogens after confirming that the amplification detection of the single pathogen has no non-specific amplification, wherein the design of the primers needs to avoid cross reaction as much as possible, and also needs to consider that the amplification conditions are as consistent as possible, and finally the cross reaction is eliminated through hybridization reaction; based on the above design, bioinformatics analysis, and the inventor's empirical design and screening of a large number of experimental tests, the following sequences were determined as a result:
congo fever virus specific amplification primer pair and probe: the specific amplification primer pair shown as SEQ ID No.1 and SEQ ID No.2 and the specific probe sequence shown as SEQ ID No.3 are as follows:
SEQ IDNo.1：5′-AAATTTGCAGAAGACATGGACTCTC-3′
SEQ IDNo.2：5′-GAACTCCGCTCCAACAGGTG-3′
SEQ IDNo.3：5′-CAGTCGCAAGAACAATCATCGTGGC-3′
amplification primer pairs and probes specific for kubo fever virus type 1: the specific amplification primer pair shown as SEQ ID No.4 and SEQ ID No.5 and the specific probe sequence shown as SEQ ID No.6 are as follows:
SEQ IDNo.4：5′-TCTCCCCTCAACTAAACTAGAAATC-3′
SEQ IDNo.5：5′-CTCTTAACGATCAAGCCCTTCTC-3′
SEQ IDNo.6：5′-AGAGGAGGAGCCATCACTTCAACCG-3′；
amplification primer pair specific to kubo fever virus type 2 and hybridization probe: the specific amplification upstream and downstream primers shown as SEQ ID No.7 and SEQ ID No.8 and the hybridization probe sequence shown as SEQ ID No.9 are as follows:
SEQ IDNo.7：5′-GCAAAGAGATGGCACGAAAGAC-3′
SEQ IDNo.8：5′-GAAACCGAGGAGGATCAACATAATC-3′
SEQ IDNo.9：5′-AGTGGTCGTCCTCTCTGTCGCCTGC-3′。
the design of the probe is particularly critical, the probe can be selected among fragments amplified by the primer, firstly, the probe cannot form primer dimer, otherwise, false negative detection results can be caused, secondly, when the probe is used for detecting multiple pathogens, cross reaction cannot be caused between the fragments and the primer for multiple detection, and otherwise, false positive or false negative results can be caused. The probes are designed such that the maximum fluorescence emission wavelength of the reporter group of each pathogen probe is in a different spectral range to ensure that the detection channel of the quantitative fluorescence PCR instrument can distinguish the probes of each pathogen. Therefore, in addition to using Beacon Designer 7.5 software for evaluation to ensure that the multiplex reactions are theoretically as consistent as possible, appropriate adjustments of primer and probe concentrations should be made according to the amplification curve of the reaction until the optimal amplification curve is amplified. The three fluorescent dyes TEXRED, FAM and CY5 selected by the invention have the wavelengths in different spectral ranges, cannot interfere with each other, and have obvious distinguishing effect and signal intensity.
A large number of experiments prove that when the primers and the probes are adopted, the primers and the probes can be independently used for detecting corresponding pathogens, and the 5 'end and the 3' end of the probes can be respectively selected from markers TEXRED-BHQ2, FAM-TAMRA and CY5-BHQ 3. However, when three viruses are detected simultaneously, the labeling of each probe should label the three combination relationships, that is, TEXRED-BHQ2, FAM-TAMRA and CY5-BHQ3 are adopted to label the Congo fever virus probe, the Cogberger fever virus 1 probe and the Cogber fever virus 2 probe respectively, the fluorescent groups labeled at the 5 'end and the 3' end of each probe are not coincident, but can be combined at will, the detection result is not affected, and when a single pathogen is detected, the probe can also adopt other fluorescent groups such as VIC, NED and Texred as the luminescent groups and BHQ, MGB and Q1 as the fluorescence quenching groups.
The N protein gene of the Congo fever virus screened by the invention has a sequence number of JX297815.1 in GenBank, the screened conserved sequence is shown as a lowercase letter shown in SEQ ID No.10, and a primer and a probe are designed in the conserved sequence. Finally, the size of the amplified fragment of the designed Congo fever virus primer is determined to be 99bp, and the amplification sequence is bp from 109 th to 208 th of the sequence shown in SEQ ID No. 10.
SEQ IDNo.10：ATTTAGGTGACACTATAGagggataaaagtaaaaaaacagg ggaaagacttatatacaaaaataactttacacactaaaggattaaacatttcaaagcttgatgaaataaaatttgcagaagacatggactctcctgagtcagtcgcaagaacaatcatcgtggcctctaaatggcagaagctcctaacacctgttggagcggagttcctctaataaccatgaaaaaaagcaacaggaatcatgctgt。
The library wave fever virus type 1 is selected as a P protein gene, the sequence number in GenBank is KP324827.1, the screened conserved sequence is shown as a lower case letter shown in SEQ ID No.11, a primer and a probe are designed in the conserved sequence, the size of a primer amplification fragment is 102bp, and the amplification sequence is shown as bp 92 to 194 in SEQ ID No. 11.
SEQ ID No.11：ATTTAGGTGACACTATAGggagaggacttcgcaatcttgaat gatccagacggctacaaggtttatgaccttaggaactcagttggagattttctcccctcaactaaactagaaatcatagaggaggagccatcacttcaaccggtcaaaatgacacttatacaaattcttgagaagggcttgatcgttaagaggaaactagggactgggaaggtgaagttgacaatg。
The library wave fever virus type 2 is selected as a P protein gene, the sequence number in GenBank is KP324828.1, the screened conserved sequence is shown as a lower case letter shown in SEQ ID No.12, a primer and a probe are designed in the conserved sequence, the size of a primer amplification fragment is 76bp, and the nucleotide sequence is shown as bp 56 to 132 in the sequence shown in SEQ ID No. 12.
SEQ IDNo.12：ATTTAGGTGACACTATAGccattagatttgcttgagattgagga ctatgacgagaagcaaagagatggcacgaaagaccaagcaggcgacagagaggacgaccactggattatgttgatcctcctcggtttctataggatcaataaaataagccacaaccaatacagggcatcaatgatctccaaattgaatcaacaagcaaacaaca。
The design advantages of the invention are as follows: the primer probe design of the congo fever virus is subjected to multiple sequence comparison with other viruses of the congo fever virus, sequences with high homology of the congo fever virus and other virus genes of the congo fever virus are eliminated, and the primer probe design is carried out in a high variation region of the congo fever virus, so that the amplification efficiency of the method is ensured, and the non-specific amplification is reduced to the minimum. Through nucleotide homology comparison, the type 1 and the type 2 of the kubo fever virus belong to new infectious disease pathogens, the research on the virus is less, and no corresponding detection method exists, the design of the primer probe for the type 2 of the kubo fever virus mainly aims at the difference region between the types 2, and the established method can be ensured to amplify the kubo fever virus and classify the kubo fever virus. In the invention, SEQ ID No.10, SEQ ID No.11 and SEQ ID No.12 are selected as positive controls, as the provided sequence contains a target gene, the maintenance of 200bp is to ensure the reliability of the plasmid as the positive control, the sequence of the capital letters in the front is a promoter sequence, in order to ensure the smooth in-vitro transcription, the positive control in the kit is an RNA sequence after the transcription of the plasmid, and the positive control in the kit is also RNA.
Example 2 real-time fluorescent PCR detection kit for Congo fever Virus, Kubo fever Virus type 1 and Kubo fever Virus type 2
The fluorescent quantitative PCR detection kit for detecting the congo fever virus, the kubo fever virus type 1 and the kubo fever virus type 2 comprises the following components:
2×RT-PCR buffer；
25×RT-PCR Enzyme Mix
the sequence of an upstream primer of the congo fever virus is shown as SEQ ID No.1, the sequence of a downstream primer is shown as SEQ ID No.2, the sequence of a probe is shown as SEQ ID No.3, the 5 'marker TEXRED of the probe SEQ ID No.3 and the 3' marker BHQ 2;
the sequence of the upstream primer of the kubo fever virus type 1 is shown as SEQ ID No.4, the sequence of the downstream primer is shown as SEQ ID No.5, and the sequence of the probe is shown as SEQ ID No.6, wherein the 5 'marker FAM of the probe SEQ ID No.6 and the 3' marker TAMRA are shown;
the sequence of the upstream primer of the kubo fever virus type 2 is shown as SEQ ID No.7, the sequence of the downstream primer is shown as SEQ ID No.8, the sequence of the probe is shown as SEQ ID No.9, wherein the 5 'marker CY5 of the probe SEQ ID No.9 and the 3' marker BHQ3 are shown.
In the kit, each primer or probe can be separately and independently packaged, or all primers can be mixed to form a primer MIX, and all probes can be mixed to form a probe MIX.
Furthermore, in order to avoid the failure or pollution of the used reagent, a positive control reagent and a negative control reagent are arranged, and the negative control adopts nuclease-free water;
the positive control adopts plasmid RNA carrying amplification products, and the nucleotide sequences of the amplification products are respectively shown as SEQ ID No.10, SEQ ID No.11 and SEQ ID No. 12.
The design of negative control can effectively verify whether the used reagent is polluted or not, so that false positive is avoided, and the design of positive control can effectively verify the effectiveness of the used reagent, so that false negative is avoided.
Wherein the 2 XTR-PCR buffer, the 25 XTR-PCR Enzyme Mix and the nuclease-free water are purchased from ABI company; the primers, probes and plasmids can be synthesized by Weijie Jie (Shanghai) trade company Limited.
When the primers or the probes are separately packaged, the reagents can be used independently, when one pathogen is detected, only one detection primer and probe corresponding to one pathogen are needed, the single-body system detection of a single pathogen can be used, the detection of two pathogens can also be used, the detection is not limited to the simultaneous detection of only three viruses, and in order to consider the cost of using the reagents and the detection purpose, the used reagents can be combined according to the detection purpose.
It should be noted that: when the single pathogen is detected by adopting the monomer system, the interpretation conditions of the result are as follows: the fluorescence increase curve of the sample to be detected exceeds a threshold value line and shows good logarithmic increase, the sample to be detected is judged to be positive, if no typical amplification curve exists, the sample to be detected is judged to be negative, in the specific embodiment, the threshold value is 37, and when the Ct value is less than or equal to 37, an obvious amplification curve is a positive result; if the Ct value is more than 37 and less than or equal to 40, repeating the experiment once, if an obvious amplification curve is a positive result, otherwise, obtaining a negative result; ct values > 40 are negative results.
Example 3 fluorescent quantitative PCR method for simultaneously detecting three viruses
The method for simultaneously detecting three viruses including congo fever virus, kubo fever virus type 1 and kubo fever virus type 2 by adopting fluorescent quantitative PCR comprises the following steps:
(1) pathogen RNA extraction
The extraction can be carried out by using a virus RNA kit of Roche.
(2) Fluorescent quantitative PCR amplification
The upstream and downstream primers and probes of Congo fever virus, Kubo fever virus type 1 and type 2 are mixed, equal-volume primers are respectively taken and mixed to form primer MIX, the final concentration of each primer is 3.3 mu mol/L, equal-volume probes are respectively taken and mixed to form probe MIX, and the final concentration of each probe is 1.0 mu mol/L.
The method adopts AgPath-ID One-step RT-PCR of ABI company, and 25 mu L of reaction system: primer MIX 2.0 μ L; probe MIX 1.0 μ L; 2 × RT-PCR buffer 12.5 μ L; 25 × RT-PCR Enzyme Mix 1.0 μ L; each positive plasmid RNA template was 5.0. mu.L, nuclease-free water was 3.5. mu.L.
When positive control is set, plasmid containing positive amplification sequence of each pathogen is used to replace sample RNA, and when negative control is set, nuclease-free water is used to replace sample RNA.
Amplification conditions: the following amplification conditions are preferred:
the reverse transcription step is at 45 ℃ for 30 min; the denaturation step is at 95 ℃ for 10 min; the amplification cycle steps were 95 ℃ for 15 sec; 40 cycles were performed at 60 ℃ for 45sec, and fluorescence signals were collected at 60 ℃.
(3) Collecting fluorescence signals, respectively selecting fluorescence detection modes of TEXRED, FAM and Cy5, adjusting a base line, taking 3-15 cycles of fluorescence signals, and setting a threshold line by the highest point of which the threshold line just exceeds the normal negative control;
(4) and (4) judging a result: the fluorescence increase curve of the sample to be detected exceeds a threshold value line and shows good logarithmic increase, the sample to be detected is judged to be positive, if no typical amplification curve exists, the sample to be detected is judged to be negative, in the specific embodiment, the threshold value is 35, and when the Ct value is less than or equal to 35, an obvious amplification curve is a positive result; if the Ct value is more than 35 and less than or equal to 40, repeating the experiment once, if an obvious amplification curve is a positive result, otherwise, obtaining a negative result; ct values > 40 are negative results.
Example 4 detection of the sensitivity of the Simmondsin fever Virus, Kubo fever Virus type 1 and type 2 Simplex real-time fluorescent PCR method
The plasmid RNAs of the causative agents of Congo fever virus, Couloviral 1 and Couloviral 2, which were synthesized in example 1, were determined to have copy numbers of 2.31X 109copies/μL、2.98×109copies/μL、3.12×109Diluting copies/mu L according to a ratio of 10 times, and obtaining the Congo fever virus, kubo fever virus type 1 and kubo fever virus type 2 RNA with a dilution gradient of 10-3-10-9(ii) a The kit prepared in example 2 is used for respectively detecting three viruses of the congo fever virus, the kubo fever virus type 1 and the kubo fever virus type 2 by using a single primer pair and corresponding probes on the RNA templates with different concentrations, for example, for single detection of the congo fever virus,
1) NTC: nuclease-free water;
the reaction system adopts 25 muL of reaction system, and the reaction system consists of 2 times RT-PCR buffer 12.5 muL; 25 × RT-PCR Enzyme Mix 1.0 μ L, and Congo fever virus upstream and downstream primers (10 μ M) are 1.0 μ L; congo fever virus (3. mu.M) probe 1.0. mu.L, nuclease-free water 3.5. mu.L,
the sample RNA was 5. mu.L of plasmid RNA of Congo fever virus. Detecting the sample RNA by adopting the diluted positive template, preferably selecting amplification conditions: the reverse transcription step is at 45 ℃ for 30 min; the denaturation step is at 95 ℃ for 10 min; the amplification cycle steps were 95 ℃ for 15 sec; 40 cycles were performed at 60 ℃ for 45sec, and fluorescence signals were collected at 60 ℃. Real-time fluorescent quantitative PCR detection was performed on an ABI7500PCR instrument.
2) Three replicates were made for each gradient.
And (4) judging a result: the Ct value is less than or equal to 37, an obvious amplification curve is a positive result, and the Ct value is more than 40, and no obvious amplification curve is a negative result.
A fluorescence value graph of the detection results, wherein the sensitivity test results of the congo fever virus are shown in FIG. 1, and the template copy numbers of the curves from left to right in the graph are 2.31X 106copies/μL、2.31×105copies/μL L、2.31×104copies/μL、2.31×103copies/μL、2.31×102As shown by the results of the congo fever virus RNA with the copies/mu L, 2.31 multiplied by 10 copies/mu L and 2.31 copies/mu L, the method established by the invention can detect the congo fever virus RNA with the concentration of 2.31 copies/mu L. The results of the sensitivity test of the Couloviral type 1 are shown in FIG. 2, in which the template copy numbers of the curves from left to right are 2.98X 10, respectively6copies/μL、2.98×105copies/μL、2.98×104copies/μL、2.98×103copies/μL、2.98×102The results show that the method established by the invention can detect the Copies/mu L, 2.98 × 10 Copies/mu L and 2.98 Copies/mu L of the Copple fever virus type 1 RNA, and the concentration of the Copies/mu L of the Copple fever virus type 1 RNA is 2.98 Copies/mu L. The results of the sensitivity test for kubo fever virus type 2 are shown in figure 3. The copy numbers of the templates shown from left to right in the graph are 3.12X 106copies/μL、3.12×105copies/μL、3.12×104copies/μL、3.12×103copies/μL、3.12×102The results show that the method established by the invention is used for the RNA of the Copis virus type 2 at the concentration of 3.12 copi/mu L, 3.12 multiplied by 10 copis/mu L and 3.12 copis/mu Les/mu.L of Copauloviral type 2 RNA can be detected. As can be seen, the sensitivity of detecting Congo fever virus, Copovirus type 1 and Copovirus type 2 by the monomer system of the method is respectively 2.31 copies/mu L, 2.98 copies/mu L and 3.12 copies/mu L.
Example 5 detection of sensitivity of Congo fever Virus, Kubo fever Virus type 1 and 2 triple real-time fluorescent PCR methods
The RNA templates prepared in example 4 at different concentrations were simultaneously detected for three viruses, i.e., Congo fever virus, Couloviral 1 and Couloviral 2, using the method established in example 3, and a triple-detection standard curve was plotted,
1) NTC: nuclease-free water;
the reaction system adopts 25 muL of reaction system, and the reaction system consists of 2 times RT-PCR buffer 12.5 muL; 25 × RT-PCR Enzyme Mix 1.0 μ L, primer MIX 2.0 μ L, probe MIX 1.0 μ L nuclease-free water 3.5 μ L, sample RNA 5 μ L. Sample RNA is detected using the template prepared in example 4, preferably under amplification conditions: the reverse transcription step is at 45 ℃ for 30 min; the denaturation step is at 95 ℃ for 10 min; the amplification cycle steps were 95 ℃ for 15 sec; 40 cycles were performed at 60 ℃ for 45sec, and fluorescence signals were collected at 60 ℃. Real-time fluorescent quantitative PCR detection was performed on an ABI7500PCR instrument.
2) Three replicates were made for each gradient.
And (4) judging a result: the Ct value is less than or equal to 35, an obvious amplification curve is a positive result, and the Ct value is more than 40, and no obvious amplification curve is a negative result.
Fluorescence value graph of detection results, wherein the sensitivity test results of the congo fever virus are shown in FIG. 4, and the template copy numbers of the curves from left to right in the graph are 2.31X 106copies/μL、2.31×105copies/μL L、2.31×104copies/μL、2.31×103copies/μL、2.31×102The results show that the method established by the invention can detect Congo fever virus RNA with the concentration of 23.1 copies/. mu.L. The sensitivity test results of the kubo fever virus type 1 are shown in FIG. 4, in which the template copy numbers shown from left to right of the curve are2.98×106copies/μL、2.98×105copies/μL、2.98×104copies/μL、2.98×103copies/μL、2.98×102The results show that the established method can detect the Copies/mu L and 2.98X 10 Copies/mu L of the Copple fever virus type 1 RNA, and the concentration of the Copies/mu L of the Copple fever virus type 1 RNA is 29.8 Copies/mu L. The results of the sensitivity test for kubo fever virus type 2 are shown in fig. 4. The copy numbers of the templates shown from left to right in the graph are 3.12X 106copies/μL、3.12×105copies/μL、3.12×104copies/μL、3.12×103copies/μL、3.12×102The results show that the established method can detect the Copies/mu L and 3.12X 10 Copies/mu L of the Copple fever virus type 2 RNA, and the concentration of the Copies/mu L of the Copple fever virus type 2 RNA is 31.2 Copies/mu L. As can be seen, the sensitivity of the method for simultaneously detecting congo fever virus, kubo fever virus type 1 and kubo fever virus type 2 is 23.1 copies/mu L, 29.8 copies/mu L and 31.2 copies/mu L respectively. The standard curve of the test kit for detecting Congo fever virus is that y is-3.41 x +41.35, R20.99; the standard curve of the kit for detecting the kubo fever virus type 1 is that y is-3.39 x +40.00, R20.99; the standard curve of the kit for detecting the kubo fever virus type 2 is that y is-3.51 x +41.85, R20.99; a comparison of the standard curves for simultaneous detection of Congo fever, Kubo fever, type 1 and Kubo fever, type 2, and the corresponding detection of each viral response is shown in FIG. 5. From the standard curve, the R for each virus for the triple detection method can be seen2All 0.99 shows that the established method has high repeatability, and the slope in the standard curve established by aiming at each method is close to-3.3, which shows that the amplification efficiency of the invention is high.
EXAMPLE 6 specificity of the kit of the invention
The viruses stored in a laboratory for preventing and controlling the diseases of Huaian city by using the kit comprise: yellow fever virus, rift valley fever virus, chikungunya virus, dengue virus, plasmodium and other insect-borne pathogens are detected.
The extracted RNA was subjected to detection by the method described in example 5. The detection result shows that the congo fever virus, the kubo fever virus 1 and the kubo fever virus 2 have amplification curves, other viruses have no amplification curves, the detection result is negative, and the result is shown in fig. 6. The result shows that the primer and the probe designed by the invention have specificity, no non-specific amplification and strong specificity.
Example 7 detection of samples Using the kit of the invention
96 parts of mosquito vector specimens are collected, wherein 48 culex rhynchophyllus, 10 anopheles sinensis, 20 culex pipiens pallens and 20 culex pipiens albopictus are collected.
The method for extracting RNA from the above sample can be performed by the method for extracting RNA as in example 4, the extracted RNA is detected by the kit of the present invention, and the result of the detection by the fluorescence quantitative method as in example 4 is shown in fig. 7, where the Ct value of the sample number 134 (culex tritaeniorhynchus) and 168 (culex tritaeniorhynchus) is 32.55, and 34.6 shows that the mosquito vector 134 sample is positive for congou virus nucleic acid and the mosquito vector 168 sample is positive for kubo virus nucleic acid according to the interpretation result standard. The detection method has good applicability to the detection of samples, the detection is carried out in an ABI7500 fluorescence quantitative PCR instrument, and the detection accuracy rate reaches 100 percent.
While the invention has been described with reference to a preferred embodiment, it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the scope of the invention. However, any simple modification, equivalent change and modification of the above embodiments according to the technical essence of the present invention are within the protection scope of the technical solution of the present invention.
Sequence listing
<110> Huaian city disease prevention and control center
<120> nucleic acid, kit and method for simultaneously detecting heat virus of fruit virus, kubo fever virus 1 and 2
<130>
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
aaatttgcag aagacatgga ctctc 25
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
<210> 3
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
cagtcgcaag aacaatcatc gtggc 25
<210> 4
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
tctcccctca actaaactag aaatc 25
<210> 5
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ctcttaacga tcaagccctt ctc 23
<210> 6
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
agaggaggag ccatcacttc aaccg 25
<210> 7
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
gcaaagagat ggcacgaaag ac 22
<210> 8
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
gaaaccgagg aggatcaaca taatc 25
<210> 9
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
agtggtcgtc ctctctgtcg cctgc 25
<210> 10
<211> 248
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
atttaggtga cactatagag ggataaaagt aaaaaaacag gggaaagact tatatacaaa 60
aataacttta cacactaaag gattaaacat ttcaaagctt gatgaaataa aatttgcaga 120
agacatggac tctcctgagt cagtcgcaag aacaatcatc gtggcctcta aatggcagaa 180
gctcctaaca cctgttggag cggagttcct ctaataacca tgaaaaaaag caacaggaat 240
catgctgt 248
<210> 11
<211> 228
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
atttaggtga cactataggg agaggacttc gcaatcttga atgatccaga cggctacaag 60
gtttatgacc ttaggaactc agttggagat tttctcccct caactaaact agaaatcata 120
gaggaggagc catcacttca accggtcaaa atgacactta tacaaattct tgagaagggc 180
ttgatcgtta agaggaaact agggactggg aaggtgaagt tgacaatg 228
<210> 12
<211> 208
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
atttaggtga cactatagcc attagatttg cttgagattg aggactatga cgagaagcaa 60
agagatggca cgaaagacca agcaggcgac agagaggacg accactggat tatgttgatc 120
ctcctcggtt tctataggat caataaaata agccacaacc aatacagggc atcaatgatc 180
tccaaattga atcaacaagc aaacaaca 208
Claims (9)
1. A group of nucleic acids for simultaneously detecting three viruses by fluorescent quantitative PCR (polymerase chain reaction), which is characterized by comprising upstream and downstream primers for detecting respectively congo fever virus, kubo fever virus type 1 and kubo fever virus type 2, wherein the upstream primer sequence of the congo fever virus is shown as SEQ ID No.1, the downstream primer sequence is shown as SEQ ID No.2, and the probe sequence is shown as SEQ ID No. 3;
the sequence of the upstream primer of the kubo fever virus type 1 is shown as SEQ ID No.4, the sequence of the downstream primer is shown as SEQ ID No.5, and the sequence of the probe is shown as SEQ ID No. 6;
the sequence of the upstream primer of the kubo fever virus type 2 is shown as SEQ ID No.7, the sequence of the downstream primer is shown as SEQ ID No.8, and the sequence of the probe is shown as SEQ ID No. 9.
2. The nucleic acid of claim 1, wherein the set of nucleic acids further comprises a positive control comprising detection of congo fever virus, kubo fever virus type 1, and kubo fever virus type 2, wherein,
the positive control for detecting the congo fever virus comprises a sequence shown as SEQ ID No. 10;
the positive control for detecting the kubo fever virus type 1 comprises a sequence shown as SEQ ID No. 11;
the positive control for detecting the kubo fever virus type 2 comprises a sequence shown as SEQ ID No. 12.
3. A kit for simultaneously detecting three viruses by fluorescent quantitative PCR, which is characterized by comprising: the three viral upstream and downstream primers of Congo fever virus, kubo fever virus type 1 and kubo fever virus type 2 and the corresponding probes of claim 1, wherein the 5 'end and the 3' end of each probe are labeled TEXRED-BHQ2, FAM-TAMRA and CY5-BHQ3, respectively.
4. The kit of claim 3, further comprising a positive control for detecting three viruses of Congo fever virus, Couloviruses type 1 and Couloviruses type 2,
the positive control for detecting the congo fever virus contains a sequence shown as SEQ ID No. 10;
the positive control for detecting the kubo fever virus type 1 contains a sequence shown as SEQ ID No. 11;
the positive control for detecting the kubo fever virus type 2 contains a sequence shown as SEQ ID No. 12.
5. The kit of claim 3 or 4, further comprising 2 x RT-PCR buffer, 25 x RT-PCR Enzyme Mix and nuclease-free water.
6. A detection method for simultaneously detecting three viruses by fluorescent quantitative PCR (polymerase chain reaction), which is a method for non-diagnostic purposes and is used for detecting three viruses including Congo fever virus, kubo fever virus type 1 and kubo fever virus type 2, and specifically comprises the following steps:
(1) extracting RNA from the sample;
(2) performing fluorescent quantitative PCR amplification on the extracted RNA; wherein, during fluorescent quantitative PCR amplification, in a reaction system, the nucleotide sequences of the upstream primer, the downstream primer and the probe of the congo fever virus are shown as SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3, and the 5 'end and the 3' end of the probe are respectively and correspondingly marked with TEXRED and BHQ 2; the nucleotide sequences of the upstream primer, the downstream primer and the probe of the kubo fever virus type 1 are shown as SEQ ID No.4, SEQ ID No.5 and SEQ ID No.6, and the 5 'end and the 3' end of the probe are respectively and correspondingly marked with FAM and TAMRA; the nucleotide sequences of the upstream primer and the downstream primer of the kubo fever virus type 2 and the probe are shown as SEQ ID No.7, SEQ ID No.8 and SEQ ID No.9, and the 5 'end and the 3' end of the probe are respectively corresponding to markers CY5 and BHQ 3;
(3) collecting fluorescence signals, selecting a fluorescence detection mode of the fluorescent group in the step (2), adjusting a base line, taking 3-15 circulating fluorescence signals, and setting a threshold line by the highest point of the threshold line just exceeding the normal negative control;
(4) and (4) judging a result: and if the fluorescence increase curve of the sample to be detected exceeds a threshold value line and shows good logarithmic increase, judging the sample to be detected to be positive, and if no typical amplification curve exists, judging the sample to be detected to be negative.
7. The detection method according to claim 6, wherein the reaction system for the fluorescent quantitative PCR amplification in the step (2) is as follows:
2×RT-PCR buffer 12.5μL，
primer MIX: 2.0. mu.L
And (3) a probe MIX: 1.0 μ L
25×RT-PCR Enzyme Mix：1.0μL
Nuclease-free water: 3.5 μ L
RNA：5.0μL
The primer MIX is a mixture of upstream and downstream primers of Congo fever virus, kubo fever virus type 1 and kubo fever virus type 2 with final concentration of 3.3 mu mol/L respectively;
the probe MIX is a mixture of probes of Congo fever virus, Cobo fever virus type 1 and Cobo fever virus type 2 with the final concentration of 1.0 mu mol/L respectively;
meanwhile, setting water without nuclease as a negative control;
meanwhile, the primer set comprises a sequence shown as SEQ ID No.10, a sequence shown as SEQ ID No.11 and a sequence shown as SEQ ID No.12 as positive controls.
8. The detection method as claimed in claim 6, wherein the reaction procedure of the fluorescent quantitative PCR amplification in the step (2) is as follows: the reverse transcription step is at 45 ℃ for 30 min; the denaturation step is at 95 ℃ for 10 min; the amplification cycle steps were 95 ℃ for 15 sec; 40 cycles were performed at 60 ℃ for 45sec, and fluorescence signals were collected at 60 ℃.
9. The detection method according to any one of claims 6 to 8, wherein in the determination of the result in the step (4), the threshold value is 35, and when the Ct value is less than or equal to 35, a significant amplification curve is a positive result; if the Ct value is more than 35 and less than or equal to 40, repeating the experiment once, if an obvious amplification curve is a positive result, otherwise, obtaining a negative result; ct values > 40 are negative results.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810099377.5A CN108220481B (en) | 2018-02-01 | 2018-02-01 | Nucleic acid, kit and method for simultaneously detecting congo fever virus, kubo fever virus 1 and 2 types |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810099377.5A CN108220481B (en) | 2018-02-01 | 2018-02-01 | Nucleic acid, kit and method for simultaneously detecting congo fever virus, kubo fever virus 1 and 2 types |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108220481A CN108220481A (en) | 2018-06-29 |
| CN108220481B true CN108220481B (en) | 2021-05-04 |
Family
ID=62670018
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810099377.5A Active CN108220481B (en) | 2018-02-01 | 2018-02-01 | Nucleic acid, kit and method for simultaneously detecting congo fever virus, kubo fever virus 1 and 2 types |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108220481B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112941235B (en) * | 2021-03-06 | 2022-09-23 | 复旦大学 | Nucleic acid composition, detection system, detection device and detection method for rapidly detecting kubo fever virus |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102277452A (en) * | 2011-08-18 | 2011-12-14 | 深圳国际旅行卫生保健中心 | Kit used for detecting highly infectious disease and detection method |
-
2018
- 2018-02-01 CN CN201810099377.5A patent/CN108220481B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102277452A (en) * | 2011-08-18 | 2011-12-14 | 深圳国际旅行卫生保健中心 | Kit used for detecting highly infectious disease and detection method |
Non-Patent Citations (2)
| Title |
|---|
| 上海出入境检验检疫局发现我国首例库波热病毒;张子龙等;《病毒学报》;20170417;第33卷;1-2 * |
| 克里米亚-刚果出血热病毒实时荧光RT-PCR检测方法的建立;袁帅等;《中国国境卫生检疫杂志》;20161231;183-190 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108220481A (en) | 2018-06-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111235232B (en) | Visual rapid nucleic acid detection method based on CRISPR-Cas12a system and application | |
| CN107988428B (en) | RAA constant temperature fluorescence detection method and reagent for Shrimp Iridovirus (SIV) | |
| CN106957927A (en) | African swine fever fluorescence PCR detection reagent, African swine fever fluorescence PCR detection reagent kit and its application | |
| CN113355459B (en) | Method and kit for detecting and screening N501Y mutation of new coronavirus | |
| CN111926116A (en) | Primer and probe for rapidly and quantitatively detecting duck adenovirus type 4, detection method and application thereof | |
| CN113604612A (en) | Alongshan virus loop-mediated isothermal amplification detection primer group, kit containing primer group and application of kit | |
| CN116287388A (en) | Identification method, primer pair and kit for cryptococcus | |
| CN110184387B (en) | RT-LAMP detection primer for detecting ANSVV, application thereof, detection reagent and detection method | |
| CN109750124B (en) | Nucleic acid group for detecting lentivirus and detection method | |
| CN110938711A (en) | Real-time fluorescent RAA primer, probe and kit for detecting avian infectious laryngotracheitis virus and using method of real-time fluorescent RAA primer, probe and kit | |
| CN113046484B (en) | Primer probe, kit and method for detecting African swine fever virus p72 gene | |
| CN108220481B (en) | Nucleic acid, kit and method for simultaneously detecting congo fever virus, kubo fever virus 1 and 2 types | |
| CN114058740B (en) | Fluorescent PCR amplification primer probe set capable of identifying gene I type and gene II type African swine fever virus and detection kit | |
| CN110592269A (en) | RAA constant-temperature fluorescence detection method and reagent for grass carp hemorrhagic disease type 2 virus (GCRV-2) | |
| CN113215314B (en) | Probe, primer set, kit and detection method for rapidly detecting SARS-CoV-2 by using L/RPA | |
| CN110387435A (en) | Utilize the method and its special complete reagent of RPA technology detection zika virus | |
| CN116064953A (en) | Kit, method and application for detecting and typing nucleic acid of monkey poxvirus in same tube | |
| CN105296668B (en) | Primer, probe and kit for specifically detecting type 3 ungulate bocavirus parvovirus | |
| CN109182597B (en) | Multiplex fluorescence quantitative PCR kit for simultaneously detecting avian adenovirus group I, II and III and detection method thereof | |
| KR101617142B1 (en) | Nucleic acid test based avian influenza virus detection kit with improved detection accuracy | |
| CN110894551A (en) | RAA constant-temperature fluorescence detection method and reagent for grass carp hemorrhagic disease type I virus (GCRV-I) | |
| CN113355460A (en) | Primer and kit for detecting novel goose reovirus, and detection method and application thereof | |
| CN113981145B (en) | Detection method and detection kit for group I avian adenovirus A, B, C, D and E | |
| CN110894549A (en) | RAA constant temperature fluorescence detection method and reagent for Epidemic Hematopoietic Necrosis Virus (EHNV) | |
| CN113308575B (en) | Method and kit for detecting and screening N439K mutation of new coronavirus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |