CN108165543B - Rice adenosine deaminase OsAD1 and application of coding gene thereof in chloroplast gene RNA editing - Google Patents

Abstract

The invention discloses a rice adenosine deaminase OsAD1 and application of a coding gene thereof in chloroplast gene RNA editing, wherein the coding gene of the rice adenosine deaminase OsAD1 has a nucleotide sequence shown as SEQ ID No.1 in a sequence table, an amino acid sequence of the coding gene is shown as SEQ ID No.2, and the coding gene is an adenosine deaminase protein containing a nucleotide deaminase structural domain. When OsAD1 is transferred into rice, the transgenic material of the over-expressed OsAD1 gene has obvious yellowing phenotype in the seedling stage, and sequencing analysis shows that the sequence of a chlorophyll synthesis gene YGL1 in the transgenic material is changed, which indicates that OsAD1 participates in editing of the sequence of YGL1mRNA and also participates in editing of sequences of ndhD, ndhF and atpA genes, and provides a theoretical basis for further application of the gene.

Description

Rice adenosine deaminase OsAD1 and application of coding gene thereof in chloroplast gene RNA editing

Technical Field

The invention relates to the technical field of genetic engineering, in particular to application of rice adenosine deaminase OsAD1 and a coding gene thereof in chloroplast gene RNA editing.

Background

RNA editing is a processing modification that occurs at specific sites of nucleotides after transcription, including insertions, deletions, and substitutions of nucleotides, throughout all organisms, involving 3 RNA-encoding genes (mRNA, tRNA, rRNA) in mitochondria, chloroplasts, and nuclei. A great deal of research shows that RNA editing plays an important role in the growth and development process of animals and plants, so that the RNA editing becomes a research hotspot in the last two years^[1]。

Higher plant RNA editing occurs mainly in the coding regions of mitochondrial and chloroplast genes, and RNA editing is of various types, most typically the C → U transition and the A → I transition in plant organelles^[2]. Deaminase is an important catalytic protein in the process, belongs to an enzyme family for deaminating nucleoside substrates, and is involved in the metabolism and maintenance of pyrimidine and purine nucleosides in cells. (deoxy) cytidine Deaminase (Deoxycytidine Deaminase) which hydrolyzes (deoxy) cytosine to (deoxy) uracil, and can catalyze the conversion of adenine to hypoxanthine^[3]. To date, few studies have been reported on the function of deaminase involved in RNA editing in plants.

Recent research of Garcla-Andlade and the like shows that RNA editing plays an important regulation and control role in the process of plant disease-resistant immunity. Among all chloroplast functional genes, the most frequently edited is the NADH (plastoquinone oxidoreductase) dehydrogenase gene, and is concentrated in 5 genes, NdhA, NdhB, NdhD, NdhF, and NdhG^[4-6]. In response to pathogenic bacteriaEarly, pathogenic bacteria inhibited RNA editing in chloroplasts, affecting the normal amino acid sequence of each subunit (NdhB, NdhD, NdhF, and NdhG) of the NDH complex, thereby reducing the stability of the NDH complex. The decrease in stability of the NDH complex breaks the cyclic electron transport chain in photosystem I (PS I), resulting in local accumulation of ROS, formation of necrotic spots through programmed cell death, and ultimately in activation of disease resistance^[4-6]. It was found that deletion of RNA editing of each subunit of chloroplast NDH complex in crr21, crr2, ppra and ocp3 mutants resulted in decreased NDH complex activity, thereby enhancing disease resistance and callose accumulation in plants^[4-6]。

To date, there are very few reports on nucleotide deaminases in rice. AtTadA is an adenosine deaminase in Arabidopsis thaliana, and is able to catalyze tRNA in chloroplasts^ArgThe A in the (ACG) anticodon loop is converted to I. Deletion of the AtTadA gene seriously affects the translation efficiency of mRNA in chloroplasts, thereby impairing photosynthesis^[7]. 16 nucleotide deaminase genes are encoded in the Arabidopsis genome, of which 9 are cytidine deaminases, 6 are adenosine deaminases and 1 is deoxycytidine deaminase. AtTAD2 and AtTAD3 are involved in editing A → I at position 34 in 6 nuclear coding tRNAs, and AtTAD2 and AtTAD3 are necessary for normal growth and development of Arabidopsis thaliana, and deletion of the two genes causes abnormal embryonic development^[8]. ST2 encodes a dCMP deaminase which is involved in chloroplast development, but no editing site has been found^[9]. The editing site of the nucleotide deaminase in rice is not clear, and the functions of the nucleotide deaminase in rice in development and stress resistance are still needed to be further researched.

Reference documents:

[1]Knoop V.When you can't trust the DNA:RNA editing changes transcript sequences[J].Cell Mol Life Sci,2011,68(4):567-586

[2]Takenaka M,Verbitskiy D,van der Merwe J A,Zehrmann A,Brennicke A.The process of RNA editing in plant mitochondria[J].Mitochondrion,2008,8(1):35-46

[3]Xu J H,Messing J.Maize haplotype with a helitron-amplified cytidine deaminase gene copy[J].BMC Genet,2006,752

[4]Fujii S,Small I.The evolution of RNA editing and pentatricopeptide repeat genes[J].New Phytol,2011,191(1):37-47

[5]Garcia-Andrade J,Ramirez V,Lopez A,Vera P.Mediated plastid RNA editing in plant immunity[J].PLoS Pathog,2013,9(10):e1003713

[6]Gowda M,Venu R C,Li H,Jantasuriyarat C,Chen S,Bellizzi M,Pampanwar V,Kim H,Dean R A,Stahlberg E,Wing R,Soderlund C,Wang G L.Magnaporthe grisea infection triggers RNA variation and antisense transcript expression in rice[J].Plant Physiol,2007,144(1):524-533

[7]Delannoy E,Le Ret M,Faivre-Nitschke E,Estavillo G M,Bergdoll M,Taylor N L,Pogson B J,Small I,Imbault P,Gualberto J M.Arabidopsis tRNA adenosine deaminase arginine edits the wobble nucleotide of chloroplast tRNAArg(ACG)and is essential for efficient chloroplast translation[J].Plant Cell,2009,21(7):2058-2071

[8]Zhou W,Karcher D,Bock R(2014)Identification of enzymes for adenosine-to-inosine editing and discovery of cytidine-to-uridine editing in nucleus-encoded transfer RNAs of Arabidopsis.Plant Physiol 166(4):1985-1997

[9]Xu J,Deng Y,Li Q,Zhu X,He Z(2014)STRIPE2encodes a putative dCMP deaminase that plays an important role in chloroplast development in rice.J Genet Genomics 41 (10):539-548.

disclosure of Invention

Aiming at the defects of the prior art, the invention provides rice adenosine deaminase OsAD1 and application of a coding gene thereof in chloroplast gene RNA editing.

The coding gene of the rice adenosine deaminase OsAD1 has a nucleotide sequence shown as SEQ ID No.1 in a sequence table, the amino acid sequence of the coding gene is shown as SEQ ID No.2, and the protein is an adenosine deaminase protein containing a nucleotide deaminase structural domain.

The invention provides rice adenosine deaminase OsAD1 and application of a coding gene thereof in chloroplast gene RNA editing.

The coding gene of the rice adenosine deaminase OsAD1 is positioned in chloroplast.

The rice adenosine deaminase OsAD1 participates in RNA editing of rice chloroplast genes YGL1, ndhD, ndhF and atpA, influences the expression of the protein thereof, and further influences chlorophyll synthesis.

At present, the function of rice deaminase in RNA editing is not clear, the inventor discovers that a chlorophyll synthesis gene YGL1 sequence in a transgenic material is changed (figures 5 and 6) by obtaining transgenic rice of OsAD1 and obtaining transgenic material of OsAD1 gene in seedling stage (figure 4), and the sequencing analysis shows that OsAD1 participates in editing YGL1mRNA sequence and can also participate in editing ndhD, ndhF and atpA gene sequences (figures 7-12).

Drawings

FIG. 1 shows the results of the cloning of rice OsAD1 gene and the construction of expression vector; a: the electrophoretogram of the OsAD1 gene obtained by cloning; b: enzyme cutting electrophoresis picture of pCAMBIA1301p-OsAD1 expression vector.

FIG. 2 shows the result of subcellular localization analysis of OsAD1 protein.

FIG. 3 shows the identification result of OsAD1 gene overexpression transgenic plants.

FIG. 4 is a photograph of phenotype of OsAD1 gene overexpression transgenic line.

FIG. 5 shows the result of analysis of the change in the editing site of YGL1 gene in the OsAD1 transgenic line.

FIG. 6 shows the results of sequence variation analysis of YGL1 protein in OsAD1 transgenic line.

FIG. 7 shows the results of analysis of the change in editing sites of ndhD gene in OsAD1 transgenic lines.

FIG. 8 shows the results of sequence variation analysis of ndhD protein in OsAD1 gene-transferred strain.

FIG. 9 shows the results of analysis of the change in editing sites of ndhF gene in OsAD1 transgenic lines.

FIG. 10 shows the results of sequence variation analysis of ndhF protein in OsAD1 gene-transferred strain.

FIG. 11 shows the results of analysis of the atpA gene editing site changes in OsAD1 transgenic lines.

FIG. 12 shows the results of sequence change analysis of atpA protein in OsAD1 transgenic lines.

The specific implementation mode is as follows:

the invention will now be described in detail with reference to the drawings and examples, which are given by way of illustration and not by way of limitation. Unless otherwise indicated, the techniques used in the examples are conventional and well known to those skilled in the art and may be performed in accordance with the molecular cloning guidelines (J. SammBruk et al, Huangpetang et al, third edition, scientific Press) or related products, using commercially available reagents and products. Various procedures and methods not described in detail are conventional methods well known in the art, and the sources, trade names, and components of the reagents used are indicated at the time of first appearance, and the same reagents used thereafter are the same as those indicated at the first appearance, unless otherwise specified. The present invention is further illustrated by the following examples, in which the following experimental procedures and the media and reagents involved are all conventional in the art, and the reagents are all commercially available products.

Example 1 cloning of adenosine deaminase OsAD1 Gene in Rice

mRNA in rice leaves is extracted by using a TRIzol kit (Invitrogen, Chicago, USA), RNA is reversely transcribed into cDNA by using a First Strand cDNA Synthesis kit (TaKaRa, Dalian, China), and specific primers are designed according to sequences published in a rice genome website and NCBI for PCR amplification.

The specific primer sequences are as follows:

OsAD1-S1:ATGGTCGATGGTGTTGTCCATGTCT(SEQ ID NO.3)Tm＝57℃

OsAD1-A1:TTACTGGTCCACCTCGTCAGGTAA(SEQ ID NO.4)Tm＝57℃

the PCR reaction system is as follows: 2 μ L cDNA template, 2 μ L10 XPCR buffer 2.5 μ L, dNTP (2.5mM each), 2 μ L, Taq enzyme each for the forward (5 μ M) and reverse (5 μ M) primers, 0.5 μ L, Taq enzymeμL、ddH₂O12.75. mu.L, total volume 25. mu.L.

The PCR reaction program is: 94 ℃ for 5min, 94 ℃ for 30s, 57 ℃ for 30s, 72 ℃ for 45s, 30 cycles, 72 ℃ for 10 min.

Electrophoresis detection of the PCR product showed that a 1617bp fragment was obtained (FIG. 1A). The sequencing shows that the nucleic acid sequence is shown in a sequence table SEQ ID NO.1, and the coded amino acid sequence is shown in a sequence table SEQ ID NO.2 (538 amino acid protein).

Example 2 construction of pCAMBIA1301p-OsAD1 expression vector

PCR was carried out using the sequence cloned in example 1 as a template and the following primers containing the cleavage sites. The primer sequences are as follows

OsAD1-S2:TTGGATCCATGGTCGATGGTGTTGTCCATG (SEQ ID NO.5) Tm 57 ℃ underlined is the BamHI site

OsAD1-A2:TTCTGCAGTTACTGGTCCACCTCGTCAGGT (SEQ ID NO.6) Tm 57 ℃ is underlined and the PstI cleavage site is shown.

The PCR reaction system and the reaction procedure were the same as in example 1.

And connecting the PCR product with pMD18-T, sequencing, transforming the competence of escherichia coli, and then selecting a positive clone for sequencing. Selecting clone extraction plasmids with correct sequencing, carrying out enzyme digestion on pMD18-T plasmids by BamH and Pst I, simultaneously carrying out enzyme digestion on pCAMBIA1301P by the two enzymes, respectively recovering an OsAD1 fragment and a pCAMBIA1301P fragment, then connecting the fragments by T4 ligase, transforming escherichia coli competence, selecting positive clone extraction plasmids for enzyme digestion identification, and successfully constructing a pCAMBIA1301p-OsAD1 expression vector as shown in a result in figure 1B. The identified plasmid was transformed into agrobacterium LBA4404 for use.

Example 3 transformation of OsAD1 into Rice

(1) Taking mature and full rice seeds, manually shelling, putting into a 100ml sterile beaker, and sterilizing with 70% alcohol for 1 min; washing with sterile water for 2 times, and soaking in 100ml 30% sodium hypochlorite solution for 10 min; washing seeds with sterile distilled water for 3 times, and soaking in 100ml of 30% sodium hypochlorite solution for 10 min; washing the seeds with sterile distilled water for 5 times, and soaking for 20min for the last time.

(2) Putting the seeds on sterile filter paper for airing, and sowing the seeds in an induction culture medium with 12-14 seeds in each dish; sealing with sealing film, and culturing in 30 deg.C light incubator for 4 weeks;

(3) opening the culture dish on an ultraclean workbench, picking naturally-divided embryogenic callus (faint yellow, compact and spherical) with forceps, transferring into a subculture medium, and subculturing at 30 deg.C in an illumination incubator for 1-2 weeks to obtain mature callus.

(4) Mu.l of the successfully transformed Agrobacterium strain of example 2 was inoculated into 4ml of LB medium (containing 50mg L)^{- 1}Rif and 50mg L^-1Culturing kanamycin K at 28 ℃ and 220rpm for overnight under shaking;

(5) 1ml of this culture broth was transferred to 30ml of LB medium (containing 50mg L)^-1Rif and 50mg L^-1K) Shaking culture at 28 deg.C and 220rpm to obtain bacterial liquid OD₆₀₀0.8 to 1.0;

(6) 1ml of the bacterial solution is taken in a centrifuge tube, centrifuged for 1min at 4 ℃ and 4000rpm, and the supernatant is removed. With a solution containing 200. mu. mol L^-1A suspension was prepared from 30ml of an Agrobacterium liquid medium (AAM) solution in which acetosyringone (As) was suspended. Putting the rice callus growing to a certain size into the agrobacterium tumefaciens suspension for infection for 10 min;

(7) taking out the callus, placing on sterile filter paper, draining for 30-40min, transferring the callus to co-culture medium, and dark culturing at 19-20 deg.C for 3 d;

(8) the callus on the co-culture medium was placed in a 50ml Erlenmeyer flask and washed 6 times with sterile water. Then 500mg L of the extract^-1Soaking cefam penicillin (Cef) in sterile water for 1 h. Finally placing the mixture on sterile filter paper and draining for 2 hours;

(9) using a solution containing 250mg of L^-1Cef and 30mg L^-1The callus is selected by a selection medium of hygromycin (Hyg) for the first round of screening, and cultured in a light incubator for about 2 weeks at 30 ℃;

(10) transfer resistant calli to 250mg L^-1Cef and 40mg L^-1Performing a second round of screening on a Hyg culture medium, and culturing for about 10 days in an illumination incubator at 30 ℃;

(11) selecting resistance callus with bright yellow color from the selective culture medium, transferring into a pre-differentiation culture medium, culturing at 28 deg.C in dark for 5-7 days, transferring into a differentiation culture medium, culturing at 30 deg.C in an illumination culture box until the callus is differentiated into seedling. After the seedlings grow to about 1cm, putting the seedlings into a rooting culture medium;

(12) selecting root, stem and leaf, differentiating to obtain intact transgenic seedling, hardening for 3-4 days, transferring to cultivation tank, and culturing in greenhouse.

Example 4 subcellular localization of OsAD1 protein

PCR was carried out using the sequence cloned in example 1 as a template and the following primers containing the cleavage sites. The PCR primer sequences are as follows:

OsAD1-S3:TTGGATCCATGGTCGATGGTGTTGTCCATG (SEQ ID NO.7) Tm 57 ℃ underlined is BamHI cleavage site;

OsAD1-A3:TTCTGCAGCTGGTCCACCTCGTCAGGT (SEQ ID NO.8) Tm 57 ℃ is underlined and represents the PstI cleavage site.

The PCR product is connected with pMD18-T, then the competence of the escherichia coli is transformed, and positive clones are selected for sequencing. Selecting clone with correct sequencing to extract plasmid, then using BamH and Pst I to enzyme-cut pMD18-T plasmid, simultaneously using the two enzymes to enzyme-cut PHB-GFP expression vector, respectively recovering OsAD1 fragment and PHB-GFP fragment, then using T4 to connect, converting escherichia coli competence, selecting positive clone to extract plasmid to make enzyme-cut identification. And transforming the identified plasmid into a rice protoplast, culturing for two days, observing by using a laser confocal microscope, and taking a picture. The localization of the protein obtained by fusing the OsAD1 protein and the GFP fluorescent protein in chloroplasts is shown in FIG. 2, which indicates that the OsAD1 is localized in chloroplasts.

Example 5 identification of transgenic Rice

(1) Screening hygromycin resistance, and screening T of transgenic rice containing OsAD1₃And (3) harvesting seeds of the generation individual plants, selecting 30 seeds of each individual plant, putting the seeds into a culture dish, adding 50mL of hygromycin solution containing 30 mu g/mL, culturing for 6 days at 28 ℃ in a 16-hour photoperiod, observing the growth condition of the rice root system, and recording.

(2) Selecting a positive plant screened by hygromycin, extracting genome RNA, carrying out reverse transcription to obtain cDNA, using OsActin as an internal reference, and using an OsAD1 fragment primer to carry out semi-quantitative PCR reaction. The primer sequences are as follows:

OsAD1-S4:TTGGTTGATGATGAGAGTA(SEQ ID NO.9)

OsAD1-A4:AAGGAGTTGTTGCTTAAT(SEQ ID NO.10)

reaction procedure: 94 ℃ for 5min, (94 ℃ for 30s, 55 ℃ for 30s, 72 ℃ for 45s, 28 and 25 cycles), 72 ℃ for 10 min.

The PCR result is shown in FIG. 3, which indicates that OsAD1 transgenic rice is successfully obtained by the invention. And the expression of the gene in a transgenic strain is obviously higher than that of a WT strain.

Example 6 phenotypic Observation of transgenic Rice lines

The transgenic line and WT seeds are soaked in water for two days and then placed in a culture dish containing a rice nutrient solution for germination, observation and photographing are carried out after one week of germination, and the results are shown in a figure 4: the analysis of the transgenic strains at the seedling stage shows that the OsAD1 overexpression strain shows obvious etiolation phenotype.

Example 7 analysis of Gene editing sites in transgenic Rice lines

Taking leaves of WT and transgenic rice lines after one week of germination, extracting RNA, reverse transcribing into cDNA, amplifying YGL1, ndhD, ndhF and atpA genes by using the cDNA of different lines as a template, sequencing, measuring three clones of each gene, and analyzing the change of basic groups in the genes (figure 7-12).

The primers for cloning the genes were as follows:

YGL1-S:CAGTCTCCAATGGCCACCT(SEQ ID NO.11)

YGL1-A:TGCTTTCATCAGTGGCTGGT(SEQ ID NO.12)

ndhD-S:ATGAGTTCTTTTCCTTGG(SEQ ID NO.13)

ndhD-A:AGAGCGGACTAGTAGAAG(SEQ ID NO.14)

ndhF-S:TGCAATTTCTTTTCTTATGG(SEQ ID NO.15)

ndhF-A:TAGGAAAGCTACTTAGGC(SEQ ID NO.16)

atpA-S:CATGGAATGGAAGAGTTA(SEQ ID NO.17)

atpA-A:ACAAGAGTAGACGTGCAA(SEQ ID NO.18)

the study in example 6 revealed that the OsAD1 overexpression strain exhibited a distinct etiolated phenotype. While the yellowing of seedlings may be related to chlorophyll synthesis, the inventors continuously detected the sequence change of the chlorophyll synthesis gene YGL1 gene in the transgenic line, and the sequence analysis found that the sequence of the gene in the transgenic rice is changed, including the A → G transition at positions 323, 368 and 1107, the T → C transition at positions 391, 403, 534, 573 and 764, the G → C transition at position 490 and the T → A transition at position 781; the change in the gene editing site directly resulted in a change in the protein sequence, in which the leucine mutation at position 261 of the YGL1 protein in OE3 strain formed a termination codon, resulting in the failure of the protein to form a complete protein sequence (FIGS. 5 and 6).

Meanwhile, the inventor also analyzes the editing stable points of other genes in the chloroplast to find that the editing sites of 3 genes, namely ndhD, ndhF and atpA, are changed. Wherein ndhD is altered at two editing sites, including the C → T transition at position 877, C → G at position 883; the change in the gene sequence resulted in a change in the protein sequence, and two serines at positions 292 and 294 of the ndhD protein were converted into leucine and cysteine (fig. 7 and 8). ndhF has two editing site changes, sequence changes including C → T transitions at positions 61 and 245. Resulting in the conversion of only the 20 th amino acid position from serine to leucine (panels 9 and 10). atp has a change in the editing site, C → T transition at position 1225 of the gene sequence, resulting in the conversion of the amino acid at position 408 from serine to leucine (FIGS. 11 and 12). These results indicate that OsAD1 participates in chloroplast gene editing, and provides a theoretical basis for the next application of the gene.

SEQUENCE LISTING

<110> center for researching biotechnology of academy of agricultural sciences of Shandong province

<120> application of rice adenosine deaminase OsAD1 and coding gene thereof in chloroplast gene RNA editing

<130>

<160> 18

<170> PatentIn version 3.3

<210> 1

<211> 1617

<212> DNA

<213> Oryza.sativa L.

<400> 1

atggtcgatg gtgttgtcca tgtctatgca gataaagact atacggaaat actttatcct 60

gttgctgatg cgacaacctt ctttactgac ttgcattata tgctccgtgt gatttctgct 120

ggaaacacaa gaaccgtgtg ccataaccgg ttaaatcttt tagagcataa attcaaattt 180

catttgatgt taaacgcgga tagggagttt cttgcccaga agactgcacc acatcgtgat 240

ttttacaatg tcaggaaggt tgatactcat gtacaccact cagcgtgcat gaatcaaaaa 300

cacttgctga gatttataaa atccaaacta aggaaagaac ctgatgaggt tgtcattttc 360

agagacggca cttatatgac tctgaaggag gtttttgaga gcttggactt aactgggtat 420

gacttgaatg ttgatttact agatgtccat gcggacaaaa gtacatttca tcgttttgac 480

aaattcaacc ttaagtacaa tccgtgtggc caaagtaggc tcagagagat tttcctcaaa 540

caggacaatc ttatccaagg tcgttttctt gccgagctaa caaagcaagt tttctccgac 600

cttacagcaa gtaaatacca gatggctgaa tataggattt caatctatgg gaggaagcaa 660

agtgaatggg acaaccttgc aagctggata gtgaacaatg aattgtccag tgaaaatgtt 720

gtctggctgg ttcagatccc acgcttatat aatgtgtaca aggaaatggg tattgttaca 780

tcattccaaa ctcttctgga caacattttc cttcctctgt ttgaggtcac cattgatcca 840

gcttctcatc cgcagcttca cgtcttccta aagcaggttg tagggttaga tttggttgat 900

gatgagagta aacctgaaag gcgtccaaca aagcatatgc ctacacctga acaatggacc 960

aatgtcttca acccagcatt ttcatattat gcatattact gctatgctaa cttatacaca 1020

ctcaataagt tgcgtgaatc aaaagggatg accacaatca aattccgtcc acatgctggc 1080

gaggctggag acatcgatca cttggcagca acatttcttc tttgtcacaa tatatcgcat 1140

ggaatcaact taaggaaatc tcctgtgctt caatatctat actatcttgg ccagattggt 1200

ctggcaatgt ccccattaag caacaactcc ttgtttcttg attaccaccg gaatcctttc 1260

ccaatgtttt tccaacgagg cctgaatgtt tccctgtcaa cggatgatcc attgcaaatt 1320

cacctgacaa aagagccatt ggtggaagaa tacagcattg ctgcttcact ctggaagctc 1380

agttcttgtg atttatgtga aatagctaga aactctgtct atcaatcagg gttttcacat 1440

gctctcaagg cacactggat tggcaagaac tattacaaaa gaggacctac agggaacgat 1500

attcataaaa ctaatgtgcc tcacatcagg gttcagttta gggacttgat ttggagagat 1560

gagatgcgtc ttgtatacct aaacaatgtc atcttacctg acgaggtgga ccagtaa 1617

<210> 2

<211> 538

<212> PRT

<213> Oryza sativa L.

<400> 2

Met Val Asp Gly Val Val His Val Tyr Ala Asp Lys Asp Tyr Thr Glu

1 5 10 15

Ile Leu Tyr Pro Val Ala Asp Ala Thr Thr Phe Phe Thr Asp Leu His

20 25 30

Tyr Met Leu Arg Val Ile Ser Ala Gly Asn Thr Arg Thr Val Cys His

35 40 45

Asn Arg Leu Asn Leu Leu Glu His Lys Phe Lys Phe His Leu Met Leu

50 55 60

Asn Ala Asp Arg Glu Phe Leu Ala Gln Lys Thr Ala Pro His Arg Asp

65 70 75 80

Phe Tyr Asn Val Arg Lys Val Asp Thr His Val His His Ser Ala Cys

85 90 95

Met Asn Gln Lys His Leu Leu Arg Phe Ile Lys Ser Lys Leu Arg Lys

100 105 110

Glu Pro Asp Glu Val Val Ile Phe Arg Asp Gly Thr Tyr Met Thr Leu

115 120 125

Lys Glu Val Phe Glu Ser Leu Asp Leu Thr Gly Tyr Asp Leu Asn Val

130 135 140

Asp Leu Leu Asp Val His Ala Asp Lys Ser Thr Phe His Arg Phe Asp

145 150 155 160

Lys Phe Asn Leu Lys Tyr Asn Pro Cys Gly Gln Ser Arg Leu Arg Glu

165 170 175

Ile Phe Leu Lys Gln Asp Asn Leu Ile Gln Gly Arg Phe Leu Ala Glu

180 185 190

Leu Thr Lys Gln Val Phe Ser Asp Leu Thr Ala Ser Lys Tyr Gln Met

195 200 205

Ala Glu Tyr Arg Ile Ser Ile Tyr Gly Arg Lys Gln Ser Glu Trp Asp

210 215 220

Asn Leu Ala Ser Trp Ile Val Asn Asn Glu Leu Ser Ser Glu Asn Val

225 230 235 240

Val Trp Leu Val Gln Ile Pro Arg Leu Tyr Asn Val Tyr Lys Glu Met

245 250 255

Gly Ile Val Thr Ser Phe Gln Thr Leu Leu Asp Asn Ile Phe Leu Pro

260 265 270

Leu Phe Glu Val Thr Ile Asp Pro Ala Ser His Pro Gln Leu His Val

275 280 285

Phe Leu Lys Gln Val Val Gly Leu Asp Leu Val Asp Asp Glu Ser Lys

290 295 300

Pro Glu Arg Arg Pro Thr Lys His Met Pro Thr Pro Glu Gln Trp Thr

305 310 315 320

Asn Val Phe Asn Pro Ala Phe Ser Tyr Tyr Ala Tyr Tyr Cys Tyr Ala

325 330 335

Asn Leu Tyr Thr Leu Asn Lys Leu Arg Glu Ser Lys Gly Met Thr Thr

340 345 350

Ile Lys Phe Arg Pro His Ala Gly Glu Ala Gly Asp Ile Asp His Leu

355 360 365

Ala Ala Thr Phe Leu Leu Cys His Asn Ile Ser His Gly Ile Asn Leu

370 375 380

Arg Lys Ser Pro Val Leu Gln Tyr Leu Tyr Tyr Leu Gly Gln Ile Gly

385 390 395 400

Leu Ala Met Ser Pro Leu Ser Asn Asn Ser Leu Phe Leu Asp Tyr His

405 410 415

Arg Asn Pro Phe Pro Met Phe Phe Gln Arg Gly Leu Asn Val Ser Leu

420 425 430

Ser Thr Asp Asp Pro Leu Gln Ile His Leu Thr Lys Glu Pro Leu Val

435 440 445

Glu Glu Tyr Ser Ile Ala Ala Ser Leu Trp Lys Leu Ser Ser Cys Asp

450 455 460

Leu Cys Glu Ile Ala Arg Asn Ser Val Tyr Gln Ser Gly Phe Ser His

465 470 475 480

Ala Leu Lys Ala His Trp Ile Gly Lys Asn Tyr Tyr Lys Arg Gly Pro

485 490 495

Thr Gly Asn Asp Ile His Lys Thr Asn Val Pro His Ile Arg Val Gln

500 505 510

Phe Arg Asp Leu Ile Trp Arg Asp Glu Met Arg Leu Val Tyr Leu Asn

515 520 525

Asn Val Ile Leu Pro Asp Glu Val Asp Gln

530 535

<210> 3

<211> 24

<212> DNA

<213> Artificial

<400> 3

ttactggtcc acctcgtcag gtaa 24

<210> 4

<211> 30

<212> DNA

<213> Artificial

<400> 4

ttggatccat ggtcgatggt gttgtccatg 30

<210> 5

<211> 30

<212> DNA

<213> Artificial

<400> 5

ttctgcagtt actggtccac ctcgtcaggt 30

<210> 6

<211> 30

<212> DNA

<213> Artificial

<400> 6

ttggatccat ggtcgatggt gttgtccatg 30

<210> 7

<211> 27

<212> DNA

<213> Artificial

<400> 7

ttctgcagct ggtccacctc gtcaggt 27

<210> 8

<211> 19

<212> DNA

<213> Artificial

<400> 8

ttggttgatg atgagagta 19

<210> 9

<211> 18

<212> DNA

<213> Artificial

<400> 9

aaggagttgt tgcttaat 18

<210> 10

<211> 19

<212> DNA

<213> Artificial

<400> 10

cagtctccaa tggccacct 19

<210> 11

<211> 20

<212> DNA

<213> Artificial

<400> 11

tgctttcatc agtggctggt 20

<210> 12

<211> 18

<212> DNA

<213> Artificial

<400> 12

atgagttctt ttccttgg 18

<210> 13

<211> 18

<212> DNA

<213> Artificial

<400> 13

agagcggact agtagaag 18

<210> 14

<211> 20

<212> DNA

<213> Artificial

<400> 14

tgcaatttct tttcttatgg 20

<210> 15

<211> 18

<212> DNA

<213> Artificial

<400> 15

taggaaagct acttaggc 18

<210> 16

<211> 18

<212> DNA

<213> Artificial

<400> 16

catggaatgg aagagtta 18

<210> 17

<211> 18

<212> DNA

<213> Artificial

<400> 17

acaagagtag acgtgcaa 18

<210> 18

<211> 25

<212> DNA

<213> Artificial

<400> 18

atggtcgatg gtgttgtcca tgtct 25

Claims (5)

1. The application of the rice adenosine deaminase OsAD1 in chloroplast gene RNA editing is characterized in that the sequence of the rice adenosine deaminase OsAD1 is shown as SEQ ID No. 2;

the rice adenosine deaminase OsAD1 participates in RNA editing of rice chloroplast genes YGL1, ndhD, ndhF and atpA, influences the expression of the protein thereof, and further influences chlorophyll synthesis;

the YGL1 gene RNA editing process has gene sequence changes of A → G transition at positions 323, 368 and 1107, T → C transition at positions 391, 403, 534, 573 and 764, G → C transition at position 490 and T → A transition at position 781; a mutation of the leucine encoding the protein at position 261 into the stop codon;

the change of the gene sequence in the process of editing the NDhD gene RNA is the conversion of C → T at the 877 position and C → G at the 883 position; the two serines at positions 292 and 294 of the encoded protein are converted into leucine and cysteine;

the change of the gene sequence in the process of editing the NDhF gene RNA is the conversion of C → T at the 61 th site and the 245 th site; the amino acid at the position 20 of the encoded protein is converted from serine to leucine;

the change of gene sequence in the process of editing ATpA gene RNA is the conversion of C → T at position 1225; it encodes a protein in which serine at position 408 is converted to leucine.

2. The application of claim 1, wherein the coding gene of the rice adenosine deaminase OsAD1 has the sequence shown in SEQ ID No. 1.

3. The use according to claim 1, wherein the gene encoding rice adenosine deaminase OsAD1 is localized in chloroplasts.

4. A method for obtaining etiolated seedlings is characterized in that a coding gene of rice adenosine deaminase OsAD1 is transferred into rice, and the rice adenosine deaminase OsAD1 is overexpressed; the rice adenosine deaminase OsAD1 participates in rice chloroplast genesYGL1mRNA、ndhD，ndhFAndatpAthe RNA editing of (1) and influences the synthesis of rice chlorophyll;

the sequence of the rice adenosine deaminase OsAD1 is shown in SEQ ID NO. 2;

the YGL1 gene RNA editing process has gene sequence changes of A → G transition at positions 323, 368 and 1107, T → C transition at positions 391, 403, 534, 573 and 764, G → C transition at position 490 and T → A transition at position 781; a mutation of the leucine encoding the protein at position 261 into the stop codon;

the change of the gene sequence in the process of editing the NDhD gene RNA is the conversion of C → T at the 877 position and C → G at the 883 position; the two serines at positions 292 and 294 of the encoded protein are converted into leucine and cysteine;

the change of the gene sequence in the process of editing the NDhF gene RNA is the conversion of C → T at the 61 th site and the 245 th site; the amino acid at the position 20 of the encoded protein is converted from serine to leucine;

the change of gene sequence in the process of editing ATpA gene RNA is the conversion of C → T at position 1225; it encodes a protein in which serine at position 408 is converted to leucine.

5. The method as claimed in claim 4, wherein the gene encoding the adenosine deaminase OsAD1 is transferred into rice by constructing pCAMBIA1301p-OsAD1 expression vector and transferring the vector into rice by means of transgene.

Images