CN108132241A - A kind of method for carrying out quantitative detection to serum miRNA marker using SOL technologies and chemiluminescence - Google Patents
A kind of method for carrying out quantitative detection to serum miRNA marker using SOL technologies and chemiluminescence Download PDFInfo
- Publication number
- CN108132241A CN108132241A CN201711423381.4A CN201711423381A CN108132241A CN 108132241 A CN108132241 A CN 108132241A CN 201711423381 A CN201711423381 A CN 201711423381A CN 108132241 A CN108132241 A CN 108132241A
- Authority
- CN
- China
- Prior art keywords
- mirna
- serum
- solution
- nucleic acid
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/75—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated
- G01N21/76—Chemiluminescence; Bioluminescence
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
- G01N33/57488—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites involving compounds identifable in body fluids
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
- G01N33/57423—Specifically defined cancers of lung
Abstract
The present invention relates to a kind of SOL（Short nucleotide connects）Technology and chemiluminescence are to serum miRNA（microRNA）The method that marker carries out quantitative detection.The method first pre-processes serum sample, fixed trapped sequence is on ELISA Plate, then the target miRNA in hybridizing nucleic acid probes a and b, serum, again by the way that the miRNA of removable mispairing and partial complementarity is cleaned multiple times, finally target miRNA contents in serum are detected using signal amplification sequence and chemiluminescence.Method provided by the invention need not extract the miRNA in serum and need not expand target miRNA, and high sensitivity, high specificity can meet clinical detection demand.
Description
Technical field
The invention belongs to blood free nucleic acid marker detection method and technical field, more particularly, to a kind of utilization
The method that SOL technologies and chemiluminescence carry out serum miRNA marker quantitative detection.
Background technology
MiRNA (microRNA) is the non-coding single strand RNA molecule of a kind of endogenous, long 19 to 24 nucleotide.It leads
It to be combined by base pair complementarity with the mRNA (messager RNA, mRNA) that protein is instructed to synthesize, it is caused to turn over
It translates and is obstructed or degrades, so as to participate in the life such as regulation and control ontogeny, Apoptosis, proliferation and differentiation.Due to being more than half
MiRNA be positioned in the genome with the relevant fragile site of tumour, therefore the generation of the miRNA of unconventionality expression and kinds of tumors,
By stages, it shifts and recurs close relation.
Since miRNA has its specific expression pattern in different tumours, there are many researchs to be used for miRNA at present
The diagnosis of tumour and the marker of the molecular marker of Prognosis scoveillance, therapeutic targets and disease parting.Human body different tissues with it is thin
The miRNA that born of the same parents generate enters blood by being combined or being concentrated on the two ways in the extracellular vesica such as excretion body with lipoprotein.
Both modes ensure that the miRNA in blood is not influenced by temperature, acid-base value and nuclease, stablize in peripheral blood
In the presence of.This to become the hot spot of research tumour instantly by detecting the miRNA marker in serum/plasma/whole blood.Such as：
(Davoren P A, McNeill R E, Lowery A J, the et al.Identification of suitable such as Chen
endogenous control genesfor microRNA gene expression analysis in human breast
cancer.[J].BMC Mol Biol,2008,9(1):76) 91 kinds in clinical serum sample are had detected using round pcr
MiRNA, filtered out after analysis wherein 10 kinds of miRNA (miR-20a, miR-24, miR-25, miR-145, miR-152,
MiR-199a-5p, miR-221, miR-222, miR-223, miR-320) it is marked as the biological of early diagnosis non-small cell lung cancer
Will object, sensitivity and specificity reach 96.6% and 97.2%.More and more experimental evidences show that miRNA is examined in tumour
There are higher sensitivity and specificity in disconnected, it can be as the biomarker of early diagnosis of tumor.
But general fluorescent quantitative PCR technique still has the defects of some are intrinsic, wherein primary disadvantage is that：1、
It needs to extract total miRNA in sample；2nd, it needs to carry out reverse transcription to the miRNA of extraction；3rd, since the sequence of miRNA is shorter,
The probe with polyA tailings method or loop-stem structure is needed to be detected, increases the cost and difficulty of experiment；It is needed when the 4th, detecting
Target miRNA is expanded, it is difficult to meet the needs of clinical detection.
Therefore, a kind of high sensitivity, high specificity are developed, and the novel miRNA detection skills of clinical detection demand can be met
Art has important research significance and application value.
Invention content
It is an object of the invention to overcome existing fluorescent quantitative PCR technique complicated for operation, clinical detection demand can not be met
The defects of, a kind of method for being carried out quantitative detection to serum miRNA marker using SOL technologies and chemiluminescence is provided.
Method provided by the invention need not extract the miRNA in serum, by the way that removable mispairing and part is cleaned multiple times mutually
The miRNA of benefit improves the detection specificity of quantitative detecting method；In addition, the letter using chemiluminescence amplification target miRNA
Number value, so there is no need to expand target miRNA；High sensitivity, high specificity can meet clinical detection demand.
For achieving the above object, the present invention adopts the following technical scheme that：
A kind of method for carrying out quantitative detection to serum miRNA marker using SOL technologies and chemiluminescence, it is described
Method includes the following steps：
S1：Pretreatment is carried out to the serum sample of clinical acquisitions makes wherein miRNA dissociate, and it is molten to obtain blood serum sample pretreatment
Liquid, it is spare；
S2：Capture sequence solutions are added in into ELISA Plate, concussion is uniformly mixed after 25~40 DEG C of concussions, will capture sequence
Row are fixed on ELISA Plate, discard solution, remove extra unreacted capture sequence；The capture sequence is NH2-(CH2)12-
GTTGTAAATTGTAGTAAAGAAGTA；The ELISA Plate contains can be with-NH2The group of reaction；
S3：Blood serum sample preprocessing solution, nucleic acid probe a solution and nucleic acid probe b solution in S1 is added in S2's
In ELISA Plate, concussion after mixing, hybridizes 15~21h under 40~50 DEG C of static conditions, discards filtrate, cleaning at least 3
It is secondary；The nucleic acid probe a is：CAAACAAACATTCAAATATCAATC- and miRNA half sequence complementary regions；The nucleic acid
Probe b is：With the other half sequence complementary region of target miRNA-TACTTCTTTACTACAATTTACAAC；
S4：Signal amplification sequence solution is added in the ELISA Plate obtained to S3, after mixing, in 40~50 DEG C of standings
Under the conditions of hybridization not less than 2h, signal amplification sequence is hybridized with nucleic acid probe b；The signal amplification sequence is：
GATTGATATTTGAATGTTTGTTG, the one or more biotins of modification on the signal amplification sequence；
S5：Being added in the ELISA Plate obtained to S4 can be molten with Avidin-peroxide enzyme fusion proteins of biotin reaction
Liquid, concussion after mixing, by biotin-avidin reaction hybridize Avidin-peroxide enzyme fusion proteins described
On signal amplification sequence；
S6：Chemiluminescence detection can be carried out with the chemiluminescent substrate of peroxidase reaction by being added on ELISA Plate, be led to
Cross the content that standard curve can obtain miRNA.
Traditional round pcr needs first to extract the total serum IgE in serum sample.But generally can in Total RNAs extraction step
Generate the loss of miRNA.The step of this needs first to carry out a large amount of nucleic acid extraction extends detection time and increases detection
Workload；And the testing result for being also possible to cause certain type miRNA is inaccurate.The present invention is pre- by being carried out to blood sample
Processing obtains the miRNA of free state to measure its content, avoids and is lost caused by extraction total serum IgE, substantially reduces detection
Time and workload；Then, using SOL technologies (short nucleotide chain interconnection technique), capture sequence is fixed on ELISA Plate, and
Hybridized by nucleic acid probe a and b with target miRNA, and weaker combination can only be generated between target miRNA and probe, if
Occurring the situation of mispairing and partial complementarity in the middle, the combination between target miRNA and probe will be reduced further, this
When, the miRNA of removal mispairing and partial complementarity can be removed by being cleaned multiple times, substantially increases detection specificity；It is sharp again
MiRNA contents are detected with signal amplification sequence and chemiluminescence, high sensitivity, high specificity, clinic can be met
Detection demand.
The method that pretreatment commonly used in the art obtains free miRNA is used equally in the present invention.
Preferably, pretreatment is in S1：Blood sample solution with serum pretreatment fluid is mixed, is shaken at 25~100 DEG C
Swing 60~120min of reaction；Mixed solution of the serum pretreatment fluid for Tween 20/TE buffer solutions and Proteinase K,
The volume ratio of the serum treatment fluid and serum sample solution is not less than 1:1.
Albumen in the degradable serum of Proteinase K, Tween 20 can damage cells in vesica, pass through the two
Mating reaction can obtain free miRNA.The serum sample solution for including free miRNA obtained by this method is i.e.
Subsequent operation can be immediately carried out, can also deposit in freezen protective at -80 DEG C.
Preferably, the pH of the TE buffer solutions is 8.0；The mass concentration of Tween 20 is not low in the serum pretreatment fluid
In being 1%；The concentration of the Proteinase K is not less than for 200 μ g/ml.
Preferably, the capture sequence is fixed on by amide reaction on ELISA Plate.
It is further preferable that the ELISA Plate in S2 is maleation ELISA Plate.
Maleation ELISA Plate can be with-the NH in capture sequence2Reaction, so that capture sequence is fixed on ELISA Plate
On.
Preferably, the ELISA Plate is 96 hole elisa Plates.
Preferably, the capture sequence solutions are capture sequence PBS buffer solutions, and the concentration of the capture sequence is not less than
1nM。
Capture sequence can ensure that it is excessive to capture sequence, and ELISA Plate is fixed on so as to as much as possible when being not less than 1nM
On.
Preferably, S3 centers acid probe a solution is nucleic acid probe a TE buffer solutions, and nucleic acid probe b solution is nucleic acid probe b
TE buffer solutions；The pH of the buffer solution is 7~8, and the concentration of the nucleic acid probe a and b is not less than 1nM.
Preferably, hybridization time is 21h in S3.
Biotin commonly used in the art can be hybridized by conventional hybridizing method on signal amplification sequence.
Preferably, the quantity for the biotin modified on signal amplification sequence in S4 is 1~4.
Preferably, the Avidin in S5-peroxide enzyme fusion proteins is join mould Avidin-horseradish peroxidase fusion
Albumen or Avidin-horseradish peroxidase fusion protein.
Preferably, hybridization temperature is 25~40 DEG C in S5, and the time is not less than 30min.
Chemiluminescent substrate commonly used in the art can also be used in the present invention.
Preferably, chemiluminescent substrate is in luminol, different luminol and its derivative species and hydrogen peroxide solution in S6
It is one or more of.
Compared with prior art, the present invention has the advantages that：
It is provided by the invention that quantitative detection is carried out to serum miRNA marker using SOL technologies and chemiluminescence
Method need not extract the miRNA in serum, occur in being hybridized with target miRNA by the way that removable nucleic acid probe a, b is cleaned multiple times
Mispairing with it is not fully complementary, improve quantitative detecting method detection specificity；Use chemiluminescence amplification target
The signal value of miRNA, so there is no need to expand target miRNA；High sensitivity, high specificity can meet clinical detection demand.
Description of the drawings
Fig. 1 is the process principle figure of method provided by the invention；
Fig. 2 is the mechanism of action figure of SOL technologies (short nucleotide chain interconnection technique)；
Fig. 3 is the chemiluminescence intensity figure of the serum miRNA of method detection that Examples 1 to 2 provides；
Fig. 4 be embodiment 2~4 provide method center acid probe a and b, target miRNA (miR-16), capture sequence with
Signal amplification sequence nucleic acid hybridizes agarose gel electrophoresis figure；
Fig. 5 is the chemiluminescence intensity of the serum miRNA of the method provided the detection of embodiment 2,5 and reference examples 1~2
Figure；
Fig. 6 is the chemiluminescence intensity figure of the serum miRNA of method detection that embodiment 2,6~8 provides；
Linear relationship (from 10fM to the 50pM) figures of Fig. 7 between chemiluminescence detection value and miR-16 concentration；
Fig. 8 is the selectivity test figure of chemiluminescence detection system.
Specific embodiment
With reference to embodiment, the present invention is further explained.These embodiments are merely to illustrate the present invention rather than limitation
The scope of the present invention.Test method without specific conditions in lower example embodiment usually according to this field normal condition or is pressed
The condition suggested according to manufacturer；Used raw material, reagent etc., unless otherwise specified, being can be from the business such as conventional market
The raw materials and reagents that approach obtains.The variation of any unsubstantiality that those skilled in the art is done on the basis of the present invention
And it replaces and belongs to scope of the present invention.
Examples 1 to 8
The present embodiment 1~8, which provides, a kind of to carry out serum miRNA marker using SOL technologies and chemiluminescence
The method quantitatively detected.As shown in Figure 1, method is as follows：
(1) pretreatment of serum sample
Tween 20 (10%) solution is diluted to final concentration of 1% with TE buffer solutions (pH 8.0), adds
Proteinase K are configured to serum treatment fluid to final concentration of 200 μ g/ml.After serum sample thaws, vortex mixing 5 to 10
It is secondary.The treatment fluid being configured is respectively placed in serum sample in constant temperature blending instrument slightly shakes mixing 30 minutes at 37 DEG C.Serum
Sample is with treatment fluid with volume ratio 1:1 mixing, in 60 DEG C of speed concussion reactions 60~90 minutes with 300rpm.After the completion of processing
Serum solution should carry out the reaction of next step immediately or be stored in -80 DEG C of refrigerators.
(2) amide reaction forming captures sequence in 96 hole elisa Plates
10X PBS buffer solution is handled into water with DEPC and is diluted to 1X PBS buffer solution.It is cleaned with 200 μ l of 1X PBS buffer solution
Every hole in maleation ELISA Plate 3 times.Capture sequence is dissolved in 1X PBS buffer solution extremely final concentration of 1nM, then
Every hole that 100 μ l is taken to add in ELISA Plate.The ELISA Plate for adding in capture sequence solutions is positioned in constant temperature blending instrument at 37 DEG C gently
Microseism is swung overnight.Solution after discarding overnight in 96 hole elisa Plates adds in SuperBlock Blocking Buffer per hole
200 μ l, (25 DEG C) are slight at room temperature shakes 1 hour.Tween 20 (10%) solution is diluted to dense eventually with 1X PBS buffer solution
It is 0.05% to spend, and is configured to washing lotion.The solution in every hole is discarded, is cleaned three times with washing lotion；96 orifice plates are covered with filter paper, after overturning
The solution gently beaten in causing ELISA Plate per hole flows completely out, and ELISA Plate surface is completely covered with porous plate sealing plate film, is put into 4 DEG C
Refrigerator preserves, on-demand.
Capture sequence is NH2-(CH2)12-GTTGTAAATTGTAGTAAAGAAGTA。
(3) the target miRNA and nucleic acid probe a and b in nucleic acid hybridization connection serum
The ELISA Plate that previous step is handled well is taken out from refrigerator, is positioned over 37 DEG C of environment.Nucleic acid probe a and nucleic acid are visited
The final concentration that needle b is dissolved in TE buffer solutions (pH 8.0) to the two is not less than 1nM.The serum solution handled well is added in 90 in every hole
μ l add prepared nucleic acid probe a and each 5 μ l of nucleic acid probe b solution, are positioned in constant temperature blending instrument in 37 DEG C of slight shakes
Swing 10min；After mixing, stop concussion, ELISA Plate surface be completely covered with porous plate sealing plate film, is warming up to 40~50 DEG C,
Hybridize 15~21h.
Nucleic acid probe a is：CAAACAAACATTCAAATATCAATC- and target miRNA half sequence complementary regions；
Nucleic acid probe b is：With the other half sequence complementary region of target miRNA-TACTTCTTTACTACAATTTACAAC.
The following table is, for the nucleic acid probe a and b corresponding to different miRNA, this table is only to enumerate, root in the present embodiment
It is different according to the type of miRNA, corresponding nucleic acid probe can be selected.
Table 1 nucleic acid probe a and b
| MiR-16 nucleic acid probes a | CAAACAAACATTCAAATATCAATCCGCCAATATTT |
| MiR-16 nucleic acid probes b | ACGTGCTGCTATACTTCTTTACTACAATTTACAAC |
| MiR-21 nucleic acid probes a | CAAACAAACATTCAAATATCAATCTCAACATCAGT |
| MiR-21 nucleic acid probes b | CTGATAAGCTATACTTCTTTACTACAATTTACAAC |
| Let-7a nucleic acid probes a | CAAACAAACATTCAAATATCAATCAACTATACAAC |
| Let-7a nucleic acid probes b | CTACTACCTCATACTTCTTTACTACAATTTACAAC |
(4) nucleic acid hybridization connection signal amplification sequence and DNA-RNA hybridization probes
Signal amplification sequence is dissolved in TE buffer solutions (pH 8.0) to final concentration of 1nM.Enzyme after previous step has been reacted
Target discards the solution in every hole, is cleaned three times with washing lotion, and 96 orifice plates are covered with filter paper, is gently beaten after overturning and causes ELISA Plate every
Solution in hole flows completely out.ELISA Plate adds in 100 μ l of signal amplification sequence solution in every hole, is positioned in constant temperature blending instrument
37 DEG C slightly shake 10 minutes；After mixing, stop concussion, ELISA Plate surface is completely covered with porous plate sealing plate film, heat up
To 40~50 DEG C, hybridize 2 hours.
Signal amplification sequence used in the present invention is modified with biotin by conventional method, and the biotin of modification can be more
A, the following table 2 is the signal amplification sequence of the biotin containing 1~4 modification.
The signal amplification sequence of biotin of the table 2 containing 1~4 modification
(5) join mould Avidin-horseradish peroxidase fusion protein in letter using Streptavidin-biotin reaction connection
On number amplification sequence
By SA-Poly-HRP (joining mould Avidin-horseradish peroxidase fusion protein) with its dedicated Poly-HRP
Streptavidin and Dilution Buffer are with 1:2500 dilution proportion.By the enzyme of upper step hybridization signal amplification sequence
Target discards the solution in every hole, is cleaned three times with washing lotion, and 96 orifice plates are covered with filter paper, is gently beaten after overturning and causes ELISA Plate every
Solution in hole flows completely out.ELISA Plate adds in the 100 μ l of SA-Poly-HRP solution after dilution per hole, is positioned over constant temperature blending
It is slightly shaken 10 minutes at 37 DEG C in instrument；After mixing, stop concussion, ELISA Plate table is completely covered with porous plate sealing plate film
Face is maintained at 37 DEG C, reacts 30 minutes.
(6) it adds in chemiluminescent substrate and detects signal
By SuperSignal West Pico ChemiluminescentSubstrate (chemiluminescent substrate solution) its
In one bottle of SuperSignal West PicoLuminol/Enhancer solution and another bottle of SuperSignal
WestPicoStable Peroxide solution is with 1:1 ratio is mixed into working solution, and working solution only keeps stablizing 8 at room temperature
Hour.Meanwhile by previous step treated ELISA Plate discards in every hole solution, cleaned three times with washing lotion, 96 are covered with filter paper
Orifice plate, the solution gently beaten after overturning in causing ELISA Plate per hole flow completely out.ELISA Plate adds in 100 μ l of working solution per hole, uses
ELISA Plate surface is completely covered in porous plate sealing plate film, is positioned over 5min in room temperature；Porous plate sealing plate film is thrown off, is positioned over multi-functional
Its fluorescence intensity is detected in microplate reader, time of integration 500ms is detected in 15min and finished.
The condition of each embodiment is as shown in table 3 below.
Reference examples 1~3
The method that reference examples 1~3 provide the quantitative detection of different condition.As shown in table 3, step in reference examples 1 and 2
(4) hybridization time is different, respectively 3h and 9h, remaining is consistent with embodiment 2.
The condition of 3 Examples 1 to 8 of table and reference examples 1~2
MiRNA used in the present embodiment and reference examples is as shown in table 4 below.
4 miRNA sequence table of table
| miR-16 | rUrArGrCrArGrCrArCrGrUrArArArUrArUrUrGrGrCrG |
| miR-21 | rUrArGrCrUrUrArUrCrArGrArCrUrGrArUrGrUrUrGrA |
| let-7a | rUrGrArGrGrUrArGrUrArGrGrUrUrGrUrArUrArGrUrU |
| let-7b | rUrGrArGrGrUrArGrUrArGrGrUrUrGrUrGrUrGrGrUrU |
| let-7c | rUrGrArGrGrUrArGrUrArGrGrUrUrGrUrArUrGrGrUrU |
| let-7d | rArGrArGrGrUrArGrUrArGrGrUrUrGrCrArUrArGrUrU |
| let-7e | rUrGrArGrGrUrArGrGrArGrGrUrUrGrUrArUrArGrUrU |
| let-7f | rUrGrArGrGrUrArGrUrArGrArUrUrGrUrArUrArGrUrU |
As shown in figure 3, the chemiluminescence intensity figure of the serum miRNA of method detection provided for Examples 1 to 2.From figure
In as can be seen that as it is found that with the extension of processing time, chemiluminescence detection value also enhances therewith, the reason is that serum
The miRNA that sample dissociates after processing increases；And between 90min (41058 ± 643AU) and 60min (37619 ± 1605AU)
Difference (3439AU) is smaller, it was demonstrated that by the processing time of 60min to 90min, most of miRNA in serum sample has been swum
It separates out and.In order to shorten detection time and degrade caused by reducing miRNA because processing time is long, we are by serum sample
Detection time preferably for 90min.
As shown in figure 4, the method center acid probe a and b that provide for embodiment 2~4, target miRNA (miR-16), capture
Sequence hybridizes agarose gel electrophoresis figure with signal amplification sequence nucleic acid.Wherein 1 is 50 DEG C, and 2 be 45 DEG C, and 3 be 40 DEG C.From figure
It can be seen that it is found that in 40~50 DEG C of temperature ranges, nucleic acid probe can hybridize with sequence；Band at 40 DEG C compared with
50 DEG C with 45 DEG C of bandwidth, it was demonstrated that hybridization is carried out not exclusively, is not thorough.50 DEG C narrow with 45 DEG C of hybridising band, card
The hybridization of bright nucleic acid carry out more completely with thoroughly.According to nucleic acid hybridization temperature generally at a temperature of Tm 5 to 10 DEG C and nucleic acid it is miscellaneous
The lower experience for reducing mismatch rate of temperature is handed over, selects 45 DEG C to hybridize preferable temperature for nucleic acid.
As shown in figure 5, the chemical of serum miRNA of the method provided the detection for embodiment 2,5 and reference examples 1~2 is sent out
Light intensity map.It can be seen that with the extension of processing time, final chemiluminescence detection value also enhances therewith, but passes through
Cross the final chemiluminescence detected value difference of miR-16 in serum after 15h hybridization times and 21h hybridization times less (15h,
40025±960AU；21h,43287±1185AU)；It is therefore contemplated that by the hybridization of 15h to 21h, exhausted big portion in serum
Divide miRNA can be with nucleic acid probe hybridization.In order to ensure all target miRNA can be fully corresponding nucleic acid probe
A hybridizes with nucleic acid probe b.Hybridization 21h is more preferably scheme.
As shown in fig. 6, the chemiluminescence intensity figure of the serum miRNA of method detection provided for embodiment 2,6~8.From
It is final caused by miR-16 in serum it is found that only modifying the signal amplification sequence 1 (Amplifier 1) of a biotin in figure
Chemiluminescence detection value is still higher (25958 ± 1109AU)；After gradually increasing biotin modification, miR-16 causes in serum
Chemiluminescence detection value increase to 42780 ± 1445AU (Amplifier 4) from 25958 ± 1109AU (Amplifier 1),
This prove by the biotin modification increased on signal amplification sequence can make to connect on nucleic acid probe b more HRP molecules after
And cause stronger chemiluminescence.In order to make the detection sensitivity highest of whole system and detection limit minimum, it is modified with biotin
Quantity be 4.
The method that the present embodiment 2 provides is carried out linear detection range and minimum detection limit, detection specificity and its should
It is characterized as below with test is carried out：
(1) linear detection range and minimum detection limit
Some researches show that miR-16 is a kind of larger and more constant miRNA of concentration in blood, conduct at present
A kind of internal reference miRNA in blood of patients with lung cancer sample is widely used in early diagnosis and the monitoring after operation of lung cancer.We will
The diagnosis of lung cancer is carried out using the method that the present embodiment 2 provides, equally using the miR-16 in serum sample as internal reference, miR-21
Chemiluminescence detection value compare with it after, pass through the tentative diagnosis that obtained ratio carries out NSCLC.
As shown in fig. 7, the concentration (10fM to 50pM) of miR-16 is linearly related to the chemiluminescence detection value of gained,
The concentration of the concentration of miR-16 is bigger, and the chemiluminescence detection value of gained is also bigger；Its linear equation is：
C.I. (chemiluminescence detection value)=184.390Con. (miRNA concentration) × 1015-113.419
Standard deviation value (76.7AU) in the blank value (727 ± 76.7AU) detected is calculated with minimum detection limit
The lowest detection that formula (3 σ/S, σ are standard deviation, and S is the slope of linear equation) obtains this method is limited to 1.248fM.Have
Document report, in blood sample contained its content of the miRNA as tumor markers generally in fM between pM, this reality
The new system miRNA quantitative detecting methods of this chemiluminescence detection miRNA of example offer are applied because its range of linearity is in 10fM
To 50pM, lowest detection is limited to 1.248fM, and the miRNA contents being capable of detecting when in clinical blood sample can be applied to face
The tentative diagnosis of bed NSCLC.
(2) detection specificity
A kind of miRNA that let-7 families miRNA is made of the similar miRNA of multiple structures, such miRNA is to each other
The difference of only one to two bases, therefore it is usually utilized to the specificity of test miRNA detecting systems.It is provided in this embodiment
Six kinds of miRNA of let-7a to let-7f of artificial synthesized 1pM has equally been used to go the miRNA detections of test this method in method
Specificity.This method is less (11 bases) using the base that short nucleic acid chains (probe) hybridize with target miRNA, if there is mispairing
Or the situation of partial complementarity then connects loosely, can remove not fully complementary miRNA by the cleaning of multiple washing lotion.According to
There is the research of document, the artificial synthesized miRNA of a concentration of 1pM are had detected using let-7a nucleic acid probes a and nucleic acid probe b
Six kinds of miRNA of let-7a to let-7f in let-7 families.These miRNA are each other between structure there are most 3 bases, minimum 1
The difference of base.The present invention select six kinds of miRNA of let-7a to let-7f of artificial synthesized 1pM go test the present embodiment provides
Method miRNA detection specificity.
As shown in figure 8, the selectivity test figure for chemiluminescence detection system.It can be seen that the present embodiment 2 provided
Method at most causes the experimental error of 25.01% (let-7c) left and right.
(3) lung cancer detection is carried out using specific miRNA marker in SOL technologies and chemiluminescence detection serum
Present invention uses including being collected in Shenzhen people's hospital Serum of Patients with Lung Cancer in March, 2014 in June, 2016
28, sample, wherein 10 normal healthy controls persons with 18 differences by stages, in NSCLC patients serum's samples of age and gender
Both miRNA of miR-16, miR-21.
We will express relatively stable miR-16 as internal reference substance in blood, will be special in NSCLC patients serums
The miR-21 of different in nature high expression is as miRNA marker.Meanwhile we employ the miRCURY of Exiqon companiesTMRNA
Isolation Kits-Biofluids kits are extracted the miRNA in clinical serum sample, then use Applied
The TaqMan MicroRNA detection kits of Biosystems companies are determined with real-time fluorescence quantitative PCR instrument (7500) by fluorescence
The method of amount PCR has detected miR-16 and the Ct value internal references of miR-21, miR-21 detection in collected serum sample
The Ct values of miR-16 are uniformed, and miR-21 is relative to the multiple of internal reference miR-16 with 2-ΔCtIt represents.
In 5 fluorescence quantitative PCR detection normal healthy controls person's serum of table the Ct values of miR-16 and miR-21 and its homogenization after
Express multiple
Δ Ct* is that the Ct values of miR-21 in detection serum subtract the Ct values of miR-16 in serum.
In 6 fluorescence quantitative PCR detection NSCLC patients serum's samples of table the Ct values of miR-16 and miR-21 and its homogenization after
Expression multiple
Δ Ct* is that the Ct values of miR-21 in detection serum subtract the Ct values of miR-16 in serum.
The chemiluminescence inspection of miR-16 and miR-21 in method detection normal healthy controls person's serum that 7 the present embodiment 2 of table provides
Expression multiple after measured value (C.I.) and its homogenization
C.I.* 21/16Ratio for miR-21 chemiluminescence detections value and internal reference miR-16 chemiluminescence detection values.
The change of miR-16 and miR-21 in method detection NSCLC patients serum's samples that 8 the present embodiment 2 of table provides
Learn the expression multiple after shine detected value (C.I.) and its homogenization
C.I.* 21/16Ratio for miR-21 chemiluminescence detections value and internal reference miR-16 chemiluminescence detection values.
By the detection data of table 5~8, it is found that, compared with normal healthy controls person, miR-21 expression is general in NSCLC patients serums
All over raising, as a result meet existing document report.By fluorescent quantitative PCR technique testing result it is found that in normal healthy controls person's serum
Expression multiple after miR-21 and internal reference miR-16 homogenization is generally 0.0174 to 0.1398, median 0.0325；So
And the expression multiple in NSCLC patients serums after miR-21 and internal reference miR-16 homogenizations is in 0.0179 to 0.1857, wherein position
Number is 0.0709.The testing result of method that is there is provided by the present embodiment 2 it is found that in normal healthy controls person's serum miR-21 detected values with
Internal reference miR-16 detected value ratios multiple is generally 0.0254 to 0.1376, median 0.0434；However NSCLC patient's blood
Expression multiple in clear after miR-21 and internal reference miR-16 homogenizations is 0.0217 to 0.2040, median 0.0946.This
Embodiment 2 provide method testing result and fluorescent quantitative PCR technique testing result it is more consistent, present in difference
It may be from the extraction and separation process of the miRNA in serum.
It can be seen from the above result that the method that the present embodiment 2 provides can have as traditional fluorescent quantitative PCR technique
There is the ability of miRNA in detection and analysis serum, and it need not carry out the extraction and amplification of nucleic acid；Suffered from by detecting NSCLC
Specific expressed miRNA marker in person's serum can be used for facing using the chemical luminescence detection method of SOL technologies
The diagnosis of bed NSCLC.
Claims (10)
1. a kind of method for carrying out quantitative detection to serum miRNA marker using SOL technologies and chemiluminescence, feature
It is, described method includes following steps：
S1：Pretreatment is carried out to the serum sample of clinical acquisitions makes wherein miRNA dissociate, and obtains blood serum sample preprocessing solution, standby
With；
S2：Capture sequence solutions are added in into ELISA Plate, concussion is uniformly mixed after 25 ~ 40 DEG C of concussions, capture sequence is fixed
On ELISA Plate, solution is discarded, removes extra unreacted capture sequence；The capture sequence is NH2-(CH2)12-
GTTGTAAATTGTAGTAAAGAAGTA；The ELISA Plate contains can be with-NH2The group of reaction；
S3：Blood serum sample preprocessing solution, nucleic acid probe a solution and nucleic acid probe b solution in S1 is added in the enzyme mark of S2
In plate, concussion after mixing, hybridizes 15 ~ 21h under 40 ~ 50 DEG C of static conditions, discards filtrate, cleans at least 3 times；It is described
Nucleic acid probe a is：CAAACAAACATTCAAATATCAATC- and target miRNA half sequence complementary regions；The nucleic acid probe
B is：With the other half sequence complementary region of target miRNA-TACTTCTTTACTACAATTTACAAC；
S4：Signal amplification sequence solution is added in the ELISA Plate obtained to S3, after mixing, in 40 ~ 50 DEG C of static conditions
Lower hybridization hybridizes signal amplification sequence with nucleic acid probe b not less than 2h；The signal amplification sequence is：
GATTGATATTTGAATGTTTGTTG, the one or more biotins of modification on the signal amplification sequence；
S5：It adds in and can be shaken with Avidin-peroxide enzyme fusion proteins solution of biotin reaction in the ELISA Plate obtained to S4
It swings after mixing, is put Avidin-peroxide enzyme fusion proteins hybridization in the signal by biotin-avidin reaction
In big sequence；
S6：Chemiluminescence detection can be carried out with the chemiluminescent substrate of peroxidase reaction by being added on ELISA Plate, pass through mark
Directrix curve is the content that can obtain miRNA.
2. method according to claim 1, which is characterized in that in S1 pretreatment be：Blood sample solution is located in advance with serum
Manage liquid mixing, 60 ~ 120min of concussion reaction at 25 ~ 100 DEG C；The serum pretreatment fluid for Tween 20-TE buffer solutions with
The volume ratio of the mixed solution of Proteinase K, the serum treatment fluid and serum sample solution is not less than 1:1.
3. method according to claim 2, which is characterized in that the pH of the TE buffer solutions is 8.0；The serum pretreatment fluid
It is 1% that the mass concentration of middle Tween 20, which is not less than,；The concentration of the Proteinase K is not less than for 200 μ g/ml.
4. method according to claim 1, which is characterized in that the capture sequence is fixed on ELISA Plate by amide reaction
On.
5. method according to claim 1, which is characterized in that the capture sequence solutions is capture sequence PBS buffer solution, institute
The concentration for stating capture sequence is not less than 1nM.
6. method according to claim 1, which is characterized in that S3 center acid probe a solution is nucleic acid probe a TE buffer solutions,
Nucleic acid probe b solution is nucleic acid probe b TE buffer solutions；The pH of the buffer solution is 7 ~ 8, the concentration of the nucleic acid probe a and b
It is not less than 1nM.
7. method according to claim 1, which is characterized in that hybridization time is 21h in S3.
8. method according to claim 1, which is characterized in that the quantity for the biotin modified on signal amplification sequence in S4 is
1 ~ 4.
9. method according to claim 1, which is characterized in that Avidin-peroxide enzyme fusion proteins in S5 are mould to join
Avidin-horseradish peroxidase fusion protein or Avidin-horseradish peroxidase fusion protein.
10. method according to claim 1, which is characterized in that in S6 chemiluminescent substrate for luminol, different luminol and its
One or more of derivative species and hydrogen peroxide solution.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711423381.4A CN108132241A (en) | 2017-12-25 | 2017-12-25 | A kind of method for carrying out quantitative detection to serum miRNA marker using SOL technologies and chemiluminescence |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711423381.4A CN108132241A (en) | 2017-12-25 | 2017-12-25 | A kind of method for carrying out quantitative detection to serum miRNA marker using SOL technologies and chemiluminescence |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108132241A true CN108132241A (en) | 2018-06-08 |
Family
ID=62392403
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711423381.4A Pending CN108132241A (en) | 2017-12-25 | 2017-12-25 | A kind of method for carrying out quantitative detection to serum miRNA marker using SOL technologies and chemiluminescence |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108132241A (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090181390A1 (en) * | 2008-01-11 | 2009-07-16 | Signosis, Inc. A California Corporation | High throughput detection of micrornas and use for disease diagnosis |
| US20120045768A1 (en) * | 2009-04-16 | 2012-02-23 | Padma Arunachalam | Methods and compositions to detect and differentiate small rnas in rna maturation pathway |
| CN104569394A (en) * | 2014-12-24 | 2015-04-29 | 深圳市老年医学研究所 | Multiple miRNA tumor marker detecting method and application thereof |
| CN105506126A (en) * | 2016-01-12 | 2016-04-20 | 重庆大学 | Small annular nucleotide probe with large tension and preparation method and application thereof |
| CN107058584A (en) * | 2017-06-07 | 2017-08-18 | 浙江殷欣生物技术有限公司 | A kind of nucleic acid hybridizes chemical luminescence detection method |
| CN107099612A (en) * | 2017-06-21 | 2017-08-29 | 深圳市展行生物有限公司 | A kind of method based on short nucleotide chain connecting detection cancer patient's serum miRNA |
-
2017
- 2017-12-25 CN CN201711423381.4A patent/CN108132241A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090181390A1 (en) * | 2008-01-11 | 2009-07-16 | Signosis, Inc. A California Corporation | High throughput detection of micrornas and use for disease diagnosis |
| US20120045768A1 (en) * | 2009-04-16 | 2012-02-23 | Padma Arunachalam | Methods and compositions to detect and differentiate small rnas in rna maturation pathway |
| CN104569394A (en) * | 2014-12-24 | 2015-04-29 | 深圳市老年医学研究所 | Multiple miRNA tumor marker detecting method and application thereof |
| CN105506126A (en) * | 2016-01-12 | 2016-04-20 | 重庆大学 | Small annular nucleotide probe with large tension and preparation method and application thereof |
| CN107058584A (en) * | 2017-06-07 | 2017-08-18 | 浙江殷欣生物技术有限公司 | A kind of nucleic acid hybridizes chemical luminescence detection method |
| CN107099612A (en) * | 2017-06-21 | 2017-08-29 | 深圳市展行生物有限公司 | A kind of method based on short nucleotide chain connecting detection cancer patient's serum miRNA |
Non-Patent Citations (1)
| Title |
|---|
| 王晓峰等: "《园艺植物生物技术实验指导》", 30 September 2017 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107365852B (en) | Application of lung cancer related microRNA molecular marker in serum exosome and detection kit thereof | |
| US20070065844A1 (en) | Solution-based methods for RNA expression profiling | |
| US9637793B2 (en) | Pancreatic cancer markers, and detecting methods, kits, biochips thereof | |
| CN101988060A (en) | Marker for detecting colon and rectum cancer as well as detection method, kit and biological chip thereof | |
| WO2016186987A1 (en) | Biomarker micrornas and method for determining tumor burden | |
| WO2014114802A1 (en) | Non-invasive prenatal genetic diagnostic methods | |
| CN107881241A (en) | Application of the gene marker in breast cancer diagnosis and treatment | |
| CN102666878A (en) | Markers, methods, biochips and kits for milk qualit y detection | |
| CN102892898A (en) | Diagnostic kit including micro-rna biomarkers and used for diagnosis of hepatocellular carcinoma, and method | |
| CN110423811A (en) | Sepsis diagnosis marker | |
| CN103764843B (en) | For the method and composition for the risk for determining heart failure or heart failure | |
| Alsop et al. | A novel tissue atlas and online tool for the interrogation of small RNA expression in human tissues and biofluids | |
| CN109022583A (en) | Hsa_circ_0021977 is preparing the application on Diagnosis of Breast cancer product | |
| CN109251964A (en) | Recycle the method and application of microRNAs detection kit and specific detection circulation microRNAs | |
| CN107312851A (en) | Myocardial infarction biomarker miR 1283 | |
| CN107614704A (en) | sampling sequencing | |
| CN102443638A (en) | Internal reference for detecting miRNA (micro Ribonucleic Acid) in serum/blood plasma and application of internal reference | |
| CN108132241A (en) | A kind of method for carrying out quantitative detection to serum miRNA marker using SOL technologies and chemiluminescence | |
| CN108660211A (en) | A kind of and the relevant biomarker LINC01549 of hepatocellular carcinoma and its application | |
| CN107447008A (en) | For the enhancer RNA combinations of acatalepsia reason recurrent miscarriage, primer sets and application and kit | |
| CN108152274A (en) | A kind of method for carrying out quantitative detection to serum miRNA using RNase ONE nucleases and chemiluminescence | |
| CN101365800B (en) | Composition and method for determination of CK19 expression | |
| Chen et al. | Single-molecule assay guided crRNA optimization enhances specific microRNA detection by CRISPR-Cas12a | |
| CN106701761A (en) | Long-chain non-coding RNA (Ribonucleic Acid) NR-027469.1 and preparation or diagnostic reagent or medicine or kit and application | |
| CN105664163A (en) | Application of mir-5010 and mature miRNA (micro ribonucleic acid) of mir-5010 in preparation of OSA (osteosarcoma) diagnosis and treatment preparation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180608 |