CN108192972A - For the method for the diagnosis of Metastasis in Breast Cancer, prognosis and treatment - Google Patents

For the method for the diagnosis of Metastasis in Breast Cancer, prognosis and treatment Download PDF

Info

Publication number
CN108192972A
CN108192972A CN201810147703.5A CN201810147703A CN108192972A CN 108192972 A CN108192972 A CN 108192972A CN 201810147703 A CN201810147703 A CN 201810147703A CN 108192972 A CN108192972 A CN 108192972A
Authority
CN
China
Prior art keywords
expression
gene
maf
breast cancer
subject
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201810147703.5A
Other languages
Chinese (zh)
Other versions
CN108192972B (en
Inventor
R·戈米斯卡布雷
M·塔拉戈纳苏涅尔
A·阿纳尔埃斯塔佩
M·帕夫洛维茨
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Meeting Of Biomedical Research Institutional Fund
Institucio Catalana de Recerca i Estudis Avancats ICREA
Original Assignee
Meeting Of Biomedical Research Institutional Fund
Institucio Catalana de Recerca i Estudis Avancats ICREA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from ES201031478A external-priority patent/ES2379918B1/en
Application filed by Meeting Of Biomedical Research Institutional Fund, Institucio Catalana de Recerca i Estudis Avancats ICREA filed Critical Meeting Of Biomedical Research Institutional Fund
Publication of CN108192972A publication Critical patent/CN108192972A/en
Application granted granted Critical
Publication of CN108192972B publication Critical patent/CN108192972B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00—Drugs for genital or sexual disorders; Contraceptives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/04—Antineoplastic agents specific for metastasis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07F—ACYCLIC, CARBOCYCLIC OR HETEROCYCLIC COMPOUNDS CONTAINING ELEMENTS OTHER THAN CARBON, HYDROGEN, HALOGEN, OXYGEN, NITROGEN, SULFUR, SELENIUM OR TELLURIUM
    • C07F9/00—Compounds containing elements of Groups 5 or 15 of the Periodic System
    • C07F9/02—Phosphorus compounds
    • C07F9/547—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom
    • C07F9/645—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom having two nitrogen atoms as the only ring hetero atoms
    • C07F9/6503—Five-membered rings
    • C07F9/6506—Five-membered rings having the nitrogen atoms in positions 1 and 3
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/24—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
    • C07K16/241—Tumor Necrosis Factors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1136—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against growth factors, growth regulators, cytokines, lymphokines or hormones
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/112—Disease subtyping, staging or classification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57415—Specifically defined cancers of breast

Abstract

The present invention relates to for the diagnosis shifted in breast cancer or the method for prognosis, including determining whether c MAF genes expand in primary tumor specimens.Similarly, the invention further relates to for the diagnosis shifted in ER breast cancer or the method for prognosis and relating to determining relative to the method for forming the tendency to Bone tumour for other organ metastasis, include measuring the expression of c MAF genes.Finally, the present invention relates to used as treating the inhibitor of the therapeutic target target c MAF of ER Metastasis in Breast Cancer.

Description

For the method for the diagnosis of Metastasis in Breast Cancer, prognosis and treatment
The application is the applying date on October 5th, 2011, application No. is 201180058347.6, entitled " be used for The divisional application of the application for a patent for invention of the method for diagnosis, prognosis and the treatment of Metastasis in Breast Cancer ".
Invention field
The present invention relates to the diagnosis or prognosis shifted in breast cancer, based on determining the c-MAF in primary tumor specimens Whether gene expands.Similarly, the invention further relates to for the diagnosis shifted in breast cancer or the method for prognosis and It is related to the method for designing the novel personalized therapy in the subject with breast cancer, the table including measuring c-MAF gene Up to level.Finally, the present invention relates to the inhibitor of c-MAF as treating the therapeutic target target purposes of Metastasis in Breast Cancer.
Background of invention
In the world, breast cancer is second of most common cancer types (10.4%；After lung cancer) and be the 5th The most common cancer mortality reason of kind (after lung cancer, gastric cancer, liver cancer and the carcinoma of the rectum).In women, breast cancer is most common Cancer mortality reason.In 2005, breast cancer caused 502,000 death (7% of cancer mortality in the world；It is all dead Die it is similar 1%).Since the 1970s, worldwide case load has significantly increased, this is partly to impute to In the Western countries the phenomenon that modern way of life.
According to TNM systems, breast cancer is divided into several stages.The result of prognosis and divided stages is closely related, and Divided stages are additionally operable in clinical test and distribution patient is treated in medical practice.For divided stages information such as Under：
●TX：Primary tumo(u)r can not be evaluated.T0：Not about the evidence of tumour.Tis：Carcinoma in situ is not invaded.T1：It is swollen Knurl is 2cm or smaller.T2：Tumour is more than 2cm but less than 5cm.T3：Tumour is more than 5cm.T4：It is grown in breast wall or skin Any size tumour or inflammatory breast cancer.
●NX：Neighbouring lymph node can not be evaluated.N0：Cancer is not yet diffused into regional nodes.N1：Cancer has been spread To 1 to 3 nodi lymphatici axillares or an internal mammary lymph nodes.
N2：Cancer has diffused into 4 to 9 nodi lymphatici axillares or multiple internal mammary lymph nodes.
N3：One of following state is applicable in：
■ cancers have diffused into 10 or more nodi lymphatici axillares or cancer has diffused into deltopectoral lymph node, Either cancer has diffused into supraclavicular lymph nodes or cancer and influences nodi lymphatici axillares and have diffused into internal mammary lymph nodes, Or cancer influences 4 or more nodi lymphatici axillares, and in internal mammary lymph nodes or in biopsy of lymph node is guarded against There are the cancers of minimum.
●MX：The presence of distal spread (transfer) can not be evaluated.M0：There is no distal spread.
M1：The diffusion to remote organ has been generated, has not included supraclavicular lymph nodes.
Most of dead the fact that generated by later transfer, means to manage in the patient with solid tumor cancer Solution allows the molecule of metastases and cell mechanism to be crucial.How nearest publication has been proved transfer by still knowing Few complex mechanism and generate, and also demonstrate how different metastatic cell types has towards certain organs Tropism.The metastatic cell of these organizing specifics has a series of acquisition sexual functions, them is allowed to be settled in specific organ.
All these cells on the surface thereof, in its cytoplasm and in nucleus all have receptor.Certain chemistry letters Such as hormone is made to be combined with the receptor, and this causes the change in cell.In the presence of thin there are three types of breast cancer can be influenced The important receptor of born of the same parents：Estrogen receptor (ER), PgR (PR) and HER2/neu.In order to name have in these receptors one In the presence of the receptor, positive sign is just configured in the cell of a little receptors to it, and if it does not, negative sign just is configured to it：ER sun Property (ER+), ER negative (ER-), PR+ (positive), PR negative (PR-), HER2 positive (HER2+) and HER2 feminine genders (HER2-).By Body state has become the key evaluation of all breast cancer, because it is determined using particular treatment (for example, tamoxifen or song Trastuzumab) adaptability.The α isotypes of estrogen receptor (ER) cross table in about 65% breast cancer case after diagnosing It reaches.The breast cancer type is known as " ER is positive " (ER+).In this case, the combination stimulation tumor breast cell of estrogen and ER Proliferation.ER+ tumour cells are highly dependent on the stimulation to be proliferated, and therefore, ER are used as therapeutic target at present.
The main idea of breast cancer treatment is that, when tumour is limited to local time, progress surgical operation and possible hormone auxiliary are treated Method (with the inhibitor of tamoxifen or aromatase enzyme), chemotherapy and/or radiotherapy.At present, controlling about surgical site infections The suggestion (complementary therapy) for the treatment of follows a set of pattern.The pattern experienced change, because every two years holding one in Switzerland St Gallen Secondary world conference, to discuss the actual result of world's multicenter study.Similarly, the pattern is also according to National Institutes of Health (NIH) consistent standard is revised.Based on these standards, the patient without lymphatic metastasis more than 85-90% will It is the candidate for receiving complementary constitutional treatment.
At present, PCR tests such as Oncotype DX or Microarray assays such as MammaPrint, can be based on specific base The risk expressed to predict breast cancer relapse of cause.At 2 months 2007, by obtaining food and medicine Surveillance Authority (Food And Drug Administration) formal approval, MammaPrint experiment become the first breast cancer indicant.
Patent application EP1961825-A1 describes the side for predicting transfer appearance of the breast cancer to bone, lung, liver or brain Method, the expression including measuring one or more markers in neoplasmic tissue sample, relative to it in the control sample Corresponding expression for, including c-MAF.However, the document needs to measure several genes so as to measure simultaneously The survival rate of patient with breast cancer, and genome Tag Estimation does not have the correlation between the ability of the survival rate of Bone tumour not to be It is statistically significant.
Bos, P.D. et al. [Nature, 2009,459:1005-1009] describe participation base of the breast cancer to brain metastes Cause.
Patent application US2005/0181375 describes the method for detecting metastatic breast cancer, is being turned based on detection Expression in up-regulation or the series of genes lowered (is particularly in the tumour to brain metastes) in shifting property tumour.
International patent application WO2010/000907 describes gene label, can be used as the distal end in patient with breast cancer The genome dopester of transfer.
However, there is no such gene markers in the prior art, make it possible to diagnose and/or predict with specific Whether the patient of breast cancer (for example, ER- or ER+ breast cancer) will suffer from or is not subjected to shift, so as to so to The subject of the cancer applies suitable therapy.Accordingly, there exist the needs for identifying new marker, which causes The presence shifted in the subject with ER+ or ER- breast cancer can be diagnosed and/or prediction suffers from ER+ or ER- breast cancer Subject forms the possibility of transfer.The identification of new Prognostic Factors will be in most suitable treatment be selected with coaching.
Summary of the invention
It is to cause transfer (particularly bone turn with the ER+ breast cancer of bigger that the author of the present invention, which has identified and demonstrated c-MAF, Move) the relevant marker of tendency.The overexpression is at least partially attributed to the seat 16q22-q24 that c-MAF gene is located at Amplification.It is not intended to be bound by any theory, particularly, it is believed that the signal transduction path of estrogen receptor (ER) contributes to breast The transfer of gland cancer, wherein causing for generating required molecular events for the transfer.
Effect of the c-MAF gene in ER+ Metastasis in Breast Cancer has been characterized via inventor, by immune deficiency Mouse inoculation MCF7 cell lines (people ER+ breast cancer cell lines), then to obtain with being obtained from the Bone tumour of the MCF7 cells The relevant express spectra of cell line obtained.Since the express spectra and pass through using a variety of different standards, selected c-MAF Gene, wherein demonstrating the bone relapse of the primary tumo(u)r of the variation prediction breast cancer of expression.Then, suffer from comprising breast cancer C-MAF is had studied in two disparate databases of the express spectra and clinography of the primary tumo(u)r of person and the transfer of patient with breast cancer Expression, wherein observing the gene expression of c-MAF and different clinical parameter (including recurring and shifting) positive correlation.Separately Outside, the expression of the c-MAF in the Bone tumour of breast cancer is determined, wherein observing in the transfer from ER+ and ER- tumours Middle high c-MAF is horizontal.Finally, it settles down experiment by shifting in vivo and subsequent is obtained by means of the function of slow virus carrier It must test and by means of the afunction of RNA interfering (siRNA) is used to test, demonstrate c-MAF gene alone.These researchs C-MAF has been proved in the transfer (the particularly Bone tumour of breast cancer) of breast cancer as prognostic marker and as target base The effect of cause.Similarly, inventor is also by the amplification of seat 16q22-q24 (it includes c-MAF gene) and breast cancer subject The presence of middle transfer be associated and by breast cancer cell line c-MAF gene amplification with formation Bone tumour tendency it is associated.
Therefore, in the first aspect, the present invention relates in the subject with ER+ breast cancer to transfer examine In-vitro method disconnected and/or for carrying out prognosis to the tendency for forming transfer in the subject with ER+ breast cancer, packet It includes：
(i) the quantitative expression of c-MAF gene in the neoplasmic tissue sample of the subject and
(ii) expression of the expression that front is obtained and the gene in the control sample is compared,
Wherein if the expression of the gene increases for the expression of the gene in the control sample Add, then the subject has the tendency of the formation transfer of the positive diagnosis or bigger about transfer.
In the second aspect, the present invention relates to for design for the novel personalized therapy for the subject for suffering from ER+ breast cancer In-vitro method, including：
(i) the quantitative expression of c-MAF gene in the neoplasmic tissue sample of the subject and
(ii) expression of the expression that front is obtained and the gene in the control sample is compared,
Wherein if the expression increases for the expression of the gene in the control sample, then The subject can receive to be intended to prevent and/or treat the therapy of transfer.
In terms of the third, the present invention relates to for designing of the subject for suffering from the breast cancer with Bone tumour The in-vitro method of property amic therapy method, including：
(i) the quantitative expression of c-MAF gene in the metastatic bone tumor tissue sample of the subject and
(ii) it will be carried out in the expression of the expression obtained in step (i) and the gene in the control sample Compare,
Wherein if the expression of c-MAF gene increases for the expression of the gene in the control sample Add, then the subject can receive the therapy for being intended to prevent bone from degrading.
The 4th aspect, the present invention relates in the subject with breast cancer to transfer diagnosed and/or For carrying out the in-vitro method of prognosis to the tendency for forming transfer in the subject with breast cancer, including determining described Whether c-MAF gene expands in the neoplasmic tissue sample of subject, if wherein there are institutes for control sample State the amplification of gene, then the subject has the tendency of the formation transfer of the positive diagnosis or bigger about transfer.
At the 5th aspect, the present invention relates to the inhibition reagent purposes in medicine preparation of c-MAF, the drug is used In the transfer for treating and/or preventing breast cancer.
In terms of the last one, the present invention relates to can avoid or prevent the use of the reagent of bone degradation in medicine preparation On the way, the drug in subject for treating Bone tumour, and the subject is with breast cancer and in metastatic tumo(u)r tissue There is c-MAF levels high for control sample in sample.
Brief description
The diagram of the internal selection course of Fig. 1 (A) tissue specificity transfer subgroup.It is each in subsequent Bone tumour generation In generation, is named as BoM0, BoM1 and BoM2.This is analyzed by intracardiac injection among transplantation model in immunosuppressed mice The transfer ability of a little cell types.(B) from parent ER+ breast cancer cells and its subsequent metastatic derived cell system BoM0, The transcription spectrum of BoM1 and BoM2 starts the hierarchical clustering obtained.(C) Ka-(Kaplan-Meier) curve advanced in years, wherein according to c-MAF Expression separate patient group, and indicate the general of recurrence at any time for each patient group and Bone tumour Rate.Total data includes 560 breast cancer primary tumo(u)rs.The analysis is limited to ER+ and ER- tumours (Gene respectively Expression Omnibus databases, accession number GSE 2603,2034 and 12276).(D) come using the expression of c-MAF It is divided among the express spectra of 338 breast cancer primary tumo(u)rs described in NKI groups.By Ka-curve advanced in years, in a manner of comparing Show the survival probability of each group of patient at any time.The p- Value Datas shown in C and D show by using these values As continuous variable, intersecting between the expression of c-MAF gene and ER independently and significantly predicts recurrence or transfer, wherein Use multivariate model (the p- values of COX types<0.01).
Fig. 2 (A) are for other transfers site (brain, liver and lung), the c-MAF in the Bone tumour from breast cancer The normalised expression (GSE14020) of gene.(B) with different bone settle down ability and derived from MDA-MB- The normalised expression of c-MAF gene in the different subgroups of 231 (ER-) breast cancer cells.(C) with different bones It is colonization ability and derived from MDA-MB-231 (ER-) breast cancer cell or with coding MAF genes (long isotype= Long the warp of CTGF genes (gene induced by the transcriptional activity of c-MAF) in the different subgroups that the external source of cDNA) is overexpressed The expression of standardization.
Fig. 3 (A) are carried out by quantitative RT-PCR in MCF7ER+ breast cancer cells and its metastatic derivative (BoM) The analysis of the expression of middle c-MAF.(B) it is tested with the afunction of (C) c-MAF and function.It the missing of c-MAF and obtains It obtains and is carried out in the cell of height Bone tumour and faint Bone tumour respectively.By spreading out with and without the expression of c-MAF Raw cell line is injected into the left ventricle of immunosuppressed mice, and is analyzed in real time in vivo by biodiversity resources technology Bone is settled down, to verify contributions of the c-MAF for Bone tumour in ER+ breast cancer.MAF-sho represents short c-MAF, and (short is of the same race Type).
Fig. 4 from from parent MCF7 cells or be overexpressed any c-MAF isotypes (isotype short short-, With the isotype of long- long) the conditioned medium of cell start, the osteoclast since the precursor from marrow Differentiation experiment.The number of osteoclast is measured by TRAP technologies.Significant difference between group passes through double tails Wilcoxon examines to be evaluated.
Fig. 5 (A) are in chromosome 16, for MCF7 cells, in BoM2 cells since gene expression dose Copy number analysis.In upper part, it is shown that expression indicant.In the middle section of the figure, it is shown that transcript or base Because of the reference sequences (transcript reference sequences) of (being configured with expression value for it), pacified according to their genomic locations Row；(B) ACE analyses (change carried out by copy number the analysis based on expression data) are primary swollen in 348 ER+ breast cancer The recurrent genome in the 16q12-q24 of region is identified in knurl in the patient with breast cancer with transfer to benefit.Institute It states region and includes the seat 16q22-q24 comprising c-MAF gene.Being associated between gene expression and transfer formation passes through application " Cox log risk-ratios (HR) " model carries out.By the logarithm (1000 kinds arrangement) of HR is arranged in whole gene group come Significance,statistical is obtained, wherein adjusting p value by Benjamini-Hochberg to control FDR (false positive rate) to 0.05 Level.Only those regions at least 15 continuous significantly genes are reported with grey.
Fig. 6 (A) are by the detection of the copy number of the MAF and IGH genes of fluorescence in situ hybridization (FISH), wherein using c- The specific probe (arrow with asterisk) of MAF genes and the specific probe (arrow) of IGH genes.IGH genes are used as Control.Engineer's scale：25μm.(B) the cell percentage of the copy number with shown MAF genes and the ratio between the copy number of IGH genes Quantitative (total number for indicating the cell counted for each group) of ratio.
Detailed description of the invention
The diagnosis shifted in breast cancer of expression based on c-MAF and method of prognosis
Inventor is it has been shown that c-MAF gene in Metastasis in Breast Cancer, is particularly overexpressed, Yi Ji in ER+ tumours The expression of c-MAF clinical parameter different from breast cancer in primary tumo(u)r is particularly related to recurrence and transition probability.Cause This, according to observed in an embodiment of the present invention (referring to embodiment 2), overexpression and the ER+ tumors of breast of c-MAF The appearance of Bone tumour is related (referring to Fig. 1).Therefore, c-MAF may be used as in the subject with ER+ breast cancer for Transfer is diagnosed and/or the marker of prognosis.
Therefore, in one aspect, the present invention relates in the subject with ER+ breast cancer to transfer diagnose And/or for carrying out the in-vitro method of prognosis (below to the tendency for forming transfer in the subject with ER+ breast cancer In, of the invention first method), including：
(i) the quantitative expression of c-MAF gene in the neoplasmic tissue sample of the subject and
(ii) expression of the expression that front is obtained and the gene in the control sample is compared,
Wherein if the expression of the gene increases for the expression of the gene in the control sample Add, then the subject has the tendency of the formation transfer of the positive diagnosis or bigger about transfer.
C-MAF gene (v-maf aponeurosis fibrosarcoma oncogene homologues (birds), also referred to as MAF or MGC71685) It is the transcription factor for including leucine zipper, works with homodimer or with heterodimer.Depending on DNA binding sites, Encoded protein can be transcription activating protein or transcription repression albumen.The DNA sequence dna of c-MAF is encoded with accession number NG_ 016440 description (SEQ ID NO in ncbi database:1).Two kinds of mRNAs are transcribed out from the DNA sequence dna, in them Each generate one of two kinds of isotypes (α isotypes and β isotypes) of c-MAF albumen.About every in the isotype A kind of complementary dna sequence of isotype is respectively with accession number NM_005360.4 (SEQ ID NO:And NM_001031804.2 2) (SEQ ID NO:3) description is in ncbi database.
In the context of the present invention, " transfer " refers to that cancerous lesions spread to the organ different from the organ that it is originated. Transfer is usually occurred by blood or Lymphatic channel.When cancer cell is spread and forms new tumour, the latter is referred to as secondary Tumour or metastatic tumo(u)r.The cancer cell of formation secondary tumors and the cell of primary tumor are alike.For example, if breast cancer dissipates Cloth (transfer) is to lung, then secondary tumors are formed by the malignant cell of breast cancer.Disease in lung is metastatic breast cancer Rather than lung cancer.In a special embodiment of the method for the present invention, the transfer is to have spread (transfer) to the ER+ of bone Breast cancer.
In the present invention, " ER+ breast cancer " refers to the breast cancer of its tumor cells expression estrogen receptor (ER).This causes The tumour is for estrogen sensitive, it means that estrogen causes the cancerous breast tumour growth.On the contrary, " ER- mammary gland Cancer " refers to that its tumour cell does not express the breast cancer of estrogen receptor (ER).
In the present invention, " diagnosis shifted in the subject with breast cancer " refers to by checking its disease, that is, exist The present invention background under, by c-MAF gene in breast tumor tissue the increased expression water for control sample Flat (that is, overexpression), to identify disease (transfer).
In the present invention, " in the subject with ER+ breast cancer to formed transfer tendency carry out prognosis " refer to from It accuses of and starts whether to be shifted in the future come the ER+ breast cancer for knowing to encroach on the subject.In the context of the present invention, The overexpression accused of as the c-MAF gene in tumor tissues.
The method of the present invention includes, in a first step, the quantitative c-MAF gene in the neoplasmic tissue sample of subject Expression.
In a preferred embodiment, first method of the invention includes the only quantitatively c- as unique designation object The expression of MAF genes, i.e. this method are not related to the measure of the expression of any other marker.
Term " subject " or " patient " refer to all animals for being classified as mammal used in herein, and And include but not limited to, domestic animal and farming animals, primate and people, such as the mankind, non-human primates, milk cow, horse, pig, sheep, mountain Sheep, dog, cat or rodent.Preferably, the subject is the man or woman of any age or race.
In the present invention, " neoplasmic tissue sample " refers to the tissue sample of the primary tumo(u)r from ER+ breast cancer.The sample Product can (such as biopsy comes by using for the technical staff in relevant medical technical aspect by conventional method Method known to saying) it obtains.Include lesion segmentation into bulk or micro- cut for obtaining the method for biopsy samples Cut or other it is as known in the art separate cells methods.Furthermore it is possible to by via the cytology aspirated with fine needle To obtain tumour cell.In order to simplify the preservation of sample and operation, sample can be fixed and be embedded in formalin It is freezed in paraffin or first, submergence can be passed through in the medium (such as OCT compounds) of cold curing by being then embedded in In the height deep cooling medium for allowing to be rapidly frozen.
As understood by those skilled in the art, gene expression dose can quantitatively pass through the mRNA of the gene Level or be measured by the level of the protein of the gene code.
For this purpose, biological sample can be handled physically or mechanically to make institutional framework or cytoclasis, so as to Intracellular members are discharged into aqueous solution or organic solution to prepare nucleic acid.Pass through well known by persons skilled in the art and business Upper available method (Sambroock, J. et al., " Molecular cloning:A Laboratory Manual ", the 3rd edition, 1-3 volumes of Cold Spring Harbor Laboratory Press, N.Y., the) extract nucleic acid.
Therefore, the expression of c-MAF gene quantitatively can be from RNA (mRNAs obtained by the transcription as the gene Or mRNA) start or alternatively, carried out since the complementary DNA (cDNA) of the gene.Therefore, at one of the present invention In special embodiment, the mRNA for quantitatively including c-MAF gene of the expression of c-MAF gene or the mRNA's Segment, the segment or its mixture of the complementary DNA of c-MAF gene or the cDNA quantify.
In fact, it can be compiled within the scope of the invention using any conventional method to detect and quantify by c-MAF gene The level of the mRNA or its corresponding cDNA of code.It illustrates and not restrictive, by the level of the mRNA of the gene code It can be quantified in the following manner：By using conventional method, such as the amplification including mRNA and the amplification of the mRNA The method of quantitative (such as electrophoresis and the dyeing) of product or alternatively, by Southern traces and uses suitable probe, The specific probe of the mRNA or its corresponding cDNA of Northern traces and use target gene (c-MAF), with S1 nucleases Mapping, RT-PCR, hybridization, microarray etc., it is preferable that by using the real-time quantitative PCR of suitable marker.Similarly, accordingly It can also be quantified in the level of the cDNA of the mRNA by c-MAF gene coding by using routine techniques；At this In the case of kind, the method for the present invention includes the reverse transcriptions (RT) by corresponding mRNA the step of synthesizing corresponding cDNA, to be followed by The amplified production of amplification and the cDNA quantify.The conventional method of quantitative expression levels can for example in Sambrook et al., It is found in 2001 (according to above-cited).
In a special embodiment, quantifying for the expression of c-MAF gene passes through quantitative polyase chain reaction (PCR) or DNA or RNA arrays carry out.
On the other hand, the expression of c-MAF gene can also be quantitatively by the protein by the gene code The table of any functionally variant of equivalence of c-MAF albumen (c-MAF) [NCBI, accession number O75444] or c-MAF albumen It quantitative is carried out up to horizontal.There are the isotype of two kinds of c-MAF albumen, by 403 amino acid (SEQ ID NO:4) it forms α isotypes (NCBI, NP_005351.2) and by 373 amino acid (SEQ ID NO:5) the β isotypes (NP_ of composition 001026974.1).The expression of c-MAF gene can quantitatively pass through the expression water of any isotype of c-MAF albumen It is flat quantitative to carry out.Therefore, in a special embodiment, determined by the horizontal of protein of c-MAF gene coding Amount includes quantifying for c-MAF albumen.
In the context of the present invention, " variant functionally of equal value of c-MAF albumen " refers to：(i) c-MAF albumen (SEQ ID NO:4 or SEQ ID NO:5) variant, wherein one or more amino acid residues are by conservative or non-conservative amino acid Residue (preferably, conservative amino acid residue) replace, wherein such amino acid residue through displacement can by or can not By the insertion of genetic code encoding or (ii) comprising one or more amino acid or missing and perform and c-MAF albumen phases The variant of same function (working as DNA combination transcription factors).The variant of c-MAF albumen can be by using based under The method of aspect is stated to identify：Promote the ability of cell Proliferation in vitro based on c-MAF, such as in international patent application WO2005/ Shown by 046731；Opening in Cyclin D2 is blocked in the cell of expression c-MAF based on the inhibitor of hypothesis Report base under the control of mover or the response region (MARE or c-MAF response elements) of promoter comprising to(for) c-MAF The ability of the transcriptional capability of cause, as described in WO2008098351；Or it is being expressed based on the inhibitor of hypothesis The control of the promoter in IL-4 of stimulation in response to being carried out with PMA/ ionomycins is blocked in the cell of NFATc2 and c-MAF Under reporter expression ability, as described in US2009048117A.
Preferably, isotype (the SEQ ID NO of variant according to the present invention and c-MAF albumen:4 or SEQ ID NO:5) Any one of isotype amino acid sequence have at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, At least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity.Homogeneity degree between the particular sequence of the variant and c-MAF albumen as defined above is led to Algorithm and computer program using those skilled in the art's likewise known are crossed to be measured.It is same between amino acid sequence Property preferably by using BLASTP algorithms [BLAST Manual, Altschul, S. et al., NCBI NLM NIHBethesda, Md.20894, Altschul, S. et al., J.Mol.Biol.215:403-410 (1990)] it is measured.
The expression of c-MAF albumen can be by allowing to detect and quantifying appointing for the protein in Samples subjects What conventional method is quantified.Illustrate and not restrictive, the level of the protein can by following manner come It is quantified：Such as by using the antibody with the ability combined with c-MAF (or its segment comprising antigenic determinant) and Then quantitative formed compound.The antibody used in these trials can be labeled or not labeled.It can use The illustrative example of label includes radioactive isotope, enzyme, fluorogen, chemical illuminating reagent, zymolyte or co-factor, enzyme Inhibitor, particle, colorant etc..There are the diversified known test that can be used in the present invention, using unmarked Antibody (primary antibody) and labeled antibody (secondary antibody)；Shifted among these techniques including western blot or Western, ELISA (enzyme linked immunosorbent assay (ELISA)), RIA (radiommunoassay), competitiveness EIA (Competitive enzyme immunoassay), DAS- ELISA (double-antibody sandwich elisa), immunocytochemistry and immunohistochemistry technology, based on using including specific antibody Protein-biochips or microarray technology or experiment based on the colloidal precipitation in the form of such as dipstick.Other For detecting and quantifying the mode of the c-MAF albumen includes affinity chromatography technology, ligand binding is tested etc..When using immunology During method, can use it is known with high-affinity and the protein bound any antibody of c-MAF or reagent to detect c-MAF albumen Amount.However, preferentially using antibody, for example, polyclonal serum, doma supernatant or monoclonal antibody, antibody fragment, Fv, Fab, Fab ' and F (ab ') 2, scFv, double-chain antibody, three chain antibodies, four chain antibodies and humanized antibody.On the market, existing can be The commercial antibodies for c-MAF albumen that use under the background of the present invention, for example, antibody ab427, ab55502, ab55502, ab72584、ab76817、ab77071(Abcam plc,330Science Park,Cambridge CB4 0FL,United Kingdom), AbD Serotec monoclonal antibody O75444 (monoclonal antibody without azide of mouse anti human MAF, not Conjugated, clone 6b8) etc..There is provided the commercial company of anti-c-MAF antibody has more families, such as Abnova Corporation, Bethyl Laboratories, Bioworld Technology, GeneTex etc..
In a special embodiment, the level of c-MAF albumen quantitatively passes through western blot, ELISA or egg White matter array carries out.
First method of the present invention includes, in second step, the c- that will be obtained in the tumor sample of subject The expression of MAF genes and the expression of the gene in the control sample are compared.
Once measure the expression of the c-MAF gene in the neoplasmic tissue sample of the subject with ER+ breast cancer And compare itself and control sample, if the expression of the gene is relative to its expression water in the control sample It is increased for flat, then can conclude that：The subject has the positive diagnosis or bigger about transfer Formation transfer tendency.
It must be related to the value of control sample or reference sample by the measured value of the expression of c-MAF gene.It depends on The type of tumour as analysis object, the exact nature of control sample can change.Therefore, in the situation of the diagnosis to be evaluated Under, then reference sample is the neoplasmic tissue sample with the subject of ER+ breast cancer not shifted also or it is corresponding It is surveyed in tumor tissues set in the biopsy samples of the subject of ER+ breast cancer not shifted also The average value of the expression of the c-MAF gene of amount.
Usually the reference sample is obtained by the way that the sample of the subject group of equivalent is mutually merged.It is in general, typical Reference sample by from clinically through it is fully proving and wherein shift there is no the subjects through fully characterizing to obtain. In such sample, it may be determined that normal (reference) concentration of biomarker (c-MAF gene), such as by providing pass In the mean concentration of reference group.In the reference concentration for determining the marker, various considerations are taken into account.Such the considerations of it In, age, weight, gender, overall physical condition including patient etc..For example, as with reference to group, using at least two of equivalent, The considerations of at least ten, at least 100 groups to preferably more than 1000 subjects, these subjects are advantageously according to front Classify, such as belong to various age categories.Show that the sample set of reference levels will be preferably by suffering from and research from it The subject of the cancer of subject patient same type is formed.
Once establish the average value, it is possible to by the level for the marker expressed in the tumor tissues of patient with being somebody's turn to do Average value is compared, and is so assigned to " increased " expression.Changeability (the example being attributed between subject Such as, it is related to the aspect of age, race etc.), the absolute reference value for establishing c-MAF expression is extremely difficult (if not reality It is upper impossible).In this way, in a special embodiment, " increased " or " reduction " expression about c-MAF expression Reference value calculate percentile by using conventional means to determine, be involved in and be isolated from the wherein disease through fully proving Subject one or more samples in the expression of c-MAF is examined and determine by any approach mentioned above.So, " reduction " level of c-MAF can be distributed to, preferably such sample, the expression of c-MAF in the sample Equal to or less than the 50th percentile in normal population, including for example, equal to or less than in normal population The expression of 60 percentiles, equal to or less than the expression of the 70th percentile in normal population, Equal to or less than the expression of the 80th percentile in normal population, equal to or less than in normal population The expression and the expression water equal to or less than the 95th percentile in normal population of 90 percentiles It is flat.It is possible to " increased " expression of c-MAF gene is distributed to, preferably such sample, in the sample The expression of c-MAF gene is equal to or higher than the 50th percentile in normal population, including for example, being equal to or greatly In the expression of the 60th percentile in normal population, equal to or more than the 70th distribution in normal population The expression of percentage equal to or more than the expression of the 80th percentile in normal population, is equal to or greatly In the expression of the 90th percentile in normal population and equal to or more than the 95th in normal population The expression of percentile.
In the present invention, " increased expression " refers to such expression, when the expression is related to being higher than During the level of horizontal c-MAF gene occurred in reference sample or control sample.Particularly, when relative to being isolated from patient's For sample, the expression in reference sample is at least 1.1 times, 1.5 times, 5 times, 10 times, 20 times, 30 times, 40 times, 50 Times, 60 times, 70 times, 80 times, 90 times, 100 times or during even higher multiple, it may be considered that a sample has high c-MAF Expression.
In the context of the present invention, it should be understood that when the ER+ breast cancer suffered from from the subject is by body During transfer (in a special embodiment, the transfer to bone) for other organs, " subject has the positive about transfer Diagnosis ".
In a more preferred embodiment, the Bone tumour is osteolytic Bone tumour.According to institute in the present invention Use, statement " osteolytic Bone tumour " refer to such transfering type, wherein transfer nearby generate bone information (bone density Gradually lose), cause, and with serious pain, pathologic bone since tumour cell have stimulated the activity of osteoclast Folding, hypercalcinemia, spinal compression and other symptoms caused by neurothlipsis are characterized.
On the other hand, in the present invention, it should be understood that when the ER+ breast cancer suffered from by the subject will meet in future When the probability shifted is high, " patient has the tendency of the formation transfer of bigger ".
It will be understood to those of skill in the art that do not long for about the tendency by the transfer since mammary gland primary tumo(u)r Prediction is all correct for all subjects (that is, for 100% subject) to be identified.However, the term requires, it can To identify the subject of a statistically significant part (for example, group in group research).One part Whether be it is statistically significant, can be by those skilled in the art by using various well known statistical evaluation tools (for example, the determining of confidence interval, the determining of p value, Student t- are examined, Mann-Whitney is examined etc.) simply carries out It determines.Details are provided in Dowdy and Wearden, Statistics for Research, John Wiley and Sons, In Nueva York 1983.Preferred confidence interval is at least 90%, at least 95%, at least 97%, at least 98% or at least 99%.P values are preferably 0.1,0.05,0.01,0.005 or 0.0001.It is highly preferred that the subject of a group is at least 60%th, it at least 70%, at least 80% or at least 90% can suitably be identified by the method for the present invention.
The method of design individuality amic therapy method of the invention in the patient with ER+ tumors of breast
As knowing from the prior art, the treatment for treating to implement to the subject with cancer depends on whether this is to dislike Property tumour, i.e., whether have the high probability shifted or this whether be benign tumour.It is selected in first is assumed The treatment selected is systemic therapy, such as chemotherapy, and in assuming at second, selected treatment is local treatment, such as Radiotherapy.
Therefore, according to described in the present invention, it is assumed that the overexpression of c-MAF gene and transfer in breast cancer cell Presence it is related, then the expression of c-MAF gene allows in the therapy side for being best suited for the subject with the cancer It makes decision in face.
Therefore, on the other hand, the present invention relates to for design for the personalization for the subject for suffering from ER+ breast cancer The in-vitro method (hereinafter, second method of the invention) of therapy, including：
(i) the quantitative expression of c-MAF gene in the neoplasmic tissue sample of the subject and
(ii) expression of the expression that front is obtained and the gene in the control sample is compared,
Wherein if the expression increases for the expression of the gene in the control sample, then The subject can receive to be intended to avoid and/or treat the therapy of transfer.
In a special embodiment, the transfer is Bone tumour.It is described in a further preferred embodiment Bone tumour is ostelytic metastases.
About the present invention first method be described in detail term and statement " subject ", " ER+ breast cancer ", " neoplasmic tissue sample ", " transfer ", " measure of expression ", " c-MAF gene ", " increased expression " and " control sample Product ", and they are similarly applied to second and the third method of the present invention.
Second method of the present invention includes, in a first step, quantitative in the swollen of the subject with ER+ breast cancer The expression of c-MAF gene in tumor tissue sample.
In a preferred embodiment, second method of the invention includes the only quantitatively c- as unique designation object The expression of MAF genes, i.e. this method are not related to the measure of the expression of any other marker.
In the case of second method of the present invention, the sample is the primary tumor tissue sample of subject. In two steps, by the expression of the c-MAF gene obtained in the tumor sample of subject with it is described in the control sample The expression of gene is compared.It must be by the measured value of the expression of c-MAF gene and control sample or reference sample Value it is related.Depending on the type of the tumour as analysis object, the exact nature of control sample can change.Therefore, one In a preferred embodiment, reference sample is the tumor tissues sample with the subject of ER+ breast cancer not shifted also Product or its correspond in the biopsy samples of the subject of ER+ breast cancer not shifted also in tumour The average value of the expression of measured c-MAF gene in tissue set.
Once it measures the expression of c-MAF gene in the sample and compares itself and control sample, if The expression of the gene increases for its expression in the control sample, then can obtain such Conclusion：The subject can receive to be intended to avoid (if the subject is not shifted also) and/or treatment (if this is tested Person had been subjected to transfer) transfer therapy.
When cancer has generated transfer, using systemic therapy, including but not limited to chemotherapy, is exempted from hormone therapy Epidemic disease therapy or these combination.Furthermore, it is possible to using radiotherapy and/or surgical operation.The selection for the treatment of generally depends on original Send out the type of cancer, size, the positioning of transfer, age, the general health of patient and the treatment type that is previously used.
Systemic therapy is to reach those treatments of entire body：
Chemotherapy is the use for destroying the drug of cancer cell.In general, the drug passes through oral route or quiet Approach is administered in arteries and veins.Sometimes, chemotherapy is used together with radiotherapy.
Hormonotherapy is based on, and certain hormones promote the growth of certain cancers.For example, in women estrogen (its by Ovary generate) sometimes promote breast cancer growth.There are the modes that various these hormones of prevention generate.A kind of mode is to extract Generate the organ of hormone：In the case of women, ovary；In the case of male, testis.More often, can use be used for These organs is prevented to generate hormone or the drug for hormone to be avoided to work cancer cell.
Immunotherapy is to assist the immune system of itself of patient with the treatment to anticancer.Have various types of immune Therapy is used for patient of the treatment with transfer.These include but not limited to, cell factor, monoclonal antibody and antitumor Vaccine.
The method of design individuality amic therapy method of the invention in the patient with the breast cancer for having Bone tumour
The author of the present invention it has been shown that with it is high cause the ability of Bone tumour and be overexpressed c-MAF derived from original Osteoclast can be induced with the degree bigger than the cell for not being overexpressed c-MAF by sending out the conditioned medium of the cell line of tumor of breast It is formed.Therefore, with the ER- breast cancer for being transferred to bone and wherein there are those patients of high c-MAF levels can be with The therapy for particularly having benefited from being intended to avoid the bone as caused by increased osteoclast activity to degrade.
Therefore, on the other hand, the present invention relates to for design for suffer from the ER- breast cancer with Bone tumour by The in-vitro method (hereinafter, third method of the invention) of the novel personalized therapy of examination person, including：
(i) the quantitative expression of c-MAF gene in the metastatic bone tumor tissue sample of the subject and
(ii) expression of the expression obtained in front and the gene in the control sample is compared,
Wherein if the expression increases for the expression of the gene in the control sample, then The subject can receive the therapy for being intended to prevent bone from degrading.
About the present invention first method be described in detail term and statement " subject ", " ER+ breast cancer ", " neoplasmic tissue sample ", " transfer ", " measure of expression ", " c-MAF gene ", " increased expression " and " control sample Product ", and they are similarly applied to second and the third method of the present invention.
In a further preferred embodiment, the Bone tumour is ostelytic metastases.
The third method of the present invention includes, in a first step, quantitative to swell in the subject with breast cancer The expression of c-MAF gene in tumor tissue sample.In the case of the third method of the present invention, the sample is Bone tumour Tissue sample.
In a preferred embodiment, third method of the invention includes the only quantitatively c- as unique designation object The expression of MAF genes, i.e. this method are not related to the measure of the expression of any other marker.
In second step, by the expression of the c-MAF gene obtained in the tumor sample of subject with right The expression of gene described in product is compared in the same old way.It must be by the measured value and control sample of the expression of c-MAF gene The value of product or reference sample is related.Depending on the type of the tumour as analysis object, the exact nature of control sample can become Change.Therefore, in the case of third method the present invention is concerned, then reference sample is with the mammary gland not shifted also The neoplasmic tissue sample of the subject of cancer or its correspond to the subject with the breast cancer not shifted also work group Knit the average value for the expression for checking c-MAF gene measured in tumor tissues set in sample.
Once it measures the expression of c-MAF gene in the sample and compares itself and control sample, if The expression of the gene increases for its expression in the control sample, then can obtain such Conclusion：The subject can receive to be intended to avoid or prevent the therapy that bone is degraded.
According to used in the present invention, " for the reagent for avoiding or preventing bone from from degrading " refers to any such point Bone degradation can be treated or be prevented to son or by stimulating the proliferation of osteoblast or the increasing by inhibiting osteoclast It grows.The illustrative example of reagent for avoiding and/or preventing bone from from degrading includes but not limited to：
Parathyroid hormone (PTH) or its recombinant forms (Teriparatide corresponds to the amino acid 1-34 of PTH).It should Hormone is worked by stimulating osteoblast and increasing its activity.
Strontium Ranelate：It is the alternative of oral medication, and forms and be known as " double action bone reagent " (DABA) Medicine group a part because they stimulate osteoblasts proliferation and inhibit osteoclast proliferation.
" conditioning agent of estrogen receptor " (SERM) refers to interfere or inhibit the compound that estrogen is combined with receptor, no By mechanism why.The example of the conditioning agent of estrogen receptor includes, especially estrogen, progestational hormone, estradiol, Droloxifene, Raloxifene, lasofoxifene, TSE-424, tamoxifen, Idoxifene, LY353381, LY117081, Toremifene, fluorine dimension department Group, 4- [7- (2,2- dimethyl -1- oxopropoxy -4- methyl -2- [4- [2- (1- piperidyls) ethyoxyl] phenyl] -2H-1- Chromene -3- bases]-phenyl -2,2- dimethyl propylenes acid esters, 4,4 '-dihydroxy benaophenonel-dinitrophenyl group-hydrazone and SH646。
Calcitonin：It directly inhibits the activity of osteoclast by calcitonin receptor.On the surface of osteoclast On identify calcitonin receptor.
Bisphosphonates：It is drug as one group, and the drug has bone information or bone weight for preventing and treating The disease of absorption, such as osteoporosis and the cancer with Bone tumour, the latter with and without hypercalcinemia, with breast cancer and Prostate cancer is associated.The reality of bisphosphonates that can be used in the therapy designed by the third method of the present invention Example includes but not limited to, and nitrogenous bisphosphonates are (for example, Pamidronate, Neridronic Acid salt, olpadronate, alendronic acid Salt, ibandronate, Risedronate, incadronate, zoledronate or zoledronic acid etc.) and unazotized bisphosphonates (for example, etidronate, clodronate, Tiludronate etc.).
" inhibitor of cathepsin K " refers to interfere the activity of this cysteine proteinase of cathepsin K Compound.The non-limiting examples of the inhibitor of cathepsin K include：Derivative (the description of 4- amidino-pyridine -2- formonitrile HCNs In with the international patent application WO 03/020278 of the name of Novartis Pharma GMBH), in publication WO 03/ Pyrrole described in 020721 (Novartis Pharma GMBH) and publication WO 04/000843 (ASTRAZENECA AB) Cough up miazines and PCT WO 00/55126, Merck Frosst Canada＆ in Axys Pharmaceuticals Co. with the inhibitor described in the WO of Axys Pharmaceuticals 01/49288 these publications.
" inhibitor of RANKL " according to used in the present invention, refers to any activity drop that can cause RANK Low compound.RANKL is present on the surface of the film of osteoblast, stroma cell and T lymphocytes, and T lymphocytes It is the cell of unique ability for wherein showing secretion RANKL.Its major function is activation osteoclast, this is to participate in bone to inhale The cell of receipts.The inhibitor of RANKL can be situated between by blocking the combination of RANKL and its receptor (RANK) by blocking by RANK The signal transduction led or by working via the transcription or translation that block RANKL the expression of RANKL to be caused to decline. The antagonist or inhibitor for being suitable for the RANKL being used in the present invention include but not limited to：
Zero can be with reference to RANKL and the whole of the extracellular domain comprising rank protein or the suitable RANK of segment Albumen.Soluble RANK can include muroid or people's RANK polypeptides signal peptide and extracellular domain or it is alternatively possible to Use the mature form for the protein for eliminating signal peptide.
Zero bone protector protein or its variant with the ability with reference to RANKL.
Zero is specific to the antisense molecule of RANKL.
Zero has the ribozyme of the ability of the transcript of processing RANKL.
The specific antibody of zero anti-RANKL.In the context of the present invention, " anti-RANKL antibody or resisting for RANKL Body " refers to all such antibody, can specifically combine " receptor activator of the nuclear factor-κappaB ligand " (RANKL), so as to Cause the inhibition of the one or more functions of RANKL.It can be made by using any method well known by persons skilled in the art The standby antibody.Therefore, polyclonal antibody is prepared by using repressed Western Immuno animal is wished.By using Kohler, Milstein et al. (Nature, 1975,256:495) described method prepares monoclonal antibody.In the present invention Background under, suitable antibody include include combine antigen variable region and constant region complete antibody, segment " Fab ", " F (ab ') 2 " and " Fab ' ", Fv, scFv, double-chain antibody and bispecific antibody.
In a preferred embodiment, the anti-RANKL antibody is monoclonal antibody.It is more preferred at one In embodiment, the anti-RANKL antibody is ground Shu Dankang (Pageau, Steven C. (2009) .mAbs 1 (3):210- 215, CAS number 615258-40-7).In the context of the present invention, ground Shu Dankang combinations RANKL and hinder its activate Monoclonal antibody (not bind receptor RANK).
In a preferred embodiment, the reagent for preventing bone from degrading is bisphosphonates.At one more preferably Embodiment in, the bisphosphonates be zoledronic acid.
It is alternatively possible to carry out combination therapy, wherein will be combined more than a kind of above mentioned reagent to treat and/or The reagent can be combined by prevention transfer with other supplements (such as calcium or vitamin D) or with hormone therapy.
The diagnosis shifted in breast cancer of detection based on c-MAF gene amplification or method of prognosis
The author of the present invention has identified that the cell line derived from ER+ tumors of breast and with height transfer ability is shown Go out the amplification of seat 16q22-q24 (it includes the locus corresponding to c-MAF gene) and the amplification of c-MAF gene.
Therefore, in one aspect, the present invention relates in the subject with breast cancer to transfer diagnosed ( Hereinafter, the 4th diagnostic method of the invention) and/or for the tendency to forming transfer in the subject with breast cancer The in-vitro method of prognosis is carried out, including determining whether c-MAF gene expands in the neoplasmic tissue sample of the subject Increase, if wherein there are the amplifications of the gene for control sample, then the subject has about transfer The tendency of the formation transfer of positive diagnosis or bigger.
In a special embodiment, the breast cancer diagnosed in the 4th method of the present invention is ER+ or ER- breasts Gland cancer.
Term " c-MAF gene " has been described in detail under the background of first method of the present invention, " transfer ", " has swollen Tumor tissue sample ", " ER+ breast cancer ", " diagnosis shifted in the subject with ER+ breast cancer ", " with ER+ mammary gland The tendency progress prognosis shifted in the subject of cancer to formation ", " patient ", " has inclining for the formation transfer of bigger at " subject " To subject ", and be similarly applied to the present invention the 4th method.
In a special embodiment, determining for the amplification degree of c-MAF gene can be by determining comprising described The amplification of the chromosomal region of gene measures.In a preferred scheme, amplification is the amplification there are c-MAF gene The chromosomal region of instruction is seat 16q22-q24, including c-MAF gene.Seat 16q22-q24 is located on chromosome 16, The chromosome it is long-armed in and section between band 22 and band 24 in.The region is in ncbi database corresponding to weight Folded group NT_010498.15 and NT_010542.15.In another preferred embodiment, the amplification degree of c-MAF gene It determines to measure by using the probe for being specific to the gene.
The 4th diagnosis/method of prognosis of the present invention includes, and in a first step, determines the tumor tissues in subject Whether c-MAF gene expands in sample.For this purpose, by the amplification of the c-MAF gene in tumor sample relative to control sample It is compared.
As understood in the present invention, term " amplification of gene " refers to such process, by the process specific Gene or multiple copies of genetic fragment are formed in cell or cell line.The copy of gene is not necessarily to be located at identical chromosome On.The region copied is frequently referred to as " amplicon ".In general, the amount of generated mRNA, i.e. gene expression dose, also with it is specific The copy number of gene proportionally increases.
In a special embodiment, in the subject with breast cancer to transfer diagnosed and/or The 4th method for carrying out the present invention of prognosis to the tendency for forming transfer in the subject with breast cancer includes, and surveys It is scheduled in the neoplasmic tissue sample of the subject copy number of c-MAF gene and by the copy number and control sample or reference The copy number of sample is compared, if wherein the copy number of c-MAF for the copy number of the c-MAF of control sample more It is more, then the subject has the tendency of the formation transfer of the positive diagnosis or bigger about transfer.
Control sample refers to ER+ or ER- breast cancer (the cancer class being subjected to according to subject not shifted also Type) subject neoplasmic tissue sample or its correspond to ER+ the or ER- breast cancer not shifted also by The average value of the copy number of c-MAF gene measured in tumor tissues set in the biopsy samples of examination person.Usually The reference sample is obtained by the way that the sample of the subject group of equivalent is mutually merged.If the copy number phase of c-MAF gene Increase for the copy number of the gene in the control sample, then the subject has the positive about transfer Diagnosis or the tendency of the formation transfer of bigger.
As used in the present disclosure, term " copy number of gene " refers to the copy number of cell nucleic acid molecule.Base The copy number of cause is included in the copy number of gene in genome (chromosome) DNA of cell.In normal (non-tumour) cell In, the copy number of gene is typically two copies (there are one copy for tool in each member of chromosome pair).The copy of gene Number includes the average value of the copy number of gene obtained from cell population sample sometimes.
In the present invention, when the copy number of c-MAF gene is higher than copy number possessed by reference sample or control sample, Then it is known as " copy number of increased gene ".Particularly, when copy number more than two copies, such as 3,4,5,6,7,8,9 or 10 When copy and even more than 10 c-MAF genes copied, it is believed that a sample has the copy number of increased c-MAF.
In a special embodiment, the amplification or the copy number are carried out really by situ hybridization or PCR It is fixed.
Method for determining c-MAF gene or whether chromosomal region 16q22-q24 occurs expanding is in the prior art Likewise known.The method includes but be not limited to, in situ hybridization (ISH) is (for example, fluorescence in situ hybridization (FISH), original of adding lustre to Position hybridization (CISH) or silver staining in situ hybridization (SISH)), comparative genome hybridization or polymerase chain reaction be (for example, real-time quantitative PCR).For any ISH methods, the amplification or the copy number can be by the fluorescence in chromosome or in nucleus The number of point, colored spots or silver staining point is counted to determine.
Fluorescence in situ hybridization (FISH) is the existence or non-existence for detecting and being located in specific dna sequence in chromosome Cytogenetic techniques.FISH uses fluorescence probe, and the fluorescence probe is only in conjunction with the sequence phase that high level is shown with it Like those parts of the chromosome of property.In a typical FISH method, DNA probe fluorescent molecular or haptens are into rower Note, the fluorescent molecular or haptens usually with fluorescent dye-dUTP (fluor-dUTP), digoxin-dUTP, biotin- The form of dUTP or haptens-dUTP, they are incorporated by using enzymatic reaction such as nick translation or PCR in DNA.It will Sample comprising inhereditary material (chromosome) is placed on glass slide and makes its denaturation by formamide processing.Then, it is labeled Probe under suitable conditions with the sample hybridization for including inhereditary material, the suitable condition will be by art technology Personnel determine.After hybridization or directly (in the case of the probe being marked with fluorescent dye (fluor)) or (detecting haptens using the antibody through fluorescent marker) indirectly visualizes sample.
In the case of CISH, probe digoxin, biotin or fluorescein are marked, and under suitable conditions Hybridized with the sample comprising inhereditary material.
Can using it is any can with reference to DNA mark molecule or tag molecule come mark the present invention the 4th method The middle probe used, so as to allow the detection of nucleic acid molecules.The example of marker for being marked includes but not limited to, and puts Injectivity isotope, zymolyte, co-factor, ligand, chemical illuminating reagent, fluorogen, haptens, enzyme and these combination.With In the method being marked and for selecting the guidance for the marker for being suitable for different purposes can be with, such as in Sambrook et al. (Molecular Cloning:A Laboratory Manual, Cold Spring Harbor, New York, 1989) and Ausubel et al. (In Current Protocols in Molecular Biology, John Wiley and Sons, New York, 1998) it is found in.
Once it is determined that the presence of amplification (determines seat by directly determining the amplification of c-MAF gene or passing through The amplification of 16q22-q24), and after its amplification with the gene in the control sample is compared, detecting It is that the subject has about the positive diagnosis of transfer or the formation of bigger in the case of amplification in c-MAF gene The instruction of the tendency of transfer.
Must be related to the value of control sample or reference sample by the measurement result of the amplification of c-MAF gene, the control The value of sample or reference sample corresponds to the institute in the neoplasmic tissue sample of the subject with the breast cancer not shifted also The level of amplification of the c-MAF gene of measurement or corresponding to the work group in the subject with the breast cancer not shifted also Knit the average value for the amplification for checking c-MAF gene measured in tumor tissues set in sample.Usually by by equivalent The sample of subject group mutually merges to obtain the reference sample.In general, typical reference sample will be from clinically through filling The subject through fully characterizing that is not present that is proving and wherein shifting is divided to obtain.The collection of the sample of reference levels is obtained from it Conjunction will be preferably made of the subject suffered from the cancer of goal in research patient's same type.Once the average value is established, Can by the tumor tissues of patient the level of amplification of c-MAF be compared, and so with the average value, if deposited It is expanding, then the subject has the tendency of the formation transfer of the positive diagnosis or bigger about transfer.
In a preferred embodiment, the transfer is Bone tumour.In a more preferred embodiment, institute Bone tumour is stated as osteolytic Bone tumour.According to used in the present invention, statement " osteolytic Bone tumour " refers to such turn Move type, wherein nearby generate bone information (the gradual forfeiture of bone density) in transfer, due to tumour cell have stimulated it is osteoclastic thin The activity of born of the same parents and cause, and with serious pain, pathologic fracture, hypercalcinemia, spinal compression and other due to nerve press Symptom is characterized caused by compeling.
The therapy of the present invention
Bone tumour is treated using the inhibition reagent of c-MAF
By thus use xenograft experiments model, author of the invention it has been shown that in breast cancer cell c- The inhibition of the expression of MAF leads to statistically significant in terms of Bone tumour is formed from the cell decline.On the contrary, at this In identical system, the overexpression of c-MAF causes the increase of the transfer ability of the cell in tumour cell.It therefore, can be with C-MAF gene expression or the inhibition of the protein by the gene code are used in the treatment and/or prevention of Metastasis in Breast Cancer Property reagent.
Therefore, on the other hand, the suppression of the protein the present invention relates to c-MAF gene expression or by the gene code Property reagent (hereafter hereinafter, inhibition reagent of the invention) processed is being prepared for treating and/or prevent Metastasis in Breast Cancer Purposes in drug.Alternatively, the inhibition examination of the protein the present invention relates to c-MAF gene expression or by the gene code Agent is used in the treatment and/or prevention of Metastasis in Breast Cancer use.Alternatively, the present invention relates to breast is treated in subject The method of gland cancer transfer, the inhibitor including applying c-MAF to the subject.
According to used in the present invention, " the inhibition reagent of c-MAF " is to refer to wholly or partly inhibit Any molecule of c-MAF gene expression both (interrupted the transcription of c-MAF gene by the way that the expression product of the gene is hindered to generate And/or block the translation of mRNA expressed from c-MAF gene), also by the activity for directly inhibiting c-MAF albumen.C-MAF bases Because the inhibitor of expression can be identified by using the method based on following aspects：Inhibitor based on hypothesis blocks c-MAF Promote the ability of the ability of cell Proliferation in vitro, as shown in international patent application WO2005/046731；Based on vacation Fixed inhibitor is blocked in the cell of expression c-MAF in the promoter of Cyclin D2 or comprising answering for c-MAF The ability of the transcriptional capability of the reporter under the control of the promoter in region (MARE or c-MAF response elements) is answered, is such as existed Described in WO2008098351；Or it is blocked and rung in the cell of expression NFATc2 and c-MAF based on the inhibitor of hypothesis The ability of the expression of the reporter under the control of the promoter of IL-4 for the stimulation that Ying Yuyong PMA/ ionomycins carry out, As described in US2009048117A.
And not restrictive, the inhibition reagent for being suitable for the c-MAF being used in the present invention includes antisense for illustration Oligonucleotides, RNA interfering (siRNA), catalytic RNA or specific ribozyme and inhibiting antibody.
Antisense oligonucleotides
Another aspect of the present invention is related to inhibit to encode its activity hope being pressed down using " antisense " nucleic acid of separation The expression of the nucleic acid of the c-MAF of system, such as by the way that it is inhibited to transcribe and/or translate.Antisense nucleic acid can pass through conventional base Complementation such as in the case where being combined with double-stranded DNA is interacted by the specificity in the major groove of double helix, with The potential targeted integration of drug.Usually, these methods be related to technology usually used in the art range and including Any method based on the specific binding with oligonucleotide sequence.
The antisense construct thing of the present invention can for example be distributed as expression plasmid, the expression plasmid is when in cell transfer During record, the RNA at least one differentiated part complementation of the cell mRNA of coding c-MAF is generated.Alternatively, the antisense construct Object is such oligonucleotide probe, is generated in vitro, and it is when being introduced into cell, by with target nucleic acid MRNA and/or genome sequence hybridize and generate the inhibition of gene expression.Such oligonucleotide probe is preferably modified Oligonucleotides, it is resistant for endogenous nuclease (such as exonuclease and/or endonuclease), and it is therefore It is stable in vivo.For being used as the illustrative nucleic acid molecules of antisense oligonucleotides for phosphoramidate, Thiophosphonate With the DNA analogs of methyl phosphonate (referring also to U.S. Patent number 5176996,5264564 and 5256775).It is in addition, comprehensive The general approach for building oligomer useful in antisense therapy has been stated, for example, in Van der Krol et al., BioTechniques 6:958-976,1988；With Stein et al., Cancer Res 48:In 2659-2668,1988.
About antisense oligonucleotides, the widow of the translation initiation site (for example, between -10 and+10) from target gene takes off Oxygen ribonucleotide region is preferred.Antisense approach involve with coding target polypeptide mRNA complementations oligonucleotides (DNA or RNA design).Antisense oligonucleotides is combined with the transcript of mRNA and prevents to translate.
With the few core of the 5 ' ends of mRNA (for example, until and 5 ' non-translated sequences including initiation codon AUG) complementation Thuja acid should most effectively work to inhibit to translate.However, recently it has been shown that sequence with 3 ' the non-translated sequences complementation of mRNA It is also effective (Wagner, Nature 372 to arrange for inhibiting the translation of mRNA:333,1994).Therefore, for inhibiting The few core fully complementary with 5 ' or 3 ' non-translational regions (noncoding region of gene) can be used in the antisense approach of the translation of mRNA Thuja acid.It should include the complement of initiation codon AUG with the oligonucleotides of 5 ' the non-translational regions complementation of mRNA.With the volume of mRNA The oligonucleotides of code area's complementation is less efficient translation inhibitor, but can also be used according to the present invention.If they are set It counts to hybridize with the 5 ' of mRNA areas, 3rd ' area or code area, then antisense nucleic acid should have the length of at least six nucleotide, And there are preferably less than about 100 nucleotide and the more preferably less than length of about 50,25,17 or 10 nucleotide Degree.
Preferably, the in vitro study of the ability for quantitative antisense oligonucleotides inhibition of gene expression is carried out first.It is excellent Choosing, these researchs use the antisense gene inhibition of the differentiation oligonucleotides and compareing for non-specific biological effect. It is also preferred that the level and the internal contrast of RNA or protein of target RNA or target protein are compared by these researchs.It can be with The result obtained by using antisense oligonucleotides is compared with the result obtained by using control oligonucleotide. Preferably, control oligonucleotide has the length about the same with oligonucleotides to be tested, and the oligonucleotides Sequence and antisense sequences the difference is that only that it is required for preventing for the specific hybrid with target sequence.
Antisense oligonucleotides can be single-stranded or double-strand DNA or RNA or its chimeric mixtures or derivative or warp The form of modification.The oligonucleotides can be modified, such as in base group, glycosyl group or phosphate backbone to change Stability, its hybridization ability of kind molecule etc..The oligonucleotides can include the other groups combined, such as peptide is (for example, be They are oriented to the receptor of host cells) or for promote by cell membrane (see, for example, Letsinger et al., Proc.Natl.Acad.Sci.U.S.A.86:6553-6556,1989；Lemaitre et al., Proc.Natl.Acad.Sci.84:648-652,1987；PCT Publication WO88/09810) or blood-brain barrier (see, for example, PCT Publication WO89/10134) transhipment reagent, intercalator is (see, for example, Zon, Pharm.Res.5:539-549, 1988).For this purpose, the oligonucleotides can be conjugated to other molecules, such as peptide, transhipment reagent, caused by hybridization Cutting reagent etc..
Antisense oligonucleotides can include at least one modified base group.Antisense oligonucleotides can also include extremely A few modified glycosyl group, selected from including but not limited to arabinose, 2- fluorine arabinose, xylulose and hexose Group.Antisense oligonucleotides can also include and main chain as neutral peptides.Such molecule is known as peptide nucleic acid (PNA) oligomer, and And description is in such as Perry-O ' Keefe et al., Proc.Natl.Acad.Sci.U.S.A.93:14670,1996 and Eglom Et al., Nature 365:In 566,1993.
In another embodiment, antisense oligonucleotides includes at least one modified phosphate backbone.Also In another embodiment, antisense oligonucleotides is α-different head oligonucleotides.
Although the antisense oligonucleotides with the complementation of the code area of the target sequence of mRNA can be used, it is also possible to use with it is non- Translate those antisense oligonucleotides of transcriptional domain complementation.
In some cases, the intracellular antisense oligonucleotides acid concentration for reaching the translation for being enough to inhibit endogenous mRNA may be Difficult.Therefore, preferred method is using recombinant DNA constructs, wherein by antisense oligonucleotides be placed in pol III or Under the control of the strong promoter of pol II.
It is alternatively possible to the expression of target gene is reduced by following manner：By complementary deoxyribonucleotide sequence The control region (that is, promoter and/or enhancer) of the gene is oriented to, so as to form prevention gene in target cell in body Transcription triple helix structure (usually referring to Helene, Anticancer Drug Des.6 (6):569-84,1991). In certain embodiments, antisense oligonucleotides is antisense morpholine oligonucleotides (Morpholinos).
siRNA
SiRNA or siRNA are the reagents that can inhibit expression of target gene by the interference of RNA.SiRNA can change Synthesis is learned, can be obtained or can be in vivo synthesized in target cell by in-vitro transcription.Typically, siRNA is by RNA double-strands Composition, the length of the RNA double-strands is 15 to 40 nucleotide, and can include 3 ' and/or the 5 ' of 1 to 6 nucleotide and dash forward Go out area.Total length of the length in prominent area independent of siRNA molecule.The post-transcriptional degradation or silence that siRNA passes through target courier And it works.
The siRNA of the present invention is real with the mRNA of the gene of coding c-MAF or with the genome sequence of code for said proteins It is homologous in matter." substantial homologous " refers to, has such sequence, fully complementary or similar to said target mrna, so as to the siRNA The degradation of mRNA can be caused by the interference of RNA.It is suitable for causing the siRNA of the interference to include what is formed by RNA The siRNA and siRNA for including different chemical modifications, such as：
Such siRNA, the key between nucleotide are different from those occurred in nature, such as thio phosphorus Acid esters key；
The conjugate of-RNA chains and functional reagent (such as fluorogen)；
The trim of the trim of the end of-RNA chains, particularly 3 ' ends, by using different functional groups in 2 ' positions The hydroxyl at place is modified；
Such nucleotide, with modified sugar, such as carry out at 2 ' positions O- alkylated residues such as 2 '- O- methylriboses or 2 '-O- fluorine ribose；
Such nucleotide, with modified base, such as halogenation base (such as 5-bromouracil and 5- ioduria Pyrimidine), alkylation base (such as 7- methylguanosines).
SiRNA can be used like this, i.e., in the form of the double-stranded RNA with aforementioned feature.Alternatively, may be used Energy is using such carrier, and it includes the sense strand of siRNA and the sequences of antisense strand, they, which are in, is being suitable for it in mesh Cell under the control of promoter expressed.
The carrier for being suitable for the expression of siRNA is these carriers, wherein two region of DNA domains of two chains of coding siRNA It is unique in being arranged in series in same DNA chain and separated by spacer region (it forms ring after transcription), and wherein Promoter guidance generate shRNA DNA molecular transcription.
Alternatively, it is possible to such carrier is used, wherein each in the chain of formation siRNA is by different transcriptions The transcription of unit starts to be formed.And these carriers are divided into Divergence transcription vector and convergent transcription vector.Turn in Divergence It records in carrier, the transcript unit that coding forms each chain of the DNA chain of siRNA is lain in series in carrier, so as to each The transcription of DNA chain dependent on the promoter of its own, the promoter can be same or different (Wang, J. et al., 2003,Proc.Natl.Acad.Sci.USA.,100:5103-5106；And Lee, N.S. et al., 2002, Nat.Biotechnol.,20:500-505).In convergent transcription vector, the region of DNA domain formation flank for generating siRNA is two The sense strand and antisense strand in the region of DNA domain of reverse starting.After the transcription of sense and antisense RNA chains, they form heterozygote So as to form functional siRNA.The carrier with reverse starting subsystem has been described, wherein using 2 U6 promoters (Tran, N. et al., 2003, BMC Biotechnol., 3:21), using mouse U6 promoters and people's H1 promoters (Zheng, L. Et al., 2004, Proc.Natl.Acad.Sci.USA., 135-140 and WO2005026322) and using human U_6 promoter and Mouse H1 promoters (Kaykas, A. and Moon, R., 2004, BMC Cell Biol., 5:16).
It is suitable for the promoter used in the expression of the siRNA since convergent or Divergence expression vector to include and hope Any promoter of the cytocompatibility of the siRNA or promoter pair are expressed wherein.Therefore, it is adapted for carrying out opening for the present invention Mover includes but is not necessarily limited to：Constitutive promoter, for example, eukaryotic virus (such as polyomavirus, adenovirus, SV40, CMV, avian sarcoma virus, hepatitis type B virus) genome derivative, the promoter of metallothionein gene, simple blister The promoter of the thymidine kinase gene of exanthema virus, the LTR areas of retrovirus, the promoter of immunoglobulin gene, flesh move egg The promoter of white gene, the wherein promoter and inducible promoter of EF-1 α genes, the expression of protein depend on external source The addition of molecule or signal, such as tet-off, NFkappaB/UV photosystems, Cre/Lox systems and heat shock gene Promoter, the adjustable type promoter and tissue specificity of the rna plymerase ii described in WO/2006/135436 open Mover (for example, promoter of the PSA described in WO2006012221).In a preferred embodiment, it is described to open Mover is the promoter of rna plymerase iii that works of composition ground.The promoter of rna plymerase iii is in a limited number of base Because occurring in (for example, 5S RNA, tRNA, 7SL RNA and U6snRNA).Different from other promoters of rna plymerase iii, Type III promoter does not need to sequence in any gene, but needs the sequence on 5 ' directions, is included in -34 to -24 place of position TATA boxes, proximal sequence element (PSE) between -66 and -47 and in some cases, position -265 and -149 it Between distal sequence element (DSE).In a preferred embodiment, rna plymerase iii type III promoter behave or The H1 genes in muroid source and the promoter of U6 genes.In a more preferred embodiment, the promoter is 2 people Or the U6 promoters in muroid source, mouse U6 promoters and people H1 promoters or human U_6 promoter and mouse H1 promoters. Under the background of the present invention, for specifically being expressed for target gene (preferably, in ER+ tumors of breast) in breast tumors Specially suitable and therefore promoter of the particularly preferred promoter for ER α genes or cyclin D1 gene.
SiRNA can be generated in the cell since so-called shRNA (short hairpin RNA), the feature of the shRNA exists In the antiparallel chain for forming siRNA is connected by ring or hair clip area.The shRNA can be (particularly anti-by plasmid or virus Retroviral) coding, and under the control of promoter.The promoter for being suitable for the expression of shRNA is in the previous paragraph In about those pointed by the expression of siRNA.
The carrier for being suitable for the expression of siRNA and shRNA includes, prokaryotic expression carrier, such as pUC18, pUC19, Bluescript and its derivative, mp18, mp19, pBR322, pMB9, CoIEl, pCRl, RP4；Bacteriophage and shuttle vector, example Such as pSA3 and pAT28；Yeast expression carrier, such as the carrier of 2 μm of Plasmid Types, integrated plasmid, YEP carriers, centromere plasmid Deng；Insect cell expression vector, such as the carrier of pAC series and pVL series；Plant expression vector, such as pIBI, The carrier of the series such as pEarleyGate, pAVA, pCAMBIA, pGSA, pGWB, pMDC, pMY, pORE；It is thin with higher eucaryote Cellular expression carrier, or based on viral vectors (adenovirus, adeno-associated virus (AAV) and retrovirus, particularly slow disease Poison) or based on non-virus carrier such as pcDNA3, pHCMV/Zeo, pCR3.1, pEFl/His, pIND/GS, pRc/HCMV2, PSV40/Zeo2, pTRACER-HCMV, pUB6/V5-His, pVAXl, pZeoSV2, pCI, pSVL and pKSV-10, pBPV-1, PML2d and pTDTl.In a preferred embodiment, the carrier is slow virus carrier.
The siRNA and shRNA of the present invention can be obtained by using a series of technologies well known by persons skilled in the art. As not being conditional, and coded sequence area can be included for designing the region of nucleotide sequence on the basis of siRNA (between initiation codon and terminator codon) or it is alternatively possible to the sequence of 5 ' or 3 ' non-translational regions is included, preferably Length with 25 to 50 nucleotide and in any position for initiation codon at 3 ' ariyoshi positions In.A kind of mode for designing siRNA involves the identifications of AA (N19) TT motifs, and (wherein N can be the sequence in c-MAF gene Any nucleotide in row), and select those with high G/C contents.If the motif is not found, then possible It is to identify NA (N21) motif, wherein N can be any nucleotide.
The siRNA for being specific to c-MAF is included in siRNA described in WO2005046731, and one of chain is ACGGCUCGAGCAGCGACAA(SEQ ID NO:6).Other sequences for being specific to the siRNA of c-MAF include but not limited to： CUUACCAGUGUGUUCACAA(SEQ ID NO:7)、UGGAAGACUACUACUGGAUG(SEQ ID NO:8)、 AUUUGCAGUCAUGGAGAACC(SEQ ID NO:9)、CAAGGAGAAAUACGAGAAGU(SEQ ID NO:10)、 ACAAGGAGAAAUACGAGAAG(SEQ ID NO:And ACCUGGAAGACUACUACUGG (SEQ ID NO 11):12).
DNA enzymatic
On the other hand, present invention further contemplates that inhibiting the expression of the c-MAF gene of the present invention using DNA enzymatic.The DNA enzymatic Incorporate some mechanistic features of both antisense technology and ribozyme technology.Design dna enzyme in this wise, thus and antisense oligonucleotides Seemingly, they identify specific target nucleic acid sequence to acids, however similar with ribozyme, they are catalytic and specifically cut target Nucleic acid.
Ribozyme
The ribozyme molecule of the transcript designed for catalysis cutting said target mrna can also be used, to prevent its activity of coding uncommon Hope the translation of the mRNA of repressed c-MAF.Ribozyme is the enzymatic RNA molecules for the specificity cutting that can be catalyzed RNA (about comprehensive It states, referring to Rossi, Current Biology 4:469-471,1994).The mechanism of action of ribozyme involves the sequence of ribozyme molecule With the specific hybrid of complementary target RNA, it is followed by kernel dissolubility cutting event.The composition of ribozyme molecule preferably includes one A or multiple sequences cut with the sequence of said target mrna complementation and well known responsible mRNA or sequence functionally of equal value (ginseng See for example, U.S. Patent number 5093246).
The ribozyme being used in the present invention includes hammerhead ribozyme, and endoribonuclease RNA is (hereafter hereinafter, " ribozyme of Cech types ") (Zaug et al., Science 224:574-578,1984).
Ribozyme can be made of (such as in order to improve stability, targeting etc.) modified oligonucleotides, and should be by It is distributed to the cell for expressing target gene in vivo.One preferred distribution method involves using in the strong of pol III or pol II The DNA constructions of " coding " ribozyme under the control of constitutive promoter, so as to which the cell through transfection generates the ribozyme of sufficient amount For destroying endogenous target courier and inhibiting to translate.Due to different from other antisense molecules, ribozyme is catalytic, therefore for Relatively low intracellular concentration is needed for its effect.
Inhibiting antibody
In the context of the present invention, " inhibiting antibody " refers to all such antibody, can specifically combine c-MAF Albumen and the one or more functions for inhibiting the protein, preferably with transcribing relevant function.It can be by using ability Field technique personnel any known method (some of them have been mentioned above) prepares the antibody.Therefore, by using uncommon Repressed Western Immuno animal is hoped to prepare polyclonal antibody.By using Kohler, Milstein et al. (Nature, 1975,256:495) described method prepares monoclonal antibody.In the context of the present invention, suitable antibody include comprising With reference to the variable region of antigen and the complete antibody of constant region, segment " Fab ", " F (ab ') 2 " and " Fab ' ", Fv, scFv, double-strand resist Body and bispecific antibody.Once the antibody with the ability with reference to c-MAF albumen is identified, just by using identification inhibition The experiment of reagent can inhibit those active of the protein to select.
Inhibitory peptide
As used in this article, term " inhibitory peptide " refers to those such peptides, can combine c-MAF albumen And inhibit its active (according to explained above), that is, prevent c-MAF being capable of activated gene transcription.
The dominant negative variant of c-MAF
It is assumed that the protein of maf families can homodimer and with other members of AP-1 families (such as Fos and Jun) heterodimerisation, then inhibit c-MAF activity a kind of mode be by using dominant negative variant, can be with c- MAF is Dimerized but lacks the ability of activated transcription.Therefore, the dominant negative variant of c-MAF can be such any small Maf albumen, be present in cell and lack the amino terminal comprising transactivation domain 2/3rds (for example, MafK, mafF, mafg and pi 8) (Fujiwara et al., (1993) Oncogene 8,2371-2380；Igarashi et al., (1995)J.Biol.Chem.270,7615-7624；Andrews et al., (1993) Proc.Natl.Acad.Sci.USA 90, 11488-11492；Kataoka et al., (1995) Mol.Cell.Biol.15,2180-2190) (Kataoka et al., (1996) Oncogene 12,53-62)。
Alternatively, the dominant negative variant of c-MAF includes the variant of such c-MAF, keep with other protein into The Dimerized ability of row but the ability for lacking activated transcription.These variants are, for example, to lack positioned at the N- ends of the protein Those of the transactivation domain of c-MAF.Therefore, illustratively, the dominant negative variant of c-MAF includes such change Body, has had been removed at least amino acid 1-122 in the variant, at least amino acid 1-187 or at least amino acid 1-257 (is examined The number of people c-MAF is considered, as described in US6274338).
The present invention consider c-MAF dominant negative variant and encode c-MAF polynucleotides (be suitable for it is thin in target Under the effective control for the promoter expressed in born of the same parents) purposes.It can be used for adjusting the transcription of the polynucleotides of the present invention Promoter can be constitutive promoter (i.e. its transcription for instructing foundation level) or inducible promoter (wherein transcriptional activity Need external signal).Constitutive promoter in particular CMV promoter, SV40 promoters, the DHFR for being suitable for transcriptional regulatory start Son, the promoter (MMTV) of mouse mammary tumor virus, the promoter of extension factor 1 a (EF1a), the promoter of albumin, The promoter of ApoA1, the promoter of keratin, the promoter of CD3, heavy chain immunoglobulin or light chain promoter, neurofilament Promoter, the promoter of neuronspecific enolase, L7 promoters, CD2 promoters, myosin light chain kinase open Mover, the promoter of hox gene, the promoter of thymidine kinase, the promoter of rna plymerase ii, the promoter of MyoD genes, phosphorus The promoter of acid glycerol acid kinase (PGK) gene, promoter, the promoter of actin gene of low-density lipoprotein (LDL). In a preferred embodiment, the promoter for adjusting the expression of trans-activator is the promoter of pgk gene.At one In preferred embodiment, the promoter for adjusting the transcription of the polynucleotides of the present invention is the startup of phage t7 RNA polymerase Son.
Preferably, the inducible promoter that can be used in the context of the present invention is those promoters, in response to luring Agent is led, zero or insignificant basal expression is shown in the absence of derivant, and it can promote to be located at 3 ' positions Gene activation.According to the type of derivant, inducible promoter can be classified as to Tet on/off promoters (Gossen, M. and H.Bujard (1992) Proc.Natl.Acad.Sci.USA, 89:5547-5551；Gossen, M. et al., 1995,Science 268:1766-1769；Rossi, F.M.V. and H.M.Blau, 1998, Curr.Opin.Biotechnol.9:451-456), Pip on/off promoters (US6287813), antiprogestin dependence start Sub (US2004132086), moulting hormone dependence promoter (Christopherson et al., 1992, Proc.Natl.Acad.Sci.USA,89:6314-6318；No et al., 1996, Proc.Natl.Acad.Sci.USA, 93: 3346-3351；Suhr et al., 1998, Proc.Natl.Acad.Sci.USA, 95:7999-8004；And WO9738117), metal Sulfoprotein dependence promoter (WO8604920) and rapamycin dependence promoter (Rivera et al., 1996, Nat.Med.2:1028-32)。
The carrier for being suitable for expressing the polynucleotides for the dominant negative variant for encoding c-MAF is included derived from following carrier Carrier：Prokaryotic expression carrier, for example, pUC18, pUC19, Bluescript and its derivative, mp18, mp19, pBR322, pMB9、ColEl、pCRl、RP4；Bacteriophage and shuttle vector, such as pSA3 and pAT28；Yeast expression carrier, such as 2 μm of plasmids Carrier, integrated plasmid, YEP carriers, centromere plasmid of type etc.；Insect cell expression vector, such as pAC series and pVL systems The carrier of row；Plant expression vector, for example, pIBI, pEarleyGate, pAVA, pCAMBIA, pGSA, pGWB, pMDC, pMY, The carrier of the series such as pORE；With higher eukaryotic cell expression vector, or based on viral vectors (adenovirus, adenovirus Correlated virus and retrovirus, particularly slow virus) or based on non-virus carrier such as pSilencer 4.1-CMV (Ambion)、pcDNA3、pcDNA3.1/hyg、pHCMV/Zeo、pCR3.1、pEFl/His、pIND/GS、pRc/HCMV2、 PSV40/Zeo2, pTRACER-HCMV, pUB6/V5-His, pVAXl, pZeoSV2, pCI, pSVL and pKSV-10, pBPV-1, PML2d and pTDTl.
Other inhibitory compounds of the activity of c-MAF albumen
Other inhibitory compounds for being suitable for the c-MAF being used in the present invention include：
Table 1：Small molecule with the ability for inhibiting c-MAF
The inhibitor of other c-MAF is described in patent application WO2005063252, as shown in following table (table 2) 's.
Table 2：The inhibitor of c-MAF
In a preferred embodiment, it treats using the inhibition reagent of c-MAF and/or prevents Bone tumour. In one more preferred embodiment, the Bone tumour is ostelytic metastases.
In general, by the inhibition reagent of c-MAF and pharmaceutically acceptable " material containing " it is combined be administered.
Term " material containing (vehicle) " refers to use it to the diluent or excipient using active constituent.Such pharmacy carries Material can be sterile liquid, such as water and oil, include oil, animal, plant or synthesis source those, such as peanut oil, big Soya-bean oil, mineral oil, sesame oil etc..Preferably, using water or the aqueous solution of normal saline solution and dextrose and glycerine as Material containing, especially for Injectable solution.Suitable pharmacy material containing description is in " Remington ' s Pharmaceutical In Sciences ", E.W.Martin, 1995.Preferably, material containing of the invention obtains state or the approval of management organization of federal government, Or it is put into United States Pharmacopeia or other of accreditation is commonly available for its use in animal (more particularly, in the mankind) In pharmacopeia.
Other than other factors, for the desirable pharmaceutical administration forms of pharmaceutical composition for preparing the present invention Required material containing and auxiliary substance particularly depend on selected pharmaceutical administration forms.The medicament administration shape of described pharmaceutical composition Formula is prepared according to conventional method well known by persons skilled in the art.Different is used for the method using active constituent, treats The excipient that uses and for produce their process summary can at " Tratado de Farmacia Gal é nica ", It is found in C.Faul í i Trillo, Luz á n 5, S.A., 1993 editions.The example of pharmaceutical composition include it is any for take orally, office The solid composite of portion or parenteral administration (tablet, pill, capsule, granule etc.) or liquid composition (solution, suspension or Lotion).In addition, as needed, pharmaceutical composition can also include stabilizer, suspension, preservative, surfactant etc..
For the use in medicine, the inhibition reagent of c-MAF can be with prodrug, salt, solvate or inclusion polymerization The form of object exists, discretely or combined with other active agent, and can be with that can be connect from the point of view of pharmacy viewpoint The excipient received is prepared together.Preferred excipient includes carbohydrate, starch, fiber for use in the present invention Element, natural gum and protein.In a special embodiment, the pharmaceutical composition of the present invention is configured to solid drugs application Form (such as tablet, capsule, dragee, granule, suppository, can be reconfigured with provide the crystal of liquid form or Unbodied sterile solid, etc.), liquid medicine administration form (such as solution, suspension, lotion, elixir, lotion, ointment Agent, etc.) or semi-solid medicament administration form (gelling agent, ointment, creme, etc.).The pharmaceutical composition of the present invention can lead to Any approach is crossed to be administered, including but not limited to oral, intravenous, intramuscular, intra-arterial, marrow are interior, intrathecal, intra-ventricle, it is percutaneous, Subcutaneously, peritonaeum is interior, intranasal, intestines, local, sublingual or anal route.Different active constituent administration forms, excipient to be used With the summary of its preparation process can in Tratado de Farmacia Gal é nica, C.Faul í i Trillo, Luz á n 5, S.A., in 1993 editions and Remington ' s Pharmaceutical Sciences (A.R.Gennaro, editor), the 20th Edition, it is found in Williams＆Wilkins PA, USA (2000).The example of pharmaceutically acceptable material containing is in the prior art Know, and including phosphate buffered saline, water, lotion, such as oil/water lotion, different types of wetting agent, sterile solution etc.. Composition comprising the material containing can be prepared by conventional method well known in the prior art.
In administration of nucleic acid, (dominant of siRNA, the polynucleotides for encoding siRNA or shRNA or coding c-MAF become The polynucleotides of body) in the case of, the present invention is thought of as the pharmaceutical composition that the application of the nucleic acid is especially prepared.These drugs Composition can be included with the nucleic acid of naked form, i.e., degrading there is no protection nucleic acid from its nuclease by body Compound in the case of, this results in it is such the advantages of：It eliminates and the relevant toxicity of reagent for transfection.It is suitable for naked The administration method for revealing compound includes in intravascular, tumour, in encephalic, peritonaeum, spleen is interior, under intramuscular, retina, subcutaneously, mucous membrane, Part and oral route (Templeton, 2002, DNA Cell Biol., 21:857-867).Alternatively, the nucleic acid can be with It is administered by following manner：As a part for liposome, the liposome, which is conjugated to cholesterol or is conjugated to, to be promoted Into the compound for being transported through cell membrane, such as Tat peptides, the Drosophila melanogaster of the TAT protein derived from HIV-1 (D.melanogaster) the third spiral of the homeodomain of Antennapedia, VP22 albumen, the arginine of herpes simplex virus Oligomer and such as described in WO07069090 the peptide of those (Lindgren, A. et al., 2000, Trends Pharmacol.Sci,21:99-103；Schwarze, S.R. et al., 2000, Trends Pharmacol.Sci., 21:45- 48；Lundberg, M et al., 2003, Mol Therapy 8:143-150；And Snyder, E.L. and Dowdy, S.F., 2004, Pharm.Res.21:389-393).Alternatively, the polynucleotides can be administered by following manner：It is carried as plasmid A part for body or viral vectors is based preferably on adenovirus, adeno-associated virus or retrovirus [such as based on murine leukemia Viral (MLV) or the virus of slow virus (HIV, FIV, EIAV)] carrier.
The inhibition reagent of c-MAF can be preferably few to be less than 10mg/ kg body weights comprising its pharmaceutical composition In 5,2,1,0.5,0.1,0.05,0.01,0.005,0.001,0.0005,0.0001,0.00005 or 0.00001mg/kg bodies The dosage of weight is administered.Single dosage can be administered by injecting, by sucking or by local application.
Dosage depends on seriousness and the response of symptom to be treated, and can be between some months or straight at several days It is changed to observing that symptom mitigates.Optimum amount can by carry out in patient's body reagent concentration periodic measurement come It determines.Optimal dose can be from by the way that pre-trial determines the EC50 values that obtain (in animal model) in vitro or in vivo. Single dosage can be less than and once be administered once a day or daily less than once for preferably every 2,4,8 or 30 days. Alternatively, it is possible to, using initial dose, then using one or several maintenance doses, usually have than initial dose Few amount.Concept of Maintenance can involve the dosage that is changed in following ranges to treat patient：0.01 μ g are to 1.4mg/kg bodies Weight/day, such as 10,1,0.1,0.01,0.001 or 0.00001mg/kg body weight/days.Preferably, maintenance dose at most every 5,10 Or application in 30 days is primary.Treatment should continue for some time, disorderly type that this time will be subjected to according to patient, its Seriousness and the state of patient and change.After the treatment, the variation of patient should be monitored to determine to control for described in disease Whether treat in the case of no response incremental dose or if it is observed that the improvement of disease or if it is observed that should be not intended to Side effect, then reduce dosage.
Bone degradation is treated or prevented in the patient for showing horizontal, with Bone tumour the breast cancer of high c-MAF
For the author of the present invention it has been proved that in the Bone tumour of tumor of breast, the level of c-MAF reveals raising.Similarly, The author of the present invention with high it has been shown that causing the ability of Bone tumour and being overexpressed swelling derived from primary mammary gland for c-MAF The conditioned medium of the cell line of knurl can induce osteoclast formation with the degree bigger than the cell for not being overexpressed c-MAF.Cause This, those patients for high c-MAF levels wherein occur with the breast cancer for being transferred to bone and in the transfer can With the therapy for particularly having benefited from being intended to avoid the bone as caused by increased osteoclast activity to degrade.
Therefore, on the other hand, the present invention relates to for avoiding or prevent reagent that bone degrades in medicine preparation Purposes, the drug are used to preventing and/or treating Bone tumour in subject, and the subject is with breast cancer and is shifting Property neoplasmic tissue sample in have the high c-MAF for control sample horizontal.
Alternatively, the present invention relates to the reagent for avoiding or preventing bone from from degrading, be used in subject prevention and/or Treat Bone tumour, the subject with breast cancer and in metastatic tumo(u)r tissue sample have relative to control sample and Say that high c-MAF is horizontal.
Alternatively, the present invention relates to the method prevented in subject and/or treat bone degradation, the subject is with breast Gland cancer and have that the high c-MAF for control sample is horizontal, and this method includes in metastatic tumo(u)r tissue sample The reagent for avoiding or preventing bone from from degrading is applied to the subject.
In a special embodiment, the Bone tumour is ostelytic metastases.In another special embodiment In, the breast cancer is ER+ or ER- breast cancer.
About the present invention first method be described in detail term and statement " subject ", " ER+ breast cancer ", " neoplasmic tissue sample ", " transfer ", " c-MAF gene ", " increased or raised expression " and " control sample ", and it Be similarly applied to for avoid or prevent bone degrade reagent.
Be suitable for described therapy in the present invention can avoid or prevent the reagent that bone is degraded a It is described in detail in front under the background of property amic therapy method method.
Reference sample or control sample are with the tumor group of the subject of ER+ or ER- breast cancer not shifted also Tissue samples or its correspond in the biopsy samples of the subject of ER+ breast cancer not shifted also The average value of the expression of measured c-MAF gene in tumor tissues set.
First method about the present invention be described in detail for measure or quantitative c-MAF horizontally relative to right Whether occurs raised method for product in the same old way, and they are similarly applied to the reagent for avoiding or preventing bone from from degrading.
It is alternatively possible to carry out combination therapy, it is used to avoid or prevent bone from degrading wherein will be more than that one kind is above mentioned Reagent be combined to treat and/or prevent transfer or can be by the reagent and other supplements (such as calcium or vitamin D it) or with certain hormones is combined.
In general, by for avoiding or preventing the reagent that bone is degraded and pharmaceutically acceptable material containing combined applying With.Have been described above about c-MAF inhibition reagent and can be in the form of it be administered and dosage defines term " material containing " and the type of material containing, and they are similarly applied to the reagent for avoiding or preventing bone from from degrading.
The following examples are not intended to limit its range for illustrating the present invention.
Embodiment
I. material and method
The experimental model of research
Developed new experimental model for study transfer in ER+ breast cancer.It is known as this purpose, having used People's ER+ breast cancer cell lines of MCF7 steadily transfect its carrier with permission GFP/ luciferase expressions.Pass through through The cell line is seeded in immunodeficient mouse (Balb-c/ nude mices) by intraventricular route or injected in tail vein, So as to select the cell of ability for having and being shifted to Different Organs.The mouse carries subcutaneous estrogen implantation material, Ensure the presence in the entire during the experiment hormone.
The selection of metastatic group
The metastatic group in different tissues is selected by being identified and isolated from the cell of transfer damage.For this purpose, make With biodiversity resources technology, utilizing allows to detect the foundation and growth of the tumour cell in purpose organ at different time And the technology of the number of quantitative existing tumour cell.In order to apply the technology, these cells have been transformed into expression fluorescent Thus plain enzyme and GFP genes simultaneously allow to track it in vivo in real time with noninvasive method.Luminescent image (luciferin Enzymatic activity) capture carried out with the animal under narcosis, wherein using Xenogen IVIS types equipment and For Livingimage softwares as preferred method, this is attributed to its sensitivity and speed.In order to detach metastatic cell, cut Neoplastic lesion and then by fluorescence (GFP) laser scanning Cytometry technology by metastatic cell and host organisms from The cell of body separates.Once isolating these cells, the process is just repeated to be enriched with it for the tropism by different tissues. By these processes, the different metastatic groups with tissue specificity is isolated, including Bone tumour.
Once identifying and isolating metastatic group, efficient transcription analysis is just carried out.In short, the strategy makes it possible to reflect It makes it and transcribes increased gene and the mediator as the transfer process in the cancer cell of the prognosis with difference work one A little genes.Confirm its gene for changing of expression by selection course in unbiased body to take part in as for metastatic cell Colonization in specific tissue and organ.
Identify the group of gene being enriched in the Bone tumour in ER+ breast cancer
By comparing the highly and poorly gene expression profile of metastatic cell subsets, one group of its overexpression is identified Or the relevant gene of bone resorption phenotype of inhibition and Bone tumour.It is different from those (synthesis) of osteoblastic, osteolytic Bone tumour It is related to clinically more aggressive Bone tumour breast cancer form to damage (degradation).By using the method for standardization, It obtains and the relevant express spectra of cell line with high Bone tumour ability.It is analyzed by unbiased, about its bone aggressiveness table Type and its express spectra, the different Bone tumour derivatives from ER+ mammary glandular cells are classified.In both of these case Under, metastatic derived cell system, BoM1 and BoM2 are all shown with the displacement behavior different from initiator cell (MCF7), both In gene expression profile level also in phenotype (Figure 1A).
The group of gene being enriched with about the Bone tumour in ER+ breast cancer includes cell factor, cell adhesion molecule, film Protease, the mediator of signal transduction and transcription factor.
Then, make as that group of gene for adjusting the candidate of the ability of Bone tumour in ER+ breast cancer and being selected Undergo the clinical verification in people.For this purpose, by the change of the expression of candidate gene with going out in the gene expression profile of two groups Existing change is compared, one in described two groups be mammary gland primary tumo(u)r and another be transfer, respectively include 560 tumors of breast and 58 transfers.
It identifies those genes being enriched in the Bone tumour in ER+ breast cancer, is in the Bone tumour in ER- breast cancer It is relevant
Then effect of the gene being enriched in the Bone tumour in ER+ breast cancer in ER- hypotypes is evaluated.About in ER+ Bone tumour in breast cancer and the group of gene that is enriched with includes transcription factor c-MAF.
Bioinformatics and calculation biology
In order to obtain the group for the gene being enriched in transfer and confirm its clinical correlation, used R and Bioconductor statistics software packets.Input function special for data processing and structure, and it comes from and passes through The public visit of www.bioconductor.org accesses.
Embodiment 1
The selection of related gene
It is poor in the cell derived from the ER+ breast cancer cell lines with the tendency for forming Bone tumour to select to be analyzed The gene (Figure 1A) of different expression.The analysis carried out makes it possible to identify 91 derived from the ability to Bone tumour Gene (Figure 1B) be enriched in the cell line of MCF7ER+ cell lines or silence.Conclusive gene and work(are selected alone It can be to be studied in more detail according to following standards：
I) with the clinical correlation of aggressiveness ER+ breast cancer and Bone tumour,
Ii) function of the previously known participation process compatible with aggressive phenotype is (for example, bone reabsorption, inflammation, blood vessel hair It is raw),
Iii) for parent between metastatic group expression variation, as described earlier and
Iv) central role in gene regulatory network and cell signaling pathway.
Based on these standards, transcription factor c-MAF is identified, and how the variation for having checked its expression is predicted Bone relapse in ER+ breast cancer primary tumo(u)rs.
Embodiment 2
The therapeutic value and prognostic value of gene being enriched with about the Bone tumour independent of breast cancer hypotype
By the base by developing here for selecting the experimental system of metastatic cell group to be enriched in Bone tumour Because being evaluated for two different databases, the database includes 560 breast cancer primary tumo(u)rs and 58 breast cancer The express spectra and clinography of patient's transfer.These tumours are the representatives of all breast cancer hypotypes and transfer positioning.The two numbers All it is that the public is addressable (GSE 2603,2034,12276 and 14020) according to library and its clinography.
In ER+ primary tumo(u)rs the gene expression of Bone tumour gene with recurrence, without the transfer survival rate and notable phase of survival rate It closes (Fig. 1 C and D).
On the other hand, the c-MAF gene in metastatic tissue is had rated in the group of 58 patient with breast cancer's transfers Expression (GSE 14020).These transfers are isolated from lung, liver, bone and brain.Confirm c-MAF gene specifically in Bone tumour Middle enrichment, the breast cancer hypotype belonging independent of tumour or transfer damage, ER+ or ER- (Fig. 2A).
Embodiment 3
The in vivo functionality verification of Bone tumour gene c-MAF in ER- breast cancer
By Metastasis in Breast Cancer transplantation experiments mould of the result for positive metastatic gene c-MAF in mouse in the analysis It settles down in experiment in Bone tumour among type and is functionally verified.ER- breast cancer with the high ability grown in bone The selection of cell is accompanied (Fig. 2 B) with the high-caliber selection of metastatic gene c-MAF.
In order to verify that the method that the candidate gene instructs transfer process and carries out is tested for function.For this purpose, make C-MAF gene is expressed in parental cell MDA-MB-231, and is then evaluated its induction and contributed to the gene (CTGF) of transfer The ability (Fig. 2 C) of expression.
Embodiment 4
The in vivo functionality verification of tissue specificity metastatic gene
By Metastasis in Breast Cancer transplantation experiments mould of the result for positive metastatic gene c-MAF in mouse in the analysis It settles down in experiment in Bone tumour among type and is functionally verified.
In order to verify that the method that the candidate gene instructs transfer process and carries out is tested for afunction or function.For This purpose makes c-MAF gene in parental cell or expresses or sink in the metastatic derived cell of height for bone It is silent, and then its Bone tumour ability is evaluated in vivo.
Function is tested
In order to express c-MAF gene, using slow virus system come induce the candidate gene in parental tumor cell and With the heterogenous expression in those cells gone out selected by low transfer ability.Turned by being seeded in mouse through intracardiac approach Move property cell bioluminescence tracking technology come measure c-MAF gene induction transfer ability (such as in " the experiment mould of research Described in type " part).In all cases, parallelly injection is not in the parallel animal group as negative control Express the corresponding control cell (Fig. 3 B) of the slow virus carrier infection of c-MAF albumen.
Afunction is tested
Height Bone tumour and with high endogenous c-MAF gene expression BoM2 cell lines in inhibit c- The expression (Fig. 3 A and 3C) of MAF genes.For this purpose, using the slow virus carrier for allowing expression RNA interfering (siRNA), it is described RNA interfering have make c-MAF gene expression reduced for the level present in BoM2 cell lines 80% ability. The cell colony expressed with the c-MAF gene through silence is inoculated with by intracardiac approach (such as in " experimental model of research " portion Described in point) in immunosuppressed mice, wherein monitoring these animals to turn by biodiversity resources technology to detect Move activity.In these experiments, using infected by using slow virus carrier and from the cell that BoM2 cell lines obtain as Negative control, the slow virus carrier coding are effective against the siRNA of the expression of other genes unrelated with transfer process.
Embodiment 5
Osteoclast differentiation experiment
The primary cell from mouse bone marrow cells is separated, and it is made to exist in M-CSF (macrophage colony stimulating factor) Lower culture growth.After 3 days, cell is made to carry out trypsin digestion, and is seeded in (1.5 × 10 in 24- hole plates4A cell/ Hole), each experiment condition is repeated three times.In order to induce the differentiation of osteoclast, deposited in RANK ligands and M-CSF Under, with from the MCF7ER+ breast cancer cells (mistake of its " short " and " length " isotype with and without c-MAF gene Expression) conditioned medium culture these precursors.Culture medium is replaced every three days, at the 7th day, carries out the specificity of osteoclast Dyeing, the acid phosphatase (TRAP) including detecting resistance to tartaric acid.Image is observed by reversing beam optical microscope.It surveys Determine the number of TRAP positive cells, and divided by cell in each visual field total number.Finally, by all values control group (MCF7) value is standardized.As can be observed in Figure 4, when the precursor for making osteoclast is overexpressed c- with coming from When the culture medium of the MCF7ER+ breast cancer cells of the short isotype of MAF or the isotype of length is in contact, the number of osteoclast Increase.
The experiment makes it possible to measure metastatic cell with representing the phase interaction of the transfer environment of bone or the component of microhabitat With.Osteoclast is responsible for the degradation of bone, and is apparent in ostelytic metastases damage.
Embodiment 6
The identification of chromosome amplification in region chr16q22-q24 (including c-MAF gene)
By expression pattern analysis come detect copy number change (CNA) be possible in theory because genome change Between the unconventionality expression of gene in impacted genome area there are strong correlation (Pollack et al., 2002, PNAS,99:12963-12968).Specifically, it is possible accurately to detect CNA using gene expression analysis, and it is tired Difficulty from starting expression data type (Hu et al., 2009Cancer Cell, 15:9-20).
The effect for the gene being enriched in the Bone tumour in ER+ breast cancer is had rated.For this purpose, analyze derived from The change of genome copy numbers in the cell BoM2 of the height Bone tumour of MCF7 breast cancer cell lines, the BoM2 is in researcher It is generated in itself laboratory and characterized by high-caliber c-MAF gene is expressed.The analysis is based on parental cell with being derived from The comparison of the gene expression profile of the BoM2 of MCF7.It, will in terms of its position present in people's cell in 23 kinds of chromosome types The gene expression difference observed in BoM2 cells for parental cell is aligned and has been positioned.
In this way, the genome area (Fig. 5) of gene as wherein occurring, the expression of the gene are identified Mistake or low presentation for parental cell in BoM2 cells, this is the amplification of genomic DNA or instruction (Hu etc. of missing People, 2009, Cancer Cell, 15:9-20).For this purpose, use " Partek Genomic Suite 6.5 " software.The software is permitted Perhaps we identify those genes that its expression increases or decreases in BoM2 cells for parental cell.Once identification These genes, the corresponding chromosome mapping that just gene will be depicted in for the differential expression observed by each gene In.The graphic representation of these observation results makes it possible to identify the growth or loss of chromosomal region, based on continuous dye Increased or reduction the continuous expression (Fig. 5) of the gene of colour solid positioning.By using well-known and described above Chromosomal region band (cytoband), author of the invention have been able to position these regions.
It among the region of differential amplification, is observed in BoM2 cells for MCF7ER+ breast cancer parental cells To the growth in chromosomal region 16q22-q24 (it includes the locus for encoding c-MAF gene).
And then, it has rated in patient with breast cancer, in breast tumors between the change and transfer of gene copy number Relationship.In this way, it has been identified that there is the chromosomal region with the relevant gene of transfer in patient of great number Domain, the gene are identified by using " Cox log risk-ratios (HR) " model.The concept in ACE is followed by (in expression number The analysis changed according to middle copy number) (Hu et al., 2009, according to above-cited), have by being located in copy number aspect The potential region of variation.The function of R software packages " phenoTest " is used.Therefore, by selecting to join via cross validation Number, " the log HR " about each gene is obtained, and by being arranged in whole gene group via the conclusion of additive model Row " log HR " (1000 kinds arrangement) and P- values are adjusted to control false positive rate (FDR) extremely via Benjamini-Hochberg 0.05 level evaluates significance,statistical.Only identify the region (Fig. 5 B) with minimum 15 continuous significantly genes. There are the region 16q12-q24 including c-MAF gene among these regions.
Then, it carries out being characterized in parent's MCF7 cells and with high shape by fluorescence in situ hybridization (FISH) The copy number of c-MAF gene in the BoM2 cell lines being characterized into the tendency of the transfer to bone tissue.As the control of the experiment, The copy number of IGH genes is measured simultaneously.The results show that most of studied MCF7 cells have the c- equal to or less than 1.5 The ratio between the copy number of MAF genes and the copy number of IGF genes, i.e. the copy number of the two genes is similar (Fig. 6), however big The BoM2 cells that part is studied show the ratio between the copy number of the c-MAF gene more than 2 and the copy number of IGF genes (Fig. 6). These are the results show that the increase as the copy number of the acquisition and c-MAF gene of Bone tumour phenotype for breast cancer cell is accompanied With.
Conclusion
C-MAF is the marker for diagnosing with prognosis, and is in the transfer process in breast cancer, particularly in ER The reason of property target gene in the Bone tumour of+breast cancer.The conclusion obtains clinical verification data and function obtains and afunction Experiment (it forms the part of the present invention) is supported.
It (is wherein proved, the expression of c-MAF is predictive of height in primary tumo(u)r in view of result given in the present invention In patient with breast cancer by the risk of Bone tumour), tumour include have in genome area chr16q22-q24 The patient of the cell of amplification or the amplification of c-MAF gene is also easy to by high Bone tumour risk.Therefore, c-MAF gene or seat Position 16q22-q24 amplification the diagnostic method for being determined as the Bone tumour since breast cancer primary tumo(u)r and Forecasting Methodology be Useful.
Similarly, experiment of the invention (embodiment 4 and 5) imply, c-MAF be suitable for treating and/or prevent shift (from It is that ER+ tumours start and since ER- tumours) target.Therefore, the inhibitor of c-MAF for breast cancer by Treatment transfer will be useful in examination person.
Some embodiments of the present invention are as follows：
1. for being diagnosed and/or transfer for ER+ breast cancer in the subject with ER+ breast cancer Subject in formed transfer tendency carry out prognosis in-vitro method, including：
(i) the quantitative expression of c-MAF gene in the neoplasmic tissue sample of the subject and
(ii) expression of the expression that front is obtained and the gene in the control sample is compared,
Wherein if the expression of the gene increases for the expression of the gene in the control sample Add, then the subject has the tendency of the formation transfer of the positive diagnosis or bigger about transfer.
2. for designing the in-vitro method of the novel personalized therapy of subject for suffering from ER+ breast cancer, including：
(i) the quantitative expression of c-MAF gene in the neoplasmic tissue sample of the subject and
(ii) expression of the expression that front is obtained and the gene in the control sample is compared,
Wherein if the expression increases for the expression of the gene in the control sample, then The subject can receive to be intended to prevent and/or treat the therapy of transfer.
3. according to the method for embodiment 1 or 2, wherein the transfer is Bone tumour.
4. according to the method for embodiment 3, wherein the Bone tumour is ostelytic metastases.
5. for designing the in-vitro method of the novel personalized therapy of subject for suffering from the breast cancer with Bone tumour, Including：
(i) the quantitative expression of c-MAF gene in the metastatic bone tumor tissue sample of the subject and
(ii) it will be carried out in the expression of the expression obtained in step (i) and the gene in the control sample Compare,
Wherein if the expression of c-MAF gene increases for the expression of the gene in the control sample Add, then the subject can receive the therapy for being intended to prevent bone from degrading.
6. according to the method for embodiment 5, wherein the reagent for preventing bone from degrading is selected from the suppression of bisphosphonates, RANKL Preparation, PTH or PRG analogs, Strontium Ranelate, the conditioning agent of estrogen receptor, calcitonin and cathepsin K inhibitor.
7. according to the method for embodiment 6, wherein the inhibitor of the RANKL is selected from the specific antibody and shield of RANKL Bone protein.
8. according to the method for embodiment 7, wherein the specific antibody of the RANKL is ground Shu Dankang.
9. according to the method for embodiment 6, wherein the bisphosphonates are zoledronic acid.
10. according to the method for any one of embodiment 5 to 9, wherein the breast cancer is ER+ or ER-.
11. according to the method for any one of embodiment 1 to 10, wherein the expression of the c-MAF gene quantifies The segment of mRNA (mRNA) or the mRNA including the gene, the complementary DNA (cDNA) or described of the gene The segment of cDNA quantifies.
12. according to the method for embodiment 11, wherein quantifying for the expression passes through quantitative polyase chain reaction (PCR) or DNA or RNA arrays carry out.
13. according to the method for any one of embodiment 1 to 10, wherein the expression of the c-MAF gene quantifies It is quantified including the protein by the gene code or the horizontal of its variant.
14. according to the method for embodiment 13, wherein the protein it is horizontal quantitatively by western blot, ELISA or protein array carry out.
15. in the subject with breast cancer to transfer diagnosed and/or for breast cancer by The in-vitro method of prognosis is carried out in examination person to the tendency for forming transfer, including determining the neoplasmic tissue sample in the subject Whether middle c-MAF gene expands, wherein the amplification if there is the gene, then the subject has about transfer Positive diagnosis or bigger formation transfer tendency.
16. according to the method for embodiment 15, wherein the breast cancer is ER+ or ER-.
17. according to the method for embodiment 15 or 16, wherein the determining of the amplification of the c-MAF gene passes through seat The determining of the amplification of 16q22-q24 carries out.
18. according to the method for embodiment 15 or 16, wherein the amplification of the c-MAF gene is determined by using special It is carried out in the probe of c-MAF gene.
19. according to the method for any one of embodiment 15 to 18, wherein the control sample is to be not subject to transfer The breast tumor tissue sample of subject.
20. according to the method for any one of embodiment 15 to 19, wherein the amplification by situ hybridization or PCR come into Row determines.
21. according to the method for any one of embodiment 15 to 20, wherein the transfer is Bone tumour.
22. according to the method for embodiment 21, wherein the Bone tumour is ostelytic metastases.
The purposes of the inhibition reagent of 23.c-MAF in medicine preparation, the drug are used to treat and/or prevent mammary gland The Bone tumour of cancer.
24. according to the purposes of embodiment 23, wherein the breast cancer is ER+ or ER-.
25. according to the purposes of embodiment 23 or 24, wherein the inhibition reagent of the c-MAF, which is selected from, is specific to c-MAF SiRNA, the antisense oligonucleotides for being specific to c-MAF, the ribozyme, the inhibiting antibody of c-MAF, the c-MAF that are specific to c-MAF Dominant negative variant and the compound of table 1 or table 2.
26. the purposes of the reagent of bone degradation in medicine preparation can be avoided or be prevented, the drug is used in subject Middle treatment Bone tumour, the subject have with breast cancer and in metastatic tumo(u)r tissue sample relative to control sample For high c-MAF it is horizontal.
27. according to the purposes of embodiment 26, wherein the reagent that can avoid or prevent bone from from degrading is selected from di 2 ethylhexyl phosphonic acid Class, the inhibitor of RANKL, PTH or PRG analogs, Strontium Ranelate, the conditioning agent of estrogen receptor, calcitonin and histone The inhibitor of enzyme K.
28. according to the purposes of embodiment 27, wherein the inhibitor of the RANKL be selected from RANKL specific antibody and Bone protector protein.
29. according to the purposes of embodiment 28, wherein the specific antibody of the RANKL is ground Shu Dankang.
30. according to the purposes of embodiment 27, wherein the bisphosphonates are zoledronic acid.
31. according to the purposes of any one of embodiment 26 to 30, wherein the breast cancer is ER+ or ER-.
32. according to the purposes of any one of embodiment 26 to 31, wherein the Bone tumour is ostelytic metastases.
Sequence table
<110>Biomedical research mechanism private foundation
Catalonia advanced studies and learning organization private foundation
<120>For the method for the diagnosis of Metastasis in Breast Cancer, prognosis and treatment
<130> P6136ES01
<141> 2011-10-05
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 6878
<212> DNA
<213>Homo sapiens（Homo sapiens）
<400> 1
agaggcttta aaatcttttt tcatcttcta gctgtagctc gggctgcttg tcggcttggc 60
ctccccctcc cccctttgct ctctgcctcg tctttcccca ggacttcgct attttgcttt 120
tttaaaaaaa ggcaagaaag aactaaactc ccccctccct ctcctccagt cgggctgcac 180
ctctgccttg cactttgcac agaggtagag agcgcgcgag ggagagagag gaaagaaaaa 240
aaataataaa gagagccaag cagaagagga ggcgagaagc atgaagtgtt aactcccccg 300
tgccaaggcc cgcgccgccc ggacagacgc ccgccgcgcc tccagccccg agcggacgcc 360
gcgcgcgccc tgcctgcagc ccgggccggc gaggcgagcc cttccttatg caaagcgcgc 420
agcggagcgg cgagcggggg acgccgcgca ccgggccggg ctcctccagc ttcgccgccg 480
cagccaccac cgccgccacc gcagctcgcg gaggatcttc ccgagcctga agccgccggc 540
tcggcgcgca aggaggcgag cgagcaagga ggggccgggg cgagcgaggg agcacattgg 600
cgtgagcagg ggggagggag ggcgggcgcg gggggcgcgg gcagggcggg ggggtgtgtg 660
tgtgagcgcg ctcggaggtt tcgggccagc caccgccgcg caagctagaa gcgccccagc 720
ccggcaagct ggctcacccg ctggccaccc agcacagccc gctggcccct ctcctgcagc 780
ccatctggcg gagcggcggc ggcggcggcg gcggcggcag gagaatggca tcagaactgg 840
caatgagcaa ctccgacctg cccaccagtc ccctggccat ggaatatgtt aatgacttcg 900
atctgatgaa gtttgaagtg aaaaaggaac cggtggagac cgaccgcatc atcagccagt 960
gcggccgtct catcgccggg ggctcgctgt cctccacccc catgagcacg ccgtgcagct 1020
cggtgccccc ttcccccagc ttctcggcgc ccagcccggg ctcgggcagc gagcagaagg 1080
cgcacctgga agactactac tggatgaccg gctacccgca gcagctgaac cccgaggcgc 1140
tgggcttcag ccccgaggac gcggtcgagg cgctcatcag caacagccac cagctccagg 1200
gcggcttcga tggctacgcg cgcggggcgc agcagctggc cgcggcggcc ggggccggtg 1260
ccggcgcctc cttgggcggc agcggcgagg agatgggccc cgccgccgcc gtggtgtccg 1320
ccgtgatcgc cgcggccgcc gcgcagagcg gcgcgggccc gcactaccac caccaccacc 1380
accacgccgc cggccaccac caccacccga cggccggcgc gcccggcgcc gcgggcagcg 1440
cggccgcctc ggccggtggc gctgggggcg cgggcggcgg tggcccggcc agcgctgggg 1500
gcggcggcgg cggcggcggc ggcggaggcg gcgggggcgc ggcgggggcg gggggcgccc 1560
tgcacccgca ccacgccgcc ggcggcctgc acttcgacga ccgcttctcc gacgagcagc 1620
tggtgaccat gtctgtgcgc gagctgaacc ggcagctgcg cggggtcagc aaggaggagg 1680
tgatccggct gaagcagaag aggcggaccc tgaaaaaccg cggctatgcc cagtcctgcc 1740
gcttcaagag ggtgcagcag agacacgtcc tggagtcgga gaagaaccag ctgctgcagc 1800
aagtcgacca cctcaagcag gagatctcca ggctggtgcg cgagagggac gcgtacaagg 1860
agaaatacga gaagttggtg agcagcggct tccgagaaaa cggctcgagc agcgacaacc 1920
cgtcctctcc cgagtttttc atgtgagtct gacacgcgat tccagctagc caccctgata 1980
agtgctccgc gggggtccgg ctcgggtgtg ggcttgctag ttctagagcc atgctcgcca 2040
ccacctcacc acccccaccc ccaccgagtt tggccccctt ggccccctac acacacacaa 2100
acccgcacgc acacaccaca cacacacaca cacacacaca cacaccccac accctgctcg 2160
agtttgtggt ggtggtggct gttttaaact ggggagggaa tgggtgtctg gctcatggat 2220
tgccaatctg aaattctcca taacttgcta gcttgttttt tttttttttt tacacccccc 2280
cgccccaccc ccggacttgc acaatgttca atgatctcag cagagttctt catgtgaaac 2340
gttgatcacc tttgaagcct gcatcattca catatttttt cttcttcttc cccttcagtt 2400
catgaactgg tgttcatttt ctgtgtgtgt gtgtgtttta ttttgtttgg attttttttt 2460
ttaattttac ttttagagct tgctgtgttg cccacctttt ttccaacctc caccctcact 2520
ccttctcaac ccatctcttc cgagatgaaa gaaaaaaaaa agcaaagttt ttttttcttc 2580
tcctgagttc ttcatgtgag attgagcttg caaaggaaaa aaaaatgtga aatgttatag 2640
acttgcagcg tgccgagttc catcgggttt tttttttagc attgttatgc taaaatagag 2700
aaaaaaatcc tcatgaacct tccacaatca agcctgcatc aaccttctgg gtgtgacttg 2760
tgagttttgg ccttgtgatg ccaaatctga gagtttagtc tgccattaaa aaaactcatt 2820
ctcatctcat gcattattat gcttgctact ttgtcttagc aacaatgaac tataactgtt 2880
tcaaagactt tatggaaaag agacattata ttaataaaaa aaaaaagcct gcatgctgga 2940
catgtatggt ataattattt tttccttttt ttttcctttt ggcttggaaa tggacgttcg 3000
aagacttata gcatggcatt catacttttg ttttattgcc tcatgacttt tttgagttta 3060
gaacaaaaca gtgcaaccgt agagccttct tcccatgaaa ttttgcatct gctccaaaac 3120
tgctttgagt tactcagaac ttcaacctcc caatgcactg aaggcattcc ttgtcaaaga 3180
taccagaatg ggttacacat ttaacctggc aaacattgaa gaactcttaa tgttttcttt 3240
ttaataagaa tgacgcccca ctttggggac taaaattgtg ctattgccga gaagcagtct 3300
aaaatttatt ttttaaaaag agaaactgcc ccattatttt tggtttgttt tatttttatt 3360
ttatattttt tggcttttgg tcattgtcaa atgtggaatg ctctgggttt ctagtatata 3420
atttaattct agtttttata atctgttagc ccagttaaaa tgtatgctac agataaagga 3480
atgttataga taaatttgaa agagttaggt ctgtttagct gtagattttt taaacgattg 3540
atgcactaaa ttgtttacta ttgtgatgtt aaggggggta gagtttgcaa ggggactgtt 3600
taaaaaaagt agcttataca gcatgtgctt gcaacttaaa tataagttgg gtatgtgtag 3660
tctttgctat accactgact gtattgaaaa ccaaagtatt aagaggggaa acgcccctgt 3720
ttatatctgt aggggtattt tacattcaaa aatgtatgtt tttttttctt ttcaaaatta 3780
aagtatttgg gactgaattg cactaagata taacctgcaa gcatataata caaaaaaaaa 3840
ttgcaaaact gtttagaacg ctaataaaat ttatgcagtt ataaaaatgg cattactgca 3900
cagttttaag atgatgcaga tttttttaca gttgtattgt ggtgcagaac tggattttct 3960
gtaacttaaa aaaaaatcca cagttttaaa ggcaataatc agtaaatgtt attttcaggg 4020
actgacatcc tgtctttaaa aagaaatgaa aagtaaatct taccacaata aatataaaaa 4080
aatcttgtca gttacttttc ttttacatat tttgctgtgc aaaattgttt tatatcttga 4140
gttactaact aaccacgcgt gttgttccta tgtgcttttc tttcattttc aattctggtt 4200
atatcaagaa aagaataatc tacaataata aacggcattt ttttttgatt ctgtactcag 4260
tttcttagtg tacagtttaa ctgggcccaa caacctcgtt aaaagtgtaa aatgcatcct 4320
tttctccagt ggaaggattc ctggaggaat agggagacag taattcaggg tgaaattata 4380
ggctgttttt tgaagtgagg aggctggccc catatactga ttagcaatat ttaatataga 4440
tgtaaattat gacctcattt ttttctcccc aaagttttca gttttcaaat gagttgagcc 4500
ataattgccc ttggtaggaa aaacaaaaca aaacagtgga actaggcttc ctgagcatgg 4560
ccctacactt ctgatcagga gcaaagccat ccatagacag aggagccgga caaatatggc 4620
gcatcagagg tggcttgcgc acatatgcat tgaacggtaa agagaaacag cgcttgcctt 4680
ttcactaaag ttgactattt ttccttcttc tcttacacac cgagattttc ttgttagcaa 4740
ggcctgacaa gatttaacat aaacatgaca aatcatagtt gtttgttttg ttttgctttt 4800
ctctttaaca ctgaagatca tttgtcttaa ataggaaaaa gaaaatccac tccttacttc 4860
catatttcca agtacatatc tggtttaaac tatgttatca aatcatattt caccgtgaat 4920
attcagtgga gaacttctct acctggatga gctagtaatg atttcagatc atgctatccc 4980
cagaaataaa agcaaaaaat aatacctgtg tggaatatag gctgtgcttt gatttactgg 5040
tatttacccc aaaataggct gtgtatgggg gctgacttaa agatcccttg gaaagactca 5100
aaactacctt cactagtagg actcctaagc gctgacctat ttttaaatga cacaaattca 5160
tgaaactaat gttacaaatt catgcagttt gcactcttag tcatcttccc ctagcacacc 5220
aatagaatgt tagacaaagc cagcactgtt ttgaaaatac agccaaacac gatgactttt 5280
gttttgtttt ctgccgttct taaaagaaaa aaagataata ttgcaactct gactgaaaga 5340
cttattttta agaaaacagg ttgtgtttgg tgctgctaag ttctggccag tttatcatct 5400
ggccttcctg cctatttttt acaaaacacg aagacagtgt gtaacctcga cattttgacc 5460
ttcctttatg tgctagttta gacaggctcc tgaatccaca cttaattttg cttaacaaaa 5520
gtcttaatag taaacctccc ctcatgagct tgaagtcaag tgttcttgac ttcagatatt 5580
tctttccttt tttttttttt ttcctcatca caactaagag atacacaaac tctgaagaag 5640
cagaaatgga gagaatgctt ttaacaaaaa agcatctgat gaaagatttt aggcaaacat 5700
tctcaaaata agagtgatat tctggatgta gttattgcag ttatctcatg acaaatgagg 5760
cctggattgg aaggaaaata tagttgtgta gaattaagca ttttgatagg aatctacaag 5820
gtagttgaat ataataagca ggtttgggcc cccaaacttt agaaaatcaa atgcaaaggt 5880
gctggcaaaa atgaggtttg agtggctggc tgtaagagaa ggttaactcc tagtaaaagg 5940
catttttaga aataacaatt actgaaaact ttgaagtata gtgggagtag caaacaaata 6000
catgtttttt ttttcttaca aagaactcct aaatcctgag taagtgccat tcattacaat 6060
aagtctctaa atttaaaaaa aaaaaaatca tatgaggaaa tctagctttc ccctttacgc 6120
tgcgtttgat ctttgtctaa atagtgttaa aattcctttc attccaatta cagaactgag 6180
cccactcgca agttggagcc atcagtggga tacgccacat tttggaagcc ccagcatcgt 6240
gtacttacca gtgtgttcac aaaatgaaat ttgtgtgaga gctgtacatt aaaaaaaatc 6300
atcattatta ttattatttg cagtcatgga gaaccaccta cccctgactt ctgtttagtc 6360
tcctttttaa ataaaaatta ctgtgttaga gaagaaggct attaaatgta gtagttaact 6420
atgcctcttg tctgggggtt tcatagagac cggtaggaaa gcgcactcct gcttttcgat 6480
ttatggtgtg tgcaagtaaa caggtgcatt gctttcaacc tgccatacta gttttaaaaa 6540
ttcactgaaa ttacaaagat acatatatat gcatatatat aatggaaagt ttcccggaat 6600
gcaacaatta gcattttaaa atcatatata ggcatgcaca ttctaaatag tactttttca 6660
tgcttcattg tttctctggc agataatttt actaagaaga aaaatagata ttcgactccc 6720
cttccctaaa caaatccacg ggcagaggct ccagcggagc cgagccccct ggttttctcg 6780
taggccctag acggtgttgc atttatcagt gatgtcaaac gtgctcattt gtcagacata 6840
gctgtaaatg aaaacaatgt gtggcaaaat acaaagtt 6878
<210> 2
<211> 2656
<212> DNA
<213>Homo sapiens
<400> 2
gaggctttaa aatctttttt catcttctag ctgtagctcg ggctgcttgt cggcttggcc 60
tccccctccc ccctttgctc tctgcctcgt ctttccccag gacttcgcta ttttgctttt 120
ttaaaaaaag gcaagaaaga actaaactcc cccctccctc tcctccagtc gggctgcacc 180
tctgccttgc actttgcaca gaggtagaga gcgcgcgagg gagagagagg aaagaaaaaa 240
aataataaag agagccaagc agaagaggag gcgagaagca tgaagtgtta actcccccgt 300
gccaaggccc gcgccgcccg gacagacgcc cgccgcgcct ccagccccga gcggacgccg 360
cgcgcgccct gcctgcagcc cgggccggcg aggcgagccc ttccttatgc aaagcgcgca 420
gcggagcggc gagcggggga cgccgcgcac cgggccgggc tcctccagct tcgccgccgc 480
agccaccacc gccgccaccg cagctcgcgg aggatcttcc cgagcctgaa gccgccggct 540
cggcgcgcaa ggaggcgagc gagcaaggag gggccggggc gagcgaggga gcacattggc 600
gtgagcaggg gggagggagg gcgggcgcgg ggggcgcggg cagggcgggg gggtgtgtgt 660
gtgagcgcgc tcggaggttt cgggccagcc accgccgcgc aagctagaag cgccccagcc 720
cggcaagctg gctcacccgc tggccaccca gcacagcccg ctggcccctc tcctgcagcc 780
catctggcgg agcggcggcg gcggcggcgg cggcggcagg agaatggcat cagaactggc 840
aatgagcaac tccgacctgc ccaccagtcc cctggccatg gaatatgtta atgacttcga 900
tctgatgaag tttgaagtga aaaaggaacc ggtggagacc gaccgcatca tcagccagtg 960
cggccgtctc atcgccgggg gctcgctgtc ctccaccccc atgagcacgc cgtgcagctc 1020
ggtgccccct tcccccagct tctcggcgcc cagcccgggc tcgggcagcg agcagaaggc 1080
gcacctggaa gactactact ggatgaccgg ctacccgcag cagctgaacc ccgaggcgct 1140
gggcttcagc cccgaggacg cggtcgaggc gctcatcagc aacagccacc agctccaggg 1200
cggcttcgat ggctacgcgc gcggggcgca gcagctggcc gcggcggccg gggccggtgc 1260
cggcgcctcc ttgggcggca gcggcgagga gatgggcccc gccgccgccg tggtgtccgc 1320
cgtgatcgcc gcggccgccg cgcagagcgg cgcgggcccg cactaccacc accaccacca 1380
ccacgccgcc ggccaccacc accacccgac ggccggcgcg cccggcgccg cgggcagcgc 1440
ggccgcctcg gccggtggcg ctgggggcgc gggcggcggt ggcccggcca gcgctggggg 1500
cggcggcggc ggcggcggcg gcggaggcgg cgggggcgcg gcgggggcgg ggggcgccct 1560
gcacccgcac cacgccgccg gcggcctgca cttcgacgac cgcttctccg acgagcagct 1620
ggtgaccatg tctgtgcgcg agctgaaccg gcagctgcgc ggggtcagca aggaggaggt 1680
gatccggctg aagcagaaga ggcggaccct gaaaaaccgc ggctatgccc agtcctgccg 1740
cttcaagagg gtgcagcaga gacacgtcct ggagtcggag aagaaccagc tgctgcagca 1800
agtcgaccac ctcaagcagg agatctccag gctggtgcgc gagagggacg cgtacaagga 1860
gaaatacgag aagttggtga gcagcggctt ccgagaaaac ggctcgagca gcgacaaccc 1920
gtcctctccc gagtttttca taactgagcc cactcgcaag ttggagccat cagtgggata 1980
cgccacattt tggaagcccc agcatcgtgt acttaccagt gtgttcacaa aatgaaattt 2040
gtgtgagagc tgtacattaa aaaaaatcat cattattatt attatttgca gtcatggaga 2100
accacctacc cctgacttct gtttagtctc ctttttaaat aaaaattact gtgttagaga 2160
agaaggctat taaatgtagt agttaactat gcctcttgtc tgggggtttc atagagaccg 2220
gtaggaaagc gcactcctgc ttttcgattt atggtgtgtg caagtaaaca ggtgcattgc 2280
tttcaacctg ccatactagt tttaaaaatt cactgaaatt acaaagatac atatatatgc 2340
atatatataa tggaaagttt cccggaatgc aacaattagc attttaaaat catatatagg 2400
catgcacatt ctaaatagta ctttttcatg cttcattgtt tctctggcag ataattttac 2460
taagaagaaa aatagatatt cgactcccct tccctaaaca aatccacggg cagaggctcc 2520
agcggagccg agccccctgg ttttctcgta ggccctagac ggtgttgcat ttatcagtga 2580
tgtcaaacgt gctcatttgt cagacatagc tgtaaatgaa aacaatgtgt ggcaaaatac 2640
aaagttaaaa aaaaaa 2656
<210> 3
<211> 6887
<212> DNA
<213>Homo sapiens
<400> 3
gaggctttaa aatctttttt catcttctag ctgtagctcg ggctgcttgt cggcttggcc 60
tccccctccc ccctttgctc tctgcctcgt ctttccccag gacttcgcta ttttgctttt 120
ttaaaaaaag gcaagaaaga actaaactcc cccctccctc tcctccagtc gggctgcacc 180
tctgccttgc actttgcaca gaggtagaga gcgcgcgagg gagagagagg aaagaaaaaa 240
aataataaag agagccaagc agaagaggag gcgagaagca tgaagtgtta actcccccgt 300
gccaaggccc gcgccgcccg gacagacgcc cgccgcgcct ccagccccga gcggacgccg 360
cgcgcgccct gcctgcagcc cgggccggcg aggcgagccc ttccttatgc aaagcgcgca 420
gcggagcggc gagcggggga cgccgcgcac cgggccgggc tcctccagct tcgccgccgc 480
agccaccacc gccgccaccg cagctcgcgg aggatcttcc cgagcctgaa gccgccggct 540
cggcgcgcaa ggaggcgagc gagcaaggag gggccggggc gagcgaggga gcacattggc 600
gtgagcaggg gggagggagg gcgggcgcgg ggggcgcggg cagggcgggg gggtgtgtgt 660
gtgagcgcgc tcggaggttt cgggccagcc accgccgcgc aagctagaag cgccccagcc 720
cggcaagctg gctcacccgc tggccaccca gcacagcccg ctggcccctc tcctgcagcc 780
catctggcgg agcggcggcg gcggcggcgg cggcggcagg agaatggcat cagaactggc 840
aatgagcaac tccgacctgc ccaccagtcc cctggccatg gaatatgtta atgacttcga 900
tctgatgaag tttgaagtga aaaaggaacc ggtggagacc gaccgcatca tcagccagtg 960
cggccgtctc atcgccgggg gctcgctgtc ctccaccccc atgagcacgc cgtgcagctc 1020
ggtgccccct tcccccagct tctcggcgcc cagcccgggc tcgggcagcg agcagaaggc 1080
gcacctggaa gactactact ggatgaccgg ctacccgcag cagctgaacc ccgaggcgct 1140
gggcttcagc cccgaggacg cggtcgaggc gctcatcagc aacagccacc agctccaggg 1200
cggcttcgat ggctacgcgc gcggggcgca gcagctggcc gcggcggccg gggccggtgc 1260
cggcgcctcc ttgggcggca gcggcgagga gatgggcccc gccgccgccg tggtgtccgc 1320
cgtgatcgcc gcggccgccg cgcagagcgg cgcgggcccg cactaccacc accaccacca 1380
ccacgccgcc ggccaccacc accacccgac ggccggcgcg cccggcgccg cgggcagcgc 1440
ggccgcctcg gccggtggcg ctgggggcgc gggcggcggt ggcccggcca gcgctggggg 1500
cggcggcggc ggcggcggcg gcggaggcgg cgggggcgcg gcgggggcgg ggggcgccct 1560
gcacccgcac cacgccgccg gcggcctgca cttcgacgac cgcttctccg acgagcagct 1620
ggtgaccatg tctgtgcgcg agctgaaccg gcagctgcgc ggggtcagca aggaggaggt 1680
gatccggctg aagcagaaga ggcggaccct gaaaaaccgc ggctatgccc agtcctgccg 1740
cttcaagagg gtgcagcaga gacacgtcct ggagtcggag aagaaccagc tgctgcagca 1800
agtcgaccac ctcaagcagg agatctccag gctggtgcgc gagagggacg cgtacaagga 1860
gaaatacgag aagttggtga gcagcggctt ccgagaaaac ggctcgagca gcgacaaccc 1920
gtcctctccc gagtttttca tgtgagtctg acacgcgatt ccagctagcc accctgataa 1980
gtgctccgcg ggggtccggc tcgggtgtgg gcttgctagt tctagagcca tgctcgccac 2040
cacctcacca cccccacccc caccgagttt ggcccccttg gccccctaca cacacacaaa 2100
cccgcacgca cacaccacac acacacacac acacacacac acaccccaca ccctgctcga 2160
gtttgtggtg gtggtggctg ttttaaactg gggagggaat gggtgtctgg ctcatggatt 2220
gccaatctga aattctccat aacttgctag cttgtttttt tttttttttt acaccccccc 2280
gccccacccc cggacttgca caatgttcaa tgatctcagc agagttcttc atgtgaaacg 2340
ttgatcacct ttgaagcctg catcattcac atattttttc ttcttcttcc ccttcagttc 2400
atgaactggt gttcattttc tgtgtgtgtg tgtgttttat tttgtttgga tttttttttt 2460
taattttact tttagagctt gctgtgttgc ccaccttttt tccaacctcc accctcactc 2520
cttctcaacc catctcttcc gagatgaaag aaaaaaaaaa gcaaagtttt tttttcttct 2580
cctgagttct tcatgtgaga ttgagcttgc aaaggaaaaa aaaatgtgaa atgttataga 2640
cttgcagcgt gccgagttcc atcgggtttt ttttttagca ttgttatgct aaaatagaga 2700
aaaaaatcct catgaacctt ccacaatcaa gcctgcatca accttctggg tgtgacttgt 2760
gagttttggc cttgtgatgc caaatctgag agtttagtct gccattaaaa aaactcattc 2820
tcatctcatg cattattatg cttgctactt tgtcttagca acaatgaact ataactgttt 2880
caaagacttt atggaaaaga gacattatat taataaaaaa aaaaagcctg catgctggac 2940
atgtatggta taattatttt ttcctttttt tttccttttg gcttggaaat ggacgttcga 3000
agacttatag catggcattc atacttttgt tttattgcct catgactttt ttgagtttag 3060
aacaaaacag tgcaaccgta gagccttctt cccatgaaat tttgcatctg ctccaaaact 3120
gctttgagtt actcagaact tcaacctccc aatgcactga aggcattcct tgtcaaagat 3180
accagaatgg gttacacatt taacctggca aacattgaag aactcttaat gttttctttt 3240
taataagaat gacgccccac tttggggact aaaattgtgc tattgccgag aagcagtcta 3300
aaatttattt tttaaaaaga gaaactgccc cattattttt ggtttgtttt atttttattt 3360
tatatttttt ggcttttggt cattgtcaaa tgtggaatgc tctgggtttc tagtatataa 3420
tttaattcta gtttttataa tctgttagcc cagttaaaat gtatgctaca gataaaggaa 3480
tgttatagat aaatttgaaa gagttaggtc tgtttagctg tagatttttt aaacgattga 3540
tgcactaaat tgtttactat tgtgatgtta aggggggtag agtttgcaag gggactgttt 3600
aaaaaaagta gcttatacag catgtgcttg caacttaaat ataagttggg tatgtgtagt 3660
ctttgctata ccactgactg tattgaaaac caaagtatta agaggggaaa cgcccctgtt 3720
tatatctgta ggggtatttt acattcaaaa atgtatgttt ttttttcttt tcaaaattaa 3780
agtatttggg actgaattgc actaagatat aacctgcaag catataatac aaaaaaaaat 3840
tgcaaaactg tttagaacgc taataaaatt tatgcagtta taaaaatggc attactgcac 3900
agttttaaga tgatgcagat ttttttacag ttgtattgtg gtgcagaact ggattttctg 3960
taacttaaaa aaaaatccac agttttaaag gcaataatca gtaaatgtta ttttcaggga 4020
ctgacatcct gtctttaaaa agaaatgaaa agtaaatctt accacaataa atataaaaaa 4080
atcttgtcag ttacttttct tttacatatt ttgctgtgca aaattgtttt atatcttgag 4140
ttactaacta accacgcgtg ttgttcctat gtgcttttct ttcattttca attctggtta 4200
tatcaagaaa agaataatct acaataataa acggcatttt tttttgattc tgtactcagt 4260
ttcttagtgt acagtttaac tgggcccaac aacctcgtta aaagtgtaaa atgcatcctt 4320
ttctccagtg gaaggattcc tggaggaata gggagacagt aattcagggt gaaattatag 4380
gctgtttttt gaagtgagga ggctggcccc atatactgat tagcaatatt taatatagat 4440
gtaaattatg acctcatttt tttctcccca aagttttcag ttttcaaatg agttgagcca 4500
taattgccct tggtaggaaa aacaaaacaa aacagtggaa ctaggcttcc tgagcatggc 4560
cctacacttc tgatcaggag caaagccatc catagacaga ggagccggac aaatatggcg 4620
catcagaggt ggcttgcgca catatgcatt gaacggtaaa gagaaacagc gcttgccttt 4680
tcactaaagt tgactatttt tccttcttct cttacacacc gagattttct tgttagcaag 4740
gcctgacaag atttaacata aacatgacaa atcatagttg tttgttttgt tttgcttttc 4800
tctttaacac tgaagatcat ttgtcttaaa taggaaaaag aaaatccact ccttacttcc 4860
atatttccaa gtacatatct ggtttaaact atgttatcaa atcatatttc accgtgaata 4920
ttcagtggag aacttctcta cctggatgag ctagtaatga tttcagatca tgctatcccc 4980
agaaataaaa gcaaaaaata atacctgtgt ggaatatagg ctgtgctttg atttactggt 5040
atttacccca aaataggctg tgtatggggg ctgacttaaa gatcccttgg aaagactcaa 5100
aactaccttc actagtagga ctcctaagcg ctgacctatt tttaaatgac acaaattcat 5160
gaaactaatg ttacaaattc atgcagtttg cactcttagt catcttcccc tagcacacca 5220
atagaatgtt agacaaagcc agcactgttt tgaaaataca gccaaacacg atgacttttg 5280
ttttgttttc tgccgttctt aaaagaaaaa aagataatat tgcaactctg actgaaagac 5340
ttatttttaa gaaaacaggt tgtgtttggt gctgctaagt tctggccagt ttatcatctg 5400
gccttcctgc ctatttttta caaaacacga agacagtgtg taacctcgac attttgacct 5460
tcctttatgt gctagtttag acaggctcct gaatccacac ttaattttgc ttaacaaaag 5520
tcttaatagt aaacctcccc tcatgagctt gaagtcaagt gttcttgact tcagatattt 5580
ctttcctttt tttttttttt tcctcatcac aactaagaga tacacaaact ctgaagaagc 5640
agaaatggag agaatgcttt taacaaaaaa gcatctgatg aaagatttta ggcaaacatt 5700
ctcaaaataa gagtgatatt ctggatgtag ttattgcagt tatctcatga caaatgaggc 5760
ctggattgga aggaaaatat agttgtgtag aattaagcat tttgatagga atctacaagg 5820
tagttgaata taataagcag gtttgggccc ccaaacttta gaaaatcaaa tgcaaaggtg 5880
ctggcaaaaa tgaggtttga gtggctggct gtaagagaag gttaactcct agtaaaaggc 5940
atttttagaa ataacaatta ctgaaaactt tgaagtatag tgggagtagc aaacaaatac 6000
atgttttttt tttcttacaa agaactccta aatcctgagt aagtgccatt cattacaata 6060
agtctctaaa tttaaaaaaa aaaaaatcat atgaggaaat ctagctttcc cctttacgct 6120
gcgtttgatc tttgtctaaa tagtgttaaa attcctttca ttccaattac agaactgagc 6180
ccactcgcaa gttggagcca tcagtgggat acgccacatt ttggaagccc cagcatcgtg 6240
tacttaccag tgtgttcaca aaatgaaatt tgtgtgagag ctgtacatta aaaaaaatca 6300
tcattattat tattatttgc agtcatggag aaccacctac ccctgacttc tgtttagtct 6360
cctttttaaa taaaaattac tgtgttagag aagaaggcta ttaaatgtag tagttaacta 6420
tgcctcttgt ctgggggttt catagagacc ggtaggaaag cgcactcctg cttttcgatt 6480
tatggtgtgt gcaagtaaac aggtgcattg ctttcaacct gccatactag ttttaaaaat 6540
tcactgaaat tacaaagata catatatatg catatatata atggaaagtt tcccggaatg 6600
caacaattag cattttaaaa tcatatatag gcatgcacat tctaaatagt actttttcat 6660
gcttcattgt ttctctggca gataatttta ctaagaagaa aaatagatat tcgactcccc 6720
ttccctaaac aaatccacgg gcagaggctc cagcggagcc gagccccctg gttttctcgt 6780
aggccctaga cggtgttgca tttatcagtg atgtcaaacg tgctcatttg tcagacatag 6840
ctgtaaatga aaacaatgtg tggcaaaata caaagttaaa aaaaaaa 6887
<210> 4
<211> 403
<212> PRT
<213>Homo sapiens
<400> 4
Met Ala Ser Glu Leu Ala Met Ser Asn Ser Asp Leu Pro Thr Ser Pro
1 5 10 15
Leu Ala Met Glu Tyr Val Asn Asp Phe Asp Leu Met Lys Phe Glu Val
20 25 30
Lys Lys Glu Pro Val Glu Thr Asp Arg Ile Ile Ser Gln Cys Gly Arg
35 40 45
Leu Ile Ala Gly Gly Ser Leu Ser Ser Thr Pro Met Ser Thr Pro Cys
50 55 60
Ser Ser Val Pro Pro Ser Pro Ser Phe Ser Ala Pro Ser Pro Gly Ser
65 70 75 80
Gly Ser Glu Gln Lys Ala His Leu Glu Asp Tyr Tyr Trp Met Thr Gly
85 90 95
Tyr Pro Gln Gln Leu Asn Pro Glu Ala Leu Gly Phe Ser Pro Glu Asp
100 105 110
Ala Val Glu Ala Leu Ile Ser Asn Ser His Gln Leu Gln Gly Gly Phe
115 120 125
Asp Gly Tyr Ala Arg Gly Ala Gln Gln Leu Ala Ala Ala Ala Gly Ala
130 135 140
Gly Ala Gly Ala Ser Leu Gly Gly Ser Gly Glu Glu Met Gly Pro Ala
145 150 155 160
Ala Ala Val Val Ser Ala Val Ile Ala Ala Ala Ala Ala Gln Ser Gly
165 170 175
Ala Gly Pro His Tyr His His His His His His Ala Ala Gly His His
180 185 190
His His Pro Thr Ala Gly Ala Pro Gly Ala Ala Gly Ser Ala Ala Ala
195 200 205
Ser Ala Gly Gly Ala Gly Gly Ala Gly Gly Gly Gly Pro Ala Ser Ala
210 215 220
Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Ala Ala
225 230 235 240
Gly Ala Gly Gly Ala Leu His Pro His His Ala Ala Gly Gly Leu His
245 250 255
Phe Asp Asp Arg Phe Ser Asp Glu Gln Leu Val Thr Met Ser Val Arg
260 265 270
Glu Leu Asn Arg Gln Leu Arg Gly Val Ser Lys Glu Glu Val Ile Arg
275 280 285
Leu Lys Gln Lys Arg Arg Thr Leu Lys Asn Arg Gly Tyr Ala Gln Ser
290 295 300
Cys Arg Phe Lys Arg Val Gln Gln Arg His Val Leu Glu Ser Glu Lys
305 310 315 320
Asn Gln Leu Leu Gln Gln Val Asp His Leu Lys Gln Glu Ile Ser Arg
325 330 335
Leu Val Arg Glu Arg Asp Ala Tyr Lys Glu Lys Tyr Glu Lys Leu Val
340 345 350
Ser Ser Gly Phe Arg Glu Asn Gly Ser Ser Ser Asp Asn Pro Ser Ser
355 360 365
Pro Glu Phe Phe Ile Thr Glu Pro Thr Arg Lys Leu Glu Pro Ser Val
370 375 380
Gly Tyr Ala Thr Phe Trp Lys Pro Gln His Arg Val Leu Thr Ser Val
385 390 395 400
Phe Thr Lys
<210> 5
<211> 373
<212> PRT
<213>Homo sapiens
<400> 5
Met Ala Ser Glu Leu Ala Met Ser Asn Ser Asp Leu Pro Thr Ser Pro
1 5 10 15
Leu Ala Met Glu Tyr Val Asn Asp Phe Asp Leu Met Lys Phe Glu Val
20 25 30
Lys Lys Glu Pro Val Glu Thr Asp Arg Ile Ile Ser Gln Cys Gly Arg
35 40 45
Leu Ile Ala Gly Gly Ser Leu Ser Ser Thr Pro Met Ser Thr Pro Cys
50 55 60
Ser Ser Val Pro Pro Ser Pro Ser Phe Ser Ala Pro Ser Pro Gly Ser
65 70 75 80
Gly Ser Glu Gln Lys Ala His Leu Glu Asp Tyr Tyr Trp Met Thr Gly
85 90 95
Tyr Pro Gln Gln Leu Asn Pro Glu Ala Leu Gly Phe Ser Pro Glu Asp
100 105 110
Ala Val Glu Ala Leu Ile Ser Asn Ser His Gln Leu Gln Gly Gly Phe
115 120 125
Asp Gly Tyr Ala Arg Gly Ala Gln Gln Leu Ala Ala Ala Ala Gly Ala
130 135 140
Gly Ala Gly Ala Ser Leu Gly Gly Ser Gly Glu Glu Met Gly Pro Ala
145 150 155 160
Ala Ala Val Val Ser Ala Val Ile Ala Ala Ala Ala Ala Gln Ser Gly
165 170 175
Ala Gly Pro His Tyr His His His His His His Ala Ala Gly His His
180 185 190
His His Pro Thr Ala Gly Ala Pro Gly Ala Ala Gly Ser Ala Ala Ala
195 200 205
Ser Ala Gly Gly Ala Gly Gly Ala Gly Gly Gly Gly Pro Ala Ser Ala
210 215 220
Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Ala Ala
225 230 235 240
Gly Ala Gly Gly Ala Leu His Pro His His Ala Ala Gly Gly Leu His
245 250 255
Phe Asp Asp Arg Phe Ser Asp Glu Gln Leu Val Thr Met Ser Val Arg
260 265 270
Glu Leu Asn Arg Gln Leu Arg Gly Val Ser Lys Glu Glu Val Ile Arg
275 280 285
Leu Lys Gln Lys Arg Arg Thr Leu Lys Asn Arg Gly Tyr Ala Gln Ser
290 295 300
Cys Arg Phe Lys Arg Val Gln Gln Arg His Val Leu Glu Ser Glu Lys
305 310 315 320
Asn Gln Leu Leu Gln Gln Val Asp His Leu Lys Gln Glu Ile Ser Arg
325 330 335
Leu Val Arg Glu Arg Asp Ala Tyr Lys Glu Lys Tyr Glu Lys Leu Val
340 345 350
Ser Ser Gly Phe Arg Glu Asn Gly Ser Ser Ser Asp Asn Pro Ser Ser
355 360 365
Pro Glu Phe Phe Met
370
<210> 6
<211> 19
<212> RNA
<213>Artificial sequence
<220>
<223>It is specific to the siRNA of c-MAF
<400> 6
acggcucgag cagcgacaa 19
<210> 7
<211> 19
<212> RNA
<213>Artificial sequence
<220>
<223>It is specific to the siRNA of c-MAF
<400> 7
cuuaccagug uguucacaa 19
<210> 8
<211> 20
<212> RNA
<213>Artificial sequence
<220>
<223>It is specific to the siRNA of c-MAF
<400> 8
uggaagacua cuacuggaug 20
<210> 9
<211> 20
<212> RNA
<213>Artificial sequence
<220>
<223>It is specific to the siRNA of c-MAF
<400> 9
auuugcaguc auggagaacc 20
<210> 10
<211> 20
<212> RNA
<213>Artificial sequence
<220>
<223>It is specific to the siRNA of c-MAF
<400> 10
caaggagaaa uacgagaagu 20
<210> 11
<211> 20
<212> RNA
<213>Artificial sequence
<220>
<223>It is specific to the siRNA of c-MAF
<400> 11
acaaggagaa auacgagaag 20
<210> 12
<211> 20
<212> RNA
<213>Artificial sequence
<220>
<223>It is specific to the siRNA of c-MAF
<400> 12
accuggaaga cuacuacugg 20

Claims (10)

1. in the subject with ER+ breast cancer to transfer diagnosed and/or for ER+ breast cancer by The in-vitro method of prognosis is carried out in examination person to the tendency for forming transfer, including：
(i) the quantitative expression of c-MAF gene in the neoplasmic tissue sample of the subject and
(ii) expression of the expression that front is obtained and the gene in the control sample is compared,
Wherein if the expression of the gene increases for the expression of the gene in the control sample, that The subject has the tendency of the formation transfer of the positive diagnosis or bigger about transfer.
2. for designing the in-vitro method of the novel personalized therapy of subject for suffering from ER+ breast cancer, including：
(i) the quantitative expression of c-MAF gene in the neoplasmic tissue sample of the subject and
(ii) expression of the expression that front is obtained and the gene in the control sample is compared,
Wherein if the expression increases for the expression of the gene in the control sample, then described Subject can receive to be intended to prevent and/or treat the therapy of transfer.
3. according to the method for claims 1 or 2, wherein the transfer is Bone tumour.
4. method according to claim 3, wherein the Bone tumour is ostelytic metastases.
5. for designing the in-vitro method of the novel personalized therapy of subject for suffering from the breast cancer with Bone tumour, packet It includes：
(i) the quantitative expression of c-MAF gene in the metastatic bone tumor tissue sample of the subject and
(ii) expression of the expression obtained in step (i) and the gene in the control sample is compared Compared with,
Wherein if the expression of c-MAF gene increases for the expression of the gene in the control sample, So described subject can receive the therapy for being intended to prevent bone from degrading.
6. method according to claim 5, wherein the reagent for preventing bone from degrading be selected from bisphosphonates, RANKL inhibitor, PTH or PRG analogs, Strontium Ranelate, the conditioning agent of estrogen receptor, calcitonin and cathepsin K inhibitor.
7. method according to claim 6, wherein the inhibitor of the RANKL is selected from the specific antibody of RANKL and shield bone egg In vain.
8. method according to claim 7, wherein the specific antibody of the RANKL is ground Shu Dankang.
9. method according to claim 6, wherein the bisphosphonates are zoledronic acid.
10. according to the method for any one of claim 5 to 9, wherein the breast cancer is ER+ or ER-.
CN201810147703.5A 2010-10-06 2011-10-05 Methods for diagnosis, prognosis and treatment of breast cancer metastasis Active CN108192972B (en)

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
ES201031478A ES2379918B1 (en) 2010-10-06 2010-10-06 METHOD FOR THE DIAGNOSIS, FORECAST AND TREATMENT OF THE BREAST CANCER METALLASIS.
ESP201031478 2010-10-06
ESP201131073 2011-06-27
ES201131073 2011-06-27
CN201180058347.6A CN103339265B (en) 2010-10-06 2011-10-05 Method for the diagnosis of Metastasis in Breast Cancer, prognosis and treatment
PCT/ES2011/070693 WO2012045905A2 (en) 2010-10-06 2011-10-05 Method for the diagnosis, prognosis and treatment of breast cancer metastasis

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
CN201180058347.6A Division CN103339265B (en) 2010-10-06 2011-10-05 Method for the diagnosis of Metastasis in Breast Cancer, prognosis and treatment

Publications (2)

Publication Number Publication Date
CN108192972A true CN108192972A (en) 2018-06-22
CN108192972B CN108192972B (en) 2022-09-09

Family

ID=45099129

Family Applications (2)

Application Number Title Priority Date Filing Date
CN201810147703.5A Active CN108192972B (en) 2010-10-06 2011-10-05 Methods for diagnosis, prognosis and treatment of breast cancer metastasis
CN201180058347.6A Active CN103339265B (en) 2010-10-06 2011-10-05 Method for the diagnosis of Metastasis in Breast Cancer, prognosis and treatment

Family Applications After (1)

Application Number Title Priority Date Filing Date
CN201180058347.6A Active CN103339265B (en) 2010-10-06 2011-10-05 Method for the diagnosis of Metastasis in Breast Cancer, prognosis and treatment

Country Status (14)

Country Link
US (3) US10047398B2 (en)
EP (3) EP2626431B1 (en)
JP (5) JP6159254B2 (en)
KR (2) KR101944555B1 (en)
CN (2) CN108192972B (en)
AR (1) AR083357A1 (en)
AU (4) AU2011311452B2 (en)
BR (1) BR112013008505B1 (en)
CA (1) CA2813674C (en)
DK (2) DK2626431T3 (en)
ES (3) ES2562274T3 (en)
HK (1) HK1187377A1 (en)
MX (1) MX344315B (en)
WO (1) WO2012045905A2 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114574577A (en) * 2022-01-04 2022-06-03 中山大学孙逸仙纪念医院 METTL16 gene and uses thereof

Families Citing this family (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2626431B1 (en) 2010-10-06 2015-09-16 Fundació Institut de Recerca Biomèdica (IRB Barcelona) Method for the diagnosis, prognosis and treatment of breast cancer metastasis
EP2650682A1 (en) * 2012-04-09 2013-10-16 Fundació Privada Institut de Recerca Biomèdica Method for the prognosis and treatment of cancer metastasis
TR201819859T4 (en) 2012-06-06 2019-01-21 Fundacio Inst De Recerca Biomedica Irb Barcelona Method for diagnosis and prognosis of lung cancer metastasis.
US10119171B2 (en) 2012-10-12 2018-11-06 Inbiomotion S.L. Method for the diagnosis, prognosis and treatment of prostate cancer metastasis
US20140105918A1 (en) * 2012-10-12 2014-04-17 Inbiomotion S.L. Method for the diagnosis, prognosis and treatment of prostate cancer metastasis
MX2015011362A (en) * 2013-03-15 2015-12-16 Fundació Inst De Recerca Biomèdica Irb Barcelona Method for the prognosis and treatment of cancer metastasis.
US20160032399A1 (en) * 2013-03-15 2016-02-04 Inbiomotion S.L. Method for the Prognosis and Treatment of Renal Cell Carcinoma Metastasis
WO2014140896A2 (en) * 2013-03-15 2014-09-18 Fundacio Privada Institut De Recerca Biomedica Method for the diagnosis, prognosis and treatment of cancer metastasis
EP3055429B1 (en) * 2013-10-09 2019-03-27 Fundació Institut de Recerca Biomèdica (IRB Barcelona) Method for the prognosis and treatment of metastasizing cancer of the bone originating from breast cancer
EP2933639A1 (en) * 2014-04-16 2015-10-21 Deutsches Krebsforschungszentrum Stiftung des Öffentlichen Rechts S100p and Hyaluronic acid as biomarkers for metastatic breast cancer
CN104398506A (en) * 2014-12-09 2015-03-11 厦门大学 New application of strontium ranelate in preparation of medicine for preventing and curing cancers
BR112017012515A2 (en) 2014-12-11 2018-01-02 Inbiomotion S.L. binding members for human c-maf
KR20230128144A (en) * 2016-05-25 2023-09-01 인바이오모션 에스.엘. Therapeutic treatment of breast cancer based on c-maf status
KR101896558B1 (en) 2016-11-21 2018-09-07 주식회사 젠큐릭스 Methods for predicting risk of recurrence of breast cancer patients
CN107699619B (en) * 2017-11-17 2019-02-22 柳超 The purposes of lncRNA composition and preparation diagnosis indication Luminal Type B Bone of Breast Cancer metastatic gene diagnostic kit
KR20200104298A (en) * 2017-11-22 2020-09-03 인바이오모션 에스.엘. Therapeutic treatment of breast cancer based on c-MAF status
JP2023079997A (en) 2021-11-29 2023-06-08 東洋インキＳｃホールディングス株式会社 Active energy ray-curable inkjet ink and printed matter

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE4013632A1 (en) * 1990-04-27 1991-10-31 Max Planck Gesellschaft LIPOSOMES WITH POSITIVE EXCESS CHARGE
EP1961825A1 (en) * 2007-02-26 2008-08-27 INSERM (Institut National de la Santé et de la Recherche Medicale) Method for predicting the occurrence of metastasis in breast cancer patients
WO2009045115A1 (en) * 2007-10-05 2009-04-09 Pacific Edge Biotechnology Ltd Proliferation signature and prognosis for gastrointestinal cancer

Family Cites Families (59)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0217822B1 (en) 1985-02-13 1993-05-12 Scios Nova Inc. Human metallothionein-ii promoter in mammalian expression system
US4902505A (en) 1986-07-30 1990-02-20 Alkermes Chimeric peptides for neuropeptide delivery through the blood-brain barrier
US4987071A (en) 1986-12-03 1991-01-22 University Patents, Inc. RNA ribozyme polymerases, dephosphorylases, restriction endoribonucleases and methods
US4904582A (en) 1987-06-11 1990-02-27 Synthetic Genetics Novel amphiphilic nucleic acid conjugates
US5176996A (en) 1988-12-20 1993-01-05 Baylor College Of Medicine Method for making synthetic oligonucleotides which bind specifically to target sites on duplex DNA molecules, by forming a colinear triplex, the synthetic oligonucleotides and methods of use
US5256775A (en) 1989-06-05 1993-10-26 Gilead Sciences, Inc. Exonuclease-resistant oligonucleotides
US5264564A (en) 1989-10-24 1993-11-23 Gilead Sciences Oligonucleotide analogs with novel linkages
CA2251466A1 (en) 1996-04-05 1997-10-16 The Salk Institute For Biological Studies Hormone-mediated methods for modulating expression of exogenous genes in mammalian systems, and products related thereto
CA2274987C (en) 1996-12-23 2012-01-24 Immunex Corporation Ligand for receptor activator of nf-kappa b, ligand is member of tnf superfamily
US6316408B1 (en) 1997-04-16 2001-11-13 Amgen Inc. Methods of use for osetoprotegerin binding protein receptors
US6274338B1 (en) 1998-02-24 2001-08-14 President And Fellows Of Harvard College Human c-Maf compositions and methods of use thereof
US6455502B1 (en) 1999-03-15 2002-09-24 Axys Pharmaceuticals, Inc. Compounds and compositions as protease inhibitors
US6287813B1 (en) 1999-04-23 2001-09-11 Cistronics Cell Technology Gmbh Antibiotic-based gene regulation system
WO2001049288A1 (en) 2000-01-06 2001-07-12 Merck Frosst Canada & Co. Novel compounds and compositions as protease inhibitors
US6750015B2 (en) 2000-06-28 2004-06-15 Kathryn B. Horwitz Progesterone receptor-regulated gene expression and methods related thereto
DE122010000047I1 (en) 2001-06-26 2011-05-05 Amgen Fremont Inc ANTIBODIES AGAINST OPGL
GB0121033D0 (en) 2001-08-30 2001-10-24 Novartis Ag Organic compounds
AR036375A1 (en) 2001-08-30 2004-09-01 Novartis Ag PIRROLO [2,3-D] PIRIMIDINE -2- CARBONITRILE COMPOUNDS, A PROCESS FOR THEIR PREPARATION, A PHARMACEUTICAL COMPOSITION AND THE USE OF SUCH COMPOUNDS FOR THE PREPARATION OF MEDICINES
KR100485271B1 (en) 2002-01-16 2005-04-27 메타볼랩(주) Nivalenol as a specific inhibitor of the transcriptional factor, c-maf and pharmaceutical compositions comprising the same
SE0201980D0 (en) 2002-06-24 2002-06-24 Astrazeneca Ab Novel compounds
DE10235624A1 (en) 2002-08-02 2004-02-19 Aventis Pharma Deutschland Gmbh New fused tetracyclic compounds, e.g. endiandric acid H obtained from the plant Beilschmieda fulva, are c-maf and NFAT inhibitors useful for treating allergy or asthma
US20050181375A1 (en) 2003-01-10 2005-08-18 Natasha Aziz Novel methods of diagnosis of metastatic cancer, compositions and methods of screening for modulators of metastatic cancer
WO2005026322A2 (en) 2003-09-11 2005-03-24 Clontech Laboratories, Inc. siRNA ENCODING CONSTRUCTS AND METHODS FOR USING THE SAME
EP1668354A2 (en) 2003-09-24 2006-06-14 Oncotherapy Science, Inc. Method of diagnosing breast cancer
WO2005046731A1 (en) 2003-10-17 2005-05-26 The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Interference with c-maf function in multiple myeloma
US20090048117A1 (en) 2003-12-18 2009-02-19 President And Fellows Of Harvard College Modulation of immune system function by modulation of polypeptide arginine methyltransferases
TW200526224A (en) 2003-12-22 2005-08-16 Alcon Inc Short form c-Maf transcription factor antagonists for treatment of glaucoma
US8019552B2 (en) 2004-03-05 2011-09-13 The Netherlands Cancer Institute Classification of breast cancer patients using a combination of clinical criteria and informative genesets
US20080131940A1 (en) 2004-06-25 2008-06-05 Robert Chiu Target Cell-Specific Short Interfering Rna and Methods of Use Thereof
WO2006135436A2 (en) 2004-10-22 2006-12-21 University Of Florida Research Foundation, Inc. Inhibition of gene expression and therapeutic uses thereof
US9134237B2 (en) 2005-09-20 2015-09-15 Janssen Diagnotics, LLC High sensitivity multiparameter method for rare event analysis in a biological sample
ES2886923T3 (en) 2005-09-20 2021-12-21 Menarini Silicon Biosystems Spa Methods and composition for generating single-sequence DNA probes, labeling of DNA probes, and the use of these probes
JP2009509966A (en) 2005-09-26 2009-03-12 ノバルティス アクチエンゲゼルシャフト Molecular markers associated with bone metastasis
US8242081B2 (en) 2005-12-06 2012-08-14 Centre National De La Recherche Scientifique Cell penetrating peptides for intracellular delivery of molecules
WO2008098351A1 (en) 2007-02-14 2008-08-21 University Health Network Treatment of d-cyclin mediated proliferative diseases and hemotological malignancies
US8623361B2 (en) 2007-05-24 2014-01-07 Ablynx N.V. Amino acid sequences directed against RANK-L and polypeptides comprising the same for the treatment of bone diseases and disorders
WO2008145125A1 (en) 2007-05-31 2008-12-04 Dako Denmark A/S Methods for utilizing esr copy number changes in breast cancer treatments and prognoses
EP2211861A4 (en) 2007-10-18 2010-08-25 Univ Health Network Clioquinol for the treatment of hematological malignancies
WO2009114534A1 (en) 2008-03-14 2009-09-17 The Regents Of The University Of California Multi-gene classifiers and prognostic indicators for cancers
EP2296654A4 (en) 2008-06-06 2012-04-18 Univ Health Network 8-hydroxyquinoline derivatives for the treatment of hematological malignancies
ES2338843B1 (en) 2008-07-02 2011-01-24 Centro De Investigaciones Energeticas, Medioambientales Y Tecnologicas GENOMIC FOOTPRINT OF CANCER OF MAMA.
US8642270B2 (en) 2009-02-09 2014-02-04 Vm Institute Of Research Prognostic biomarkers to predict overall survival and metastatic disease in patients with triple negative breast cancer
EP2435071A1 (en) 2009-05-29 2012-04-04 F. Hoffmann-La Roche AG Modulators for her2 signaling in her2 expressing patients with gastric cancer
CA2807557C (en) 2009-08-06 2019-09-17 Partha S. Ray Diagnosis of primary and metastatic basal-like breast cancer and other cancer types
EP2626431B1 (en) 2010-10-06 2015-09-16 Fundació Institut de Recerca Biomèdica (IRB Barcelona) Method for the diagnosis, prognosis and treatment of breast cancer metastasis
EP2671076A4 (en) 2011-02-04 2016-11-16 Bioarray Genetics Inc Methods of using gene expression signatures to select a method of treatment, predict prognosis, survival, and/or predict response to treatment
US9066963B2 (en) 2011-03-15 2015-06-30 The University Of North Carolina At Chapel Hill Methods of treating breast cancer with anthracycline therapy
CA2856295A1 (en) 2011-11-18 2013-05-23 Vanderbilt University Markers of triple-negative breast cancer and uses thereof
EP2650682A1 (en) 2012-04-09 2013-10-16 Fundació Privada Institut de Recerca Biomèdica Method for the prognosis and treatment of cancer metastasis
TR201819859T4 (en) 2012-06-06 2019-01-21 Fundacio Inst De Recerca Biomedica Irb Barcelona Method for diagnosis and prognosis of lung cancer metastasis.
US10119171B2 (en) 2012-10-12 2018-11-06 Inbiomotion S.L. Method for the diagnosis, prognosis and treatment of prostate cancer metastasis
US20140105918A1 (en) 2012-10-12 2014-04-17 Inbiomotion S.L. Method for the diagnosis, prognosis and treatment of prostate cancer metastasis
US20160032399A1 (en) 2013-03-15 2016-02-04 Inbiomotion S.L. Method for the Prognosis and Treatment of Renal Cell Carcinoma Metastasis
MX2015011362A (en) 2013-03-15 2015-12-16 Fundació Inst De Recerca Biomèdica Irb Barcelona Method for the prognosis and treatment of cancer metastasis.
WO2014140896A2 (en) 2013-03-15 2014-09-18 Fundacio Privada Institut De Recerca Biomedica Method for the diagnosis, prognosis and treatment of cancer metastasis
EP3055429B1 (en) 2013-10-09 2019-03-27 Fundació Institut de Recerca Biomèdica (IRB Barcelona) Method for the prognosis and treatment of metastasizing cancer of the bone originating from breast cancer
BR112017012515A2 (en) 2014-12-11 2018-01-02 Inbiomotion S.L. binding members for human c-maf
KR20230128144A (en) 2016-05-25 2023-09-01 인바이오모션 에스.엘. Therapeutic treatment of breast cancer based on c-maf status
KR20200104298A (en) 2017-11-22 2020-09-03 인바이오모션 에스.엘. Therapeutic treatment of breast cancer based on c-MAF status

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE4013632A1 (en) * 1990-04-27 1991-10-31 Max Planck Gesellschaft LIPOSOMES WITH POSITIVE EXCESS CHARGE
EP1961825A1 (en) * 2007-02-26 2008-08-27 INSERM (Institut National de la Santé et de la Recherche Medicale) Method for predicting the occurrence of metastasis in breast cancer patients
WO2009045115A1 (en) * 2007-10-05 2009-04-09 Pacific Edge Biotechnology Ltd Proliferation signature and prognosis for gastrointestinal cancer

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
ADAM M BRUFSKY等: "The Evolving Role of Bone-Conserving Therapy in Patients With Breast Cancer", 《SEMIN ONCOL》 *
VINCENZO GIANCOTTI等: "Breast cancer markers", 《CANCER LETT》 *
马飞等: "趋化因子受体CCR7促进乳腺癌细胞的趋化与侵袭", 《第四军医大学学报》 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114574577A (en) * 2022-01-04 2022-06-03 中山大学孙逸仙纪念医院 METTL16 gene and uses thereof

Also Published As

Publication number Publication date
ES2911505T3 (en) 2022-05-19
AU2019201493B2 (en) 2021-03-11
CN103339265B (en) 2018-03-30
EP2626431A2 (en) 2013-08-14
JP2021192636A (en) 2021-12-23
JP6159254B2 (en) 2017-07-12
MX344315B (en) 2016-12-13
EP3517630A1 (en) 2019-07-31
JP6946385B2 (en) 2021-10-06
CA2813674C (en) 2020-11-24
US11072831B2 (en) 2021-07-27
AR083357A1 (en) 2013-02-21
KR20140071946A (en) 2014-06-12
AU2016266009B2 (en) 2018-12-06
JP2017104115A (en) 2017-06-15
JP2013541339A (en) 2013-11-14
WO2012045905A3 (en) 2012-06-21
KR102240323B1 (en) 2021-04-14
AU2011311452A1 (en) 2013-05-09
CN108192972B (en) 2022-09-09
ES2562274T3 (en) 2016-03-03
US10047398B2 (en) 2018-08-14
BR112013008505A2 (en) 2016-07-05
JP2019195340A (en) 2019-11-14
AU2011311452B2 (en) 2016-09-01
US20140057796A1 (en) 2014-02-27
CN103339265A (en) 2013-10-02
EP2626431B1 (en) 2015-09-16
HK1187377A1 (en) 2014-04-04
WO2012045905A2 (en) 2012-04-12
DK3091085T3 (en) 2019-05-06
MX2013003880A (en) 2013-12-02
JP6571698B2 (en) 2019-09-04
US20190169693A1 (en) 2019-06-06
KR20190009835A (en) 2019-01-29
EP3517630B1 (en) 2022-01-19
ES2721639T3 (en) 2019-08-02
EP3091085A1 (en) 2016-11-09
AU2016266009A1 (en) 2016-12-15
CA2813674A1 (en) 2012-04-12
KR101944555B1 (en) 2019-02-01
DK2626431T3 (en) 2015-12-21
AU2019201493A1 (en) 2019-03-28
BR112013008505B1 (en) 2023-01-24
JP2018099132A (en) 2018-06-28
US20220049316A1 (en) 2022-02-17
AU2021203599A1 (en) 2021-07-01
EP3091085B1 (en) 2019-02-27

Similar Documents

Publication Publication Date Title
CN103339265B (en) Method for the diagnosis of Metastasis in Breast Cancer, prognosis and treatment
KR102252332B1 (en) Method for the prognosis and treatment of cancer metastasis
CN104603288B (en) Method for the diagnosis of lung cancer metastasis, prognosis and treatment
CN105324491B (en) Methods for diagnosis and treatment of cancer metastasis
JP6446381B2 (en) Methods for diagnosis, prognosis and treatment of prostate cancer metastasis using c-MAF
DK3055429T3 (en) Procedure for the prognosis and treatment of metastatic bone cancer resulting from breast cancer
CN105431548A (en) Method for the diagnosis, prognosis and treatment of cancer metastasis
EP1354962A1 (en) Use of the slug gene or of the transcription or expression products thereof in the detection and/or treatment of cancerous cells
JP6806440B2 (en) New fusion and its detection method

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant