CN108220430A - Detect the primer pair of people C9ORF98 gene expression amounts and relative expression quantity - Google Patents
Detect the primer pair of people C9ORF98 gene expression amounts and relative expression quantity Download PDFInfo
- Publication number
- CN108220430A CN108220430A CN201611151158.4A CN201611151158A CN108220430A CN 108220430 A CN108220430 A CN 108220430A CN 201611151158 A CN201611151158 A CN 201611151158A CN 108220430 A CN108220430 A CN 108220430A
- Authority
- CN
- China
- Prior art keywords
- cell
- expression quantity
- c90rf98
- reagent
- tissue
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Physics & Mathematics (AREA)
- Pathology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the primer pairs of detection people C90RF98 gene expression amounts and relative expression quantity.The primer pair of detection people C90RF98 gene expression amounts and relative expression quantity disclosed by the invention, the primer pair being made of the single stranded DNA shown in sequence in sequence table 1 and the single stranded DNA shown in sequence 2 for being entitled C90RF98 P.It is demonstrated experimentally that the primer pair of the present invention can detect expression contents of the C90RF98 in liver cancer tissue, operation is relatively easy, as a result accurately.
Description
Technical field
The present invention relates to the primer pairs that people C9ORF98 gene expression amounts and relative expression quantity are detected in biotechnology.
Background technology
Liver cancer is the very high digestive system tumor of case fatality rate, wherein 90% is hepatocellular carcinoma
(hepatocellularcarcinoma, HCC).Worldwide, the trend risen is presented in incidence.China is liver cancer
Big country and the global highest country of onset of liver cancer rate.According to statistics, onset of liver cancer number in China's accounts for global 55% at present, and
Death toll accounts for about the 45% of whole world PLC mortality number, is known as the title of " king of cancer ", and the health of our people is formed
Serious threat.Markers of the AFP as diagnosing cancer of liver mainly clinically is used at present, but due to influences such as hepatitis, hepatic sclerosis
Easily cause mistaken diagnosis.Therefore, it is most important to find new diagnosing cancer of liver marker.
C9ORF98 is newfound gene in recent years, and there is presently no detailed descriptions for function.In liver cancer, with
Cancer beside organism compares, and the expression of C9ORF98 is significantly raised.Therefore, C9ORF98 promises to be potential diagnosing cancer of liver mark
Object.
Invention content
The technical problems to be solved by the invention are how to detect people C9ORF98 gene expression amounts or relative expression quantity.
In order to solve the above technical problems, present invention firstly provides detection or auxiliary detection people's C9ORF98 gene expression amounts
Or the primer pair of relative expression quantity.
Detection provided by the present invention or the primer pair of auxiliary detection people C9ORF98 gene expression amounts or relative expression quantity,
The primer being made of the single stranded DNA shown in sequence in sequence table 1 and the single stranded DNA shown in sequence 2 for entitled C9ORF98-P
It is right.
In order to solve the above technical problems, the present invention also provides detection or auxiliary detection mankind's C9ORF98 gene expression amounts
Or the reagent set of relative expression quantity.
Detection provided by the present invention or the complete examination of auxiliary detection mankind C9ORF98 gene expression amounts or relative expression quantity
Agent is made of the C9ORF98-P with the primer pair combined with the GAPDH gene specifics of people of entitled GAPDH-P.
In above-mentioned reagent set, the GAPDH-P is as the single stranded DNA shown in sequence in sequence table 3 and the list shown in sequence 4
Chain DNA forms.
In order to solve the above technical problems, the present invention also provides detection or auxiliary detection people C9ORF98 gene expression amounts or
The reagent or kit of relative expression quantity.
Detection provided by the present invention or reagent or the examination of auxiliary detection people C9ORF98 gene expression amounts or relative expression quantity
Agent box is made of the C9ORF98-P or described reagent sets with X1, and the X1 is carries out reagent needed for quantitative pcr amplification.
In mentioned reagent or kit, reagent needed for the progress quantitative pcr amplification can be qPCR MIX.QPCR MIX can
For Beijing full formula gold biotechnology (TransGen Biotech) Co., Ltd's product.
In mentioned reagent or kit, the quantitative pcr amplification can be that real-time fluorescence quantitative PCR expands.
In order to solve the above technical problems, the present invention also provides detection or auxiliary detection people C9ORF98 gene expression amounts or
The system of relative expression quantity.
Detection provided by the present invention or the system of auxiliary detection people C9ORF98 gene expression amounts or relative expression quantity, by
The C9ORF98-P, the reagent set or the reagent or kit and Y1 composition, the Y1 is carries out needed for RNA extractions
Reagent, carry out reverse transcription needed for reagent and/or carry out quantitative pcr amplification needed for instrument.
In above system, the reagent carried out needed for RNA extractions can be TRIzol, chloroform, isopropanol and/or ethyl alcohol.
TRIzol can be Shanghai Jierui Biology Engineering Co., Ltd's product.
Reagent needed for the carry out reverse transcription can be the reagent in ReverTranscript qPCR RT Kit.
ReverTranscript qPCR RT Kit are Takara Products.
Instrument needed for the carry out quantitative pcr amplification can be real time fluorescent quantitative pcr instrument (such as ABI7300 or ABI7500
(Applied Biosystems companies of the U.S.)).
In order to solve the above technical problems, the present invention also provides identifications or auxiliary identification tumor tissues and/or cell to be
System.
Identification provided by the present invention or the system of auxiliary identification tumor tissues and/or cell, including the C9ORF98-
P, the reagent set, the reagent or kit or the detection or auxiliary detection people C9ORF98 gene expression amounts or opposite
The system of expression quantity and gene quantification data processing system；The gene quantification data processing system is waited to reflect for calculating to come from
The expression quantity or relative expression quantity of the C9ORF98 genes of tissue and/or cell are determined, according to the tissue to be identified and/or cell
C9ORF98 genes expression quantity or relative expression quantity determine whether tissue and/or cell to be identified are tumor tissues and/or thin
Born of the same parents.
In order to solve the above technical problems, expression quantity or relative expression quantity the present invention also provides detection C9ORF98 genes
Method.
The method of the expression quantity or relative expression quantity of detection C9ORF98 genes provided by the present invention, including in vitro
The cDNA or RNA of tissue and/or cell to be identified carry out PCR amplification for template, with the C9ORF98-P, in the PCR amplification
Annealing conditions can be 58 DEG C of 35sec.Reaction condition is concretely：95 DEG C of pre-degeneration 1min；95 DEG C of 15s, 58 DEG C of 35sec, 40
A cycle.
The reaction system during PCR amplification can be 25 μ L reaction systems, specific as follows：2 μ L cDNA solution, 12.5 μ L
QPCR Mix (2 ×), C9ORF98-F (C9ORF98-F in the reaction system a concentration of 0.2 μM), C9ORF98-R
(C9ORF98-R in the reaction system a concentration of 0.2 μM), is mended with sterile distilled water to 25 μ L.
In order to solve the above technical problems, the present invention also provides identification or the sides of auxiliary identification tumor tissues and/or cell
Method.
Identification provided by the present invention or the method for auxiliary identification tumor tissues and/or cell, including：Detection comes from and waits to reflect
Determine the expression quantity or relative expression quantity of the C9ORF98 genes of tissue and/or cell；If the tissue to be identified and/or cell
C9ORF98 genes expression quantity or relative expression quantity it is higher, the tissue to be identified and/or cell are or candidate is tumor group
It knits and/or the risk of cell is bigger, if the expression quantity or opposite of the C9ORF98 genes of the tissue to be identified and/or cell
Expression quantity is lower, and the tissue to be identified and/or the risk that cell is or candidate is tumor tissues and/or cell are smaller.
In the above method, the tissue to be identified and/or cell can be cervical tissue and/or cervical cell.
In order to solve the above technical problems, the present invention also provides the C9ORF98-P, the reagent set, the reagents
Or kit or the system are following 1) -5) in it is any in application：
1) detect or assist detection people C9ORF98 gene expression amounts or relative expression quantity；
2) detection or auxiliary detection people C9ORF98 gene expression amounts or relative expression quantity product are prepared；
3) identify or assist identification tumor tissues and/or cell；
4) identification or auxiliary identification tumor tissues and/or cell products are prepared.
In above application, the tumor tissues and/or cell can be liver cancer tissue and/or cell.
It is demonstrated experimentally that the primer pair of the present invention can detect expression contents of the C9ORF98 in liver cancer tissue, operation is opposite
Simply, as a result accurately.
For the present invention in view of detecting the deficiency of hepatoma sample marker in the prior art, the present invention devises detection internal reference/mesh
Gene primer, with fluorescent quantitative PCR technique detect people's fusion relative expression quantity.By adjusting the primer of two genes
Concentration and probe concentration and ratio optimize the reaction system and reaction condition of PCR, develop a kind of opposite for detecting C9ORF98 genes
The kit of expression quantity.
Using the kit of the present invention, real-time fluorescence PCR technology is detected the expression of C9ORF98 genes,
Accuracy of detection is high, and easy to operate, can reduce testing cost, saves detection time.Using double calibration curve methods, pass through structure
The standard quantitative curve of C9ORF98 and reference gene GAPDH, the reference gene copy number and C9ORF98 of accurate quantification sample are copied
Shellfish number, compared to previous ImmunohistochemistryMethods Methods, which has many advantages, such as precision height, as a result convenient for interpretation.In addition the examination
Primer, probe needed for reaction system is carried out rational proportion and optimization by agent box, experiment condition is made to reach best, so as to eliminate
Cumbersome condition gropes link, greatly improves conventional efficient.The kit is specific good after tested, high sensitivity, operation letter
Just.Contribute to the complementary detection of clinical sample.
Description of the drawings
Fig. 1 is C9ORF98 melting curves.
Fig. 2 is GAPDH melting curves.
Fig. 3 is the amplification curve of C9ORF98 and GAPDH.Wherein.Left side be GAPDH amplification curves, right side C9ORF98
Amplification curve.
Fig. 4 is the relative expression quantity of 6 clinical liver cancer patient C9ORF98.
Specific embodiment
The present invention is further described in detail With reference to embodiment, the embodiment provided is only for explaining
The bright present invention, the range being not intended to be limiting of the invention.
Experimental method in following embodiments is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
Embodiment 1
The kit for being used to detect C9ORF98 gene relative expression quantities of the present invention, including：
TRIzol (Shanghai Jierui Biology Engineering Co., Ltd)；
Chloroform；
Absolute ethyl alcohol；
ReverTranscript qPCR RT Kit (Takara companies)；
Detection architecture PCR reaction solution：QPCR Mix (2 ×) (the full formula gold biotechnologys in Beijing (TransGen Biotech)
Co., Ltd), each 0.2 μM of C9ORF98-F/C9ORF98-R
Wherein, primer sequence is：
C9ORF98-F：TCACACCCAGACACGTCATT (sequence 1)
C9ORF98-R：TTCTGGATTTCAGATTCGGG (sequence 2)
GAPDH-F：CATGAGAAGTATGACAACAGCCT (sequence 3)
GAPDH-R：AGTCCTTCCACGATACCAAAGT (sequence 4)
Embodiment 2
The application method of kit of the present invention：
(1) the tissue RNA of extracting：Suitable flesh tissue is taken, 1mL trizol is added in and uniformly, adds in homogenate wherein grinding
Enter 0.2ml chloroforms, concussion is uniform；4 DEG C of centrifugation 10min of 14000rpm, draw supernatant layer and are transferred in another new centrifuge tube；
Isometric isopropanol is added in, abundant mixing, is stored at room temperature 10min up and down；14000rpm4 DEG C of centrifugation 10min, abandons supernatant, adds
Enter 75% ethyl alcohol 1ml, gently turn upside down washing tube wall；4 DEG C of centrifugation 5min of 14000rpm, abandon ethyl alcohol；Drying at room temperature 10-
15min adds in 20ulRNase-free water dissolutions precipitation.
(2) with reference to the ReverTranscript qPCR RT Kit kit specifications of Takara companies, RNA is inverted
For cDNA, cDNA solution is obtained, a concentration of 50 μ L/ μ L of cDNA in cDNA solution.
(3) reagent is configured：Each reaction system is 25 μ L reaction systems, specific as follows：2 μ L cDNA solution, 12.5 μ L
QPCR Mix (2 ×), C9ORF98-F or GAPDH-F (a concentration of 0.2 μ of C9ORF98-F or GAPDH-F in the reaction system
M), C9ORF98-R or GAPDH-R (C9ORF98-R or GAPDH-R in the reaction system a concentration of 0.2 μM), with sterile steaming
Distilled water is mended to 25 μ L.By the use of physiological saline as blank control.
(4) it detects：Detection carries out on real-time fluorescence PCR instrument, can include ABI7300, the ABI7500 (U.S. with instrument
Applied Biosystems companies) etc..Reaction condition：95 DEG C of pre-degeneration 1min；95 DEG C of 15s, 58 DEG C of 35sec, 40 are followed
Ring, fluorescence signal acquire when 58 DEG C of 35sec.
(5) result judges：Threshold line is adjusted to more than background signal and negative amplification line, system according to standard curve and
CT values calculate copy number automatically.
The solubility curve and amplification curve detected using the kit is shown in Fig. 1, Fig. 2 and Fig. 3.
Embodiment 3
Clinical samples are detected using kit for detecting nucleic acid of the present invention
Detect object：Clinical liver cancer patient 6, (all samples are organized for the liver cancer I phases).The liver cancer tissue of each patient and
It is organized by liver cancer to 6 pairs altogether of detection, sample to be tested is detected by the application method of 2 kit of embodiment.3 weights of each sample
It is multiple, 1 part of blank control.Detection time only needs 100 minutes.
The results are shown in table below for 6 clinical liver cancer patient pattern detections：
Fig. 4 is shown in 6 clinical liver cancer patient pattern detection result summaries.
Fig. 4 using the primer pair the results show that can detect expression contents of the C9ORF98 in liver cancer tissue, operation phase
To simple, as a result accurately.
For the present invention in view of detecting the deficiency of hepatoma sample marker in the prior art, the present invention devises detection internal reference/mesh
Gene primer, with fluorescent quantitative PCR technique detect people's fusion relative expression quantity.By adjusting the primer of two genes
Concentration and probe concentration and ratio optimize the reaction system and reaction condition of PCR, develop a kind of opposite for detecting C9ORF98 genes
The kit of expression quantity.
Using the kit of the present invention, real-time fluorescence PCR technology is detected the expression of C9ORF98 genes,
Accuracy of detection is high, and easy to operate, can reduce testing cost, saves detection time.Using double calibration curve methods, pass through structure
The standard quantitative curve of C9ORF98 and reference gene GAPDH, the reference gene copy number and C9ORF98 of accurate quantification sample are copied
Shellfish number, compared to previous ImmunohistochemistryMethods Methods, which has many advantages, such as precision height, as a result convenient for interpretation.In addition the examination
Primer, probe needed for reaction system is carried out rational proportion and optimization by agent box, experiment condition is made to reach best, so as to eliminate
Cumbersome condition gropes link, greatly improves conventional efficient.The kit is specific good after tested, high sensitivity, operation letter
Just.Contribute to the complementary detection of clinical sample.
Claims (10)
1. detection or the primer pair of auxiliary detection people C90RF98 gene expression amounts or relative expression quantity are entitled C90RF98-P
The primer pair being made of the single stranded DNA shown in sequence in sequence table 1 and the single stranded DNA shown in sequence 2.
2. detection or the reagent set of auxiliary detection mankind C90RF98 gene expression amounts or relative expression quantity, by claim 1 institute
C90RF98-P is stated to form with the primer pair combined with the GAPDH gene specifics of people of entitled GAPDH-P.
3. reagent set according to claim 2, it is characterised in that：The GAPDH-P is as shown in sequence in sequence table 3
Single stranded DNA composition shown in single stranded DNA and sequence 4.
4. detection or the reagent or kit of auxiliary detection people C90RF98 gene expression amounts or relative expression quantity, by claim 1
Reagent set described in the primer pair or Claims 2 or 3 is formed with X1, and the X1 is carries out reagent needed for quantitative pcr amplification.
5. reagent according to claim 4 or kit, it is characterised in that：Reagent needed for the carry out quantitative pcr amplification
For qPCR MIX.
6. detection or the system of auxiliary detection people C90RF98 gene expression amounts or relative expression quantity, the primer as described in claim 1
To reagent set described in, Claims 2 or 3 or the reagent of claim 4 or 5 or kit and Y1 composition, the Y1 be into
The required reagent of row RNA extractions carries out the reagent needed for reverse transcription and/or carries out instrument needed for quantitative pcr amplification.
7. identification or the system of auxiliary identification tumor tissues and/or cell, including primer pair, claim 2 described in claim 1
Or 3 reagent sets, the reagent of claim 4 or 5 or kit or system and gene quantification number described in claim 6
According to processing system；The gene quantification data processing system is used to calculate the C90RF98 from tissue to be identified and/or cell
The expression quantity or relative expression quantity of gene, according to the tissue to be identified and/or the expression quantity or phase of the C90RF98 genes of cell
Determine whether tissue and/or cell to be identified are tumor tissues and/or cell to expression quantity.
8. following methods 1) or 2)：
1) method of the expression quantity or relative expression quantity of detection C90RF98 genes, including in vitro tissue to be identified and/or carefully
The cDNA or RNA of born of the same parents is template, and the primer pair described in claim 1 carries out PCR amplification, the annealing conditions in the PCR amplification
For 58 DEG C of 35sec.
2) method identified or assist identification tumor tissues and/or cell, including：Detection is from tissue to be identified and/or cell
C90RF98 genes expression quantity or relative expression quantity；If the C90RF98 genes of the tissue to be identified and/or cell
Expression quantity or relative expression quantity are higher, the tissue to be identified and/or the wind that cell is or candidate is tumor tissues and/or cell
Danger is bigger, described if the expression quantity or relative expression quantity of the C90RF98 genes of the tissue to be identified and/or cell are lower
The risk that tissue and/or cell to be identified are or candidate is tumor tissues and/or cell is smaller.
9. primer pair described in claim 1, reagent set, the reagent of claim 4 or 5 or reagent described in Claims 2 or 3
Box or the system of claim 6 or 7 are following 1) -5) in it is any in application：
1) detect or assist detection people C90RF98 gene expression amounts or relative expression quantity；
2) detection or auxiliary detection people C90RF98 gene expression amounts or relative expression quantity product are prepared；
3) identify or assist identification tumor tissues and/or cell；
4) identification or auxiliary identification tumor tissues and/or cell products are prepared.
10. it is applied described in system, claim 8 the method or claim 9 according to claim 7, it is characterised in that：
Described in claim 7 or 8 it is to be identified tissue and/or cell be uterine neck cervical tissue and/or uterine neck cervical cell；Claim
Tumor tissues described in 9 and/or cell are liver cancer tissue and/or cell.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611151158.4A CN108220430A (en) | 2016-12-14 | 2016-12-14 | Detect the primer pair of people C9ORF98 gene expression amounts and relative expression quantity |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611151158.4A CN108220430A (en) | 2016-12-14 | 2016-12-14 | Detect the primer pair of people C9ORF98 gene expression amounts and relative expression quantity |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108220430A true CN108220430A (en) | 2018-06-29 |
Family
ID=62638985
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611151158.4A Pending CN108220430A (en) | 2016-12-14 | 2016-12-14 | Detect the primer pair of people C9ORF98 gene expression amounts and relative expression quantity |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108220430A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090275633A1 (en) * | 2006-04-13 | 2009-11-05 | Oncomethylome Sciences Sa | Novel Tumour Suppressor |
| CN105506131A (en) * | 2016-01-15 | 2016-04-20 | 苏州吉诺瑞生物科技有限公司 | Primer pair for detecting people AEG-1 gene expression quantity and relative expression quantity |
-
2016
- 2016-12-14 CN CN201611151158.4A patent/CN108220430A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090275633A1 (en) * | 2006-04-13 | 2009-11-05 | Oncomethylome Sciences Sa | Novel Tumour Suppressor |
| CN105506131A (en) * | 2016-01-15 | 2016-04-20 | 苏州吉诺瑞生物科技有限公司 | Primer pair for detecting people AEG-1 gene expression quantity and relative expression quantity |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101261279B (en) | Endometrium cancer diagnose reagent, reagent kit and controlling medicament | |
| CN106399555A (en) | Real-time fluorescent quantitative PCR (polymerase chain reaction) detection method as well as standard substance and detection kit for real-time fluorescent quantitative PCR detection | |
| CN101608240B (en) | Primers and probes for detecting human EGFR gene mutations as well as use method thereof | |
| CN104818320A (en) | Primers, probes, detection system and kit for one time detection of lung cancer multiple genes | |
| CN104818318A (en) | Primers, probes, detection system and kit for one time detection of lung cancer multiple genes | |
| CN107663533A (en) | A kind of lung cancer EGFR L858R and 19Del ddPCR detection methods and application | |
| CN103773861B (en) | Clonorchis sinensis and angiostrongylus cantonensis dual real-time fluorescence PCR detection reagent, test kit and detection method thereof | |
| CN105838777A (en) | Method for monitoring secondary drug resistance of lung cancer patient to tyrosine kinase inhibitor through ddPCR technology | |
| CN109055555A (en) | A kind of lung cancer transfer diagnosis marker and its kit and application in early days | |
| JP7090357B2 (en) | Use of primer sets, kits, and microRNA serum markers and primer sets to identify the sex of sturgeon | |
| CN110257520A (en) | A technique for utilizing miRNA in short capillary high speed electrophoresis detection lung carcinoma cell | |
| CN100371459C (en) | Kit with fluorescent quantitative RT-PCR detection technique used for cell keratin 19(Ck19)mRNA | |
| CN105463117A (en) | Primer pair for detecting human RIOK2 gene expression quantity and relative expression quantity | |
| CN107385038A (en) | Detect oligonucleotides, method and the kit of ZNF198 FGFR1 fusions in sample | |
| CN107574246A (en) | Detect TBLR1 RAR α and PRKAR1A RAR alpha fusion gene relative expression quantity primed probe methods | |
| CN105506131A (en) | Primer pair for detecting people AEG-1 gene expression quantity and relative expression quantity | |
| CN109825585A (en) | A kind of biomarker of nasopharyngeal carcinoma diagnosis and/or prognosis evaluation | |
| CN108220430A (en) | Detect the primer pair of people C9ORF98 gene expression amounts and relative expression quantity | |
| CN105734152B (en) | Detect the primer pair and its application of the expression of people SRPK2 gene | |
| CN110358825A (en) | Detect the kit and its application method of people BCR-ABL fusion | |
| CN110551821B (en) | Primers, probe and kit for detecting MEF2D gene rearrangement by using fluorescent quantitative PCR | |
| US20120058477A1 (en) | Method for detecting the expression of cyclin b2 gene by real-time quantitative pcr | |
| CN106702002A (en) | Biomarker for lung adenocarcinoma diagnosis and treatment | |
| CN108220431A (en) | Detect the primer pair of people EIF2AK1 gene expression amounts and relative expression quantity | |
| CN105838779A (en) | Method for monitoring and controlling drug resistance of gastrointestinal stromal tumor patient to imatinib/sunitinib through ddPCR technology |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20180629 |