CN116655758B

CN116655758B - IlMYB5 protein, and coding gene and application thereof

Info

Publication number: CN116655758B
Application number: CN202310453227.0A
Authority: CN
Inventors: 王玲; 孙炜伦; 杨娟; 刘桂伶; 王好
Original assignee: Northeast Forestry University
Current assignee: Northeast Forestry University
Priority date: 2023-04-25
Filing date: 2023-04-25
Publication date: 2024-06-07
Anticipated expiration: 2043-04-25
Also published as: CN116655758A

Abstract

The invention belongs to the technical field of molecular biology, and discloses IlMYB protein, a coding gene thereof and application thereof in color regulation and control. The amino acid sequence of IlMYB protein is shown as SEQ ID NO.1, and the nucleotide sequence of coded IlMYB protein is shown as SEQ ID NO. 2. The over-expression IlMYB gene in tobacco can raise the sensitivity of tobacco corolla to light, and its coloring period is advanced, and its flower colour is deepened after it is fully bloomed. The IlMYB protein and the coding gene thereof provided by the invention not only can provide an important theoretical basis for the research on the regulation and control of the flower color of the swallow, but also can be used as an excellent gene resource to be applied to the flower color breeding of other flower plants.

Description

IlMYB5 protein, and coding gene and application thereof

Technical Field

The invention belongs to the technical field of molecular biology, and particularly relates to IlMYB protein, a coding gene thereof and application thereof in anthocyanin synthesis and accumulation.

Background

The flower color is one of important quality traits of ornamental flowers, and is an important index for evaluating ornamental value and economic value of flowers. In plant flower color breeding, researchers often adopt various breeding methods such as hybridization, mutagenesis, genetic engineering and the like to change plant flower colors and create novel colors, so that flower color varieties in plant application are greatly enriched, especially flower color breeding by means of molecular biology means overcomes the problem of color breeding which cannot be solved by conventional breeding, shortens the breeding period, and has wide application prospects in modern flower breeding. Anthocyanin is the main substance of plant flower color formation, and the biosynthesis pathway and the regulation mechanism thereof have been widely studied in model plants. MYB is the largest transcription factor family of plants, plays an important role in flower color regulation, for example, the transcription factors of Arabidopsis PAP1, PAP2, MYB113 and MYB114 can directly regulate and control the transcription level of structural genes in anthocyanin synthesis paths, promote synthesis and accumulation of anthocyanin, and further influence flower color of plants.

The swallow flower (IRIS LAEVIGATA) is a blue aquatic flower commonly used for landscaping in northeast China, has bright flower color, beautiful flower shape and extremely strong cold resistance. At present, research on the molecular level of flower color formation of the swallow flowers is mainly focused on cloning and expression analysis of structural genes in anthocyanin biosynthesis pathways, but research on transcription regulation is not clear, and particularly, research on flower color regulation of MYB is not reported.

Disclosure of Invention

To overcome the shortcomings and drawbacks of the prior art, a primary object of the present invention is to provide a IlMYB protein.

Another object of the present invention is to provide a gene encoding the IlMYB protein and its use in regulating plant anthocyanin synthesis and accumulation.

The aim of the invention is achieved by the following technical scheme:

IlMYB5 protein, which is a protein having a sequence represented by the following (A1) or (A2):

(A1) A protein consisting of the amino acid sequence shown in SEQ ID NO. 1;

(A2) And (3) the protein derived from (A1) with the same function is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID NO. 1.

A gene encoding IlMYB protein, characterized by comprising either (B1) or (B2) as follows:

(B1) The nucleotide sequence is cDNA shown as SEQ ID NO.2 in the sequence table;

(B2) The cDNA having 85% or more similarity with the nucleotide sequence defined in (B1) and encoding IlMYB protein described in (B1).

A biomaterial associated with IlMYB protein comprising any one of the following:

(C1) A recombinant plant expression vector comprising a gene encoding IlMYB protein;

(C2) A recombinant plant expression vector obtained by connecting a tag to the N-terminal or/and the C-terminal of the gene (C1);

(C3) A bioengineering bacterium comprising the recombinant plant expression vector of (C1) or (C2);

(C4) A transgenic plant comprising the recombinant plant expression vector of (C1) or (C2).

A biomaterial associated with IlMYB protein, characterized in that: the plant expression vector is pCAMBIA1302.

A biomaterial associated with IlMYB protein, characterized in that: the bioengineering bacteria is agrobacterium GV3101.

A method of introducing a recombinant plant expression vector into a recipient plant, characterized by: the recombinant plant expression vector containing IlMYB gene is used to transform plant tissue through agrobacterium-mediated process and the transformed plant tissue is cultured into plant.

Use of IlMYB protein to regulate plant anthocyanin synthesis and accumulation, wherein the use comprises any one of:

(D1) Regulating and controlling the anthocyanin content of plants;

(D2) Regulating and controlling the coloring period of the corolla of the plant;

(D3) Preparing the related products in (D1) - (D2);

(D4) Cultivating the relevant plants in (D1) to (D2).

A method for regulating synthesis and accumulation of plant anthocyanin, which is characterized in that:

(E1) Introducing a recombinant plant expression vector comprising the IlMYB gene into a recipient plant;

(E2) Knocking out or silencing the coding IlMYB gene, inactivating or reducing its function.

Compared with the prior art, the invention has the following advantages and effects:

(1) According to the invention, a IlMYB gene is cloned from the swallow flower, a recombinant plant expression vector is successfully constructed, and an agrobacterium transformation method is adopted to transform the recombinant plant expression vector containing IlMYB gene into model plant tobacco, so that compared with wild type tobacco, the sensitivity of the tobacco corolla to light can be improved by introducing IlMYB gene, the coloring period is advanced, the corolla starts to synthesize and accumulate anthocyanin after receiving a light signal, and the anthocyanin of the whole corolla is improved by more than 2 times compared with wild type tobacco after being fully bloomed, which means that IlMYB gene has the functions of promoting the forward synthesis of anthocyanin and regulating the deepening of plant flower color.

(2) The IlMYB gene provided by the invention can be widely applied to the field of plant genetic breeding as an excellent gene resource, and plays an important role in molecular breeding for changing flower color and accumulating anthocyanin.

Drawings

FIG. 1 is a double restriction map of a recombinant plant expression vector, wherein M is DL10000 Marker, lane 1 is the plasmid pCAMBIA 1302-IlMYB-GFP of the recombinant plant expression vector, and lane 2 is the result of double restriction of the recombinant plant expression vector pCAMBIA 1302-IlMYB-GFP.

FIG. 2 is a PCR identification electrophoretogram of transgenic tobacco, wherein M is DL2000 Marker, lane 1 is recombinant plant expression vector pCAMBIA 1302-IlMYB-GFP plasmid, lane 2 is wild type tobacco, and lanes 3-8 are 6 transgenic tobacco lines.

FIG. 3 is a graph of wild-type and transgenic IlMYB gene tobacco corolla phenotype and anthocyanin content, where WT is wild-type tobacco, OE1, OE2, OE3 are three lines of transgenic tobacco.

FIG. 4 shows the expression pattern of related genes on anthocyanin synthesis pathways in the corolla of transgenic IlMYB-gene tobacco, where WT is wild-type tobacco and OE is transgenic tobacco.

Detailed Description

The invention aims to overcome the defects in the prior art and provides IlMYB protein, a coding gene thereof and application thereof in regulating and controlling plant flower colors. The invention relates to gene cloning, plant expression vector construction, genetic transformation, molecular detection and real-time fluorescence quantification, and establishes a method for stably improving plant anthocyanin accumulation and deepening plant flower color.

The relevant culture medium formulation method in the examples is as follows:

LB liquid Medium (100 mL): 0.5g yeast extract+1 g tryptone+1 g sodium chloride

LB solid medium (100 mL): 0.5g yeast extract+1 g tryptone+1 g sodium chloride+1.5 g agar

YEP liquid medium (100 mL): 1g yeast extract+1 g tryptone+0.5 g sodium chloride

YEP solid medium (100 mL): 1g yeast extract+1 g tryptone+0.5 g sodium chloride+1.5 g agar

MS1 medium: MS+6BA 1.0mg/L+NAA 0.05mg/L

MS2 medium: 1/2MS+6BA 1.0mg/L+NAA 0.05mg/L+Hyg 20 mg/L+Tintin 200mg/L

MS3 culture medium 1/2MS+6BA 1.0mg/L+NAA 0.05 mg/L+Hyg25mg/L+Tintin 200mg/L

MS4 culture medium 1/2MS+NAA 0.1mg/L+Hyg 25 mg/L+Tintin 200mg/L

EXAMPLE 1IlMYB Gene cloning

1. Extraction of total RNA from plants

The total RNA of the plants is extracted by OminiPlant RNA Kit (Dnase I) (century, china) kit, and the extraction steps are carried out according to the specification.

2. CDNA Synthesis

CDNA was synthesized using PRIMESCRIPT ^TM RT REAGENT KIT WITH GDNA ERASER (PERFECT REAL TIME) (Takara, japan) kit, and the procedure was followed according to the instructions.

3. Gene cloning

Primer 5 software is used for designing a swallow flower MYB5 gene clone specific Primer, and the Primer sequence is as follows:

IlMYB5-F1:5’-AGAGCTCCTTGTTGTGAGAAAGTGGGACTGAAT-3’

IlMYB5-R1:5’-TGGCTTCAATGAATCAAGAATCTGATGATGATC-3’

A50. Mu.L reaction system was prepared in pcr tubes, which included 2. Mu.L of template cDNA, 25. Mu.L of 2X PCR buffer for KOD FX, 10. Mu.L of 2mM dNTPs, 1. Mu.L of each of the upstream and downstream primers, 1. Mu.L of KOD FX and 10. Mu.L of ddH ₂ O, and the sample addition was performed on ice, and after the addition, the mixture was homogenized and centrifuged.

The PCR reaction procedure was: 94 ℃ for 2min; cycling for 35 times at 98 ℃ for 10s,58 ℃ for 30s and 68 ℃ for 90 s; and at 68℃for 10min.

After the PCR reaction is finished, detecting an amplification result by using 1% agarose gel electrophoresis, recovering a target strip, connecting a target fragment to a cloning vector PEASY-Blunt-Zero (full-gold, china), coating the target fragment on an LB solid medium after transforming escherichia coli, carrying out inversion culture at 37 ℃ overnight, picking up a monoclonal for PCR identification the next day, carrying out shaking culture on the identified correct strain in 10mL of LB liquid medium at 37 ℃ for 10h, taking 1mL of bacterial liquid, sending to a biological company for sequencing, and obtaining an ORF sequence of IlMYB after sequencing. The IlMYB gene sequence was submitted to NC BI, genBank accession No. OQ243218.

The nucleotide sequence of IlMYB gene is shown below:

ATGGGGAGAGCTCCTTGTTGTGAGAAAGTGGGACTGAATAGAGGGCCTTGGACCAAGGAAGAAGAT

ATGCTTCTCACCCGCTTCATCGTCGCCAATGGGGAAGGAGGGTGGCGGCATCTGCCCAAGTCTGCAG

GGCTACTTCGATGTGGGAAGAGCTGCAGGCTGCGCTGGATTAACTACCTCCGCCCGGGTCTTAAACG

AGGGAACATCACAGAAGAGGAGGACCGACTTATAATGGAGATGCACACCATGTTAGGAAACAGGTGG

TCACTAATTGCTGCCCGGTTGCCTGGACGAACTGACAACGAAATCAAGAACTACTGGAACACTCATC

TCAAGAAAAAGAAGACAAGATTGGCAGAGCAGAAGCAAGATCAAGAACAGAAGCCTCCATTAAACC

TGATTAATAATTCATTAAACGGGACTAGCAGCGCGATTAACAAGGAGAACACTAATCCAATCCCCTCTA

ACCCATCCCTAATCCACCCCATTAAGCCCAGCAAAAGCAATAACATGAATGATAATCAGATGTGCTTCC

GAGCTCGACCTCTCTACTCTCTCGATCCCAACTCTCTAAGCACCCTCCCTAAGCTTCATGATCACCACC

CTAATCCTAATTATCTCCCTAATCCTTCCATTAATTGTCCCGGATATCCACTCACGTCCACCCGAAACAT

CACTGCCATCACCCCATATAATTCTGTCAACCCTAATAACGGAGTTAATACAGGTGCTAATGATGGGATT

AGTAGCAATGATGGTAATAGGGTGAATAATGAAGGCTATATTGATGAAGGGTTTATGTTGATGATGAGG

AATTCATCTTCTTCTCATCTTTTGTTGGGTCCTCCTACTAATACTAATATTAATACTAGTACTAGTATTACT

ACTCCTAGGTTGATGAGGGCACCTTCTTCGGCTTCTTCCTCCTCTTCCGGCATATCCATGGAGAGACTA

CGCAGTACTCGATCTGACATTAGCACCTCGAGAAATAACATCCGCGCCATTGTTAGCTTCTTGGAGATG

GACACTAATAACAACTTTCGCACCACTAATCTTTCTCCTATTCCTACTACTACCACTACTGCTGCTACTG

CTGACACTTGTAGCAGTAGTACTATTGATCTAGCCTATGCCTTCAATGATCTTATTTGTGAGGAAAAGC

TGAACCATCATTCTCCGTTGTTCATCCAAGAGACTCATATCGACCACCTTGCAGTGGCTGATTTGGAGC

ACCTCTTCATTGCACAAGATGAAGTTGACGAGAGTTCTACACTGCTCTTGGGTGATGACCATGGCCAA

GCCTATTGTTGGGATTTCACCCAACAAGATGATCATCATCAGATTCTTGATTCATTGAAGCCACAGGAC

TAA

the ORF region of the IlMYB gene contains 1374 bases, encodes 457 amino acids, and has the amino acid sequence shown below:

MGRAPCCEKVGLNRGPWTKEEDMLLTRFIVANGEGGWRHLPKSAGLLRCGKSCRLRWINYLRPGLKRGNITEEEDRLIMEMHTMLGNRWSLIAARLPGRTDNEIKNYWNTHLKKKKTRLAEQKQDQEQKPPLNLINNSLNGTSSAINKENTNPIPSNPSLIHPIKPSKSNNMNDNQMCFRARPLYSLDPNSLSTLPKLHDHHPNPNYLPNPSINCPGYPLTSTRNITAITPYNSVNPNNGVNTGANDGISSNDGNRVNNEGYIDEGFMLMMRNSSSSHLLLGPPTNTNINTSTSITTPRLMRAPSSASSSSSGISMERLRSTRSDISTSRNNIRAIVSFLEMDTNNNFRTTNLSPIPTTTTTAATADTCSSSTIDLAYAFNDLICEEKLNHHSPLFIQETHIDHLAVADLEHLFIAQDEVDESSTLLLGDDHGQAYCWDFTQQDDHHQILDSLKPQD

EXAMPLE 2 construction of plant expression vectors

In this example, a plant expression vector was constructed comprising the steps of:

(1) The primers of the homologous arms of the vectors with the Nco I enzyme cutting site and the Bgl II enzyme cutting site are designed through a primer design small program (https:// crm.vazyme.com/cetool/simple.html) on the official line of the Norwegian, and PCR amplification is carried out by taking a BluntZero-IlMYB cloning vector plasmid as a template, aiming at adding pCAMBIA1302 vector homologous arms at two ends of IlMYB gene ORF region, and the target fragment is recovered after the PCR is finished. Vector homology arm primers (underlined as Nco I and Bgl II cleavage sites) are as follows:

IlMYB5 F2:5’-ACGGGGGACTCTTGACCATGGATGGGGAGAGCTCCTTGTTGT-3’

IlMYB5 R2:5’-TCTCCTTTACTAGTCAGATCTGTCCTGTGGCTTCAATGAATCAA-3’

(2) The vector pCAMBIA1302 is subjected to double enzyme digestion by using restriction enzymes Nco I and Bgl II to obtain a linearization vector, then the linearization vector is connected with a target fragment by using a homologous recombination kit (Noruzhan, china), competent DH5 alpha of escherichia coli is transformed, and bacterial liquid containing the target fragment is subjected to plasmid extraction by coating and bacterial liquid PCR. The extracted plasmid was subjected to double cleavage verification (BamH I and Bgl II), and the result showed that the recombinant plasmid was significantly cut into two bands, thereby demonstrating that IlMYB was successfully ligated with pCAMBIA1302-GFP vector and that the plant expression vector was constructed successfully (FIG. 1).

Example 3 Agrobacterium-mediated transformation of tobacco

1. Cultivation of aseptic seedlings of tobacco

Placing a plurality of wild tobacco seeds into a sterile 1.5mL centrifuge tube, sterilizing with 75% alcohol in a sterile workbench for 1min, washing with sterile water for 3 times, sterilizing with 1% NaClO for 10min, washing with sterile water for 5 times, inoculating onto MS culture medium, and culturing under normal illumination at 25deg.C to obtain aseptic tobacco seedlings.

2. Preparation of the dyeing liquor

(1) The pCAMBIA 1302-IlMYB-GFP plasmid was transformed into Agrobacterium competent GV3101 (Veidi, china) and spread on YE P solid medium, and the transformation procedure was followed by inversion and dark culture at 28℃for 36 h;

(2) Selecting a monoclonal to carry out PCR identification, and carrying out amplification culture on the colony with correct identification in 10mL of YEP liquid culture medium containing 50mg/L Kana and 25mg/L Rif, wherein the temperature is 28 ℃ and the shaking culture is carried out at 180rpm for 12-16h;

(3) 1mL of bacterial liquid is sucked and added into 50mL of YEB liquid culture medium containing 50mg/L Kana and 25mg/L Rif for continuous expansion culture until OD ₆₀₀ reaches 0.6-0.8;

(4) Centrifuging the cultured bacterial liquid at 4 ℃ and 5000rpm for 5min, discarding supernatant under aseptic condition, suspending bacterial precipitate with an equal volume (50 mL) of 1/2MS osmotic culture medium (pH 5.8), and placing on ice for tobacco infection.

3. Tobacco infection

(1) Pre-culturing. Cutting sterile tobacco seedling leaf into 1cm×1cm small blocks, placing in MS1 solid culture medium (leaf upper surface upward), and pre-culturing for 2 days (light culture and dark culture);

(2) And (5) infection. Pouring the resuspended bacterial liquid into a sterile small conical flask in an ultra-clean workbench, taking out tobacco leaves which are pre-cultured for 2 days, putting the tobacco leaves into the bacterial liquid, soaking for 5min, taking out the leaves, putting the leaves on sterile filter paper to suck the bacterial liquid attached to the surfaces of the leaves, and simultaneously setting a leaf disc which is not infected by agrobacterium as a negative control;

(3) Co-culturing. Inoculating the infected tobacco leaves on an MS1 culture medium (the upper surfaces of the leaves face upwards), sealing by using a sealing film, and performing dark co-culture at 28 ℃ for 2 days;

(4) And (5) selecting and culturing. The co-cultured leaf explants are transferred to a degerming differentiation or callus induction medium MS2 for resistance screening. The back of the leaf is downward, the edge is pressed into the culture medium, and the leaf is cultivated under the illumination of 25 ℃;

(5) And (5) subculturing. Inoculating tobacco leaf on MS3 culture medium for subculture for about 1-2 weeks, culturing for 7-15 days to obtain visible callus formation, and growing differentiation bud after about 20 days;

(6) Rooting culture. When the plant grows about 1cm adventitious bud, cutting off, placing on a rooting culture medium MS4 containing selective pressure for rooting culture, and growing adventitious roots about 7-10 days;

(7) Transplanting transgenic tobacco. After the root system is developed, taking out the plant, cleaning a solid culture medium attached to the plant by using sterile water, transferring the solid culture medium into soil, covering the plant with a plastic cup for several days, taking down the plastic cup after the plant is strong, and culturing in a greenhouse;

(8) Extracting DNA from the obtained transgenic tobacco plants, carrying out PCR identification by adopting IlMYB homology arm primers, and screening transgenic positive tobacco plants;

(9) 3 transgenic positive tobacco strains are selected for anthocyanin content analysis, and the specific operation steps are as follows:

a: preparation of the extract: 0.1mol/L hydrochloric acid ethanol solution (8.3 mL concentrated hydrochloric acid diluted to 1L with 95% ethanol).

B: taking 1g of tobacco leaves and a proper amount of liquid nitrogen, putting into a mortar, grinding into powder, taking out the powder, putting into a centrifuge tube which is prepared in advance and is filled with 10ml of 0.1mol/L ethanol hydrochloride solution, leaching in a water bath at 60 ℃ for 30min, centrifuging at 5000rpm for 5min, and taking the supernatant to detect anthocyanin.

C: the supernatants were poured into cuvettes and OD values were measured at 530, 620 and 650nm, respectively. According to the formula:

optical density value of anthocyanin: OD _λ＝(OD₅₃₀-OD₆₂₀)-0.1(OD₆₅₀-OD₆₂₀) Wherein OD _λ = optical density of anthocyanidin at 530nm wavelength; epsilon=anthocyanin molar extinction coefficient 4.62×10 ⁶; v = total volume of extract (ml); m=sampling quality (g); 1000000: the calculation results are converted into multiples of nmol.

Wild tobacco plants were used as controls.

(10) Recording the growth and development processes of the 3 transgenic positive tobacco strains in the step (9), and finding that the sensitivity of the transgenic tobacco corolla to light is improved, and synthesizing and accumulating anthocyanin after receiving a light signal, so that the color period of the corolla is obviously advanced, and the color is deepened after full bloom. The IlMYB protein has the functions of promoting anthocyanin forward synthesis and regulating plant flower color deepening.

(11) RT-qPCR (reverse transcription-quantitative polymerase chain reaction) detection of expression patterns of anthocyanin synthesis pathway related genes in transgenic tobacco corolla: the colored tobacco corolla is taken, ground by adding liquid nitrogen, RNA is extracted, cDNA is obtained through reverse transcription, and the cDNA is diluted 10 times and then used as an RT-qPCR template. The reaction system was 20. Mu.L, which included 7. Mu.L deionized water, 2. Mu.L cDNA template, 0.5. Mu.L specific upstream and downstream primers, and 10. Mu.L each of 2 XSYBR dye. The amplification procedure was: pre-denaturation at 95 ℃ for 10min, denaturation at 95 ℃ for 10s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 30s, cycling 45 times, extension at 72 ℃ for 7min, the reaction was completed on a LIGHT CYCLER fluorescent quantitative PCR instrument, the results were calculated with 2 ^-△△CT, the significance of the data was analyzed with SPSS, and plotted with Origin Pro 8.0. Wherein wild-type tobacco plants were used as controls, 3 biological replicates were set.

The quantitative analysis specific primers for the tobacco anthocyanin synthesis pathway related genes for RT-qPCR detection are shown in Table 1:

TABLE 1 tobacco fluorescent quantitative primers

Analysis of results:

(1) Identification of transgenic positive plants

DNA was extracted from the 6 obtained transgenic tobacco lines, PCR identification was performed using the vector homology arm primer of IlMYB gene, wild type tobacco was negative control, recombinant plasmid was positive control, and the results showed that the 6 transgenic tobacco lines all contained the target band, which indicated that IlMYB gene had been successfully inserted into the tobacco genome (FIG. 2).

(2) Anthocyanin content detection of transgenic tobacco

Experimental results show that the anthocyanin content in the wild type tobacco corolla is 99.796nmol/g, and the anthocyanin content in the corolla of the 3 transgenic IlMYB5 gene tobacco lines is 275.115nmol/g, 229.890nmol/g and 148.223nmol/g on average, and the data fully show that the over-expression of IlMYB genes significantly improves the anthocyanin content in the tobacco corolla (figure 3).

(3) Quantitative analysis of tobacco anthocyanin synthesis pathway related genes

The RT-qPCR result shows that the over-expression of IlMYB gene obviously improves the expression quantity of UFGT and AN2 in tobacco corolla, and is improved by 14 and 18 times compared with the wild type. In addition, the expression level of the optical signal factor HY5 is also improved, so that the early synthesis of anthocyanin and the mass accumulation of anthocyanin by the transgenic tobacco corolla in response to the optical signal are probably due to the over-expression of the optical signal factor HY5, the expression of a downstream anthocyanin synthesis transcription factor gene AN2 is activated, and further the AN2 positively regulates UFGT, so that the color of the transgenic tobacco is deepened (figure 4).

Claims

1. IlMYB5 protein, the protein sequence of which is shown as SEQ ID NO. 1.

2. A gene encoding the IlMYB protein of claim 1, wherein the nucleotide sequence is the cDNA of SEQ ID No.2 in the sequence listing.

3. Use of the IlMYB gene according to claim 2 to promote synthesis and accumulation of anthocyanin in recipient plants, wherein said IlMYB gene is overexpressed in Yan Hua or Nicotiana tabacum.