CN108220431A - Detect the primer pair of people EIF2AK1 gene expression amounts and relative expression quantity - Google Patents
Detect the primer pair of people EIF2AK1 gene expression amounts and relative expression quantity Download PDFInfo
- Publication number
- CN108220431A CN108220431A CN201611151159.9A CN201611151159A CN108220431A CN 108220431 A CN108220431 A CN 108220431A CN 201611151159 A CN201611151159 A CN 201611151159A CN 108220431 A CN108220431 A CN 108220431A
- Authority
- CN
- China
- Prior art keywords
- eif2ak1
- cell
- expression quantity
- reagent
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Physics & Mathematics (AREA)
- Pathology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the primer pairs of detection people EIF2AK1 gene expression amounts and relative expression quantity.The primer pair of detection people EIF2AK1 gene expression amounts and relative expression quantity disclosed by the invention, the primer pair being made of the single stranded DNA shown in sequence in sequence table 1 and the single stranded DNA shown in sequence 2 for being entitled EIF2AK1 P.It is demonstrated experimentally that the primer pair of the present invention can detect expression contents of the EIF2AK1 in cervical cancer tissues, operation is relatively easy, as a result accurately.
Description
Technical field
The present invention relates to the primer pairs that people EIF2AK1 gene expression amounts and relative expression quantity are detected in biotechnology.
Background technology
Cervical carcinoma is most common gynecologic malignant tumor.Carcinoma in situ Gao Fa Nian Ling is 30~35 years old, and infiltrating carcinoma is 45~55
Year, in recent years its morbidity have the tendency that rejuvenation.Diagnostic method clinically is generally cell scapes detection, gynecatoptron detects,
Organize biopsy etc..But the reasons such as fibroid, mullerianosis, cervical polyp, ulcer can be to the certainty of diagnostic result
Cause severe jamming.Therefore, it is most important to find new diagnosis of cervical cancer marker.
EIF2AK1 (Eukaryotic translation initiation factor 2-alpha kinase 1) is
A kind of protein kinase.Some researches show that the gene is related to inflammation stress reaction.In cervical carcinoma, compared with cancer beside organism,
The expression of EIF2AK1 is significantly raised.Therefore, EIF2AK1 promises to be potential diagnosis of cervical cancer marker.
Invention content
The technical problems to be solved by the invention are how to detect people EIF2AK1 gene expression amounts or relative expression quantity.
In order to solve the above technical problems, present invention firstly provides detection or auxiliary detection people's EIF2AK1 gene expression amounts
Or the primer pair of relative expression quantity.
Detection provided by the present invention or the primer pair of auxiliary detection people EIF2AK1 gene expression amounts or relative expression quantity,
The primer being made of the single stranded DNA shown in sequence in sequence table 1 and the single stranded DNA shown in sequence 2 for entitled EIF2AK1-P
It is right.
In order to solve the above technical problems, the present invention also provides detection or auxiliary detection mankind's EIF2AK1 gene expression amounts
Or the reagent set of relative expression quantity.
Detection provided by the present invention or the complete examination of auxiliary detection mankind EIF2AK1 gene expression amounts or relative expression quantity
Agent is made of the EIF2AK1-P with the primer pair combined with the GAPDH gene specifics of people of entitled GAPDH-P.
In above-mentioned reagent set, the GAPDH-P is as the single stranded DNA shown in sequence in sequence table 3 and the list shown in sequence 4
Chain DNA forms.
In order to solve the above technical problems, the present invention also provides detection or auxiliary detection people EIF2AK1 gene expression amounts or
The reagent or kit of relative expression quantity.
Detection provided by the present invention or reagent or the examination of auxiliary detection people EIF2AK1 gene expression amounts or relative expression quantity
Agent box is made of the EIF2AK1-P or described reagent sets with X1, and the X1 is carries out reagent needed for quantitative pcr amplification.
In mentioned reagent or kit, reagent needed for the progress quantitative pcr amplification can be qPCR MIX.QPCR MIX can
For Beijing full formula gold biotechnology (TransGen Biotech) Co., Ltd's product.
In mentioned reagent or kit, the quantitative pcr amplification can be that real-time fluorescence quantitative PCR expands.
In order to solve the above technical problems, the present invention also provides detection or auxiliary detection people EIF2AK1 gene expression amounts or
The system of relative expression quantity.
Detection provided by the present invention or the system of auxiliary detection people EIF2AK1 gene expression amounts or relative expression quantity, by
The EIF2AK1-P, the reagent set or the reagent or kit and Y1 composition, the Y1 is carries out needed for RNA extractions
Reagent, carry out reverse transcription needed for reagent and/or carry out quantitative pcr amplification needed for instrument.
In above system, the reagent carried out needed for RNA extractions can be TRIzol, chloroform, isopropanol and/or ethyl alcohol.
TRIzol can be Shanghai Jierui Biology Engineering Co., Ltd's product.
Reagent needed for the carry out reverse transcription can be the reagent in ReverTranscript qPCR RT Kit.
ReverTranscript qPCR RT Kit are Takara Products.
Instrument needed for the carry out quantitative pcr amplification can be real time fluorescent quantitative pcr instrument (such as ABI7300 or ABI7500
(Applied Biosystems companies of the U.S.)).
In order to solve the above technical problems, the present invention also provides identifications or auxiliary identification tumor tissues and/or cell to be
System.
Identification provided by the present invention or the system of auxiliary identification tumor tissues and/or cell, including the EIF2AK1-
P, the reagent set, the reagent or kit or the detection or auxiliary detection people EIF2AK1 gene expression amounts or opposite
The system of expression quantity and gene quantification data processing system；The gene quantification data processing system is waited to reflect for calculating to come from
The expression quantity or relative expression quantity of the EIF2AK1 genes of tissue and/or cell are determined, according to the tissue to be identified and/or cell
EIF2AK1 genes expression quantity or relative expression quantity determine whether tissue and/or cell to be identified are tumor tissues and/or thin
Born of the same parents.
In order to solve the above technical problems, expression quantity or relative expression quantity the present invention also provides detection EIF2AK1 genes
Method.
The method of the expression quantity or relative expression quantity of detection EIF2AK1 genes provided by the present invention, including in vitro
The cDNA or RNA of tissue and/or cell to be identified carry out PCR amplification for template, with the EIF2AK1-P, in the PCR amplification
Annealing conditions can be 58 DEG C of 35sec.Reaction condition is concretely：95 DEG C of pre-degeneration 1min；95 DEG C of 15s, 58 DEG C of 35sec, 40
A cycle.
The reaction system during PCR amplification can be 25 μ L reaction systems, specific as follows：2 μ L cDNA solution, 12.5 μ L
QPCR Mix (2 ×), EIF2AK1-F (EIF2AK1-F in the reaction system a concentration of 0.2 μM), EIF2AK1-R
(EIF2AK1-R in the reaction system a concentration of 0.2 μM), is mended with sterile distilled water to 25 μ L.
In order to solve the above technical problems, the present invention also provides identification or the sides of auxiliary identification tumor tissues and/or cell
Method.
Identification provided by the present invention or the method for auxiliary identification tumor tissues and/or cell, including：Detection comes from and waits to reflect
Determine the expression quantity or relative expression quantity of the EIF2AK1 genes of tissue and/or cell；If the tissue to be identified and/or cell
EIF2AK1 genes expression quantity or relative expression quantity it is higher, the tissue to be identified and/or cell are or candidate is tumor group
It knits and/or the risk of cell is bigger, if the expression quantity or opposite of the EIF2AK1 genes of the tissue to be identified and/or cell
Expression quantity is lower, and the tissue to be identified and/or the risk that cell is or candidate is tumor tissues and/or cell are smaller.
In the above method, the tissue to be identified and/or cell can be cervical tissue and/or cervical cell.
In order to solve the above technical problems, the present invention also provides the EIF2AK1-P, the reagent set, the reagents
Or kit or the system are following 1) -5) in it is any in application：
1) detect or assist detection people EIF2AK1 gene expression amounts or relative expression quantity；
2) detection or auxiliary detection people EIF2AK1 gene expression amounts or relative expression quantity product are prepared；
3) identify or assist identification tumor tissues and/or cell；
4) identification or auxiliary identification tumor tissues and/or cell products are prepared.
In above application, the tumor tissues and/or cell can be cervical cancer tissues and/or cell.
It is demonstrated experimentally that the primer pair of the present invention can detect expression contents of the EIF2AK1 in cervical cancer tissues, phase is operated
To simple, as a result accurately.
The present invention in view of in the prior art detect cervical carcinoma sample marker deficiency, the present invention devise detection internal reference/
Target gene primer detects people's fusion relative expression quantity with fluorescent quantitative PCR technique.By adjusting drawing for two genes
Object concentration and probe concentration and ratio optimize the reaction system and reaction condition of PCR, develop one kind for detecting EIF2AK1 gene phases
To the kit of expression quantity.
Using the kit of the present invention, real-time fluorescence PCR technology is detected the expression of EIF2AK1 genes,
Accuracy of detection is high, and easy to operate, can reduce testing cost, saves detection time.Using double calibration curve methods, pass through structure
The standard quantitative curve of EIF2AK1 and reference gene GAPDH, the reference gene copy number and EIF2AK1 of accurate quantification sample are copied
Shellfish number, compared to previous ImmunohistochemistryMethods Methods, which has many advantages, such as precision height, as a result convenient for interpretation.In addition the examination
Primer, probe needed for reaction system is carried out rational proportion and optimization by agent box, experiment condition is made to reach best, so as to eliminate
Cumbersome condition gropes link, greatly improves conventional efficient.The kit is specific good after tested, high sensitivity, operation letter
Just.Contribute to the complementary detection of clinical sample.
Description of the drawings
Fig. 1 is EIF2AK1 melting curves.
Fig. 2 is GAPDH melting curves.
Fig. 3 is the amplification curve of EIF2AK1 and GAPDH.Wherein.Left side be GAPDH amplification curves, right side EIF2AK1
Amplification curve.
Fig. 4 is the relative expression quantity of 6 clinical cervical cancer patient EIF2AK1.
Specific embodiment
The present invention is further described in detail With reference to embodiment, the embodiment provided is only for explaining
The bright present invention, the range being not intended to be limiting of the invention.
Experimental method in following embodiments is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
Embodiment 1
The kit for being used to detect EIF2AK1 gene relative expression quantities of the present invention, including：
TRIzol (Shanghai Jierui Biology Engineering Co., Ltd)；
Chloroform；
Absolute ethyl alcohol；
ReverTranscript qPCR RT Kit (Takara companies)；
Detection architecture PCR reaction solution：QPCR Mix (2 ×) (the full formula gold biotechnologys in Beijing (TransGen Biotech)
Co., Ltd), each 0.2 μM of EIF2AK1-F/EIF2AK1-R
Wherein, primer sequence is：
EIF2AK1-F：CGTTACATGAGCCGAGATGA (sequence 1)
EIF2AK1-R：ACAGCCACCATGTTTAAGGC (sequence 2)
GAPDH-F：CATGAGAAGTATGACAACAGCCT (sequence 3)
GAPDH-R：AGTCCTTCCACGATACCAAAGT (sequence 4)
Embodiment 2
The application method of kit of the present invention：
(1) the tissue RNA of extracting：Suitable flesh tissue is taken, 1mL trizol is added in and uniformly, adds in homogenate wherein grinding
Enter 0.2ml chloroforms, concussion is uniform；4 DEG C of centrifugation 10min of 14000rpm, draw supernatant layer and are transferred in another new centrifuge tube；
Isometric isopropanol is added in, abundant mixing, is stored at room temperature 10min up and down；14000rpm4 DEG C of centrifugation 10min, abandons supernatant, adds
Enter 75% ethyl alcohol 1ml, gently turn upside down washing tube wall；4 DEG C of centrifugation 5min of 14000rpm, abandon ethyl alcohol；Drying at room temperature 10-
15min adds in 20ulRNase-free water dissolutions precipitation.
(2) with reference to the ReverTranscript qPCR RT Kit kit specifications of Takara companies, RNA is inverted
For cDNA, cDNA solution is obtained, a concentration of 50 μ L/ μ L of cDNA in cDNA solution.
(3) reagent is configured：Each reaction system is 25 μ L reaction systems, specific as follows：2 μ L cDNA solution, 12.5 μ L
QPCR Mix (2 ×), EIF2AK1-F or GAPDH-F (a concentration of 0.2 μ of EIF2AK1-F or GAPDH-F in the reaction system
M), EIF2AK1-R or GAPDH-R (EIF2AK1-R or GAPDH-R in the reaction system a concentration of 0.2 μM), with sterile steaming
Distilled water is mended to 25 μ L.By the use of physiological saline as blank control.
(4) it detects：Detection carries out on real-time fluorescence PCR instrument, can include ABI7300, the ABI7500 (U.S. with instrument
Applied Biosystems companies) etc..Reaction condition：95 DEG C of pre-degeneration 1min；95 DEG C of 15s, 58 DEG C of 35sec, 40 cycles,
Fluorescence signal acquires when 58 DEG C of 35sec.
(5) result judges：Threshold line is adjusted to more than background signal and negative amplification line, system according to standard curve and
CT values calculate copy number automatically.
The solubility curve and amplification curve detected using the kit is shown in Fig. 1, Fig. 2 and Fig. 3.
Embodiment 3
Clinical samples are detected using kit for detecting nucleic acid of the present invention
Detect object：Clinical cervical cancer patient 6, (all samples are organized for the cervical carcinoma I phases).The cervical carcinoma of each patient
It is organized by tissue and cervical carcinoma to 6 pairs altogether of detection, sample to be tested is detected by the application method of 2 kit of embodiment.Each
3 repetitions of sample, 1 part of blank control.Detection time only needs 100 minutes.
The results are shown in table below for 6 clinical cervical cancer patient pattern detections：
Fig. 4 is shown in 6 clinical cervical cancer patient pattern detection result summaries.
Fig. 4 is operated the results show that can detect expression contents of the EIF2AK1 in cervical cancer tissues using the primer pair
It is relatively easy, as a result accurately.
The present invention in view of in the prior art detect cervical carcinoma sample marker deficiency, the present invention devise detection internal reference/
Target gene primer detects people's fusion relative expression quantity with fluorescent quantitative PCR technique.By adjusting drawing for two genes
Object concentration and probe concentration and ratio optimize the reaction system and reaction condition of PCR, develop one kind for detecting EIF2AK1 gene phases
To the kit of expression quantity.
Using the kit of the present invention, real-time fluorescence PCR technology is detected the expression of EIF2AK1 genes,
Accuracy of detection is high, and easy to operate, can reduce testing cost, saves detection time.Using double calibration curve methods, pass through structure
The standard quantitative curve of EIF2AK1 and reference gene GAPDH, the reference gene copy number and EIF2AK1 of accurate quantification sample are copied
Shellfish number, compared to previous ImmunohistochemistryMethods Methods, which has many advantages, such as precision height, as a result convenient for interpretation.In addition the examination
Primer, probe needed for reaction system is carried out rational proportion and optimization by agent box, experiment condition is made to reach best, so as to eliminate
Cumbersome condition gropes link, greatly improves conventional efficient.The kit is specific good after tested, high sensitivity, operation letter
Just.Contribute to the complementary detection of clinical sample.
Claims (10)
1. detection or the primer pair of auxiliary detection people EIF2AK1 gene expression amounts or relative expression quantity are entitled EIF2AK1-P
The primer pair being made of the single stranded DNA shown in sequence in sequence table 1 and the single stranded DNA shown in sequence 2.
2. detection or the reagent set of auxiliary detection mankind EIF2AK1 gene expression amounts or relative expression quantity, by claim 1 institute
EIF2AK1-P is stated to form with the primer pair combined with the GAPDH gene specifics of people of entitled GAPDH-P.
3. reagent set according to claim 2, it is characterised in that：The GAPDH-P is as shown in sequence in sequence table 3
Single stranded DNA composition shown in single stranded DNA and sequence 4.
4. detection or the reagent or kit of auxiliary detection people EIF2AK1 gene expression amounts or relative expression quantity, by claim 1
Reagent set described in the primer pair or Claims 2 or 3 is formed with X1, and the X1 is carries out reagent needed for quantitative pcr amplification.
5. reagent according to claim 4 or kit, it is characterised in that：Reagent needed for the carry out quantitative pcr amplification
For qPCR MIX.
6. detection or the system of auxiliary detection people EIF2AK1 gene expression amounts or relative expression quantity, the primer as described in claim 1
To reagent set described in, Claims 2 or 3 or the reagent of claim 4 or 5 or kit and Y1 composition, the Y1 be into
The required reagent of row RNA extractions carries out the reagent needed for reverse transcription and/or carries out instrument needed for quantitative pcr amplification.
7. identification or the system of auxiliary identification tumor tissues and/or cell, including primer pair, claim 2 described in claim 1
Or 3 reagent sets, the reagent of claim 4 or 5 or kit or system and gene quantification number described in claim 6
According to processing system；The gene quantification data processing system is used to calculate the EIF2AK1 from tissue to be identified and/or cell
The expression quantity or relative expression quantity of gene, according to the tissue to be identified and/or the expression quantity or phase of the EIF2AK1 genes of cell
Determine whether tissue and/or cell to be identified are tumor tissues and/or cell to expression quantity.
8. following methods 1) or 2)：
1) method of the expression quantity or relative expression quantity of detection EIF2AK1 genes, including in vitro tissue to be identified and/or carefully
The cDNA or RNA of born of the same parents is template, and the primer pair described in claim 1 carries out PCR amplification, the annealing conditions in the PCR amplification
For 58 DEG C of 35sec.
2) method identified or assist identification tumor tissues and/or cell, including：Detection is from tissue to be identified and/or cell
EIF2AK1 genes expression quantity or relative expression quantity；If the EIF2AK1 genes of the tissue to be identified and/or cell
Expression quantity or relative expression quantity are higher, the tissue to be identified and/or the wind that cell is or candidate is tumor tissues and/or cell
Danger is bigger, described if the expression quantity or relative expression quantity of the EIF2AK1 genes of the tissue to be identified and/or cell are lower
The risk that tissue and/or cell to be identified are or candidate is tumor tissues and/or cell is smaller.
9. primer pair described in claim 1, reagent set, the reagent of claim 4 or 5 or reagent described in Claims 2 or 3
Box or the system of claim 6 or 7 are following 1) -5) in it is any in application：
1) detect or assist detection people EIF2AK1 gene expression amounts or relative expression quantity；
2) detection or auxiliary detection people EIF2AK1 gene expression amounts or relative expression quantity product are prepared；
3) identify or assist identification tumor tissues and/or cell；
4) identification or auxiliary identification tumor tissues and/or cell products are prepared.
10. it is applied described in system, claim 8 the method or claim 9 according to claim 7, it is characterised in that：
Described in claim 7 or 8 it is to be identified tissue and/or cell be uterine neck cervical tissue and/or uterine neck cervical cell；Claim
Tumor tissues described in 9 and/or cell are cervical cancer tissues and/or cell.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611151159.9A CN108220431A (en) | 2016-12-14 | 2016-12-14 | Detect the primer pair of people EIF2AK1 gene expression amounts and relative expression quantity |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611151159.9A CN108220431A (en) | 2016-12-14 | 2016-12-14 | Detect the primer pair of people EIF2AK1 gene expression amounts and relative expression quantity |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108220431A true CN108220431A (en) | 2018-06-29 |
Family
ID=62638342
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611151159.9A Pending CN108220431A (en) | 2016-12-14 | 2016-12-14 | Detect the primer pair of people EIF2AK1 gene expression amounts and relative expression quantity |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108220431A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007132156A2 (en) * | 2006-05-02 | 2007-11-22 | Ifom Fondazione Istituto Firc Di Oncologia Molecolare | Materials and methods relating to cancer diagnosis, prognosis and treatment based on the determination of novel molecular markers in tumors |
| CN105463117A (en) * | 2016-01-15 | 2016-04-06 | 苏州吉诺瑞生物科技有限公司 | Primer pair for detecting human RIOK2 gene expression quantity and relative expression quantity |
-
2016
- 2016-12-14 CN CN201611151159.9A patent/CN108220431A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007132156A2 (en) * | 2006-05-02 | 2007-11-22 | Ifom Fondazione Istituto Firc Di Oncologia Molecolare | Materials and methods relating to cancer diagnosis, prognosis and treatment based on the determination of novel molecular markers in tumors |
| CN105463117A (en) * | 2016-01-15 | 2016-04-06 | 苏州吉诺瑞生物科技有限公司 | Primer pair for detecting human RIOK2 gene expression quantity and relative expression quantity |
Non-Patent Citations (1)
| Title |
|---|
| OLSEN,J.V.,ET AL.: "Accession No:NM_018343,Homo sapiens RIO kinase 2 (yeast) (RIOK2), mRNA", 《GENBANK DATABASE》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107034296B (en) | A kind of composition and its application for early stage of lung cancer non-invasive screening | |
| CN101608240B (en) | Primers and probes for detecting human EGFR gene mutations as well as use method thereof | |
| CN106011292A (en) | Kit for detecting methylation of lung cancer-associated gene SHOX2 (short stature homebox2) | |
| CN109112216A (en) | The kit and method of triple qPCR detection DNA methylations | |
| CN105838777A (en) | Method for monitoring secondary drug resistance of lung cancer patient to tyrosine kinase inhibitor through ddPCR technology | |
| CN109055555A (en) | A kind of lung cancer transfer diagnosis marker and its kit and application in early days | |
| CN105624166B (en) | A kind of aptamer for detecting Human Bladder Transitional Cell Carcinoma cell and its application in detection preparation is prepared | |
| JP7090357B2 (en) | Use of primer sets, kits, and microRNA serum markers and primer sets to identify the sex of sturgeon | |
| CN110257520A (en) | A technique for utilizing miRNA in short capillary high speed electrophoresis detection lung carcinoma cell | |
| CN105463117A (en) | Primer pair for detecting human RIOK2 gene expression quantity and relative expression quantity | |
| CN109402262A (en) | The PCR detection kit of auxiliary diagnosis neuroblastoma and the method for detecting miR-199a-3p expression | |
| CN109371022A (en) | A kind of circular rna hsa_circKPNA2_002 and its specificity amplification primer and application | |
| CN111424085B (en) | Application of tRNA source fragment in preparation of breast cancer diagnostic reagent | |
| JP7187081B2 (en) | Methods for early diagnosis and post-treatment monitoring of breast cancer using liquid biopsy multiplex oncogene biomarkers | |
| CN108220431A (en) | Detect the primer pair of people EIF2AK1 gene expression amounts and relative expression quantity | |
| CN110172511A (en) | For detecting probe groups, kit and its application of HER-2 gene magnification level | |
| CN107326092A (en) | Applications and colorectal cancer detection kit of the related miRNA of colorectal cancer as biomarker | |
| CN110358825A (en) | Detect the kit and its application method of people BCR-ABL fusion | |
| CN105506131A (en) | Primer pair for detecting people AEG-1 gene expression quantity and relative expression quantity | |
| CN104087671A (en) | Kit used for detecting number of human chromosomes 21 | |
| WO2017114005A1 (en) | Terc gene and/or myc gene detection probe, preparation method therefor, and reagent kit | |
| CN105734152B (en) | Detect the primer pair and its application of the expression of people SRPK2 gene | |
| CN103589786B (en) | Method, test kit and the primer of detection RRM1 mRNA relative expression quantity and probe | |
| CN108220430A (en) | Detect the primer pair of people C9ORF98 gene expression amounts and relative expression quantity | |
| CN106702002A (en) | Biomarker for lung adenocarcinoma diagnosis and treatment |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20180629 |