WO2005046731A1

WO2005046731A1 - Interference with c-maf function in multiple myeloma

Info

Publication number: WO2005046731A1
Application number: PCT/US2003/033162
Authority: WO
Inventors: Louis M. Staudt, M.D., Ph.D.; Elaine Hurt; Michael Kuehl
Original assignee: The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services
Priority date: 2003-10-17
Filing date: 2003-10-17
Publication date: 2005-05-26
Also published as: AU2003286499A8; AU2003286499A1

Abstract

The present invention relates to a method for inhibiting the proliferation, survival and/or migration of a multiple myeloma cell that expresses (overexpresses) c-maf, comprising contacting the multiple myeloma cell with an effective amount of an inhibitor of expression and/or activity of c-maf, integrin 7 and/or cyclin D2. Also disclosed are methods for detecting multiple myeloma in a subject, and for treating multiple myeloma in a subject who has multiple myeloma cells that express c-maf. Also disclosed is a method for identifying an agent that inhibits the proliferation of multiple myeloma cells that express c-maf, and/or inhibits the adhesion of the multiple myeloma cells to bone marrow stromal cells.

Description

INTERFERENCE WITH C-MAF FUNCTION IN MULTIPLE MYELOMA BACKGROUND INFORMATION Multiple myeloma, an incurable malignancy of the plasma cell, accounts for roughly 20% of all hematological malignancies. Clues to the pathogenesis of myeloma come from two general approaches; one focuses on recurrent translocations and mutations of oncogenes, while the second emphasizes the interplay between the malignant plasma cells and the bone marrow microenvironment (Kuehl et al. (2002) Nat Rev Cancer 2, 175-87). Four recurrent translocations involving the immunoglobulin heavy chain (IgH) locus have been observed in both a pre-malignant lesion termed monoclonal gammopathy of undetermined significance (MGUS) and in multiple myeloma (MM). These translocations reflect illegitimate IgH switch recombination (Fonseca et al. (2002) Blood 100, 1417-24; Kuehl et al. (2002) Nat Rev Cancer 2, 175-87). The t(ll;14) and t(6;14) translocations involve the cyclin DI and cyclin D3 genes, respectively, and presumably disturb the physiological exit of plasma cells from the cell cycle. The t(4;14) translocation deregulates both the FGFR3 and MMSETgen.es and the t(14;16) translocation deregulates the c-maf gene, but the functional consequences of these translocations are unknown. Recent work has also demonstrated that interaction of myeloma cells with bone marrow stroma provides the cells with growth and survival factors such as

IL-6 and VEGF and promotes chemotherapeutic drug resistance (Hideshima et al. (2002) Nat Rev Cancer 2, 927-37; Dalton, W. S. (2002) Semin Oncol 29, 21- 5). Although a number of adhesion molecules are present on the surface of multiple myeloma cells, it is not clear which are critical for binding to stromal cells (Cook et al, (1997) Acta Haematol 97, 81-9). A further understanding of the molecular pathogenesis of multiple myeloma, including a better understanding of the consequences of the above- mentioned translocations and of the interaction of multiple myeloma cells with bone marrow stroma, could provide, La., therapeutic targets for this devastating disease. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows frequent overexpression of c-maf and coregulated genes in multiple myeloma cell lines and patient samples. Figure 1 A shows expression levels of c-maf and integrin β7 in myeloma cell lines and patient samples as determined by a quantitative reverse transcription polymerase-chain-reaction assay. Figure IB shows genes coregulated with c-maf in multiple myeloma cell lines. Gene expression was assessed by quantitative RT-PCR (c-maf or DNA microarray measurements (integrin /37, cyclin D2, C-C CR1. Relative gene expression levels are depicted by shades of grey as indicated in the grey scale below the figure. The darker shades of grey at the right end of the scale indicate higher expression, and the lighter shades of grey at the left end of the scale indicate lower expression. Figure 2 shows that c-maf regulates the expression of integrin β7, cyclin D2, and C-C chemokine receptor 1. Figure 2 A shows that c-maf function in myeloma cell lines was manipulated by retro viral transduction of c-maf or a dominant negative form of c-maf. Gene expression changes are depicted by shades of grey as indicated in the grey scale below the figure. The darker shades of grey at the right end of the scale indicate higher expression, and the lighter shades of grey at the left end of the scale indicate lower expression. Multiple microarray elements are shown for each target gene. Figure 2B shows surface expression of integrin /37, as shown for H929 cells 72 hours after being transduced with a c-maf siRNA construct (Fig. 2B-1). Also shown is quantitative RT-PCR assay for c-maf (Fig. 2B-2), integrin βl (Fig. 2B-3), cyclin D2 (Fig. 2B- 3), and c-c chemokine receptor- 1 (Fig. 2B-4) mRNA of H929 cells 72 hours after being transduced with a c-maf siRNA construct. Figure 3 shows that c-maf increases cyclin D2 protein, promotes proliferation in myeloma cell lines and regulates cyclin D2 transcription. Figure 3 A shows that c-maf overexpression increases cyclin D2 protein levels. Western blot analysis of L363 cells that have been transduced with a retrovirus expressing c-maf or a control retro virus is shown. B-tubulin serves as a loading control. Figure 3B shows that overexpression of c-maf enhances proliferation and DNA synthesis. Growth curves are shown of two myeloma cell lines lacking endogenous c-maf expression [L363 (Fig. 3B-1) and KMS12 (Fig. 3B-2)] that have been transduced with a retrovirus expressing c-maf or a control retrovirus. An average of two experiments performed in triplicate is shown with error bars representing the standard deviation. Also shown is the incorporation of H³- thymidine into DNA in KMS 12 cells transduced with a c-maf expressing retrovirus or a control retrovirus (Fig. 3B-3). Cell cycle analysis of KMS-12 cells transduced with a retrovirus expressing GFP and c-maf from a bicistronic mRNA (Fig. 3B-4) or a GFP control retrovirus (Fig. 3B-5) are also shown. Figure 3C shows that inhibition of c-maf reduces the proliferation of c- maf-expressing cell myeloma cells. Retroviruses expressing a dominant negative form of c-maf and GFP from a bicistronic mRNA, or GFP alone were used to infect the indicated cell lines. The number of GFP+ live cells in the cultures over time were determined relative to the number at day 2 following retroviral transduction (Figs 3C-1 through 3C-9). Figure 3D shows that c-maf activates the cyclin D2 promoter. KMS 12 myeloma cells were transfected with a c-maf expression construct or a control vector together with a luciferase reporter construct driven by either a wild type or mutant cyclin D2 promoter. Luciferase activity is indicated as an average of triplicate assays from two independent experiments, with error bars representing the standard deviation (Fig. 3D-1). The conserved c-maf binding motif (MARE) in the promoter regions of the human and mouse cyclin D2 gene is shown together with the mutated nucleotides of the mutant cyclin D2 construct (Fig. 3D- 2). The MARE is located between -134 and -122 with respect to the start of translation in the human gene. Figure 4 shows that c-maf expression enhances adhesion to E-cadherin and bone marrow stroma Figure 4 A shows that surface expression of integrin B7 for cell lines infected with retroviruses expressing either c-maf (Figs. 4A-3 and 4A-4) or a dominant negative form of c-maf (Figs 4 A-1 and 4A-2). Figure 4B shows binding of myeloma cell lines expressing c-maf either endogenously or as a result of retroviral transduction to E-cadherin coated plates. Figure 4C shows binding of multiple myeloma cell lines expressing endogenous c-maf to bone marrow stroma. The effect of antibodies to integrin B7 and E-cadherin is compared to control IgGl. Figure 4D shows binding of myeloma cell lines that lack expression of endogenous c-maf to bone marrow stroma after infection with a retrovirus expressing c-maf or with a control retrovirus. The effect of antibodies to integrin βl and E-cadherin is compared to control IgGl . Figure 4E shows a competitive binding assay of myeloma cells to bone marrow stroma. c- maf-negative KMS 12 cells were fluorescently labeled and allowed to adhere to stroma in the presence of increasing numbers of unlabeled competitor cells that do or do not express c-maf, as indicated. Figure 4F shows secretion of VEGF by KMS 12 myeloma cells transduced with control or c-maf-expressing retroviruses, bone marrow stromal cells, or cocultures of myeloma and stromal cells. All assays were done in triplicate and error bars indicate the standard deviation. Figure 5 shows a model by which c-maf overexpression may cause multiple myeloma. DESCRIPTION OF THE INVENTION The inventors show here that c-maf is much more frequently overexpressed in multiple myeloma cells than was thought previously; that this overexpression is responsible for some cellular properties associated with multiple myeloma; and that inhibition of the c-røα/overexpression can lead to a reduction of these cellular properties, including the proliferation of tumor cells. This increased c-maf expression can serve as a basis for the development of, e.g., diagnostic assays or treatments for multiple myeloma. Previous reports indicated that c-maf is translocated to the immunoglobulin heavy chain locus (a t(14;16)(q32; q23) translocation) in about 5-10% of MGUS and multiple myeloma cases, and that this translocation is often associated with an overexpression of c-maf (Fonseca et al. (2002) Blood 100, 1417-1424; Chesi et al. (1998) Blood 91_, 4457-4463; Kuehl et al. (2002) Nature

Reviews Cancer 2, 175-187). The functional consequences of this overexpression were not reported. Unexpectedly, the present inventors, using expression profiling, observed much higher levels of c-maf expression, e.g., expression in multiple myeloma cells lacking c-maf translocations, and in 50% of bone marrow samples from multiple myeloma samples. Furthermore, the inventors demonstrate that this elevated expression of c-maf results in cells that proliferate faster, apparently due to accelerated entry into the cell cycle; and that inhibition of c-maf expression or activity attenuates proliferation of c-maf- expressing multiple myeloma cells and blocks tumor formation in immunodeficient mice. c-maf is a member of the basic-leucine zipper family of transcription factors that has been shown to be important for, e.g., LL-4 gene expression by T- helper-2 cells and formation of the lens (Ho et al. (1996) Cell 85, 973-83; Kim et al. (1999) Immunity J O, 745-51; Kim et al. (1999) Proc Natl Acad Sci USA 96, 3781-5). By gene expression profiling, the present inventors show that c-maf which is overexpressed in multiple myeloma cells activates the transcription of three target genes: integrin β7, cyclin D2, and C-C chemokine receptor- 1. They further show that c-maf-driven expression of integrin β7 enhances the adherence of myeloma cells to bone marrow stromal cells through interaction with E- cadherin, increasing the production of vascular endothelial growth factor (VEGF). The relevance of such adherence generally for proliferation and survival of tumor cells is discussed in Tlsty (2001) Cancer Biology \ l, 970104. The inventors further show that inhibition of c-maf activity decreases cyclin D2 expression and (presumably at least in part because of this) retards the growth of the tumor cells. Without wishing to be bound by any particular mechanism, the inventors propose that c-maf transforms plasma cells by enhancing cell cycle progression and by promoting inappropriately strong adherence to bone marrow stroma. The Examples herein demonstrate this c-maf overexpression in multiple myeloma cells and its consequences, as well as the effects of inhibiting the c-maf expression or activity. This invention relates, e.g., to a method for inhibiting the proliferation, survival and/or migration of a multiple myeloma cell that expresses c-maf, comprising contacting the multiple myeloma cell with an effective amount of an inhibitor of expression and/or activity of c-maf, integrin β7, and/or cyclin D2. In one embodiment, the multiple myeloma cell overexpresses c-maf compared to a plasma cell from a subject not having multiple myeloma, or to a baseline value. The multiple myeloma cell may or may not contain a t(14; 16) (q32; q23) chromosome translocation. In one embodiment, the inhibitor inhibits expression of c-maf, integrin β7, and or cyclin D2. Examples of such inhibitors include an antisense molecule, a ribozyme, or a small interfering RNA (si RNA). In another embodiment, the inhibitor inhibits an activity of c-maf, integrin β7, and/or cyclin I

D2. Examples of such inhibitors are a dominant negative form of c-maf; a recombinant construct that expresses a dominant negative form of c-maf; an antibody specific for integrin β7; and an intracellular antibody specific for c-maf or cyclin D2. The c-maf activity may be, e.g. , transcriptional activation of an integrin β7, cyclin D2 and/or C-C chemokine receptor- 1 gene; promotion of cell proliferation; promotion of adhesion of the multiple myeloma cell to E-cadherin and/or to a bone marrow stromal cell; and/or induction of secretion of vascular endothelial growth factor (VEGF). The method may be performed with a multiple myeloma cell that is in a subject having multiple myeloma, or the multiple myeloma cell may be contacted in vitro. Another aspect of the invention is a method for inhibiting the adhesion of a multiple myeloma cell that expresses (overexpresses) c-maf to a bone marrow stromal cell, comprising contacting the multiple myeloma cell with an effective amount of an inhibitor of c-maf expression and/or activity, or of an inhibitor of integrin β7 expression and/or activity; and/or contacting the bone marrow stromal cell with an effective amount of an inhibitor of E-cadherin expression and/or activity. In on embodiment (e.g., when performed in vivo), this method is a method of reducing tumor cell adhesion to bone marrow stroma. In another embodiment, the inhibitor(s) of integrin β7 and/or E-cadherin is an antibody specific for integrin β7 or E-cadherin. Another aspect of the invention is a method for inhibiting the transcriptional activation of an integrin β7, cyclin D2 and/or C-C chemokine receptor- 1 gene in a multiple myeloma cell that expresses (overexpresses) c-maf, comprising contacting the multiple myeloma cell with an effective amount of an inhibitor of c-maf expression and/or activity. Another aspect of the invention is a method for treating multiple myeloma in a subject who has multiple myeloma cells that express (overexpress) c-maf, comprising administering to the patient an effective amount of an inhibitor of expression and/or activity of c-maf, integrin β7, and/or cyclin D2. In one embodiment, the patient has been screened for the presence of expression (overexpression) of c-maf prior to the treatment. Some or all of the multiple myeloma cells of the patient may express (overexpress) c-maf. Another aspect of the invention is a method for treating multiple myeloma in a subject who has multiple myeloma cells that express c-maf, comprising administering to the subject an effective amount of an antibody specific for integrin β7, wherein the antibody is conjugated to a therapeutic agent. Another aspect of the invention is a method for identifying an agent that inhibits the proliferation of multiple myeloma cells that express (overexpress) c- maf, and/or inhibits the adhesion of said multiple myeloma cells to bone marrow stromal cells, comprising a) contacting said multiple myeloma cell that expresses (overexpresses) c- maf with a putative agent, and b) detecting the amount of expression and/or activity in the contacted cell of c- maf, integrin β7, cyclin D2 and/or C-C chemokine receptor- 1, wherein an inhibition of the expression and/or activity of c-maf, integrin β7, cyclin D2 and/or C-C chemokine receptor- 1 (preferably integrin β7), compared to a baseline value (e.g., to its expression and/or activity in a similar multiple myeloma cell that has not been contacted with the putative agent), indicates that the putative agent inhibits the proliferation of multiple myeloma cells which overexpress c-maf, and/or inhibits the adhesion of said multiple myeloma cells to bone marrow stroma. A variety of putative agents can be tested, including, e.g., an antisense molecule, a ribozyme, an siRNA, an antibody specific for c-maf, integrin β7, cyclin D2 or C-C chemokine receptor- 1, or a small molecule. Another aspect of the invention is a method for detecting (e.g., diagnosing the presence of) multiple myeloma in a subject, comprising determining the level of c-maf expression in a plasma cell of the subj ect and comparing that level to a baseline value. Expression of c-maf in the plasma cells indicates that the subject suffers from multiple myeloma. In embodiments of this method, the subject may or may not comprise a t(14; 16) (q32; q23) chromosome translocation. Another aspect of the invention is a method for identifying an aggressive form of multiple myeloma in a subject, comprising determining the level of c- maf expression in a multiple myeloma cell of the subject and comparing that level to a baseline value, wherein the overexpression of c-maf indicates that the multiple myeloma is an aggressive form. Another aspect of the invention is a kit for carrying out any of the methods of the invention. For example, one embodiment is a kit for inhibiting the proliferation, survival and/or migration of a multiple myeloma cell that expresses c-maf, or for inhibiting the adhesion of a multiple myeloma cell that expresses c- maf to a stromal cell, comprising an amount of an inhibitor of c-maf that is effective to inhibit said proliferation, survival, migration and/or adhesion. Optionally, the kit may comprise means to measure said proliferation, survival, migration and/or adhesion. Another embodiment is a kit for identifying an agent that inhibits the proliferation of multiple myeloma cells that express c-maf, comprising (a) a multiple myeloma cell that expresses c-maf, and (b) means for detecting the expression or activity of c-ma integrin β7, cyclin D2 or C-C chemokine receptor- 1. Another aspect of the invention is an siRNA, one of whose strands consists essentially of the sequence ACGGCUCGAGCAGCGACAA (SEQ ID NO: 12), or a functional mutant or variant thereof. As noted above, one aspect of the invention is a method for inhibiting the proliferation, survival and/or migration of a multiple myeloma cell that expresses (overexpresses) c-maf, comprising contacting the multiple myeloma cell with an effective amount of an inhibitor of expression and/or activity of c-maf, integrin β7, and/or cyclin D2. "Multiple myeloma cells" include plasma tumor cells from patients presenting with symptoms of the neoplastic disease, multiple myeloma. As used herein, the terms "multiple myeloma" and "myeloma" are interchangeable. Symptoms of this disease, and some methods for diagnosing it, are well known to those of skill in the art. Briefly, multiple myeloma, which is located at multiple sites in the bone marrow compartment, is a malignant plasma-cell tumor that is characterized by osteolytic bone lesions. In general, the term a "multiple myeloma" cell, as used herein, refers to a multiple myeloma cell in an organism, or a primary cell or cell line derived from a human subject having multiple myeloma or from an animal model of the disease. As will be clear from context, the term "multiple myeloma" refers to a cell from any stage of the disease, including the pre-malignant lesion termed monoclonal gammopathy of undetermined significance (MGUS); smoldering myeloma; intramedullary myeloma; and extramedullary myeloma. [Although the primary multiple myeloma cells exemplified in the present invention were from patients with medullary multiple myeloma, and the cell lines were from patients with extramedullary multiple myeloma, it is likely that cells from the other stages indicated above exhibit similar properties. For example, MGUS is known to have c-maf translocations in some cases (e.g., Fonseca, R. et al. (2002) Blood 100, 1417-1424 (2002). Also, it is likely that at least some cases of smoldering myeloma have c-maf expression inasmuch as there has been no evidence that smoldering myeloma differs molecularly from more aggressive forms of multiple myeloma.] A summary of some properties of these disease stages can be found in Kuehl et al. (2002), Nature Reviews 2, 176-187. A multiple myeloma cell that "overexpresses" c-maf produces a measurably increased amount of an expression product (e.g., a c-maf mRNA or a protein) compared to a baseline level. For example, the amount of c-maf can be compared to the amount in a comparable plasma cell from a control subject who does not suffer from multiple myeloma. In general, "normal" plasma cells, which have not been activated by translocation or by some other mechanism, do not express any detectable c-maf, as assayed by even the most sensitive method currently available (real-time quantitative RT-PCR). Thus, a multiple myeloma cell that "expresses" a detectable amount of c-maf in effect "overexpresses" c- maf. The amount of c-maf can be compared to any art-recognized baseline amount of expression. As used herein, a "baseline value" or "baseline amount" includes, e.g., the amount of expression of c-maf in normal plasma, such as from a "pool" of normal subjects. This value can be determined at the same time as the level in a sample from the patient being studied, or it can be available in a reference database (e.g., a reference standard, or a generic database). The baseline value can be, e.g., the level of expression in certain multiple myeloma cell lines that are considered to be negative for c-maf. These include, e.g., the cell lines KMS-12, HI 112 and FLAM-76 (Bersagel et al. (1996) Proc Natl Acad Sci USA 93, 13931-6). As shown in the Examples, the level of c-maf expression in multiple myeloma cells varies over a 100-fold range among multiple myelomas that express c-maf. Other multiple myeloma samples have no detectable c-maf expression by RT-PCR. "Proliferation" of a cell includes cell division. "Survival" refers to resistance to apoptosis. "Migration" includes the homing of multiple myeloma cells to the bone marrow. A discussion of these three properties of multiple myeloma cells is found in Hideshima et al. (2002) Nature Reviews/ Cancer 2, 927-937, and references cited therein. hi methods of the invention, a multiple myeloma cell may be "contacted" with an inhibitor by conventional methods, including, e.g., introduction of the inhibitor to the external environment of the cell or to the cell surface, or introducing the inhibitor internally into the cell. Typical methods of contacting inhibitors with multiple myeloma cells are discussed below. An "inhibitor" of expression or activity is an agent that reduces the expression or activity by a detectable amount. An "effective amount" of such an inhibitor is an amount that is sufficient to elicit a detectable amount of inhibition of expression. The term "expression" of a gene, as used herein, refers to any aspect of the process by which information in a gene is converted to a functional molecule, e.g., any aspect of transcription or translation of the gene. For example, "expression" can refer to transcription, post-transcriptional processing, translation, or post-translational processing. Typical inhibitors that can be used in the method are discussed below. "Activities" of the proteins c-maf, integrin β7, cyclin D2 and C-C chemokine receptor- 1 that can be inhibited by methods of the invention are well- known by skilled workers. Of particular interest are activities involved in the proliferation, survival and/or migration of the multiple myeloma cells. The c-maf activities include direct and indirect effects on the cell. As illustrated in the Examples, the effects of c-maf include, e.g. , transcriptional activation of an integrin β7, cyclin D2 and/or C-C chemokine receptor- 1 gene; promotion of cell proliferation; promotion of adhesion of the multiple myeloma cell to E-cadherin and/or to a bone marrow stromal cell; and/or induction of secretion of vascular endothelial growth factor (VEGF). Integrin β7 activities include the promotion of adhesion to bone marrow stromal cells, e.g. , via E-cadherin expressed on the bone marrow cell surfaces. The enhanced adhesion to bone marrow stroma that is mediated by integrin β7 results in greater production of VEGF. Cyclin D2 activities include stimulation of cell proliferation. C-C chemokine receptor 1 activities included enhanced chemotaxis of myeloma cells to the chemokine MIP-1 alpha and other chemokines that may bind to C-C chemokine receptor 1. The above aspect of the invention, as is the case for many of the methods of the invention, can be performed in vitro or in vivo. In vitro methods can be performed with any suitable multiple myeloma cell. For example, primary multiple myeloma cells can be harvested from a subject, such as an experimental animal (e.g., a rat or mouse model) or a human (e.g., a human patient). Alternatively, the cells can be from any of a variety of well-known suitable cell lines, including but not limited to human multiple myeloma cell lines or plasmocytoma cell lines (e.g., from a mouse). Some suitable cells and cell lines are illustrated in the Examples. In vivo methods can be performed with cells in any of a variety of well- known animal models of multiple myeloma, including, e.g., the SCID mouse model described in the Examples, and several alternative models summarized in Kuehl et al. (2002), Nature Reviews 2, 176- 187, including subcutaneous implantation of human fetal bone into a SCID mouse, which is then injected with intramedullary multiple myeloma tumor cells; plasmacytoma tumors in Balb/c mice; spontaneous MGUS and multiple myeloma tumors; and tumor cell lines in immunodeficient mice. Moreover, the contacted cell may be a multiple myeloma cell (e.g., a tumor cell) in a human subject (e.g., patient) suffering from multiple myeloma. A variety of agents can be used to inhibit expression or activity of c-maf, integrin β7, cyclin D2, and/or C-C chemokine receptor-1 in multiple myeloma cells. The inhibitor can be directed against molecules made from any animal, including, e.g., laboratory models of multiple myeloma (such as mouse).

Preferably, the inhibitors are directed against human polynucleotides or proteins. Inhibitory agents of the invention can be, for example, intracellular binding molecules that act to inhibit the expression of proteins (e.g., c-maf, integrin β7, cyclin D2, or C-C chemokine receptor-1) or the activity of intracellular proteins, such as c-maf or cyclin D2. As used herein, the term

"intracellular binding molecule" is intended to include molecules that act intracellularly to inhibit the expression or activity of a protein by binding to the protein itself, to a nucleic acid (e.g., an mRNA molecule) that encodes the protein, or to a target with which the protein normally interacts (e.g., a DNA target sequence to which c-maf binds). Examples of intracellular binding molecules, described in further detail below, include antisense nucleic acid molecules (e.g., to inhibit transcription or translation of an mRNA of interest), intracellular anti-c-maf-, anti-C-C chemokine receptor-1- or anti-cyclin D2- antibodies (e.g., to inhibit the activity of the proteins) and dominant negative forms of the c-Maf protein. A variety of types of inhibitors of expression of genes will be evident to the skilled worker. These include, e.g., antisense molecules, ribozymes and siRNA molecules, h addition, small molecules (i.e. drug-like compounds) may inhibit mRNA expression by interfering with signaling and other regulatory pathways that affect the transcription or stability of specific mRNAs. Further, small molecules may interfere with protein expression by inhibiting the translation or stability of specific proteins. In one embodiment, an inhibitory agent of the invention is an antisense nucleic acid molecule that is complementary to a gene encoding human c-maf, integrin β7, cyclin D2, or C-C chemokine receptor-1, or to a portion of said gene, or a recombinant expression vector encoding said antisense nucleic acid molecule. The use of antisense nucleic acids to downregulate the expression of a particular protein in a cell is well known in the art (see, e.g., Weintraub et al

(1986) Reviews— Trends in Genetics 1(1); Askari et al. (1996) N. Eng. J. Med. 334, 316-318; Bennett et al. (1995) Circulation 92, 1981-1993; Mercola et al. (1995) Cancer Gene Ther. 2, Al -59; Rossi et al. (1995) Br. Med. Bull. 51, 217- 225; Wagner, R. W. (1994) Nature 372, 333-335). An antisense nucleic acid molecule may comprise a nucleotide sequence that is complementary to the coding strand of another nucleic acid molecule (e.g., an mRΝA sequence) and accordingly is capable of hydrogen bonding to the coding strand of the other nucleic acid molecule. Antisense sequences complementary to a sequence of an mRΝA can be complementary to a sequence found in the coding region of the mRΝA, the 5 ' or 3' untranslated region of the mRΝA or a region bridging the coding region and an untranslated region (e.g., at the junction of the 5' untranslated region and the coding region). Furthermore, an antisense nucleic acid can be complementary in sequence to a regulatory region of the gene encoding the mRNA, for instance a transcription initiation sequence or regulatory element. Preferably, an antisense nucleic acid is designed so as to be complementary to a region preceding or spanning the initiation codon on the coding strand or in the 3' untranslated region of an mRNA. An antisense nucleic acid for inhibiting the expression of a protein of interest in a cell can be designed based upon the nucleotide sequence encoding the protein, constructed according to the rules of Watson and Crick base pairing. In one embodiment, an antisense molecule is designed which is complementary, not to the coding strand of a gene (thereby blocking translation) but to a region of the gene involved in transcription (thereby blocking transcription and/or the production of isoforms, such as splice variants). See, e.g, Lee et al. (1979) Nucl. Acids Res. 6, 3073; Cooney et al. (1988) Science 241, 456; and Dervan et al. (1991) Science 251, 1360. For further guidance on administering and designing antisense, see, e.g., U.S. Pat. Nos. 6,200,960, 6,200,807, 6,197,584, 6,190,869, 6,190,661, 6,187,587, 6,168,950, 6,153,595, 6,150,162, 6,133,246,

6,117,847, 6,096,722, 6,087,343, 6,040,296, 6,005,095, 5,998,383, 5,994,230, 5,891,725, 5,885,970, and 5,840,708. An antisense nucleic acid can exist in a variety of different forms. For example, it can be DNA, RNA, PNA or LNA, or chimeric mixtures or derivatives or modified versions thereof, single stranded or double stranded. The nucleic acid can be modified at the base moiety, sugar moiety, or phosphate backbone, using conventional procedures and modifications. Modifications of the bases include, e.g., methylated versions of purines or pyrimidines. Modifications may include other appending groups such as peptides, or agents facilitating transport across the cell membrane (see, e.g. Letsinger et al, 1989, Proc. Natl. Acad. Sci.

USA 54:684-652; PCT Publication WO 88/09810 (1988), hybridization-triggered cleavage agents (e.g. Krol et al, 1988, BioTechniques 5:958-976) or intercalating agents (e.g., Zon, 1988, Pharm. Res 5:539-549). Antisense oligonucleotides can be constructed using chemical synthesis procedures known in the art. An antisense oligonucleotide can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g. phosphorothioate derivatives and acridine substituted nucleotides can be used. To inhibit c-maf, integrin β7, or cyclin D2 expression in cells in culture, one or more antisense oligonucleotides can be added to cells in culture media, typically at about 200 μg oligonucleotide/ml. Alternatively, an antisense nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e., nucleic acid transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest). Expression control sequences (e.g., regulatory sequences) operatively linked to a nucleic acid cloned in the antisense orientation can be chosen which direct the expression of the antisense RNA molecule in a cell of interest. For instance, promoters and/or enhancers or other regulatory sequences can be chosen which direct constitutive, tissue specific or inducible expression of antisense RNA. Inducible expression of antisense RNA, regulated by an inducible eukaryotic regulatory system, such as the Tet system (e.g., as described in Gossen et al. (1992) Proc. Natl. Acad. Sci.

USA 89, 5547-5551; Gossen et al. (1995) Science 268, 1766-1769; PCT Publication No. WO 94/29442; and PCT Publication No. WO 96/01313) can be used. The antisense expression vector is prepared as described below for recombinant expression vectors, except that the cDNA (or portion thereof) is cloned into the vector in the antisense orientation. The antisense expression vector can be in the form of, for example, a recombinant plasmid, phagemid or attenuated virus. The antisense expression vector is introduced into cells using a standard technique, e.g., as described below for recombinant expression vectors. In another embodiment, an inhibitory agent of the invention is a ribozyme. Ribozymes are catalytic RNA molecules with ribonuclease activity which are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region. For reviews on ribozymes see e.g., Ohkawa et al. (1995) J. Biochem. 118, 251-258; Sigurdsson et al. (1995) Trends Biotechnol L3, 286-289; Rossi, J. J. (1995) Trends Biotechnol L3, 301-306; Kiehntopf et al. (1995) J. Mol. Med. 73, 65-71). A ribozyme having specificity for an mRNA of interest can be designed based upon the nucleotide sequence of, e.g., the corresponding cDNA. For example, a derivative of a Tetrahymena L-19 rVS RNA can be constructed in which the base sequence of the active site is complementary to the base sequence to be cleaved in a c-maf mRNA. See for example U.S. Pat. Nos. 4,987,071 and 5,116,742, both by Cech et al. Alternatively, human c-maf mRNA can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules. See for example Barrel et al (1993) Science 261, 1411-1418. In another embodiment, the inhibitory molecule is a small interfering RNA (siRNA), used in a method of RNA interference. Methods of designing and making siRNAs, testing them for efficacy, and using effective siRNAs in methods of RNA interference (both in vitro and in vivo), are conventional. See, e.g., USP 6,506,559. An siRNA can be designed to target any region of the coding or non-coding sequence of a gene. For example, the present inventors have identified an siRNA that is specific for a region in the coding sequence of c- maf. This siRNA, one of whose strands is ACGGCUCGAGCAGCGACAA (SEQ LO NO: 12), is a preferred siRNA of the invention. Ribozymes and siRNAs can take any of the forms described above for antisense nucleic acid molecules. Active variants (e.g., length variants, including fragments; and sequence variants) of the nucleic acid-based inhibitors discussed above are included in the invention. An "active" length variant (e.g., fragment) is one that retains an activity

(such as the ability to inhibit expression) of the inhibitor from which it is derived. An antisense nucleic acid or siRNA may be of any length that is effective for inhibition of a gene of interest. Typically, an antisense nucleic acid is between about 6 and about 50 nucleotides, and may be as large as about 100 to about 200 nucleotides, or larger. Antisense nucleic acids having about the same length as the gene to be inhibited may be used. The length of an effective siRNA is generally between about 19 bp to 29 bp in length, with shorter and longer sequences being acceptable. For example, a active variant of an siRNA having, for one of its strands, the 18 nucleotide sequence of SEQ LD NO: 12 can lack about 1-3 bp from either, or both, of the 5 ' or the 3 ' end of that double stranded

RNA. Alternatively, an active variant of the siRNA can comprise between about 11-12 additional bp at either, or both, ends of the double stranded RNA. One embodiment of the invention is an siRNA, one of whose strands consists essentially of a sequence represented by SEQ LO NO: 12. The term "consists essentially of means that the double stranded siRNA is between about 19-29 bp in length, as discussed above. A skilled worker can readily test a candidate siRNA to determine if it is inhibitory. In general, it is preferable that an inhibitory nucleic acid, such as an antisense molecule, a ribozyme (the recognition sequences), or an siRNA, is complementary (100% identical in sequence) to a sequence of a gene that it is designed to inhibit. This is particularly true for an siRNA. However, 100% sequence identity between the nucleic acid and the target gene is not required to practice the present invention. Thus, the invention has the advantage of being able to tolerate naturally occurring sequence variations that might be expected due to genetic mutation, strain polymorphism, or evolutionary divergence. Alternatively, the variants may be artificially generated. Nucleic acid sequences with, e.g., small insertions, deletions, and single point mutations relative to the target sequence can be effective for inhibition. An "active" sequence variant of the invention is one that retains an activity (such as the ability to inhibit gene expression) of the inhibitor from which it is derived. The degree of sequence identity may be optimized by sequence comparison and alignment algorithms known in the art (see Gribskov and Devereux, Sequence Analysis Primer, Stockton Press, 1991, and references cited therein) and calculating the percent difference between the nucleotide sequences by, for example, the Smith- Waterman algorithm as implemented in the BESTFIT software program using default parameters (e.g., University of Wisconsin Genetic Computing Group). Greater than about 90% sequence identity (e.g., about 95%, 98% or 99%), or even 100% sequence identity, between the inhibitory nucleic acid and the portion of the target gene is preferred. Alternatively, an active variant of an inhibitory nucleic acid of the invention is one that hybridizes to the sequence it is intended to inhibit under conditions of high stringency. For example, the duplex region of an siRNA may be defined functionally as a nucleotide sequence that is capable of hybridizing with a portion of the target gene transcript under high stringency conditions (e.g., 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50°C. or 70°C. hybridization for 12-16 hours); followed by washing. As used herein, an "isolated" RNA or DNA is one that is in a form not found in its original environment or in nature, e.g., more concentrated, more purified, separated from at least one other component with which it is naturally associated, in a buffer, etc. A variety of types of inhibitors of c-maf, integrin β7, cyclin D2, or C-C chemokine receptor-1 activity will be evident to the skilled worker. These include, e.g., dominant negative forms of c-maf; antibodies directed against surface proteins, such as integrin β7 or C-C chemokine receptor-1; and intracellular antibodies directed against intracellular proteins, such as c-maf or cyclin D2 Suitable activities that can be so inhibited are discussed elsewhere herein. In a preferred embodiment, a dominant negative form of c-maf is used to inhibit c-maf function. The maf family of proteins are known to homodimerize and to heterodimerize with other AP-1 family members, such as Fos and Jun (see e.g., Kerppola et al. (1994) Oncogene 9, 675-684; Kataoka et al. (1994) Mol

Cell. Biol. 14, 700-712). One means to inhibit the activity of transcription factors that form dimers is through the use of a dominant negative inhibitor that has the ability to dimerize with functional transcription factors but that lacks the ability to activate transcription (see e.g., Petrak et al. (1994) J. Immunol. 153, 2046- 2051). By dimerizing with functional transcription factors, such dominant negative inhibitors can inhibit their functional activity. This process may occur naturally as a means to regulate gene expression. For example, there are a number of "small" maf proteins, such as mafK, mafF, mafg and pi 8, which lack the amino terminal two thirds of c-maf that contains the transactivating domain (Fujiwara et al (1993) Oncogene 8, 2371-2380; Igarashi et al. (1995) J. Biol.

Chem. 270, 7615-7624; Andrews et al. (1993) Proc. Natl. Acad. Sci. USA 90, 11488-11492; Kataoka et al. (1995) Mol. Cell. Biol. 15, 2180-2190). Homodimers of the small maf proteins act as negative regulators of transcription (Igarashi et al (1994) Nature 20, 367:568-572) and three of the small maf proteins (MafK, MafF and MafG) have been shown to competitively inhibit transactivation mediated by the v-Maf oncoprotein (Kataoka et al. (1996) Oncogene 12, 53-62). Additionally, MafB has been identified as an interaction partner of Ets-1 and shown to inhibit Ets-1 -mediated transactivation of the transferrin receptor and to inhibit erythroid differentiation (Sieweke et al. (1996) Cell 85, 49-60). Accordingly, an inhibitory agent of the invention can be a form of a c-maf protein (e.g., a human c-maf protein) that has the ability to dimerize with other proteins but that lacks the ability to activate transcription. This dominant negative form of a c-maf protein may be, for example, an altered form of c-maf in which the transactivation domain has been removed. Such dominant negative c-maf proteins can be expressed in cells using a recombinant expression vector encoding the c-maf protein, which is introduced into the cell by standard transfection methods. To express an altered form of c-maf lacking a transactivation domain, nucleotide sequences encoding the amino terminal transactivation domain of c-Maf are removed from the c-maf coding sequences by standard recombinant DNA techniques. Preferably, for human c-maf (using the numbering of amino acids as presented in USP 6,274,338), at least amino acids 1-122 are removed. More preferably, at least amino acids 1-187, or amino acids 1-257, are removed. Nucleotide sequences encoding the basic-leucine zipper region are maintained. A typical dominant negative human c-maf is the Ac-maf molecule illustrated in the Examples. Mutant or variant forms of the dominant negative c-maf protein or nucleic acid encoding it may be used, provided that important functional regions of the protein, which will be evident to the skilled worker (e.g., the basic-leu zipper), are not significantly functionally disturbed. Variant proteins can take the form of, e.g., conservative amino acid substitutions, etc. Variant nucleic acids can take the form of mutations reflecting the redundancy of the genetic code, and can be non-naturally or naturally occurring polymorphisms, including single nucleotide polymorphisms (SNPs), allelic variants, etc. Suitable types of polypeptide and polynucleic acid variants will be evident to the skilled worker. Methods of making recombinant constructs, in which a sequence encoding a protein of interest, such as a dominant negative c-maf protein, is operatively linked to an expression control sequence, are conventional. In general, a coding sequence of interest is operably linked to an expression control sequence in an expression vector. A construct (a recombinant construct) generated in this manner can express the protein when introduced into a cell. Methods of making recombinant constructs, as well as many of the other molecular biological methods used in conjunction with the present invention, are discussed, e.g., in Sambrook, et al. (1989), Molecular Cloning, a Laboratory Manual, Cold Harbor Laboratory Press, Cold Spring Harbor, N.Y.; Ausubel et al. (1995). Current Protocols in Molecular Biology, N.Y., John Wiley & Sons;

Davis et al. (1986), Basic Methods in Molecular Biology, Elseveir Sciences Publishing,, Inc., New York; Hames et al. (1985), Nucleic Acid Hybridization, LL Press; Dracopoli et al. Current Protocols in Human Genetics, John Wiley & Sons, Inc.; and Coligan et al. Current Protocols in Protein Science, John Wiley & Sons, Inc. See, also, Examples IA and HA. As used herein, the term "expression control sequence" means a polynucleotide sequence that regulates expression of a polypeptide coded for by a polynucleotide to which it is functionally ("operably") linked. Expression can be regulated at the level of the mRNA or polypeptide. Thus, the term expression control sequence includes mRNA-related elements and protein-related elements.

Such elements include promoters, domains within promoters, upstream elements, enhancers, elements that confer tissue or cell specificity, response elements, ribosome binding sequences, transcriptional terminators, etc. An expression control sequence is operably linked to a nucleotide sequence (e.g., an "antisense" sequence or a coding sequence) when the expression control sequence is positioned in such a manner to effect or achieve expression of the antisense or coding sequence. For example, when a promoter is operably linked 5' to a coding sequence, expression of the coding sequence is driven by the promoter. Suitable expression control sequences can be selected for host compatibility and desired purpose. These include, e.g., enhancers such as from

SV40, CMV, RSV, inducible or constitutive promoters, and cell-type or tissue- type specific elements or sequences that allow selective or specific cell expression. Promoters that can be used to drive expression, include, e.g., an endogenous promoter, MMTV, SV40, CMV, c-fos, β-globin; tip, lac, tac, or T7 promoters for bacterial hosts; or alpha factor, alcohol oxidase, or PGH promoters for yeast. See, e.g., Melton et al. (1984) Polynucleotide Res. 12(18), 7035-7056; Dunn et al. (1984) J. Mol. Bio. 166, A11-A35; U.S. Pat. No. 5,891,636; Studier et al(\981) Gene Expression Technology, in Methods in Enzymology, 85, 60-89. In addition, as discussed above, translational signals (including in-frame insertions) can be included. A natural expression control sequence of a gene may be used to express the peptide recombinantly, e.g., an expression control sequence from a c-maf protein can be used to drive the expression of a recombinant dominant negative c-maf protein. As used herein, the term polynucleotide is interchangeable with the terms oligonucleotide, oligomer, and nucleic acid (and the term polypeptide is interchangeable with the term peptide or protein). A polynucleotide of the present invention may be a recombinant polynucleotide, a natural polynucleotide, or a synthetic or semi-synthetic polynucleotide, or combinations thereof.

Polynucleotides of the invention may be, e.g., RNA, PNA, LNA, or DNA, or combinations thereof. A sequence of interest placed under the control of a suitable expression control sequence is generally cloned into a suitable vector, to form a "construct." Large numbers of suitable vectors are known to those of skill in the art, and many are commercially available. The following vectors are provided by way of example; Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pBS, pDIO, phagescript, psiX174, pBluescript SK, pBSKS, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); pTRC99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia); Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXTl , pSG (Stratagene) ρSVK3, pBPV, pMSG, pSVL (Pharmacia). However, any other plasmid or vector may be used as long as it is replicable and viable in the host. Suitable host cells will be evident to the skilled worker and include, e.g., prokaryotes, yeast, insect and animal, including mammalian, cells. Large amounts of the construct can be prepared by expressing the construct in a suitable host cell. The amplified construct can then be introduced into, e.g., a multiple myeloma cell. Methods to introduce polynucleotides (or polypeptides) of the invention into cells, such as multiple myeloma cells (to "contact" the cells), will be evident to the skilled worker. These include, e.g., transfection (e.g., mediated by DEAE- Dextran or calcium phosphate precipitation), infection via a viral vector (e.g., retrovirus, adenovirus, adeno-associated virus, lentivirus, pseudotyped retrovirus or poxvirus vectors), injection, such as microinjection, electroporation, sonoporation, a gene gun, liposome delivery (e.g., Lipofectin^®, Lipofectamine^® (GIBCO-BRL, Inc., Gaithersburg, MD), Superfect^® (Qiagen, Inc. Hilden, Germany) and Transfectam^® (Promega Biotec, Inc., Madison, WI), or other liposomes developed according to procedures standard in the art), or receptor- mediated uptake and other endocytosis mechanisms. Alternatively, a dominant negative protein, itself, may be introduced into a multiple myeloma cell. Methods of harvesting and isolating (e.g., purifying) the polypeptide, for example from a cell comprising a suitable recombinant construct, are conventional and well known to those of skill in the art, as are methods of introducing such a protein into a cell. In another embodiment of the invention, an activity of c-maf, integrin β7, or cyclin D2 is inhibited by contacting the cell with an antibody. To inhibit intracellular proteins, such as c-maf or cyclin D2, an intracellular antibody may be used. The use of intracellular antibodies to inhibit protein function in a cell is known in the art (see e.g., Carlson, J. R. (1988) Mol. Cell. Biol. 8, 2638-2646; Biocca et al. (1990) EMBO J. 9, 101-108; Werge et al (1990) FEBS Letters 274,

193-198; Carlson, J. R. (1993) Proc. Natl. Acad. Sci. USA 90, 7427-7428; Marasco et al. (1993) Proc. Natl. Acad. Sci. USA 90, 7889-7893; Biocca et al. (1994) Bio/Technology 12, 396-399; Chen et al. (1994) Human Gene Therapy 5, 595-601; Duan et al. (1994) Proc. Natl. Acad. Sci. USA 91, 5075-5079; Chen et al. (1994) Proc. Natl. Acad. Sci. USA 91, 5932-5936; Beerli et al. (1994) J. Biol.

Chem. 269, 23931-23936; Beerli et al. (1994) Biochem. Biophys. Res. Commun. 204. 666-672; Mhashilkar et al. (1995) EMBO J. 14, 1542-1551; Richardson et al. (1995) Proc. Natl. Acad. Sci. USA 92, 3137-3141; PCT Publication No. WO 94/02610 by Marasco et al; and PCT Publication No. WO 95/03832 by Duan et al). To inhibit protein activity using an intracellular antibody, a recombinant expression vector is prepared which encodes the antibody chains in a form such that, upon introduction of the vector into a cell, the antibody chains are expressed as a functional antibody in an intracellular compartment of the cell. The following discussion is related to intracellular antibodies directed against c-maf, but the discussion also applies to the generation of such antibodies against any intracellular protein. For inhibition of c-maf activity according to the inhibitory methods of the invention, an intracellular antibody that specifically binds the c- maf protein is expressed in the cytoplasm of the cell. To prepare an intracellular antibody expression vector, antibody light and heavy chain cDNAs encoding antibody chains specific for the target protein of interest, e.g., c-maf, are isolated, typically from a hybridoma that secretes a monoclonal antibody specific for the c-maf protein. Hybridomas secreting anti-c-maf monoclonal antibodies, or recombinant anti-c-maf monoclonal antibodies, can be prepared as described below. Once a monoclonal antibody specific for c-maf protein has been identified (e.g., either a hybridoma-derived monoclonal antibody or a recombinant antibody from a combinatorial library), DNAs encoding the light and heavy chains of the monoclonal antibody are isolated by standard molecular biology techniques. For hybridoma derived antibodies, light and heavy chain cDNAs can be obtained, for example, by PCR amplification or cDNA library screening. For recombinant antibodies, such as from a phage display library, cDNA encoding the light and heavy chains can be recovered from the display package (e.g., phage) isolated during the library screening process. Nucleotide sequences of antibody light and heavy chain genes from which PCR primers or cDNA library probes can be prepared are known in the art. For example, many such sequences are disclosed in Kabat et al. (1991) Sequences of Proteins of Immunological interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No.

91-3242 and in the "Vbase" human germline sequence database. Once obtained, the antibody light and heavy chain sequences are cloned into a recombinant expression vector using standard methods. To allow for cytoplasmic expression of the light and heavy chains, the nucleotide sequences encoding the hydrophobic leaders of the light and heavy chains are removed. An intracellular antibody expression vector can encode an intracellular antibody in one of several different forms. For example, in one embodiment, the vector encodes full-length antibody light and heavy chains such that a full-length antibody is expressed intracellularly. In another embodiment, the vector encodes a full-length light chain but only the VH/CHl region of the heavy chain such that a Fab fragment is expressed intracellularly. In the most preferred embodiment, the vector encodes a single chain antibody (scFv) wherein the variable regions of the light and heavy chains are linked by a flexible peptide linker (e.g.,(Gb ₄ Ser₃) (SEQ ID NO: 17) and expressed as a single chain molecule. To inhibit c-maf activity in a multiple myeloma cell, the expression vector encoding the anti-c- maf intracellular antibody is introduced into the cell by standard methods, as discussed elsewhere herein. To inhibit the activity of a surface localized protein, such as integrin β7,

C-C chemokine receptor-1, or E-cadherin, a cell bearing the protein can be contacted with an antibody specific for that protein. As shown in the Examples, multiple myeloma cells may attach to bone marrow cells via integrin β7 expressed on the surface of the myeloma cell and E-cadherin expressed on the surface of the bone marrow cell. This interaction can be inhibited by introducing into an in vitro reaction containing both proteins, or into an animal, an antibody specific for integrin β7 or for E-cadherin, or antibodies having both specificities for both proteins. By a "specific" antibody or antigen-binding fragment is meant one that binds selectively (preferentially) to a protein of the invention, or to a fragment or variant thereof. An antibody "specific" for a polypeptide means that the antibody recognizes a defined sequence of amino acids within or including the polypeptide. Antibodies of the invention can be, for example, polyclonal or monoclonal antibodies. The present invention also includes chimeric, recombinant, single chain, and partially or fully humanized antibodies, as well as Fab fragments, or the product of a Fab expression library, and fragments thereof. The antibodies can be IgM, IgG, subtypes, IgG2A, IgGl, etc. Various procedures known in the art maybe used, e.g., for the production of such antibodies and fragments. Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained, e.g., by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal, e.g., goat, rabbit, mouse, chicken, etc., preferably a non-human. The antibody so obtained will then bind the polypeptide itself, hi this manner, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide. Antibodies can also be generated by administering naked DNA. See, e.g., USP Nos. 5,703,055; 5,589,466; and 5,580,859. For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include, e.g., the hybridoma technique (Kohler and Milstein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, hnmunology Today 4:72), and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole, et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). Techniques described for the production of single chain antibodies (e.g., U.S. Patent 4,946,778) can be adapted to produce single chain antibodies to immunogenic polypeptide products of this invention. Also, transgenic animals may be used to express partially or fully humanized antibodies to immunogenic polypeptide products of this invention. Another type of inhibitory agent included in the invention is a therapeutic agent that comprises an antibody which is specific for integrin β7, and to which is bound (e.g., attached, conjugated) a therapeutic moiety. Examples of suitable

"therapeutic moieties," such as drugs or toxic substances, are discussed below. An antibody of the invention which is specific for integrin β7 can thus be used to deliver a therapeutic moiety to a multiple myeloma cell that expresses integrin β7 on its surface. Such a therapeutic agent can modulate a multiple myeloma cell either positively or negatively, providing that it has a net therapeutic effect on the environment in which the cell resides (e.g., a tissue, tumor, metastasis, patient, or the like). By "modulate" is meant that any physiological response of the cell, e.g., a metabolic activity, a response to an internal or external environmental factor, a synthetic or catabolic process, activation, repression, etc., is altered. The therapeutic agent can achieve inhibition or suppression of growth, killing, destruction, elimination, control, modification, etc. of the cell or tissue. Cytostatic, cytolytic, cytotoxic, and carcinostatic effects are included. A therapeutic agent can suppress a neoplastic phenotype, or it can interfere with normal function of, or otherwise incapacitate, a cell to which it is delivered. In one embodiment, the therapeutic agent can prevent the establishment, growth or metastasis of a multiple myeloma cell e.g., can prevent its recurrence. Representative examples of antitumor agents, such as, e.g., immune activators and tumor proliferation inhibitors, are disclosed, e.g., in U.S. Patent No. 5,662,896. "Treatment" of, or the elicitation of a "therapeutic response" in, a cell, tissue, tumor, metastasis, patient, or the like, by a therapeutic agent (e.g., comprising a drug or toxic agent) is defined herein as an action which can bring about a response such as those discussed above. By an "effective amount" of a therapeutic agent is meant an amount which is sufficient to bring about such a response. A wide variety of therapeutic moieties are encompassed by the invention, including therapeutic compounds which are used currently, but which are delivered to cells by other methods. The therapeutic moieties can be isolated from natural sources, or can be produced by synthetic and/or recombinant means, all of which are well-known to one of ordinary skill in the art. Among the drugs or therapeutic moieties which can be used in the invention are chemotherapeutic and/or cytotoxic agents such as, e.g., steroids, antimetabolites, anthracycline, vincaalkaloids, neocarzinostatin (NCS), adriamycin, dideoxycytidine, cisplatin, doxorubicin, pirarubicin, melphalan and daunomycin, thalidomide, bortezomid, or the like. In one embodiment, the therapeutic moiety comprises a toxin such as, e.g., ricin (e.g., the A and/or B chain thereof, or the deglycosylated form), poisonous lectins, diphtheria toxin, exotoxin from Psuedomonas aeruginosa, abrin, modeccin, botulina toxin, alpha-amanitan, pokeweed antiviral protein (PAP, including PAPI, PAPII and PAP-S), ribosome inhibiting proteins, especially the ribosome inhibiting proteins of barley, wheat, corn, rye, or gelonin, or ribosome-inactivating glycoprotein (GPIR). Fragments, subunits, muteins, mimetics, variants and/or analogues of such toxins are, of course, known to those of skill in the art and are encompassed by the invention. It is contemplated that all such variants or mutants which retain their toxic properties will be of use in accordance with the present invention. Methods of selecting therapeutic moieties and binding (e.g. associating, attaching or conjugating) them to a targeting antibody of the invention, are routine and conventional in the art. See, e.g., U.S. patents 5,840,522; 5,079,163; 4,520,011; 5,667,786; 5,686,072; 4,340,535; 6,020,145; 5,254,342; 4,911,912; 4,450,154; and 5,928,873. Methods of attaching a peptide or polypeptide toxin to an antibody targeting moiety, include, for example, covalent binding, affinity binding, intercalation, coordinate binding and complexation. Covalent binding can be achieved either by direct condensation of existing side chains or by the incorporation of external bridging molecules. Many bivalent or polyvalent agents are useful in coupling protein molecules to other proteins, peptides or amine functions, etc. For example, the literature is replete with coupling agents such as carbodiimides, diisocyanates, glutaraldehyde, diazobenzenes, and hexamethylene diamines. In some embodiments, one may first wish to derivatize the targeting moiety and then attach the toxin component to the derivatized product. Suitable cross-linking agents for use in this manner include, e.g., SPDP (N- succinimidyl-3-(2-pyridylthio)propionate) and SMPT (4-succinimidyl-oxycarbonyl-α-methyl α(2-pyridylthio)toluene). In one embodiment, a toxin and a targeting moiety can be covalently bonded by forming a disulfide bond between naturally occurring free thiol groups (e.g., in the A chain of a ricin) and/or a thiol or activated disulfide group which has been introduced into an analogue of a peptide chain (e.g., an analogue of gelonin having a cysteine available for disulfide bonding). In another embodiment, the therapeutic moiety can comprise any of a variety of art-recognized radioisotopes or radionuclides. Methods of radiotherapy (nuclear medicine), in which cytotoxic doses of radioactivity are delivered to cells, are conventional in the art and are described, e.g., in EP 481,526; U.S. Pat. 5,962,424; Roeske et al (1990). Int. J. Radiation Oncology Biol. Phys. 19, 1539-48; and Leichner et al. (1993). Med. Phys. 20 (2 Pt. 2), 569-77. Such radioactive compounds can affect the targeted cell as well as adjacent tumor cells which, for one reason or another, do not display integrin β7 on their surface. Among the most preferred radiation sources are Tc-99 and In-1 11. Of course, combinations of the various therapeutic moieties can be coupled to one targeting antibody, thereby accommodating variable cytotoxicity. In another embodiment, two or more different therapeutic agents or inhibitory agents are admimstered together. Other inhibitory agents that can be used to inhibit the activity of a human c-maf, integrin β, cyclin D2, or C-C chemokine receptor-1 protein are chemical compounds that directly inhibit those activities or that inhibit the activities indirectly. For example, such agents can inhibit interaction between c-maf and target DNA or another protein. Such compounds can be identified using screening assays that select for such compounds, as described in detail below.

Another aspect of the invention is a method for inhibiting the adhesion of a multiple myeloma cell that expresses (overexpresses) c-maf to a bone marrow stromal cell, comprising contacting the multiple myeloma cell with an effective amount of an inhibitor of c-maf expression and/or activity, or with an inhibitor of integrin β7 expression and/or activity; or by contacting the bone marrow stromal cell with an effective amount of an inhibitor of E-cadherin expression and/or activity. Among the inhibitors that can be used are antibodies specific for integrin β7 and/or for E-cadherin. Such a method, for example when performed in an animal, can be a method of reducing tumor cell adhesion to bone marrow stroma. Another aspect of the invention is a method for treating multiple myeloma in a subject (e.g., patient) who has multiple myeloma cells that express (overexpress) c-maf, comprising administering to the subject an effective amount of an inhibitor of expression and/or activity of c-maf, integrin β7 and/or cyclin D2, or administering an agent that kills cells to which it is targeted (e.g., cells that express integrin β7 on their surface). Such a treatment can prevent, ameliorate, and/or inhibit symptoms of multiple myeloma. A treatment strategy of the invention would likely decrease the tumor burden, at least to a measurable degree, and improve survival of patients suffering from multiple myeloma. Without wishing to be bound by any particular theory, it is suggested that treatment with an inhibitor of c-maf would decrease stromal cell adhesion, secretion of VEGF and LL-6, and cyclin D2 expression, thereby inhibiting myeloma proliferation and survival. Since c-maf deficient mice are viable and only have defects in the development of the lens and in IL-4 production, it is likely that therapies targeting c-maf would be well tolerated (Kim et al. (1999) Immunity 10, 745-51); Kim et al (1999) Proc Natl Acad Sci USA 96, 3781-5). Inhibiting integrin β7 would also be expected to result in few side effects, because integrin β7 function is generally not required for the function of "normal" cells. (It is required in a relatively rare subset of lymphocytes that home to the gastrointestinal epithelium.) Furthermore, knockout animals for integrin β7 are healthy and only are missing this subset of cells that are required to form the gut-associated lymphoid tissue (GALT) (Wagner et al. (1996) Nature 382. 366-70). Inhibiting cyclin D2 would also be expected to result in few side effects, or in side effects that could be easily managed. Knockout animals in which cyclin D2 is disrupted are viable and have specific defects in the maturation of granulosa cells in the ovary, leading to sterility (Sicinski et al. (1996) Nature 5, 384, 470-4). Since the majority of women who develop multiple myeloma would be post-menopausal, such a side effect would be of little importance, and of course there would be no such effect in men. Cyclin D2 is involved in B activation through the B cell antigen receptor (Solvason et al. (2000) Int

Immunol. 12, 631-8), and therefore inhibition of cyclin D2 might block some antigen-driven immune responses. This type of side effect is not unusual in cancer therapy, and can be routinely managed using a variety of methods to prevent infections. The absence of side effects in the above treatment methods is another advantage of those treatment methods. In one embodiment of the above-mentioned treatment methods, the subject (patient) is screened for the presence of overexpression of c-maf in his or her multiple myeloma cells prior to the treatment. Subjects whose cells express c- maf are likely to be amenable to a treatment that targets c-maf expression or activity, or that targets a gene whose expression is upregulated by c-maf. C-maf can be detected by any of the methods discussed herein, or others. Another embodiment of the invention is a method for inhibiting the proliferation, survival and/or migration of a multiple myeloma cell that expresses c-maf (and that consequently overexpresses integrin β7), or for treating multiple myeloma in a subject who has multiple myeloma cells that express c-maf (and that consequently overexpress integrin β7), comprising administering to the cell or the subject an effective amount of an antibody specific for integrin β7, wherein the antibody is bound to a cytotoxic agent (such as a toxin or radionuclide). Preferably, the antibody is a monoclonal antibody. Because the only "normal" cells that appear to express integrin β7 on their surface are a subpopulation of lymphocytes that home to the intestine, such an "armed" antibody would be expected to target myeloma cells that exhibit c-maf overexpression, and relatively few normal cells. Inhibitors of the invention can be formulated as pharmaceutical compositions, comprising an inhibitor of the invention and a pharmaceutically acceptable carrier, using conventional components and methodologies. Effective dosages and routes of administration of inhibitory agents of the invention are conventional. The exact amount (effective dose) of the agent will vary from subject to subject, depending on, La., the species, age, weight and general or clinical condition of the subject, the severity or mechanism of any disorder being treated, the particular agent or vehicle used, the method and scheduling of administration, and the like. A therapeutically effective dose can be determined empirically, by conventional procedures known to those of skill in the art. See, e.g., The Pharmacological Basis of Therapeutics, Goodman and Gilman, eds., Macmillan Publishing Co., New York. For example, an effective dose can be estimated initially either in cell culture assays or in suitable animal models. The animal model may also be used to determine the appropriate concentration ranges and routes of administration. Such information can then be used to determine useful doses and routes for administration in humans. A therapeutic dose can also be selected by analogy to dosages for comparable therapeutic agents. In general, normal dosage amounts may vary from about 0.1 to 100,000 micrograms, up to a total dose of about 5g, depending on the route of administration and other factors as noted above. A variety of routes of administration are known to the skilled worker. These include, but are not limited to, oral; respiratory; intranasal; intrarectal; intravaginal; sublingual; transdermal; extracorporeal; topical; intravenous, subcutaneous, intramuscular, intramedullary, or intraperitoneal injection; other parenteral routes; or the like. One of skill in the art will recognize particular cells, tissues or organs into which therapeutic agents of the invention can be administered, as appropriate for particular indications. Methods of administering proteins, nucleic acids and small molecules to subjects (patients) are conventional and well known to skilled workers. Some such methods are described in references mentioned above or below, in or references cited therein. For the administration of nucleic acids (e.g., methods of gene therapy), see, e.g., U.S. patent application 60/464,658. Another aspect of the invention is a method for identifying an agent that inhibits the proliferation of multiple myeloma cells that express (overexpress) c- maf, and/or inhibits the adhesion of said multiple myeloma cells to bone marrow stromal cells, comprising (a) contacting said multiple myeloma cell that expresses (overexpresses) c-maf with a putative agent, and (b) detecting the amount of expression and/or activity in the contacted cell of c- maf, integrin β7, cyclin D2 and/or C-C chemokine receptor-1. An inhibition of the expression and/or activity of c-maf, integrin β7, cyclin D2 and/or C-C chemokine receptor-1, compared to a baseline value (e.g., its expression and/or activity in a multiple myeloma cell that has not been contacted with the putative agent), indicates that the putative agent inhibits the proliferation of multiple myeloma cells which express c-maf, and/or inhibits the adhesion of said multiple myeloma cells to bone marrow stroma. Any suitable method may be used to detect (e.g., measure or quantitate) the amount of expression and/or activity of c- maf, integrin β7, cyclin D2 and/or C-C chemokine receptor- 1. Methods for determining the amount of a protein or nucleic acid of interest are conventional and will be evident to the skilled worker. Many of these methodologies and analytical techniques can be found in such references as Current Protocols in Molecular Biology, F. M. Ausubel et al, eds., (a joint venture between Greene Publishing Associates, hie. and John Wiley & Sons, Inc.), Enzyme frnmunoassay, Maggio, ed. (CRC Press, Boca Raton, 1980); Laboratory Techniques in Biochemistry and Molecular Biology, T. S. Work and E. Work, eds. (Elsevier Science Publishers B. V., Amsterdam, 1985); Principles and Practice of Immunoassays, Price and Newman, eds. (Stockton Press, NY, 1991); etc. For nucleic acids, for example, changes in nucleic acid expression can be determined by polymerase chain reaction (PCR), ligase chain reaction (LCR), Qβ-replicase amplification, nucleic acid sequence based amplification (NASBA), and other transcription-mediated amplification techniques; differential display protocols; analysis of northern blots, techniques based on hybridization to specific probes, enzyme linked assays, micro-arrays and the like. Examples of these techniques can be found in, for example, PCR Protocols A Guide to Methods and Applications (Innis et al, eds, Academic Press Inc. San Diego, Calif. (1990)). Levels of proteins can be detected, for example, by quantitative immunoprecipitation, Western analysis, or the like. For surface proteins, such as integrin β7 or C-C chemokine receptor-1, flow cytometric methods can be used. In a preferred embodiment, the amount of integrin β7 is detected. This protein is located on the surface of the cell, and thus is particularly easy to assay.

Furthermore, the amount of integrin β7 made is in a 1:1 relationship to the amount of c-maf in a MM cell and thus provides an accurate indication of the amount of c-maf activity in the cell. Alternatively, activities of the proteins can be measured, using conventional methods. For c-maf, for example, activities which can be measured include binding of c-maf to DNA, such as to a maf response element (MARE); the regulation of gene expression, not only of the three target genes shown herein to be specifically upregulated by c-maf in multiple myeloma cells, but also a variety of other genes known by skilled workers. Other c-maf activities that can be detected are described in USP 6,274,338; Kurschner et al. (1995) Mol. Cell.

Biol. 15, 246-254; Kataoka et al. (1993) J. Virol. 67, 2133-2141; Kataoka et al. (1996) Oncogene 12, 53-62; Kataoka et al. (1994) Mol. Cell. Biol. 14, 700-712; and Ho et al. (1996) Cell 85, 973-983. Assays for the binding of integrin β7 to E-cadherin-coated surfaces, or the adhesion of multiple myeloma cells to bone marrow stromal cells, are described elsewhere herein. The above method to identify an agent that inhibits the proliferation of multiple myeloma cells that express (overexpress) c-maf, and/or inhibits the adhesion of said multiple myeloma cells to bone marrow stromal cells, is preferably performed in vitro. Promising candidate inhibitors can be subsequently tested in vivo, e.g. in an animal model for multiple myeloma, using one of the animal models discussed elsewhere herein, or others. Finally, the agent can be tested in a patient with multiple myeloma, e.g., in a non-human primate or a human. A variety of classes of putative inhibitory agents can be tested by this method, including the types of inhibitors discussed elsewhere herein. "Small molecules," sometimes referred to herein as "compounds," can be generated as follows: Such small molecules may be isolated from natural sources or developed synthetically, e.g., by combinatorial chemistry. In general, such molecules are identified from large libraries of natural products or synthetic (or semi-synthetic) extracts or chemical libraries according to methods known in the art. Those skilled in the field of drug discovery and development, for example, will understand that the precise source of test extracts or compounds is not critical to the methods of the invention. Accordingly, virtually any number of chemical extracts or compounds can be used in the methods described herein. Examples of such extracts or compounds include, but are not limited to, plant-, fungal-, prokaryotic- or animal-based extracts, fermentation broths, and synthetic compounds, as well as modification of existing compounds. Numerous methods are also available for generating random or directed synthesis (e.g., semi- synthesis or total synthesis) of any number of chemical compounds, including, but not limited to, saccharide-, lipid-, peptide-, polypeptide- and nucleic acid- based compounds. Synthetic compound libraries are commercially available, e.g., from Brandon Associates (Merrimack, NE) and Aldrich Chemical (Milwaukee, WI). Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant, and animal extracts are commercially available from a number of sources, e.g., Biotics (Sussex, UK), Xenova (Slough, UK), Harbor Branch Oceangraphics Institute (Ft. Pierce, FL), and PhannaMar, U.S.A. (Cambridge, MA). In addition, natural and synthetically produced libraries are generated, if desired, according to methods known in the art, e.g., by standard extraction and fractionation methods. Furthermore, if desired, any library or compound is readily modified using standard chemical, physical, or biochemical methods. Screening methods of the invention can be adapted to any of a variety of high throughput methodologies. High throughput assays are generally performed on a large number of samples, and at least some of the steps are performed automatically, e.g., robotically. Another aspect of the invention is a method for detecting (e.g., diagnosing the presence of) multiple myeloma in a subject, comprising detecting the level of c-maf expression in a plasma cell of the subject, and comparing that level to a baseline value (e.g., a reference standard; the level in a plasma cell of a subject not suffering from multiple myeloma; etc.). Such a method will identify patients whose cells are overexpressing c-maf, and which therefore suffer from multiple myeloma. This method is generally simpler to perform than the standard method used currently, which involves detecting the presence of a t(14; 16) (q32; q23) translocation, and will also detect forms of multiple myeloma in which the cells do not exhibit the translocation. C-maf is expressed in "normal" T helper type II cells and in some non-haematopoietic cells. One of skill in the art will recognize how to select appropriate plasma cells for the assay, in order to identify multiple myeloma cells above the background. As noted above, not all forms of multiple myeloma overexpress c-maf. The subclass of multiple myeloma tumors in which the cells overexpress c-maf

(e.g., cells that contain the above-mentioned translocation) are expected, on the average, to be more aggressive and to exhibit a worse prognosis than multiple myelomas which do not overexpress c-maf. Accordingly, another embodiment of the invention is a method for identifying an aggressive fon of multiple myeloma in a subject, comprising determining the level of c-maf expression in a multiple myeloma cell of the subject and comparing that level to a baseline value. Tumors which express c-maf would be expected to be more aggressive than tumors which do not express this gene. Another aspect of the invention is a method for detecting (e.g., diagnosing the presence of) multiple myeloma in a subject, comprising determining the level integrin β7 expressed on the surface of the plasma cells, compared to a baseline value. A skilled worker will recognize that integrin β7 is also expressed on the surface of certain "normal" cells, i.e., a subclass of lymphocytes that home to the intestine, and will recognize how to design the assay to take into account such background. Samples for analysis can be taken from any suitable source, including, e.g., blood, primary multiple myeloma cells isolated (e.g., purified) from bone marrow aspirates, etc. Generally, a diagnosis of multiple myeloma is made in two stages: first one determines if there are elevated levels of immunoglobulins in the blood; and then one verifies an initial diagnosis with a bone marrow biopsy. The methods of the invention would be particularly useful after the first stage of diagnosis, since they would limit the number of patients subjected to a painful, unpleasant bone marrow biopsy. Methods for detecting the levels of c-maf expression or activity are discussed elsewhere herein, as are appropriate methods for determining a baseline value. In a preferred embodiment, the amount of integrin β7 is detected as an indirect indication of the amount of c-maf expression. Integrin β7 is located on the surface of the cell, and thus is particularly easy to assay.

Furthermore, the amount of integrin β7 in a multiple myeloma cell is in a 1 : 1 relationsliip with the amount of c-maf; thus, the amount of integrin β7 provides a quantitative indication of the amount of c-maf in the cell. Suitable assays include enzymatic assays and methods for detecting the presence of the protein, itself. In one embodiment of the invention, integrin β7 on the surface of a multiple myeloma cell is detected by contacting the cell with an antibody that is specific for integrin β7, and to which is attached a detectable moiety; and then detecting antibody that has bound to integrin β7 on the surface of the cell. Suitable detectable moieties include, e.g., signal generators [entities which are capable of emitting a detectable amount of energy in the form of electromagnetic radiation (such as X-rays, UV-radiation, IR radiation, visible radiation, or the like), and include phosphorescent and fluorescent entities, bioluminescent markers, gamma and X-ray emitters, or the like]; signal reflectors (e.g., paramagnetic entities); or signal absorbers (e.g., electron beam opacifier dyes). For a further discussion of suitable detectable moieties and methods of detection

(e.g., imaging), see WO 00/54805. Another aspect of the invention is a kit, suitable for performing any of the methods (e.g., assays) of the invention. For example, the kit may be useful for inhibiting the proliferation, survival and/or migration of a multiple myeloma cell that expresses (overexpresses) c-maf (in vitro or in a subject); for inhibiting the adhesion of a multiple myeloma cell that expresses (overexpresses) c-maf to a bone marrow stromal cell; for treating a subject who has multiple myeloma cells that express (overexpress) c-maf; for identifying an agent that inhibits the proliferation of multiple myeloma cells; or for detecting multiple myeloma in a subject. The components of the kit will vary according to which method is being performed. Generally, a kit of the invention contains an inhibitor of c-maf expression and/or activity. The kits also optionally contain means (e.g., suitable reagents) for detecting proliferation, survival and/or migration of a multiple myeloma cell; the adhesion of a multiple myeloma cell to a bone marrow stromal cell; or the expression or activity of c-maf, integrin β7, cyclin D2 and/or C-C chemokine receptor-1. Reagents for performing suitable controls may also be included. Optionally, the kits comprise instructions for performing the method. Kits of the invention may further comprise a support on which a cell can be propagated (e.g., a tissue culture vessel) or a support to which a reagent used in the method is immobilized. Other optional elements of a kit of the invention include suitable buffers, media components, or the like; a computer or computer- readable medium for storing and/or evaluating the assay results; logical instructions for practicing the methods described herein; logical instructions for analyzing and/or evaluating the assay results as generated by the methods herein; containers; or packaging materials. The reagents of the kit may be in containers in which the reagents are stable, e.g., in lyophilized form or stabilized liquids. The reagents may also be in single use form, e.g., in single dosage fonn for use as therapeutics, or in single reaction form for diagnostic use. Kits of the invention have many uses, which will be evident to the skilled worker. For example, they can be used in experiments to study factors involved in c-maf mediated activities, or to understand facets of the molecular pathogenesis of multiple myeloma or the interaction of multiple myeloma cells with stromal cells; to detect the presence of multiple myeloma cells that express (overexpress) c-maf; to treat multiple myeloma; to monitor the course of treatment of multiple myeloma; or to identify inhibitory agents for use in the treatment of multiple myeloma. An agent of interest can be characterized by performing assays with the kit, and comparing the results to those obtained with known agents (or by comparison to a reference database of the invention). Such assays are useful commercially, e.g., in high-throughput drug studies. In the foregoing and in the following examples, all temperatures are set forth in uncorrected degrees Celsius; and, unless otherwise indicated, all parts and percentages are by weight. EXAMPLES Example I. Methods A. Gene expression profiling mRNA from cell lines was isolated using the Fast-track 2.0 kit (Invitrogen (Carlsbad, CA)). Total RNA from patient samples was isolated using Trizol (GIBCO-BRL (Gaithersburg, MD)). Lymphochip DNA microarrays were prepared, hybridized, and analyzed as previously described (Higgins et al. (1998) J Cell Biol 140, 197-210). Relative gene expression was assessed by comparing a myeloma cDNA probe (labeled with Cy5 dye) with a reference cDNA probe (labeled with Cy3 dye) prepared from a pool of 9 lymphoid cell lines, as described (Higgins et al, supra). DNA microarray gene expression data were used to identify genes coregulated with c-maf by comparing expression in c-maf + and c-maf- cell lines (as determined by quantitative RT-PCR), using a t-test to assess statistical significance. Selection criteria for c-maf coregulation were p < 0.001, variance > 2.0, and <10% missing values. For direct identification of c- maf target genes, Cy5-labeled cDNA probes were prepared from cells transduced with retroviruses expressing c-maf or dominant negative c-maf and compared with Cy3-labeled probes from cells transduced with a control retrovirus. B. Quantitative reverse transcription polymerase chain reaction (RT-PCR) Flow sorting was used to purify plasma cells from bone marrow aspirates of myeloma patients (CD138+, CD38+, CD56+) and from normal donor bone marrow aspirates (CD 138+, CD38+, CD 19-). Quantitative RT-PCR assays (TaqMan™) were preformed using a one-step reaction solution (Applied Biosystems (Foster City, CA)). The expression of UTF2 was detected with the forward primer GGAGCGGCCTGCGATTT (SEQ ID NO: 1), the reverse primer CTTTGAAGGTCTCCTGCATGC (SEQ ID NO: 2), and the probe TCCGGGAGTTGCGCCAGACC (SEQ ID NO: 3). Integrin β7 was detected with the forward primer GAATCAACCAGACGGTGACTTTCT (SEQ ID NO: 4), the reverse primer GCCCGGAGCCTCAGGA (SEQ ID NO: 5), and the probe CAAGCCACCCACTGCCTCCCAG (SEQ ID NO: 6). Expression of c-maf was detected with the forward primer GCTTCCGAGAAAACGGCTC (SEQ ID NO: 7), the reverse primer TGCGAGTGGGCTCAGTTATG (SEQ ID NO: 8), and the probe CGACAACCCGTCCTCTCCCGAGTTT (SEQ ID NO: 9). The level of c-maf and integrin β7 mRNA was determined by normalization to the level of the control gene UTF2.

C. Cell culture, retroviral constructs and transduction Cell lines were maintained in RPMI-1640 (GIBCO-BRL) or ACL-4 (GIBCO-BRL) with 10% fetal calf serum (HyClone) and penicillin/streptomycin (GLBCO-BRL). Bone marrow stroma was obtained from aspirates of healthy donors and cultured as previously described (Uchiyama et αl. (1993) Blood 82, 3712-20). Bicistronic retroviral constructs were generated using the Vxypuro backbone or the vEGFP-F backbone that allow for expression of a cDNA and the puromycin resistance gene or a farnesylated EGFP protein, respectively(Shaffer et αl. (2000) Immunity 13, 199-212; Davis et αl (2001) JExp Med 194, 1861- 1874). Infections were carried out as described, and cells receiving Vxypuro constructs were maintained in puromycin (1 μg/ml) (Shaffer et αl. (2000) Immunity 13, 199-212). The VxyPuro-cmaf construct contained a human c-mαf cDNA, corresponding to sequences from -804 to +2005 with respect to the translation start site. The VxyPuro-Ac-maf and vEGFP-Ac-maf constructs were made by fusing a FLAG-tagged acidic extension to the leucine zipper portion of c-maf, +1753 to +2005, as previously described (Olive et αl(\991) JBiol Chem 272, 18586-94). To determine the effect of dominant negative c-maf on cell number, myeloma cells were infected with a vEGFP-F retrovirus expressing dominant negative c-maf or a control vEGFP-F retrovirus, and EGFP positive cells were enumerated by flow cytometry as described (Higgins et αl. (1998) J Cell Biol 140, 197-210).

D. Cyclin D2 promoter analysis Myeloma cell lines were cotransfected with an expression vector (pCMV- Script; Stratagene) containing the c-maf cDNA, a reporter vector in which the human cyclin D2 promoter drives expression of luciferase, and a control β-Gal expressing plasmid, as described (Shaffer et αl. (2000) Immunity 13, 199-212). Luciferase activity was measured using a luminometer and levels were normalized to β-Gal expression. Site directed mutagenesis with the mutant cyclin D2 primers, GGGGAGGACCGGgtaGAGTtAGtacGCCCCGAGGC (SEQ ID NO: 10) and GCCTCGGGGCgtaCTaACTCtacCCGGTCCTCCCC (SEQ ID NO: 11), was preformed using the QuickChange kit (Stratagene).

E. Cell cycle analysis Cells were fixed in ethanol for 15 minutes at 4°C followed by propidium iodide staining and RNAse A digestion for 1 hour at 37°C. Flow cytometry was performed on fixed stained cells.

F. siRNA constructs and transduction The c-maf siRNA duplex construct ACGGCUCGAGCAGCGACAA (SEQ ID NO: 12) (Dharmacon), was transduced by electroporation (Amaxa). Live cells were separated by ficoll centrifugation, total RNA was extracted and mRNA levels were assayed by quantitative RT-PCR using Assays-on-Demand for c-maf, integrin Bl, C-C chemokine receptor-1 and cyclin D2 (Applied Biosystems). G. Binding assays Binding was carried out as previously described (Higgins et al. (1998) J Cell Biol 140, 197-210). Briefly, 24-well plates were coated with E-cadherin overnight at 4°C or seeded with bone marrow stromal cells (0.5 x 10⁵). Myeloma cells were incubated with the BCEF-AM dye (Molecular Probes) for 15 minutes at 37°C followed by washing, incubated at 4°C with blocking antibodies (20 ng/ml), and plated at 3xl0⁵ cells per well. The plates were incubated a 37°C for 30 minutes followed by washing and reading in a fluorescent plate reader. H. VEGF and IL-6 secretion Bone marrow stroma, isolated and cultured as previously described (Gupta et al. (2001) Leukemia 5, 1950-61), was plated at lx 10⁴ cells per well in a 96- well plate and allowed to become confluent. KMS 12 cells were added at a density of 1 x 10³ cells per well. Anti-integrin β7 (Santa Cruz Biotechnology (Santa Cruz, CA)) and anti-E cadherin (Santa Cruz Biotechnology) were added (20 ng/ml) and the plates were incubated at 37^°C for 48 hours. Supernatant was collected and assayed for VEGF and IL-6 by ELISA (R&D Systems (Minneapolis, MN)). I. In vivo tumor formation LP-1 cells were infected with the Vxy-Puro or the VxyPuro-Ac-maf retroviruses described above. Cells were selected with puromycin (1 μg/ml) for 4 days, washed extensively, and then injected intraperitoneally into 10- week old NOD-SCLD mice (10⁷ cells/mouse). Mice were monitored daily for palpable tumor formation and tail vein blood was assayed weekly for human immunoglobulin lambda production by ELIS A (Bethyl Labs). Tumors were removed and protein extracts made for western blot analysis. C-maf protein was detected by a c-maf antibody (Santa Cruz) and Ac-maf protein was detected by a FLAG antibody (Sigma (St. Louis, MO)).

Example II. c-/«fl Overexpression in multiple myeloma cells We used DNA microarrays to profile gene expression in a panel of 28 multiple myeloma cell lines that have been extensively characterized with respect to translocations, gene copy number changes, and oncogene mutations (Bergsagel et al (1996) Proc Natl Acad Sci USA 93, 13931-6; Bergsagel et al. (l996) Proc Natl Acad Sci USA 93, 13931-6). Cell lines with translocations of the cyclin DI and MMSET/FGFR3 genes expressed these genes more highly than cell lines lacking these translocations. Unexpectedly, c-maf was not only expressed in the 6 cell lines with c-maf translocations, but also in cell lines lacking this translocation. To confirm and extend this observation, we measured c-maf mRNA levels using a quantitative RT-PCR assay in the 28 cell lines (Fig. 1 A). We found that 13 (46%) expressed high levels, 3 (11%) expressed low levels, and the remainder had no detectable c-maf expression. Although c-maf expression varied over a wide range, some cell lines lacking a c-maf translocation expressed c-maf as highly as some with a c-maf translocation. It is interesting to note that c-maf is overexpressed in all cell lines with an MMSET/FFGR3 translocation and one cell line with a cyclin DI translocation. We also detected frequent c-maf expression in primary multiple myeloma cells purified from patient bone marrow aspirates (13/26 samples; 50%) (Fig. 1A), which was surprising since c-maf translocations occur in only 5-10% of myeloma cases (Kuehl et al. (2002) Nat Rev Cancer 2, 175-87). c-maf mRNA was undetectable in normal plasma cells purified from bone marrow aspirates, demonstrating that c-maf overexpression in multiple myeloma is associated with the malignant process (Fig. 1 A). Example III. Identification of molecular targets of c-maf transactivation To discover potential c-maf target genes, we searched the myeloma cell line gene expression dataset for genes that were differentially expressed between c-maf-expressing and -non-expressing cell lines. The three genes that satisfied the selection criteria (p<0.001; t-test) were integrin βl, cyclin D2, and C-C chemokine receptor-1 (Fig. IB). Even cell lines with relatively low c-maf expression (e.g. XG-2, U266) expressed these putative c-maf target genes at higher levels than c-maf negative cell lines (Fig. IB). We confirmed the coregulation of c-maf and integrin βl in the myeloma cell lines by quantitative RT-PCR, and also observed this coregulation in the primary multiple myeloma samples (Fig. 1 A). Although a few myeloma cell lines lacking c-maf expression had low levels of integrin βl mRNA, patient samples and normal bone marrow plasma cells lacking c-maf expression did not express integrin βl detectably (Fig. 1A). To directly search for c-maf target genes, we manipulated the activity of c- maf in myeloma cell lines and profiled the resultant changes in gene expression. Using retroviral transduction, we overexpressed c-maf in two cell lines that have no endogenous c-maf expression (KMS 12 and L363). Additionally, we created a dominant negative form of c-maf, termed Ac-maf, by replacing the basic DNA binding region of c-maf with an acidic region while retaining the leucine zipper (Olive et al(\991) JBiol Chem 272, 18586-94). We used retroviruses to transduce Ac-maf into two cell lines that express c-maf without a translocation (H929 and LP-1), and into one cell line that expresses c-maf as a consequence of a t(14;16) translocation (JJN3) (Chesi et al. (1998) Blood 91, 4457-63). The three genes that were consistently upregulated by c-maf overexpression and downregulated by Ac-maf were again integrin βl, cyclin D2, and C-C chemokine receptor-1, thus confirming that these genes are under the control of c-maf (Fig. 2A). No genes were consistently repressed by c-maf or induced by Ac-maf . Ac- maf had no effect on gene expression in two cell lines that do not express c-maf (L363 and KMS12; Fig. 2A), demonstrating the specificity of this dominant negative protein for c-maf. Despite the apparent specificity of the dominant negative, it is still possible that the dominant negative is exerting the observed effects through dimerization with another c-maf family member. To further confirm that these target genes are in fact due to c-maf action, we knocked down the endogenous c-maf mRNA using a siRNA approach in H929 cells. Surface expression of integrin B7 was decreased upon transduction with a c-maf siRNA construct (Fig. 2B). Quantitative RT-PCR confirmed that c-maf, integrin B7, cyclin D2 and C-C chemokine receptor-1 mRNAs were knocked down by c-maf siRNA in H929 (Fig. 2B). This further confirms that the dominant negative is acting through c- maf to affect the transcription of these genes. Example IV. c-maf can promote cell proliferation in vitro Since we identified cyclin D2 as a c-maf target gene, we confirmed that the upregulation of cyclin D2 mRNA by introduction of c-maf resulted in an increased cyclin D2 protein level (Fig. 3A). We next investigated whether c-maf can promote proliferation. Retroviral transduction of c-maf into myeloma cells lacking endogenous c-maf expression caused these already cycling cells to increase their division and DNA synthesis (Fig. 3 A). Cell cycle analysis of cells expressing c-maf revealed that a significantly higher percentage were in S- and G2-phase (9% and 7% respectively) while the percentage of G0/G1 cells was significantly decreased (Fig. 3A). This is consistent with the idea that c-maf driven increases in cyclin D2 levels promote the entry of cells into the cell cycle. Conversely, in most (6/7) c-maf expressing myeloma cell lines, introduction of Ac-maf decreased their division, including cell lines with and without a c-maf translocation (Fig. 3C). As expected, Ac-maf had no effect on the proliferation of 2 c-maf negative cell lines (Fig. 3C) again confirming the specificity of the dominant negative for c-maf. The cyclin D2 promoter has potential c-maf binding sites that are well conserved in the human and mouse orthologues, and c-maf was able to directly transactivate a cyclin D2 promoter construct in transient transfection assays (Fig. 3C). Furthermore, a 7-bp mutation that mutates the key contact nucleotides of the MARE attenuates transactivation of the cyclin D2 promoter construct (Fig. 3D).

Example V. Inhibitors of c-maf can inhibit tumor formation in vivo Given the effect of c-maf on proliferation in vitro, we tested whether tumor formation in vivo by c-maf-expressing myelomas was dependent on c-maf. NOD-SCID immunodeficient mice were injected intraperitoneally with LP-1 cells that had been transduced with a retrovirus expressing dominant negative Ac-maf or with a control retrovirus. Tumor formation was assessed by measuring human immunoglobulin in the blood and by the appearance of visible abdominal masses. All four mice injected with the control LP-1 cells developed tumors within 26-36 days and had rising titres of human immunoglobulin in their blood. Two of the mice injected with dominant negative Ac-maf LP-1 cells did form tumors 2-4 times (66 and 116 days) later than control mice. At the time of sacrifice, Ac-maf mice that developed tumors had increased blood human immunoglobulin levels similar to the levels seen in control mice (400- 600ng/ml). However, when the tumors were analyzed for Ac-maf expression one tumor had no detectable levels of Ac-maf and the other had a barely detectable level of Ac-maf despite the high level of Ac-maf at the time of injection. The existence of two tumors that selected against Ac-maf expression suggests that there is a strong growth advantage imparted to c-maf expressing escape mutants that no longer express Ac-maf. Furthermore, the low but detectable level of Ac- maf found in one tumor suggests that the Ac-maf cells were able to persist but were unable to proliferate as fast as Ac-maf negative cells. Example VI. Cells in which integrin βl is upregulated by c-maf exhibit increased adhesion to E-cadherin and bone marrow cells Since the interaction of the bone marrow stroma with multiple myeloma cells is an important component of the pathophysiology of this malignancy, we asked whether the upregulation of integrin βl by c-maf altered the adhesion properties of myeloma cells. (Anderson, K. C. (2001) Semin Hematol 38, 6-10; Shain et al. (2000) Curr Opin Oncol 12, 557-63) We first confirmed the levels of surface integrin B7 by flow cytometry. Introduction of c-maf into cells not expressing endogenous c-maf resulted in an increase in surface integrin B7 while introduction of Ac-maf resulted in decreased levels of surface integrin B7 (Fig. 4A). Integrin βl can heterodimerize with either integrin aA or integrin oE. Integrin Aβl binds to MadCAM-1 and integrin oE/37 binds to E-cadherin (Hynes, R. (2002) Cell 110, 673-87). E-cadherin has been detected on the surface of bone marrow stromal cells (Turel et al. (1998) Cell Biol Int 22, 641-8). Two cell lines that express endogenous c-maf (H929 and LP-1) adhered to E- cadherin-coated plates, whereas two cell lines lacking c-maf expression (L363 and KMS 12) did not bind to E-cadherin-coated plates (Fig. 4B). Retroviral transduction of c-maf into these latter cell lines conferred binding to E-cadherin- coated plates (Fig. 4B). Next we investigated the role of c-maf in the interaction of myeloma cells with bone marrow stromal cells (Fig.4C). Cell lines expressing c-maf were able to adhere to the stroma, presumably through the concerted action of several adhesion molecules(Anderson, K. C. (2001) Semin Hematol 38, 6-10; Shain et al. (2000) Curr Opin Oncol 12, 557-63). Preincubation of the myeloma cells with an integrin βl antibody resulted in a 40-72% decrease in adherence to the stroma

(Fig. 4C). Preincubation of the stroma with an E-cadherin antibody blocked adherence of myeloma cells to a similar degree (Fig. 3B). Myeloma cell lines lacking c-maf expression were able to adhere to stroma, but transduction of these cells with the c-maf retrovirus increased adherence 2.5-3.5 fold (Fig. 4D). Antibodies to integrin βl or E-cadherin completely blocked the increase in adherence caused by c-maf (Fig. 4D). We developed a competitive binding assay in which fluorescentiy-labelled, c-maf-negative cells were allowed to adhere to stroma in the presence of increasing numbers of unlabelled cells; c-maf- expressing cells were more efficient competitors than cells lacking c-maf (Fig. 4E). These data suggest that c-maf enhances the adhesion of myeloma cells to bone marrow stroma through interactions between integrin άEβl and E-cadherin. Interaction of myeloma cells with bone marrow stroma induces secretion of vascular endothelial growth factor (VEGF), which has been reported to act in an autocrine and paracrine fashion to promote myeloma proliferation and survival. We therefore investigated whether the enhanced stromal interaction caused by c-maf results in increased VEGF secretion (Fig. 4F). Myeloma cells and stroma cells alone did not secrete appreciable quantities of VEGF, but cocultures of stroma with myeloma cells lacking c-maf expression produced more VEGF (2.3 fold). Even greater VEGF secretion (5.5 fold) occurred in cocultures of stroma with c-maf-expressing myeloma cells. Again, this augmented VEGF production was dependent upon integrin aEβl interactions with E-cadherin since antibodies to these two adhesion proteins reduced VEGF secretion to the levels observed using c-maf non-expressing myeloma cells. These data suggest that c-maf alters the nature of the myeloma/stromal cell interaction and that interaction leads to an increase in VEGF secretion. Example VII. A role for c-maf in cell proliferation We observed that c-maf enhanced proliferation in a cell autonomous fashion, which represents one mechanism by which c-maf transforms plasma cells (Fig. 5). Plasmacytic differentiation is accompanied by upregulation of the cyclin-dependent kinase inhibitor, pi 8 (Tourigny et al. (2002) Immunity 17, 179- 89). Myelomas apparently must circumvent this physiological cell cycle arrest since two recurrent translocations in myeloma involve the cyclin DI and cyclin D3 genes, and homozygous deletions of the pi 8 locus are frequent(Kulkarni et al. (2002) Leukemia 16, 127-34). Without wislimg to be bound by any particular mechanism, we suggest that the transcriptional activation of cyclin D2 by c-maf provides another mechanism for cell cycle progression in myeloma. The fact that all three D-type cyclins are targets for overexpression, whether directly or indirectly, suggests that the D-type cyclins are important and necessary target for transformation. From the foregoing description, one skilled in the art can easily ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make changes and modifications of the invention to adapt it to various usage and conditions. Without further elaboration, it is believed that one skilled in the art can, using the preceding description, utilize the present invention to its fullest extent. The preceding prefened specific embodiments are, therefore, to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever. The entire disclosure of all applications, patents and publications, cited above and below and in the figures are hereby incorporated by reference.

Claims

WE CLAIM:

1. A method for inhibiting the proliferation, survival and or migration of a multiple myeloma cell that expresses c-maf, comprising contacting the multiple myeloma cell with an effective amount of an inhibitor of expression and/or activity of c-maf, integrin β7 and/or cyclin D2.

2. The method of claim 1 , wherein the multiple myeloma cell overexpresses c-maf compared to a baseline value.

3. The method of claim 1, wherein the inhibitor is an inhibitor of c-maf expression and/or activity.

4. The method of claim 1 , wherein the inhibitor is an inhibitor of integrin β7 expression and/or activity.

5. The method of claim 1, wherein the inhibitor is an inhibitor of cyclin D2 expression and/or activity.

6. The method of claim 1, wherein the multiple myeloma cell contains a t(14; 16) (q32; q23) chromosome translocation.

7. The method of claim 1, wherein the multiple myeloma cell does not contain a t(14; 16) (q32; q23) chromosome translocation.

8. The method of claim 1, wherein the inhibitor inhibits expression of c-maf, integrin β7 and/or cyclin D2.

9. The method of claim 8, wherein the inhibitor is an antisense molecule, a ribozyme, or a small interfering RNA (siRNA).

10. The method of claim 9, wherein the antisense molecule, ribozyme, or siRNA comprises a single stranded polynucleotide represented by the sequence

SEQ ID NO: 12, or a complement thereof.

11. The method of claim 1 , wherein the inhibitor inhibits an activity of c-maf, integrin β7 and/or cyclin D2.

12. The method of claim 11, wherein the inhibitor is a dominant negative form of c-maf; or a recombinant construct that expresses a dominant negative form of c-maf.

13. The method of claim 11 , wherein the inhibitor is an antibody specific for integrin β7; or an intracellular antibody specific for c-maf or cyclin D2.

14. The method of claim 1, wherein the c-maf activity is transcriptional activation of an integrin β7, cyclin D2 and/or C-C chemokine receptor-1 gene; promotion of cell proliferation; promotion of adhesion of the multiple myeloma cell to E-cadherin and/or to a bone marrow stromal cell; and/or induction of secretion of vascular endothelial growth factor (VEGF).

15. The method of claim 1, wherein the multiple myeloma cell is in a subject having multiple myeloma.

16. The method of claim 1 , wherein the multiple myeloma cell is contacted in vitro.

17. A method for inhibiting the adhesion of a multiple myeloma cell that expresses c-maf to a bone marrow stromal cell, comprising contacting the multiple myeloma cell with an effective amount of an inhibitor of c-maf expression and/or activity.

18. A method for inhibiting the adhesion of a multiple myeloma cell that expresses c-maf to a bone marrow stromal cell, comprising contacting the multiple myeloma cell with an effective amount of an inhibitor of integrin β7 expression and/or activity, and/or contacting the bone manow stromal cell with an effective amount of an inhibitor of E-cadherin expression and/or activity.

19. The method of claim 17 or 18, wherein the multiple myeloma cell overexpresses c-maf compared to a baseline value.

20. The method of claim 17 or 18, which is a method for reducing tumor cell adhesion to bone marrow stroma.

21. The method of claim 18, wherein the inhibitor of integrin β7 activity is an antibody specific for integrin β7, and the inhibitor of E-cadherin is an antibody specific for E-cadherein.

22. A method for inhibiting the transcriptional activation of an integrin β7, cyclin D2 and/or C-C chemokine receptor-1 gene in a multiple myeloma cell that expresses c-maf, comprising contacting the multiple myeloma cell with an effective amount of an inhibitor of c-maf expression and/or activity.

23. A method for treating multiple myeloma in a subject who has multiple myeloma cells that express c-maf, comprising administering to the subject an effective amount of an inhibitor of expression and/or activity of c-maf, integrin β7 and/or cyclin D2.

24. The method of claim 23, wherein the myeloma cells overexpress c-maf compared to a baseline value.

25. The method of claim 23 , wherein the inhibitor is an inhibitor of c-maf expression and/or activity.

26. The method of claim 23, wherein the inhibitor is an inhibitor of integrin β7 expression and/or activity.

27. The method of claim 23, wherein the inhibitor is an inhibitor of cyclin D2 expression and/or activity

28. The method of claim 23, further wherein the patient has been screened for the presence of overexpression of c-maf in his multiple myeloma cells prior to the treatment.

29. A method for treating multiple myeloma in a subject who has multiple myeloma cells that express c-maf, comprising administering to the subject an effective amount of an antibody specific for integrin β7, wherein the antibody is bound to a therapeutic agent.

30. A method for identifying an agent that inhibits the proliferation of multiple myeloma cells that express c-maf, and/or inhibits the adhesion of said multiple myeloma cells to bone marrow stromal cells, comprising a) contacting a multiple myeloma cell that expresses c-maf with a putative agent, and b) detecting the amount of expression and/or activity in the contacted cell of c- maf, integrin β7, cyclin D2 and/or C-C chemokine receptor-1, wherein an inhibition of the expression and/or activity of c-maf, integrin β7, cyclin D2 and/or C-C chemokine receptor-1, compared to its expression and/or activity in a similar multiple myeloma cell that has not been contacted with the putative agent, indicates that the putative agent inhibits the proliferation of multiple myeloma cells which express c-maf, and/or inhibits the adhesion of said multiple myeloma cells to bone manow stroma.

31. The method of claim 30, wherein the expression and/or activity of integrin β7 in the contacted cell is detected.

32. The method of claim 30, wherein the putative agent is an antisense molecule, a ribozyme, an siRNA, an antibody specific for c-maf, integrin β7, cyclin D2 or C-C chemokine receptor-1, or a small molecule.

33. A method for detecting multiple myeloma in a subject, comprising detecting the level of c-maf expression in a plasma cell of the subject, and comparing that level to a baseline value, wherein an increase in the level of c-maf in the subject compared to the baseline value indicates that the subject is suffering from multiple myeloma.

34. A method for identifying an aggressive form of multiple myeloma in a subject, comprising determining the level of c-maf expression in a multiple myeloma cell of the subject and comparing that level to a baseline value, wherein the overexpression of c-maf compared to the baseline value indicates that the multiple myeloma is an aggressive form.

35. The method of claim 34, wherein the multiple myeloma cell of the subject does not comprise a t(14; 16) (q32; q23) chromosome translocation.

36. A kit for inhibiting the proliferation, survival and/or migration of a multiple myeloma cell that expresses c-maf, or for inhibiting the adhesion of a multiple myeloma cell that expresses c-maf to a stromal cell, comprising an amount of an inliibitor of c-maf that is effective to inhibit said proliferation, survival, migration and/or adhesion.

37. A kit for identifying an agent that inhibits the proliferation of multiple myeloma cells that express c-maf, comprising a) a multiple myeloma cell that expresses c-maf, and b) means for detecting the expression or activity of c-ma integrin β7, cyclin D2 or C-C chemokine receptor-1.

38. A double stranded RNA, one of whose strands consists essentially of the sequence of SEQ ID NO: 12, or a active mutant or variant thereof.