CN108152274A - A kind of method for carrying out quantitative detection to serum miRNA using RNase ONE nucleases and chemiluminescence - Google Patents
A kind of method for carrying out quantitative detection to serum miRNA using RNase ONE nucleases and chemiluminescence Download PDFInfo
- Publication number
- CN108152274A CN108152274A CN201711421654.1A CN201711421654A CN108152274A CN 108152274 A CN108152274 A CN 108152274A CN 201711421654 A CN201711421654 A CN 201711421654A CN 108152274 A CN108152274 A CN 108152274A
- Authority
- CN
- China
- Prior art keywords
- serum
- sequence
- mirna
- solution
- elisa plate
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/75—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated
- G01N21/76—Chemiluminescence; Bioluminescence
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N1/00—Sampling; Preparing specimens for investigation
- G01N1/28—Preparing specimens for investigation including physical details of (bio-)chemical methods covered elsewhere, e.g. G01N33/50, C12Q
- G01N1/38—Diluting, dispersing or mixing samples
Abstract
RNase ONE ribalgilases and chemiluminescence are utilized to serum miRNA the present invention relates to a kind of（microRNA）The method that marker carries out quantitative detection.The method first pre-processes serum sample, fixed trapped sequence is on ELISA Plate, then the target miRNA in hybrid dna RNA hybridization probes, serum successively, RNase ONE ribalgilases is recycled to identify and cut Heteroduplex or point mutation caused by partial complementarity caused by base mispairing and the base insertion/deletion that cannot match, finally target miRNA contents in serum are detected using signal amplification sequence and chemiluminescence.Method high sensitivity provided by the invention, high specificity can meet clinical detection demand.
Description
Technical field
The invention belongs to blood free nucleic acid marker detection method and technical field, more particularly, to a kind of utilization
A kind of method for carrying out quantitative detection to serum miRNA using RNase ONE nucleases and chemiluminescence.
Background technology
MiRNA (microRNA) is the non-coding single strand RNA molecule of a kind of endogenous, long 19 to 24 nucleotide.It leads
It to be combined by base pair complementarity with the mRNA (messager RNA, mRNA) that protein is instructed to synthesize, it is caused to turn over
It translates and is obstructed or degrades, so as to participate in the life such as regulation and control ontogeny, Apoptosis, proliferation and differentiation.Due to being more than half
MiRNA be positioned in the genome with the relevant fragile site of tumour, therefore the generation of the miRNA of unconventionality expression and kinds of tumors,
By stages, it shifts and recurs close relation.
Since miRNA has its specific expression pattern in different tumours, there are many researchs to use miRNA at present
The marker of diagnosis and the molecular marker of Prognosis scoveillance, therapeutic targets and disease parting in tumour.Human body different tissues with
The miRNA that cell generates enters blood by being combined or being concentrated on the two ways in the extracellular vesica such as excretion body with lipoprotein
Liquid.Both modes ensure that the miRNA in blood is not influenced by temperature, acid-base value and nuclease, steady in peripheral blood
It is fixed to exist.This to become the hot spot of research tumour instantly by detecting the miRNA marker in serum/plasma/whole blood.Example
Such as：(Davoren P A, McNeill R E, Lowery AJ, the et al.Identification of suitable such as Chen
endogenous control genes for microRNA gene expression analysis in human
breast cancer.[J].BMC Mol Biol, 2008,9(1):76) it is had detected in clinical serum sample using round pcr
91 kinds of miRNA, analysis after filter out wherein 10 kinds of miRNA (miR-20a, miR-24, miR-25, miR-145, miR-
152, miR-199a-5p, miR-221, miR-222, miR-223, miR-320) as the life for early diagnosing non-small cell lung cancer
Object marker, sensitivity and specificity reach 96.6% and 97.2%.More and more experimental evidences show miRNA swollen
There are higher sensitivity and specificity in knurl diagnosis, it can be as the biomarker of early diagnosis of tumor.
But general fluorescent quantitative PCR technique still has the defects of some are intrinsic, wherein primary disadvantage is that：1、
It needs to extract total miRNA in sample；2nd, it needs to carry out reverse transcription to the miRNA of extraction；3rd, since the sequence of miRNA is shorter,
The probe with polyA tailings method or loop-stem structure is needed to be detected, increases the cost and difficulty of experiment；It is needed when the 4th, detecting
Target miRNA is expanded, it is difficult to meet the needs of clinical detection.
Therefore, a kind of high sensitivity, high specificity are developed, and the novel miRNA detection skills of clinical detection demand can be met
Art has important research significance and application value.
Invention content
It is an object of the invention to overcome existing fluorescent quantitative PCR technique complicated for operation, clinical detection demand can not be met
The defects of, it provides and a kind of serum miRNA marker is determined using RNase ONE ribalgilases and chemiluminescence
The method for measuring detection.
Method provided by the invention need not extract the miRNA in serum, and nucleic acid is detected by RNase ONE ribalgilases
For probe with the mispairing that occurs in target miRNA hybrid processes with not fully complementary, the detection for improving quantitative detecting method is special
Property；Using the signal value of chemiluminescence amplification target miRNA, so there is no need to expand target miRNA；High sensitivity, specificity
By force, clinical detection demand can be met.
For achieving the above object, the present invention adopts the following technical scheme that：
It is a kind of that quantitative inspection is carried out to serum miRNA marker using RNase ONE ribalgilases and chemiluminescence
The method of survey, described method includes following steps：
S1：Pretreatment is carried out to the serum sample of clinical acquisitions makes wherein miRNA dissociate, and it is molten to obtain blood serum sample pretreatment
Liquid, it is spare；
S2：Capture sequence solutions are added in into ELISA Plate, concussion is uniformly mixed after 25~40 DEG C of concussions, discards solution,
Extra unreacted capture sequence is removed, capture sequence is fixed on ELISA Plate；The capture sequence is NH2-(CH2)12-
GTTGTAAATTGTAGTAAAGAAGTA；The ELISA Plate contains can be with-NH2The group of reaction；
S3：DNA-RNA hybridization probe solution is added in into the ELISA Plate of S2, is shaken, after mixing, in 40~50 DEG C
Hybridization discards filtrate, DNA-RNA hybridization probes are solid by hybridizing with the capture sequence on ELISA Plate not less than 2h under static conditions
It is scheduled on ELISA Plate；The nucleic acid probe includes three parts：5 '-end DNA Sequences, the RNA sequence with miRNA complementations
Region and 3 '-end DNA sequence dna part；
Wherein, 5 '-end DNA sequence dna part is CAAACAAACATTCAAATATCAATC；
3 '-end DNA sequence dna part is TACTTCTTTACTACAATTTACAAC；With the RNA sequence regions of miRNA complementations with
Target miRNA sequence reverse complemental to be detected；
S4：Blood serum sample preprocessing solution described in S1 is added in the ELISA Plate obtained to S3, after mixing, in 40~
Hybridize 15~21h under 50 DEG C of static conditions, solution is discarded, by the DNA-RNA heterozygosis on the miRNA and ELISA Plate that dissociate in serum
Probe hybridizes；
S5：In the ELISA Plate that RNase ONE Ribonuclease in Aqueous Solution addition S4 is obtained, concussion is uniformly mixed after 40
0.5~1.5h of endonuclease reaction under~50 DEG C of static conditions, discards solution；
S6：Signal amplification sequence solution is added in the ELISA Plate obtained to S5, after mixing, in 40~50 DEG C of standings
Under the conditions of hybridization not less than 2h, signal amplification sequence is hybridized with DNA-RNA hybridization probes；The signal amplification sequence is：
GATTGATATTTGAATGTTTGTTG, the one or more biotins of modification on the signal amplification sequence；
S7：Being added in the ELISA Plate obtained to S6 can be molten with Avidin-peroxide enzyme fusion proteins of biotin reaction
Liquid, concussion after mixing, by biotin-avidin reaction hybridize Avidin-peroxide enzyme fusion proteins described
On signal amplification sequence；
S8：Chemiluminescence detection can be carried out with the chemiluminescent substrate of peroxidase reaction by being added on ELISA Plate, be led to
Cross the content that standard curve can obtain miRNA.
Traditional round pcr needs first to extract the total serum IgE in serum sample.But generally can in Total RNAs extraction step
Generate the loss of miRNA.The step of this needs first to carry out a large amount of nucleic acid extraction extends detection time and increases detection
Workload；And the testing result for being also possible to cause certain type miRNA is inaccurate.The present invention is pre- by being carried out to blood sample
Processing obtains the miRNA of free state to measure its content, avoids and is lost caused by extraction total serum IgE, substantially reduces detection
Time and workload；Then, capture sequence is fixed on ELISA Plate, and hybrid dna-RNA hybridization probes and miRNA successively,
Recycle can high selectivity excision single-chain nucleic acid or double-strandednucleic acid in single-stranded regions RNase ONE ribalgilases identify and cut
Part caused by base mispairing caused by cutting Heteroduplex or point mutation and the base insertion/deletion that cannot be matched is mutually
It mends, substantially increases detection specificity；Signal amplification sequence and chemiluminescence is recycled to be detected miRNA contents,
High sensitivity, high specificity can meet clinical detection demand.
The method that pretreatment commonly used in the art obtains free miRNA is used equally in the present invention.
Preferably, pretreatment is in S1：Blood sample solution with serum pretreatment fluid is mixed, is shaken at 25~100 DEG C
Swing 60~120min of reaction；The serum pretreatment fluid is molten for Tween 20/TE buffer solutions and the mixing of Proteinase K
The volume ratio of liquid, the serum treatment fluid and serum sample solution is not less than 1:1.
Albumen in the degradable serum of Proteinase K, Tween 20 can damage cells in vesica, pass through the two
Mating reaction can obtain free miRNA.The serum sample solution for including free miRNA obtained by this method is i.e.
Subsequent operation can be immediately carried out, can also deposit in freezen protective at -80 DEG C.
Preferably, the pH of the TE buffer solutions is 8.0；The mass concentration of Tween 20 is not low in the serum pretreatment fluid
In being 1%；The concentration of the Proteinase K is not less than for 200 μ g/ml.
Preferably, the capture sequence is fixed on by amide reaction on ELISA Plate.
It is further preferable that the ELISA Plate in S2 is maleation ELISA Plate.
Maleation ELISA Plate can be with-the NH in capture sequence2Reaction, so that capture sequence is fixed on ELISA Plate
On.
Preferably, the ELISA Plate is 96 hole elisa Plates.
Preferably, the capture sequence solutions are capture sequence PBS buffer solutions, and the concentration of the capture sequence is not less than
1nM。
Capture sequence can ensure that it is excessive to capture sequence, and ELISA Plate is fixed on so as to as much as possible when being not less than 1nM
On.
Preferably, S3 amplifying nucleic acids probe solution is DNA-RNA hybridization probe TE buffer solutions, the pH of the buffer solution for 7~
8, the concentration of the nucleic acid probe is not less than 1nM.
Preferably, hybridization time is 21h in S4.
Preferably, RNase ONE Ribonuclease in Aqueous Solution is RNase ONE ribonuclease T E buffer solutions in S5, described
The pH of buffer solution is 8, a concentration of 0.01~0.02U/ μ L of the RNase ONE ribalgilases.
Biotin commonly used in the art can be hybridized by conventional hybridizing method on signal amplification sequence.
Preferably, the quantity for the biotin modified on signal amplification sequence in S6 is 1~4.
Preferably, the Avidin in S7-peroxide enzyme fusion proteins is join mould Avidin-horseradish peroxidase fusion
Albumen or Avidin-horseradish peroxidase fusion protein.
Preferably, hybridization temperature is 25~40 DEG C in S7, and the time is not less than 30min.
Chemiluminescent substrate commonly used in the art can also be used in the present invention.
Preferably, chemiluminescent substrate is in luminol, different luminol and its derivative species and hydrogen peroxide solution in S8
It is one or more of.
Compared with prior art, the present invention has the advantages that：
It is provided by the invention using RNase ONE ribalgilases and chemiluminescence to serum miRNA marker into
The method that row quantitatively detects need not extract the miRNA in serum, and nucleic acid probe and mesh are detected by RNase ONE ribalgilases
With not fully complementary, the detection for improving quantitative detecting method is specific for the mispairing occurred in mark miRNA hybridization；It is sent out using chemistry
The signal value of light technology amplification target miRNA, so there is no need to expand target miRNA；High sensitivity, high specificity can meet clinic
Detection demand.
Description of the drawings
Fig. 1 is the process principle figure of method provided by the invention；
Fig. 2 is the mechanism of action figure of RNase ONE ribalgilases；
Fig. 3 is the chemiluminescence intensity figure of the serum miRNA of method detection that Examples 1 to 2 provides；
Fig. 4 is DNA-RNA heterologous nucleic acids probe in the method that embodiment 2~4 provides, target miRNA (miR-16), capture
Sequence hybridizes agarose gel electrophoresis figure with signal amplification sequence nucleic acid；
Fig. 5 is the chemiluminescence intensity of the serum miRNA of the method provided the detection of embodiment 2,5 and reference examples 1~2
Figure；
Fig. 6 is the chemiluminescence intensity figure of the serum miRNA of method detection that embodiment 2,6~8 provides；
Linear relationship (from 10fM to the 50pM) figures of Fig. 7 between chemiluminescence detection value and miR-16 concentration；
Fig. 8 is DNA-RNA heterologous nucleic acids probe and the agarose gel electrophoresis figure of RNase ONE ribonucleic acid enzyme reactions；
Fig. 9 is the selectivity test figure of chemiluminescence detection system.
Specific embodiment
With reference to embodiment, the present invention is further explained.These embodiments are merely to illustrate the present invention rather than limitation
The scope of the present invention.Test method without specific conditions in lower example embodiment usually according to this field normal condition or is pressed
The condition suggested according to manufacturer；Used raw material, reagent etc., unless otherwise specified, being can be from the business such as conventional market
The raw materials and reagents that approach obtains.The variation of any unsubstantiality that those skilled in the art is done on the basis of the present invention
And it replaces and belongs to scope of the present invention.
Examples 1 to 8
The present embodiment 1~8 provides a kind of utilization RNase ONE ribalgilases and chemiluminescence to serum
The method that miRNA marker carries out quantitative detection.As shown in Figure 1, method is as follows：
(1) pretreatment of serum sample
Tween 20 (10%) solution is diluted to final concentration of 1% with TE buffer solutions (pH 8.0), adds
Proteinase K are configured to serum treatment fluid to final concentration of 200 μ g/ml.After serum sample thaws, vortex mixing 5 to 10
It is secondary.The treatment fluid being configured is respectively placed in serum sample in constant temperature blending instrument slightly shakes mixing 30 minutes at 37 DEG C.Serum
Sample is with treatment fluid with volume ratio 1:1 mixing, in 60 DEG C of speed concussion reactions 60~90 minutes with 300rpm.After the completion of processing
Serum solution should carry out the reaction of next step immediately or be stored in -80 DEG C of refrigerators.
(2) amide reaction forming captures sequence in 96 hole elisa Plates
10X PBS buffer solution is handled into water with DEPC and is diluted to 1X PBS buffer solution.It is rinsed with 200 μ l of 1X PBS buffer solution
Every hole in maleation ELISA Plate 3 times.Capture sequence is dissolved in 1X PBS buffer solution extremely final concentration of 1nM, then
Every hole that 100 μ l is taken to add in ELISA Plate.The ELISA Plate for adding in capture sequence solutions is positioned in constant temperature blending instrument at 37 DEG C gently
Microseism is swung overnight.Solution after discarding overnight in 96 hole elisa Plates adds in SuperBlock Blocking Buffer per hole
200 μ l, (25 DEG C) are slight at room temperature shakes 1 hour.Tween 20 (10%) solution is diluted to dense eventually with 1X PBS buffer solution
It is 0.05% to spend, and is configured to washing lotion.The solution in every hole is discarded, is cleaned three times with washing lotion；96 orifice plates are covered with filter paper, after overturning
The solution gently beaten in causing ELISA Plate per hole flows completely out, and ELISA Plate surface is completely covered with porous plate sealing plate film, is put into 4 DEG C
Refrigerator preserves, on-demand.
Capture sequence is NH2-(CH2)12-GTTGTAAATTGTAGTAAAGAAGTA。
(3) nucleic acid hybridization connection capture sequence and DNA-RNA hybridization probes
The ELISA Plate that previous step is handled well is taken out from refrigerator, is positioned over 37 DEG C of environment.By DNA-RNA hybridization probes
TE buffer solutions (pH 8.0) are dissolved in final concentration of 1nM.ELISA Plate adds in nucleic acid probe solution 100 in throwing off after sealing plate film per hole
μ l are positioned in constant temperature blending instrument and are slightly shaken 10 minutes at 37 DEG C；After mixing, stop concussion, with porous plate sealing plate film
ELISA Plate surface is completely covered, is warming up to 40~50 DEG C, hybridizes 2 hours.
DNA-RNA hybridization probes are fixed on by hybridizing with the capture sequence on ELISA Plate on ELISA Plate；The nucleic acid
Probe is divided into three parts：5 '-end DNA sequence dna part, with the RNA sequence region of miRNA complementations and 3 '-end DNA sequence dna portion
Point；
Wherein, 5 '-end DNA sequence dna part is CAAACAAACATTCAAATATCAATC；
3 '-end DNA sequence dna part is TACTTCTTTACTACAATTTACAAC；
RNA sequence region and target miRNA sequence reverse complemental to be detected with miRNA complementations.
Such as DNA-RNA hybridization probe of the table 1 in the present embodiment for different miRNA corresponding to, this table is only to enumerate,
It is different according to the type of miRNA, corresponding nucleic acid probe can be selected.
Table 1DNA-RNA hybridization probes
(4) the target miRNA and DNA-RNA hybridization probes in nucleic acid hybridization connection serum
The ELISA Plate of upper step hybrid dna-RNA hybridization probes is discarded into solution in every hole, is cleaned three times with washing lotion, uses filter paper
96 orifice plates are covered, the solution gently beaten after overturning in causing enzyme mark per hole flows completely out.By the serum solution handled well in every hole
100 μ l are added in, is positioned in constant temperature blending instrument and is slightly shaken 10 minutes at 37 DEG C；After mixing, stop concussion, use is porous
Enzyme mark surface is completely covered in plate sealer, is warming up to 40~50 DEG C, hybridizes 15~21 hours.
(5) RNase ONE ribalgilases check hybridizing for target miRNA and DNA-RNA hybridization probes
By RNase ONE ribalgilases and TE buffer solutions (pH 8.0) with 1:500 dilution proportion (1-2U/100 μ
l).Serum solution in previous step treated ELISA Plate is discarded, is cleaned three times with washing lotion, per hole in add in diluted nuclease
100 μ l of solution are positioned in constant temperature blending instrument and are slightly shaken 10 minutes at 37 DEG C；After mixing, stop concussion, use porous plate
ELISA Plate surface is completely covered in sealing plate film, is maintained at 37 DEG C, endonuclease reaction 1 hour.
The mechanism of action of RNase ONE ribalgilases is as shown in Figure 2.
(6) nucleic acid hybridization connection signal amplification sequence and DNA-RNA hybridization probes
Signal amplification sequence is dissolved in TE buffer solutions (pH 8.0) to final concentration of 1nM.Enzyme after previous step has been reacted
Target discards the solution in every hole, is cleaned three times with washing lotion, and 96 orifice plates are covered with filter paper, is gently beaten after overturning and causes ELISA Plate every
Solution in hole flows completely out.ELISA Plate adds in 100 μ l of signal amplification sequence solution in every hole, is positioned in constant temperature blending instrument
It is slightly shaken 10 minutes at 37 DEG C；After mixing, stop concussion, ELISA Plate surface is completely covered with porous plate sealing plate film, rise
Temperature hybridizes 2 hours to 40~50 DEG C.
Signal amplification sequence used in the present invention is modified with biotin by conventional method, and the biotin of modification can be more
A, the following table 2 is the signal amplification sequence of the biotin containing 1~4 modification.
The signal amplification sequence of biotin of the table 2 containing 1~4 modification
(7) join mould Avidin-horseradish peroxidase fusion protein in letter using Streptavidin-biotin reaction connection
On number amplification sequence
By SA-Poly-HRP (joining mould Avidin-horseradish peroxidase fusion protein) with its dedicated Poly-HRP
Streptavidin and Dilution Buffer are with 1:2500 dilution proportion.By the enzyme of upper step hybridization signal amplification sequence
Target discards the solution in every hole, is cleaned three times with washing lotion, and 96 orifice plates are covered with filter paper, is gently beaten after overturning and causes ELISA Plate every
Solution in hole flows completely out.ELISA Plate adds in the 100 μ l of SA-Poly-HRP solution after dilution per hole, is positioned over constant temperature blending
It is slightly shaken 10 minutes at 37 DEG C in instrument；After mixing, stop concussion, ELISA Plate table is completely covered with porous plate sealing plate film
Face is maintained at 37 DEG C, reacts 30 minutes.
(8) it adds in chemiluminescent substrate and detects signal
By SuperSignal West Pico ChemiluminescentSubstrate (chemiluminescent substrate solution) its
In one bottle of SuperSignal West PicoLuminol/Enhancer solution and another bottle of SuperSignal West
PicoStable Peroxide solution is with 1:1 ratio is mixed into working solution, and working solution only keeps stablizing 8 small at room temperature
When.Meanwhile by previous step treated ELISA Plate discards in every hole solution, cleaned three times with washing lotion, 96 holes are covered with filter paper
Plate, the solution gently beaten after overturning in causing ELISA Plate per hole flow completely out.ELISA Plate adds in 100 μ l of working solution per hole, with more
ELISA Plate surface is completely covered in orifice plate sealing plate film, is positioned over 5 min in room temperature；Porous plate sealing plate film is thrown off, is positioned over multi-functional
Its fluorescence intensity is detected in microplate reader, time of integration 500ms is detected in 15min and finished.
The condition of each embodiment is as shown in table 3 below.
Reference examples 1~3
The method that reference examples 1~3 provide the quantitative detection of different condition.As shown in table 3, step in reference examples 1 and 2
(4) hybridization time is different, respectively 3h and 9h, remaining is consistent with embodiment 2；Without step in the method that reference examples 3 provide
Suddenly (5).
The condition of 3 Examples 1 to 8 of table and reference examples 1~3
MiRNA used in the present embodiment and reference examples is as shown in table 4 below.
Table 4miRNA sequence tables
As shown in figure 3, the chemiluminescence intensity figure of the serum miRNA of method detection provided for Examples 1 to 2.From figure
In as can be seen that as it is found that with the extension of processing time, chemiluminescence detection value also enhances therewith, the reason is that serum
The miRNA that sample dissociates after processing increases；And between 90min (41058 ± 643AU) and 60min (37619 ± 1605AU)
Difference (3439AU) it is smaller, it was demonstrated that by the processing time of 60min to 90min, most of miRNA in serum sample is
Through separate out.In order to shorten detection time and degrade caused by reducing miRNA because processing time is long, we are by serum
The detection time of sample is preferably 90min.
As shown in figure 4, chimeric nucleic acid probes, target in the method provided for embodiment 2~4
MiRNA (miR-16), capture sequence hybridize agarose gel electrophoresis figure with signal amplification sequence nucleic acid.Wherein 1 is
50 DEG C, 2 be 45 DEG C, and 3 be 40 DEG C.As can be seen from the figure it is found that in 40~50 DEG C of temperature ranges, nucleic acid probe and sequence
Can it hybridize；But bandwidth of band at 40 DEG C compared with 50 DEG C with 45 DEG C, it was demonstrated that hybridization carries out not exclusively, is not thorough
Bottom.50 DEG C are narrow with 45 DEG C of hybridising band, it was demonstrated that nucleic acid hybridization carry out more completely with thoroughly.According to nucleic acid hybridization temperature
5 to 10 DEG C and the lower experience for reducing mismatch rate of nucleic acid hybridization temperature generally under Tm (dissociation temperature), select 45 DEG C for
Nucleic acid hybridizes preferable temperature.
As shown in figure 5, the chemical of serum miRNA of the method provided the detection for embodiment 2,5 and reference examples 1~2 is sent out
Light intensity map.It can be seen that with the extension of hybridization time, final chemiluminescence detection value also enhances therewith, but passes through
Cross the final chemiluminescence detected value difference of miR-16 in serum after 15h hybridization times and 21h hybridization times less (15h,
39748±2466AU；21h,40472±2288AU)；It is therefore contemplated that by the hybridization of 15h to 21h, exhausted big portion in serum
Divide miRNA can be with chimeric nucleic acid probe hybridizations.Hybridization 21h is more preferably scheme.
As shown in fig. 6, the chemiluminescence intensity figure of the serum miRNA of method detection provided for embodiment 2,6~8.From
It is found that only modifying the signal amplification sequence 1 of a biotin in figure, final chemiluminescence detected value caused by miR-16 in serum
Still higher (23922 ± 1139AU)；After gradually increasing biotin modification, chemiluminescence detection caused by miR-16 in serum
Value increases to 40646 ± 333AU (Amplifier 4) from 23922 ± 1139AU (Amplifier 1), this proof passes through increase
Biotin modification on signal amplification sequence, which can make to couple on nucleic acid probe, more joins mould Avidin-horseradish peroxidase
Molecule then causes stronger chemiluminescence.In order to make the detection sensitivity highest of entire method and detection limit minimum, it is modified with
The quantity of biotin is 4.
The method that the present embodiment 2 provides is carried out linear detection range and minimum detection limit, detection specificity and its should
It is characterized as below with test is carried out：
(1) linear detection range and minimum detection limit
Some researches show that miR-16 is a kind of larger and more constant miRNA of concentration in blood, conduct at present
A kind of internal reference miRNA in blood of patients with lung cancer sample is widely used in early diagnosis and the monitoring after operation of lung cancer.We will
The diagnosis of lung cancer is carried out using the method that the present embodiment 2 provides, equally using the miR-16 in serum sample as internal reference, miR-25
After being compared with the chemiluminescence detection value of miR-223 with it, pass through the diagnosis that obtained ratio carries out lung cancer.
As shown in fig. 7, the concentration (10fM to 50pM) of miR-16 is linearly related to the chemiluminescence detection value of gained,
The concentration of the concentration of miR-16 is bigger, and the chemiluminescence detection value of gained is also bigger；Its linear equation is：
C.I. (chemiluminescence detection value)=172.893Con. (miRNA concentration) × 1015-34.311
Standard deviation value (174AU) in the blank value (1267 ± 174AU) detected is calculated with minimum detection limit
The lowest detection that formula (3 σ/S, σ are standard deviation, and S is the slope of linear equation) obtains this system this method is limited to
3.020fM.Existing document report, contained its content of the miRNA as tumor markers is generally in fM in blood sample
To between pM, miRNA quantitative detecting methods provided in this embodiment are because of its range of linearity in 10fM to 50pM, minimum detection limit
For 3.020fM, the miRNA contents being capable of detecting when in clinical blood sample can be applied to clinical lung cancer.
(2) detection specificity
A kind of miRNA that let-7 families miRNA is made of the similar miRNA of multiple structures, such miRNA is to each other
The difference of only one to two bases, therefore it is usually utilized to the specificity of test miRNA detecting systems.The present invention selects artificial
Six kinds of miRNA of the let-7a of the 1pM of synthesis to let-7f go to test the miRNA detection specificity of method provided in this embodiment.
As shown in figure 8, for agarose gel electrophoresis figure, wherein chimeric nucleic acid in 1 method provided for reference examples 5
Probe does not carry out the agarose gel electrophoresis figure of endonuclease reaction, and 2 be chimeric nucleic acid probes in the methods that embodiment 2 provides
Carry out the agarose gel electrophoresis figure of endonuclease reaction.It can be seen that RNase ONE ribalgilases can effectively be cut
Single-stranded RNA in chimeric nucleic acid probes.
As shown in figure 9, the selectivity test figure for chemiluminescence detection system.It can be seen that the present embodiment 2 provides
Method because application RNase ONE ribalgilases so as to its detection specificity it is very high, at most cause<5% (let-7c's)
Experimental error.
(3) it detects specific miRNA marker in serum using RNase ONE ribalgilases and carries out detection of early lung cancer
Present invention uses including being collected in Shenzhen people's hospital Serum of Patients with Lung Cancer in March, 2014 in June, 2016
16, sample, wherein male 9, women 7, average age 62 years old.All patients obtain pathological confirmation, acquire serum
The sample time is preoperative, does not receive radiotherapy or chemotherapy, and according to WHO standard and international stages of lung cancer system
Parting has been carried out by stages to tumour.Generally speaking, patients with lung cancer of the present invention includes I phases gland cancer 5, II~IV phases gland cancer 7, I
Phase squamous carcinoma 2, II~IV phases squamous carcinoma 2.It it is in July, 2015 in Shenzhen people separately using 10 serum samples of healthy control group
People's Hospital Physical Examination section collects, wherein male 6, women 4, average age 37 years old.Normal healthy controls crowd rabat, color ultrasound show nothing
Whole body or lung pathologies exception and blood serum tumor markers CEA, CA199, PAS etc. are range of normal value, no hepatitis, knot
The infectious diseases such as core.Used serum sample acquires serum using anticoagulant heparin pipe and is transferred to cryopreservation tube after -80
DEG C preserve.
Using the method that the present embodiment 2 provides have detected from 10 clinical normal healthy controls persons with 16 differences by stages,
MiR-16, miR-25 and miR-223 these three miRNA in the Serum of Patients with Lung Cancer sample of age and gender；Wherein according to
There is the report of document, we will express relatively stable miR-16 as internal reference substance in blood, will be in Serum of Patients with Lung Cancer
The miR-25 and miR-223 of middle specificity overexpression are as miRNA marker.Meanwhile we employ Exiqon companies
miRCURYTMRNA Isolation Kits-Biofluids kits are extracted miRNA, Ran Houyong in clinical serum sample
The TaqMan MicroRNA detection kits of Applied Biosystems companies are logical with real-time fluorescence quantitative PCR instrument (7500)
The method for crossing quantitative fluorescent PCR has detected miR-16, miR-25 and miR-223 in collected serum sample, miR-25 with
The Ct values of miR-223 detections will be uniformed with the Ct values of internal reference miR-16, and miR-25 and miR-223 is relative to internal reference
The multiple of miR-16 is represented with 2- Δs Ct.
In 5 fluorescence quantitative PCR detection normal healthy controls person's serum of table the Ct values of miR-16, miR-25 and miR-223 and its
Expression multiple after one change
Δ Ct* is that the Ct values of miR-25 in detection serum subtract the Ct values of miR-16 in serum；Δ Ct** is detection serum
The Ct values of middle miR-223 subtract the Ct values of miR-16 in serum.
In 6 fluorescence quantitative PCR detection Serum of Patients with Lung Cancer sample of table the Ct values of miR-16, miR-25 and miR-223 and its
Expression multiple after homogenization
Δ Ct* is that the Ct values of miR-25 in detection serum subtract the Ct values of miR-16 in serum；Δ Ct** is detection serum
The Ct values of middle miR-223 subtract the Ct values of miR-16 in serum.
The Ct of miR-16, miR-25 and miR-223 in method detection normal healthy controls person's serum that 7 the present embodiment 2 of table provides
Expression multiple after value and its homogenization
MiR-16, miR-25 and miR-223 in the method detection Serum of Patients with Lung Cancer sample that 8 the present embodiment 2 of table provides
Expression multiple after chemiluminescence detection value (C.I.) and its homogenization
C.I.* 25/16Ratio for miR-25 chemiluminescence detections value and internal reference miR-16 chemiluminescence detection values；
C.I.* 223/16Ratio for miR-223 chemiluminescence detections value and internal reference miR-16 chemiluminescence detection values.
By the detection data of table 5~8 it is found that compared with normal healthy controls person, miR-25 and miR- in Serum of Patients with Lung Cancer
223 expression generally increase, and as a result meet existing document report.By fluorescent quantitative PCR technique testing result it is found that normal healthy controls
Generally 0.0049 to 0.0536, median is for expression multiple in person's serum after miR-25 and internal reference miR-16 homogenization
0.0336；However the expression multiple in Serum of Patients with Lung Cancer after miR-25 and internal reference miR-16 homogenization 0.0257 to
0.1226, median 0.0629；Expression times in normal healthy controls person's serum after miR-223 and internal reference miR-16 homogenizations
Number is generally 0.2672 to 0.4813, median 0.3772；However miR-25 and internal reference miR-16 in Serum of Patients with Lung Cancer
Expression multiple after homogenization is 0.6930 to 2.9802, median 1.4705.The method provided by the present embodiment 2
Testing result is it is found that miR-25 detected values generally exist with internal reference miR-16 detected value ratio multiples in normal healthy controls person's serum
0.0127 to 0.0531, median 0.0321；However in Serum of Patients with Lung Cancer after miR-25 and internal reference miR-16 homogenizations
Expression multiple 0.0398 to 0.1429, median 0.0756；MiR-223 and internal reference in normal healthy controls person's serum
Expression multiple after miR-16 homogenizations is generally 0.2567 to 0.5213, median 0.3854；However patients with lung cancer blood
Expression multiple in clear after miR-223 and internal reference miR-16 homogenizations is 0.7867 to 2.2445, median 1.3233.This
Embodiment 2 provide method testing result and fluorescent quantitative PCR technique testing result it is more consistent, present in difference
It may be from the extraction and separation process of the miRNA in serum.
It can be seen from the above result that the method that the present embodiment 2 provides can have as traditional fluorescent quantitative PCR technique
There is the ability of miRNA in detection and analysis serum, and it need not carry out the extraction and amplification of nucleic acid；By detecting patients with lung cancer
Specific expressed miRNA marker in serum can be used to using the chemiluminescence of RNase ONE ribalgilases
Carry out the diagnosis of clinical lung cancer.
Claims (10)
1. a kind of carry out serum miRNA marker quantitative detection using RNase ONE ribalgilases and chemiluminescence
Method, which is characterized in that described method includes following steps：
S1：Pretreatment is carried out to the serum sample of clinical acquisitions makes wherein miRNA dissociate, and obtains blood serum sample preprocessing solution, standby
With；
S2：Capture sequence solutions are added in into ELISA Plate, concussion is uniformly mixed after 25 ~ 40 DEG C of concussions, discards solution, removes
Capture sequence is fixed on ELISA Plate by extra unreacted capture sequence；The capture sequence is NH2-(CH2)12-
GTTGTAAATTGTAGTAAAGAAGTA；The ELISA Plate contains can be with-NH2The group of reaction；
S3：DNA-RNA hybridization probe solution is added in into the ELISA Plate of S2, is shaken, after mixing, in 40 ~ 50 DEG C of standings
Under the conditions of hybridization not less than 2h, discard filtrate, DNA-RNA hybridization probes are fixed on by hybridizing with the capture sequence on ELISA Plate
On ELISA Plate；The nucleic acid probe includes three parts：5 '-end DNA sequence dna part, with the RNA sequence region of miRNA complementations and
3 '-end DNA sequence dna part；
Wherein, 5 '-end DNA sequence dna part is CAAACAAACATTCAAATATCAATC；
3 '-end DNA sequence dna part is TACTTCTTTACTACAATTTACAAC；With the RNA sequence regions of miRNA complementations with it is to be checked
Survey target miRNA sequence reverse complemental；
S4：Blood serum sample preprocessing solution described in S1 is added in the ELISA Plate obtained to S3, after mixing, in 40 ~ 50 DEG C
Hybridize 15 ~ 21h under static conditions, solution is discarded, by the DNA-RNA hybridization probes on the miRNA and ELISA Plate that dissociate in serum
Hybridization；
S5：In the ELISA Plate that RNase ONE Ribonuclease in Aqueous Solution addition S4 is obtained, concussion is uniformly mixed after 40 ~ 50 DEG C
0.5 ~ 1.5h of endonuclease reaction under static conditions, discards solution；
S6：Signal amplification sequence solution is added in the ELISA Plate obtained to S5, after mixing, in 40 ~ 50 DEG C of static conditions
Lower hybridization hybridizes signal amplification sequence with DNA-RNA hybridization probes not less than 2h；The signal amplification sequence is：
GATTGATATTTGAATGTTTGTTG, the one or more biotins of modification on the signal amplification sequence；
S7：It adds in and can be shaken with Avidin-peroxide enzyme fusion proteins solution of biotin reaction in the ELISA Plate obtained to S6
It swings after mixing, is put Avidin-peroxide enzyme fusion proteins hybridization in the signal by biotin-avidin reaction
In big sequence；
S8：Chemiluminescence detection can be carried out with the chemiluminescent substrate of peroxidase reaction by being added on ELISA Plate, pass through mark
Directrix curve is the content that can obtain miRNA.
2. method according to claim 1, which is characterized in that in S1 pretreatment be：Blood sample solution is located in advance with serum
Manage liquid mixing, 60 ~ 120min of concussion reaction at 25 ~ 100 DEG C；The serum pretreatment fluid for Tween 20-TE buffer solutions with
The volume ratio of the mixed solution of Proteinase K, the serum treatment fluid and serum sample solution is not less than 1:1.
3. method according to claim 2, which is characterized in that the pH of the TE buffer solutions is 8.0；The serum pretreatment fluid
It is 1% that the mass concentration of middle Tween 20, which is not less than,；The concentration of the Proteinase K is not less than for 200 μ g/ml.
4. method according to claim 1, which is characterized in that the capture sequence is fixed on ELISA Plate by amide reaction
On.
5. method according to claim 1, which is characterized in that the capture sequence solutions is capture sequence PBS buffer solution, institute
The concentration for stating capture sequence is not less than 1nM.
6. method according to claim 1, which is characterized in that S3 amplifying nucleic acids probe solution delays for DNA-RNA hybridization probes TE
Fliud flushing, the pH of the buffer solution is 7 ~ 8, and the concentration of the nucleic acid probe is not less than 1nM.
7. method according to claim 1, which is characterized in that hybridization time is 21h in S4.
8. method according to claim 1, which is characterized in that RNase ONE Ribonuclease in Aqueous Solution is RNase ONE in S5
Ribonuclease T E buffer solutions, the pH of the buffer solution are 8, the RNase ONE ribalgilases a concentration of 0.01 ~
0.02U/μL。
9. method according to claim 1, which is characterized in that the quantity for the biotin modified on signal amplification sequence in S6 is
1 ~ 4.
10. method according to claim 1, which is characterized in that Avidin-peroxide enzyme fusion proteins in S7 are mould to join
Avidin-horseradish peroxidase fusion protein or Avidin-horseradish peroxidase fusion protein.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711421654.1A CN108152274A (en) | 2017-12-25 | 2017-12-25 | A kind of method for carrying out quantitative detection to serum miRNA using RNase ONE nucleases and chemiluminescence |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711421654.1A CN108152274A (en) | 2017-12-25 | 2017-12-25 | A kind of method for carrying out quantitative detection to serum miRNA using RNase ONE nucleases and chemiluminescence |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108152274A true CN108152274A (en) | 2018-06-12 |
Family
ID=62464561
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711421654.1A Pending CN108152274A (en) | 2017-12-25 | 2017-12-25 | A kind of method for carrying out quantitative detection to serum miRNA using RNase ONE nucleases and chemiluminescence |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108152274A (en) |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2224912A1 (en) * | 2008-01-02 | 2010-09-08 | TEKMIRA Pharmaceuticals Corporation | Improved compositions and methods for the delivery of nucleic acids |
| WO2013063454A1 (en) * | 2011-10-27 | 2013-05-02 | Nesher Technologies, Inc. | Methods and compositions for multiplexed and ultrasensitive microrna detection |
| CN103383355A (en) * | 2013-07-12 | 2013-11-06 | 华南师范大学 | MicroRNA detection method based on non-enzymatic amplification and electrochemiluminescence principles |
| CN104450920A (en) * | 2014-12-11 | 2015-03-25 | 华南师范大学 | MicroRNA trace detection method based on exponential order non-enzymatic amplification and electrochemical luminescence principle |
| CN104569394A (en) * | 2014-12-24 | 2015-04-29 | 深圳市老年医学研究所 | Multiple miRNA tumor marker detecting method and application thereof |
| CN104764782A (en) * | 2015-04-10 | 2015-07-08 | 大连理工大学 | Preparation of boron-doped graphene quantum dot electrochemiluminescence sensor for detecting miRNA-20a and application of sensor |
| CN106872447A (en) * | 2017-01-14 | 2017-06-20 | 北京工业大学 | Strengthen the preparation method of the electrochemical luminescence biology sensor of Luminol |
-
2017
- 2017-12-25 CN CN201711421654.1A patent/CN108152274A/en active Pending
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2224912A1 (en) * | 2008-01-02 | 2010-09-08 | TEKMIRA Pharmaceuticals Corporation | Improved compositions and methods for the delivery of nucleic acids |
| WO2013063454A1 (en) * | 2011-10-27 | 2013-05-02 | Nesher Technologies, Inc. | Methods and compositions for multiplexed and ultrasensitive microrna detection |
| CN103383355A (en) * | 2013-07-12 | 2013-11-06 | 华南师范大学 | MicroRNA detection method based on non-enzymatic amplification and electrochemiluminescence principles |
| CN104450920A (en) * | 2014-12-11 | 2015-03-25 | 华南师范大学 | MicroRNA trace detection method based on exponential order non-enzymatic amplification and electrochemical luminescence principle |
| CN104569394A (en) * | 2014-12-24 | 2015-04-29 | 深圳市老年医学研究所 | Multiple miRNA tumor marker detecting method and application thereof |
| CN104764782A (en) * | 2015-04-10 | 2015-07-08 | 大连理工大学 | Preparation of boron-doped graphene quantum dot electrochemiluminescence sensor for detecting miRNA-20a and application of sensor |
| CN106872447A (en) * | 2017-01-14 | 2017-06-20 | 北京工业大学 | Strengthen the preparation method of the electrochemical luminescence biology sensor of Luminol |
Non-Patent Citations (1)
| Title |
|---|
| 王严南: "基于实时定量PCR和xMAP液态芯片技术检测NSCLC组织/血清miRNA的方法建立及其应用的研究", 《万方数据》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10774386B2 (en) | Serum or plasma microRNA as biomarkers for non-small cell lung cancer | |
| CN113930503B (en) | Application of miR-126 and miR-152 combination in preparation of reagent or kit for diagnosing and indicating lung cancer | |
| CN103937876B (en) | For diagnosing and treat the method and composition of adenocarcinoma of esophagus | |
| Zampetaki et al. | Analytical challenges and technical limitations in assessing circulating miRNAs | |
| CN101921759B (en) | Serum/plasma miRNA serum marker related to cervical carcinoma and precancerous lesions thereof and application thereof | |
| US9637793B2 (en) | Pancreatic cancer markers, and detecting methods, kits, biochips thereof | |
| US20130225432A1 (en) | Solution-based methods for rna expression profiling | |
| CN101988060A (en) | Marker for detecting colon and rectum cancer as well as detection method, kit and biological chip thereof | |
| US20090092974A1 (en) | Micrornas differentially expressed in leukemia and uses thereof | |
| AU2018202963B2 (en) | Biomarkers useful for detection of types, grades and stages of human breast cancer | |
| CN102388149A (en) | Methods of detecting sepsis | |
| WO2016186987A1 (en) | Biomarker micrornas and method for determining tumor burden | |
| EP2759602A1 (en) | Non-invasive prenatal genetic diagnostic methods | |
| CN102892898A (en) | Diagnostic kit including micro-rna biomarkers and used for diagnosis of hepatocellular carcinoma, and method | |
| CN103173448A (en) | Early-stage lung adenocarcinoma miRNA (micro ribonucleic acid) specific expression profile and reverse transcription primer and application thereof | |
| CN104673883B (en) | For predicting the microRNA biomarker and detection method of early stage non-metastatic colorectal cancer prognosis | |
| Tie et al. | Circulating miRNA and cancer diagnosis | |
| CN109251964A (en) | Recycle the method and application of microRNAs detection kit and specific detection circulation microRNAs | |
| CN109022583A (en) | Hsa_circ_0021977 is preparing the application on Diagnosis of Breast cancer product | |
| CN102399870B (en) | Reagent for determining survival and prognosis of patients with esophagus cancer | |
| CN102443638B (en) | Internal reference for detecting miRNA (micro Ribonucleic Acid) in serum/blood plasma and application of internal reference | |
| CN107312851A (en) | Myocardial infarction biomarker miR 1283 | |
| CN108152274A (en) | A kind of method for carrying out quantitative detection to serum miRNA using RNase ONE nucleases and chemiluminescence | |
| Chen et al. | Single-molecule assay guided crRNA optimization enhances specific microRNA detection by CRISPR-Cas12a | |
| CN108132241A (en) | A kind of method for carrying out quantitative detection to serum miRNA marker using SOL technologies and chemiluminescence |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180612 |
|
| RJ01 | Rejection of invention patent application after publication |