CN108103100A - A kind of carrier for expression of eukaryon for expressing circular rna - Google Patents

Abstract

The invention discloses a kind of carrier for expression of eukaryon for expressing circular rna.Present invention is generally applicable to the cyclization expression of various circRNA, and expression efficiency is efficient, stablizes；Meet the exposition need of overwhelming majority circRNA；Expressing circRNA using this kind of carrier, operation is simple, easy to spread.The present invention provides a strong research tool to study the function of circRNA and mechanism, to further determine that circRNA molecules provide theories integration as the research and development of Novel marker and disease treatment target.

Description

A kind of carrier for expression of eukaryon for expressing circular rna

Technical field

The present invention relates to biological technical field more particularly to a kind of carrier for expression of eukaryon for being used to help circular rna cyclization.

Background technology

The Human Genome Project and its subsequent DNA element encyclopedia plan (The Encyclopedia of DNA Elements Project, ENCODE) achievement in research shows that protein coding gene sequence only accounts for the 1- of human genomic sequence 3%, and the transcribed sequence of the overwhelming majority is non-coding RNA (non-coding RNA, ncRNA) in human genome.Non-coding RNA is although non-coding protein, the genes within cells expression regulations due to wide participation, in field of biomedical research always It is concerned.Study more is linear ncRNA molecules, from RNA sequence length can be divided into Microrna (microRNA, MiRNA, 19-23nt) and long-chain non-coding RNA (long non-coding RNA, lncRNAs,>200nt), they including Important function is played in the occurrence and development of a variety of mankind's common diseases including malignant tumour.Recently, it is a kind of brand-new NcRNA molecules, circular rna (circular RNA, circRNA) is due to its unique configuration and the important biomolecule increasingly found Function is learned, has become the new forward position of biomedical sector and hot spot.

CircRNA had once once been taken as the wrong product during genetic transcription post-processing.With the lines such as mRNA and lncRNA Property RNA process it is much like, the formation of circRNA is given birth to when being also and carrying out montage processing to RNA precursors by splicing complex Into, only in this course, the loop-forming sequences of flank combine cyclization first, and subsequent splicing complex carries out montage, most Flanking sequence cuts off to form circRNA at last.Recently as new-generation sequencings technologies such as sequencing technologies especially RNA-seq Development, more and more circRNA by research by it has been found that simultaneously disclose part circRNA in numerous life It all plays an important role in activity.Additionally due to its unique structure causes circRNA insensitive to nuclease, in conduct CircRNA also has a clear superiority in terms of the development and application of molecular marker, therefore very likely as a kind of important molecule The target spot of marker and emerging drug development.But since this field has just been risen, most of circRNA be not yet found or It there is no research.

The one essential means of function and regulatory mechanism for studying circRNA are exactly to be overexpressed to feel emerging in the cell The circRNA of interest, observes its influence to cell function.So, to improve expression efficiencies of the circRNA in cell and then grind Its function and regulatory mechanism are studied carefully, it is necessary to the instrument for being overexpressed gene studies that is efficient, stablizing.

The content of the invention

The purpose of the invention is to provide a kind of carrier for expression of eukaryon for being used to help circular rna cyclization.The present invention is general All over the cyclization expression suitable for various circRNA, expression efficiency is efficient, stablizes；Meet the expression need of overwhelming majority circRNA It asks；Expressing circRNA using this kind of carrier, operation is simple, easy to spread.It is provided to study the function of circRNA and mechanism One strong research tool, to further determine that circRNA molecules grinding as Novel marker and disease treatment target Study carefully and develop and theories integration is provided.

The present invention is achieved through the following technical solutions：

A kind of carrier for expression of eukaryon for expressing circular rna, it builds by the following method：

(1) according to the Forming Mechanism of circRNA and the fundamentum of eucaryote RNA montages, design and be suitable for The upstream and downstream loop-forming sequences of circRNA expression；According to the sequence information of carrier, multiple cloning sites are designed；

Upstream loop-forming sequences：

GTGCTGGGATTACAGGTGTGAGCTACCACCCCCGGCCCACTTTTT；Such as SEQ NO：Shown in 1,

Downstream loop-forming sequences：

GAAAAGAATTAGGCTCGGCACGGTAGCTCACACCTGTAATCCCAGCA, such as SEQ NO：Shown in 2,

It is multiple cloning sites sequence among the loop-forming sequences of upstream and downstream；Multiple cloning sites region is needed into for digestion insertion The RNA sequence of ring；It is artificial synthesized so as to obtain completely realize circRNA be overexpressed DNA sequence dna；

(2) restriction enzyme site sequence is added at the both ends of the DNA sequence dna realized circRNA and be overexpressed of above-mentioned synthesis, passes through It is built into after double digestion in carrier, obtains pcCirc empty plasmids, sequencing confirms that plasmid is correct；The restriction enzyme site of addition is and original Restriction enzyme site on beginning carrier is corresponding, and what restriction enzyme site selected is two endpoints in initial carrier multiple cloning sites region Restriction enzyme site；The DNA sequence dna that the realization circRNA of synthesis is overexpressed can be made to replace the multiple cloning sites area in initial carrier Domain；

(3) restriction enzyme site in multiple cloning sites sequence is selected for digestion pcCirc empty plasmids, and will need cyclization Sequence insertion vector upstream and downstream loop-forming sequences between.

The detailed process of step (3) is as follows：

1) loop-forming sequences are needed through double digestion rear electrophoresis, glue recycling by what is amplified；

2) pcCirc empty plasmids recycle target fragment through the identical double digestion rear electrophoresis glue of step 1)；

3) 1) carried with the connection of T4 DNA ligases with 2) step glue recovery product to get the eukaryotic expression to expression circular rna Body.

4) by the eukaryon expression plasmid transformed competence colibacillus Escherichia coli comprising loop-forming sequences that 3) step obtains, to expand matter Grain.

Initial carrier is pcDNA3.1 in step (1), and multiple cloning sites regional sequence is：

CTTAAGCTTGGTACCGAGCTCGGATCCACATCGATTGGTGGAATTCTGCAGATATCCACCGCGGTGGCGGCCGCTCG AGTCTAGA；Such as SEQ NO：Shown in 3, successively including AflII, HindIII, KpnI, BamHI, ClaI, EcoRI, EcoRV, SacII, NotI, XhoI, XbaI restriction enzyme enzyme recognition site.

Step (2) realizes that NheI restriction enzyme site sequences are added in DNA sequence dna one end that circRNA is overexpressed by synthesis, separately ApaI restriction enzyme site sequences are added in one end, by being built into after NheI and ApaI digestions in pcDNA3.1 carriers, obtain pcCirc Empty plasmid, sequencing confirm that plasmid is correct.

Step (3) selection Cla I and Sac II restriction enzyme sites will need cyclic sequence for digestion pcCirc empty plasmids Between the upstream and downstream loop-forming sequences of row insertion carrier.

Building process of the present invention exemplified by expressing circRNF13 carrier for expression of eukaryon is as follows：

(1) according to the Forming Mechanism of circRNA and the fundamentum of eucaryote RNA montages, design and be suitable for The loop-forming sequences of circRNA expression；According to the sequence information of commercial carrier pcDNA3.1, multiple cloning sites are designed, so as to It is as follows to the complete DNA sequence dna for realizing that circRNA is overexpressed：

GTGCTGGGATTACAGGTGTGAGCTACCACCCCCGGCCCACTTTTTCTTAAGCTTGGTACCGAGCTCGGATCCACATC GATTGGTGGAATTCTGCAGATATCCACCGCGGTGGCGGCCGCTCGAGTCTAGAGAAAAGAATTAGGCTCGGCACGGT AGCTCACACCTGTAATCCCAGCA, such as SEQ NO：Shown in 4, intermediate underscore part is multiple cloning sites, and both ends are respectively Upstream and downstream loop-forming sequences；

(2) above-mentioned synthesis is realized that NheI restriction enzyme site sequences are added in DNA sequence dna one end that circRNA is overexpressed, separately ApaI restriction enzyme site sequences are added in one end, by being built into after NheI and ApaI digestions in pcDNA3.1 carriers, obtain pcCirc Empty plasmid, sequencing confirm that plasmid is correct, sequence such as SEQ NO:Shown in 5；

(3) Cla I and Sac II restriction enzyme sites are selected for digestion pcCirc empty plasmids, and by circRNF13 sequences It is inserted between the upstream and downstream loop-forming sequences of carrier, circRNF13 sequences such as SEQ NO：It is specific as follows shown in 6：

1) using Tca8113 cells Tca8113 cDNA as template, TaKaRa LA are utilizedEnzyme carries out PCR amplification overall length CircRNF13 sequences；CircRNF13 full length sequence amplimers are as follows：

Sense primer：5 '-GTGATTTTACAACGAGAT-3 ' such as SEQ NO:Shown in 7；

Anti-sense primer：5 '-CTTTCTTGAATTTATGTA-3 ' such as SEQ NO:Shown in 8；

In upstream and downstream, 5 ' ends of primer are respectively plus restriction enzyme Cla I and Sac II recognition sites and protection alkali After base, primer sequence is as follows：

Sense primer：5’-AGGAATCGATGTGATTTTACAACGAGAT-3 ' such as SEQ NO:Shown in 9, underscore part For Cla I recognition sites；

Anti-sense primer：5’-ATGCCCGCGGCTTTCTTGAATTTATGTA-3 ' such as SEQ NO:Shown in 10, underscore portion It is divided into Sac II recognition sites；

2) PCR amplification, circRNF13 full length sequences, PCR reaction conditions are as follows：

PCR reaction steps

5 return to the 2nd step, carry out 39 cycling of secondary response altogether；

3) by through Cla I and Sac II double digestion rear electrophoresis, glue returns again after PCR product electrophoresis, glue recycling target fragment It receives；

4) pcCirc empty plasmids recycle target fragment through Cla I and Sac II double digestion rear electrophoresis glue；

5) with the connection of T4 DNA ligases 3) and 4) step glue recovery product to get to the eukaryotic expression of expression circRNF13 Plasmid；

6) by the eukaryon expression plasmid transformed competence colibacillus large intestine bar comprising circRNF13 full length sequences that 5) step obtains Bacterium, to expand plasmid.

At the DNA sequence dna both ends for realizing circRNA overexpressions of synthesis except adding NheI and ApaI in above-mentioned steps (2) Outside restriction enzyme site sequence or it can also add in initial carrier multiple cloning sites region close to other digestion positions of two endpoints Point；As long as the DNA sequence dna that purpose can be overexpressed the realization circRNA of synthesis replaces the multiple cloning sites in initial carrier Region.

The present invention is transferred in Tca8113 cells exemplified by expressing circRNF13 carrier for expression of eukaryon and finds and confirm CircRNF13 is overexpressed in Tca8113 cells, the multiplication of Tca8113 cells can be inhibited, and table is crossed in Dendritic cell mdr cell Up to circRNF13, the drug resistance of Tca8113 cells can be substantially reversed.Further illustrate that expression circRNF13 eukaryotic expressions carry The successful structure of body, and with far-reaching clinical meaning and important popularizing application prospect.

Meanwhile the DNA sequence dna of a variety of help RNA cyclization is devised in the experimentation of the application, by screening and reliably Experimental result confirm loop-forming sequences of the present invention and its corresponding expression vector best results, it is easy to operate, result is steady Fixed, expression is efficiently.The loop-forming sequences and corresponding carrier can be widely used in the expression of various circRNA, to study circRNA Function and mechanism provide a strong research tool, for further determine that circRNA molecules as Novel marker and The research and development of disease treatment target provides theories integration.

Description of the drawings

Fig. 1：It is the pcCirc plasmid overall structure figures of the present invention.

Fig. 2：It is the circRNF13 over-express vector structure charts constructed by the present invention.

Fig. 3：It is the pcCirc plasmids overexpression design sketch of the present invention.

Fig. 4：Design simultaneously successfully build circRNF13 over-express vectors, using pcDNA3.1 carriers as basic framework, by Its CMV promoter downstream adds in two sections of loop-forming sequences and restriction enzyme site, and the 2-8 exons of RNF13 are passed through PCR, digestion are connected in carrier (left side), are then transfected into Tca8113 cells, are successfully overexpressed in Tca8113 cells CircRNF13 (right side).

Fig. 5：It is devised for circRNF13 ring-types splicing site (extron 8 and exon 2 junction) selectively targeted The siRNA sequence (left side) of the circular rna, is then transfected into Tca8113 cells, is successfully struck in Tca8113 cells low The expression (right side) of circRNF13.

Fig. 6：MTT proliferation experiments show compared with control group (NC), and being overexpressed circRNF13 (OE-circRNF13) can be with Inhibit the multiplication of Tca8113 cells, and the expression (si-circRNF13) for striking low circRNF13 can promote Tca8113 cells Multiplication.

Fig. 7：Flow cytometry analysis is found compared with control group (NC), is overexpressed circRNF13 (OE-circRNF13) Tca8113 cells G2/M phase distribution proportions substantially increase afterwards, show cell-cycle arrest in the G2/M phases, and strike low circRNF13's After expressing (si-circRNF13), the S phases, which are distributed, significantly increases, and shows that cell cycle progression accelerates.

Fig. 8：Flow cytometry analysis Apoptosis situation is found compared with control group (NC), is overexpressed circRNF13 (OE-circRNF13) Tca8113 cells apoptosis ratio substantially increases afterwards, in the case of normal culture, apoptosis of tumor cells ratio compared with Low, so striking the expression of low circRNF13, apoptotic cell ratio is in a slight decrease.

Fig. 9：CircRNF13 expression significantly reduces in chemotherapy resistance cell (CR) compared with control group (NC).

Figure 10：The expression (si-circRNF13) of low circRNF13 is struck in original Tca8113 cells (NC) or resistance to After circRNF13 (OE-circRNF13) is overexpressed in medicine cell (CR), with the cisplatin treated cell of same concentrations, then streaming Cell instrument detects Apoptosis situation, and the expression for finding to strike low circRNF13 can increase tolerance of the cell to cis-platinum (apoptosis subtracts It is few), and the drug resistance of mdr cell can then be significantly reduced by being overexpressed circRNF13.

Specific embodiment

It further illustrates the present invention, is not intended to limit the present invention below in conjunction with specific embodiment.

Embodiment 1, the structure of the plasmid of pcCirc

Technology according to the present invention is molecular cloning conventional technical means, the enzyme being directed to, primer, reagent and Reaction condition can be reasonably selected in the case of not specified (NS) according to the experience of those skilled in the art, be directed to try Agent consumptive material belongs to commercially available mill run, and the detection means and instrument being directed to also are well known to the skilled person And it skillfully grasps.It crosses embodiment and test example is described further technical scheme, but should not be construed as to this The limitation of invention.

Exemplified by being commercialized expression vector (pcDNA3.1), we construct over-express vector pcCirc, more grams therein Grand site areas sequence is：

CTTAAGCTTGGTACCGAGCTCGGATCCACATCGATTGGTGGAATTCTGCAGATATCCACCGCGGTGGCGGCCGCTCG AGTCTAGA forgive successively AflII, HindIII, KpnI, BamHI, ClaI, EcoRI, EcoRV, SacII, NotI, XhoI, The restriction enzymes enzyme recognition site such as XbaI, carrier structure figure are shown in attached drawing 1.

It is to verify DNA sequence dna of the invention and its carrier to the expression effect of circRNA, we have selected circRNF13 Linear order information, design primer expanded from people's cDNA templates, the sequence is inserted by ClaI and SacII sites In pcCirc carriers, obtain circRNF13 and be overexpressed plasmid, plasmid construct figure is shown in attached drawing 2.

It is as follows to build circRNF13 eukaryotic vector steps：

(1) according to the Forming Mechanism of circRNA and the fundamentum of eucaryote RNA montages, design and be suitable for The loop-forming sequences of circRNA expression；According to the sequence information of commercial carrier pcDNA3.1, multiple cloning sites are designed, so as to It is as follows to the complete DNA sequence dna for realizing that circRNA is overexpressed：

GTGCTGGGATTACAGGTGTGAGCTACCACCCCCGGCCCACTTTTTCTTAAGCTTGGTACCGAGCTCGGATCCACATC GATTGGTGGAATTCTGCAGATATCCACCGCGGTGGCGGCCGCTCGAGTCTAGAGAAAAGAATTAGGCTCGGCACGGT AGCTCACACCTGTAATCCCAGCA, intermediate underscore part are multiple cloning sites, and both ends are respectively upstream and downstream loop-forming sequences；

(2) above-mentioned synthesis is realized that NheI restriction enzyme site sequences are added in DNA sequence dna one end that circRNA is overexpressed, separately ApaI restriction enzyme site sequences are added in one end, by being built into after NheI and ApaI digestions in pcDNA3.1 carriers, obtain pcCirc Empty plasmid, sequencing confirm that plasmid is correct, sequence such as SEQ NO:Shown in 5；

(3) Cla I and Sac II restriction enzyme sites are selected for digestion pcCirc empty plasmids, and by circRNF13 sequences It is inserted between the upstream and downstream loop-forming sequences of carrier, circRNF13 sequences such as SEQ NO：Shown in 6, since circRNF13 is one Circular rna simply illustrates its complete 716bp sequence in sequence table, which joins end to end, lacking beginning and end.

It is specific as follows：

1) using Tca8113 cells Tca8113 cDNA as template, TaKaRa LA are utilizedEnzyme carries out PCR amplification overall length CircRNF13 sequences；CircRNF13 full length sequence amplimers are as follows：

Sense primer：5’-GTGATTTTACAACGAGAT-3’；

Anti-sense primer：5’-CTTTCTTGAATTTATGTA-3’；

In upstream and downstream, 5 ' ends of primer are respectively plus restriction enzyme Cla I and Sac II recognition sites and protection alkali After base, primer sequence is as follows：

Sense primer：5’-AGGAATCGAT GTGATTTTACAACGAGAT-3 ', underscore part identify position for Cla I Point；

Anti-sense primer：5’-ATGCCCGCGG CTTTCTTGAATTTATGTA-3 ', underscore part identify position for Sac II Point；

2) PCR amplification, circRNF13 full length sequences, PCR reaction conditions are as follows：

PCR reaction steps

3) by through Cla I and Sac II double digestion rear electrophoresis, glue returns again after PCR product electrophoresis, glue recycling target fragment It receives；

4) pcCirc empty plasmids recycle target fragment through Cla I and Sac II double digestion rear electrophoresis glue；

5) with the connection of T4 DNA ligases 3) and 4) step glue recovery product to get to the eukaryotic expression of expression circRNF13 Plasmid；

6) by the eukaryon expression plasmid transformed competence colibacillus large intestine bar comprising circRNF13 full length sequences that 5) step obtains Bacterium, to expand plasmid；And through sequence verification.

Embodiment 2, is overexpressed circRNF13 in Tca8113 cells

1. materials and methods

1.1 cell culture and transfection

The good Human Tongue Carcinoma Lines Tca8113 and Cal27 of growth conditions is pressed 2 × 10⁵A cells/well is inoculated in 6 orifice plates, 6 orifice plates are placed in 37 DEG C, 5%CO₂In incubator, cell growth to be cultivated to 50-70% density can start circRNF13 mistakes The transfection of expression vector；Transfection process is as follows：

The carrying circRNF13 eukaryon expression plasmid polylysine modifications that 100 μ l are prepared are added in sterile EP pipes Nano silicon particles suspension, with the 100 mild mixings of μ l serum free mediums；Cell is washed with D-Hank's liquid 3 times；It will be above-mentioned mixed It closes in object and adds in 800 μ l serum free mediums (antibiotic-free), 1 hole in 6 orifice plates is added in after mild mixing；6 orifice plates are put In CO₂In incubator, when 37 DEG C of cultures 6 are small, supernatant is then abandoned, complete medium is added in and continues overnight incubation.With empty carrier The nano silicon particles of polylysine modification are as experiment contrast.

1.2 real-time fluorescence quantitative PCRs detect the expression of intracellular circRNF13

After cell processing, in suitable time point collecting cell, extracted total RNA, 1 μ g RNA through reverse transcription into after cDNA, Carry out real-time fluorescence quantitative PCR.CircRNF13 forward primers are 5-GTCCAGGATAGACATAGAGC-3 such as SEQ NO:11 institutes Show and reverse primer 5-GTGTAGACTTGTGTGGCTGA-3 such as SEQ NO:Shown in 12.

GAPDH forward primers for control are 5 '-ACCACAGTCCATGCCATCAC-3 ' such as SEQ NO:Shown in 13 and Reverse primer 5 '-TCCACCACCCTGTTGCTGTA-3 ' such as SEQ NO:Shown in 14.

Real-time fluorescence quantitative PCR reaction system

Real-time fluorescence quantitative PCR reaction step

The amplification curve and melting curve of real-time fluorescence quantitative PCR, the expression intensity root of each gene are confirmed after reaction After CT values (threshold cycle values), reference gene (GAPDH) markization, examined and calculated using group t-test P values.

2. result

After transfecting circRNF13 carrier for expression of eukaryon, we are had detected by real-time fluorescence quantitative PCR in cell The expression of circRNF13 finds that circRNF13 expressions are significantly raised (Fig. 3).Show the present invention can stablize, efficient table Up to circRNA, operation is simple.

Embodiment 3

Cell culture and transfection

The good Tca8113 cells Tca8113 and Cal27 of growth conditions or mdr cell are pressed 2 × 10⁵A cells/well It is inoculated in 6 orifice plates, 6 orifice plates is placed in 37 DEG C, 5%CO₂In incubator, cell growth to be cultivated to 50-70% density Start circRNF13 over-express vectors or the transfection of siRNA；Transfection process is as follows：

The poly that carrying circRNF13 eukaryon expression plasmids that 100 μ l prepare or siRNA are added in sterile EP pipes relies The nano silicon particles suspension of propylhomoserin modification, with the 100 mild mixings of μ l serum free mediums；Cell is washed with D-Hank's liquid 3 times； 800 μ l serum free mediums (antibiotic-free) will be added in said mixture, 1 hole in 6 orifice plates is added in after mild mixing；It will 6 orifice plates are placed in CO₂In incubator, when 37 DEG C of cultures 6 are small, supernatant is then abandoned, complete medium is added in and continues overnight incubation.With sky The nano silicon particles of carrier or the polylysine modification of Scramble sequences are as experiment contrast.

1st, real-time fluorescence quantitative PCR detects the expression of intracellular circRNF13

After cell processing, in suitable time point collecting cell, extracted total RNA, 1 μ g RNA through reverse transcription into after cDNA, Carry out real-time fluorescence quantitative PCR.CircRNF13 forward primers are 5-GTCCAGGATAGACATAGAGC-3 and reverse primer 5- GTGTAGACTTGTGTGGCTGA-3。

For control GAPDH forward primers for 5 '-ACCACAGTCCATGCCATCAC-3 ' and reverse primer 5 '- TCCACCACCCTGTTGCTGTA-3’。

Real-time fluorescence quantitative PCR reaction system

Real-time fluorescence quantitative PCR reaction step

The amplification curve and melting curve of real-time fluorescence quantitative PCR, the expression intensity root of each gene are confirmed after reaction After CT values (threshold cycle values), reference gene (GAPDH) markization, examined and calculated using group t-test P values.

2nd, MTT cell proliferation experiments

1) digest cell obtained in the previous step, cell counted with cell counter, will transfection circRNF13 and The cell inoculation of pcDNA3.1 empty carriers is inoculated with 1000 cells per hole, as a result each 5 hole of cell inoculation takes in 96 orifice plates Its average.

2) 37 DEG C, 5%CO₂When incubator culture 6 is small, after cell attachment, add 20 μ l of MTT liquid (5mg/ml) per hole.After It is continuous be incubated 4 it is small when, terminate culture, discard culture solution.150 μ l DMSO are added per hole, vibrates 10 minutes, dissolves crystal.

3) 490nm wavelength is selected, zeroing hole is concurrently set, on enzyme-linked immunosorbent assay instrument, measures each hole absorbance simultaneously Record result.

4) step is repeated when 24 is small to be same as above, detect 6 days altogether.Using absorbance as ordinate, interval time is horizontal seat Plotting MTT curves.

5) test in triplicate.Using each time point as abscissa, absorbance is ordinate, draws cell growth curve.

3rd, the flow cytometry analysis cell cycle

1) trypsin digestion cell when culture cell reaches 85% fusion, 1200rpm/min centrifugation 5min, collects cell and sinks It forms sediment.

2) cell is resuspended in 1xPBS, and 1200rpm/min centrifuges 5min, collects cell.Repeat this step 2 time.

3) cell is resuspended in 1xPBS, and 70% ethyl alcohol for adding in precooling fixes cell pellet overnight.

4) 1000rcf/min centrifuges 5min, collects cell precipitation.

5) PH7.4PBS washs cell 1 time, PBS is added in after centrifugation, cell is resuspended, and adjust cell concentration to Ix 10⁶/ ml。

6) propidium iodide (PI) dyeing liquor (PI containing 50mg/L, 1g/L Triton X-100,100g/L RNase) is added in Mixing, 4 DEG C are protected from light incubation 30min.

7) flow cytometer FACStar (U.S. company BD) is detected.Received signal is right through Cellquest software processings The fluorescence intensity of detection cell is analyzed.Experiment is repeated 3 times.

4th, flow cytometry analysis natural death of cerebral cells rate

1) when culture cell reaches 85% fusion, digest each group cell with pancreatin and be collected in centrifuge tube, be collected simultaneously Each group supernatant suspension cell.Pay attention to gently blowing and beating cell, pancreatin is avoided excessively to digest.

2) merge each group cell respectively and be transferred in centrifuge tube, 1000rpm centrifugation 5min abandon supernatant and collect cell, PBS After being gently resuspended, cell count.

3) 5~100,000 resuspension cells are taken, 1000rpm centrifugation 5min abandon supernatant, add in 195ul Annexin V-FITC knots It closes liquid and cell is gently resuspended.

4) 5ul Annexin V are added in, gently mixing.It is protected from light incubation at room temperature 10min.

5) 1000rpm centrifuges 5min, abandons supernatant, adds in 190ul Annexin V-FITC combination liquid and cell is gently resuspended.

6) 10ul PI dyeing liquors are added in, gently mixing, ice bath are protected from light.

7) flow cytomery is carried out immediately, and Annexin V-FITC are green fluorescence, and PI is red fluorescence.

As a result

1st, circRNF13 inhibits the growth of Tca8113 cells

After transfecting circRNF13 carrier for expression of eukaryon, we are had detected by real-time fluorescence quantitative PCR in cell The expression of circRNF13 finds that circRNF13 expressions are significantly raised (Fig. 4)；And transfect the small dry of targeting circRNF13 After disturbing RNA (siRNA), the expression of intracellular circRNF13 is substantially lowered (Fig. 5)；

Compared with transfecting the cell of empty carrier, the life of the Tca8113 cells Tca8113 and Cal27 of circRNF13 are overexpressed Long speed significantly slows down, and after the expression of low circRNF13 is struck using siRNA interference sequences, vitro growth rates accelerate (figure 6)。

2nd, circRNF13 inhibits the growth of Tca8113 cells by arresting cell cycle, inducing cell apoptosis.

Flow cytometry analysis shows after transfecting circRNF13 in Tca8113 cells that G2/M phase cell proportions significantly increase Add, and S phases cell proportion is reduced, and shows that circRNF13 can block Tca8113 cells in the G2/M phases, make its cell division slow Speed (figure/7).Meanwhile apoptotic cell ratio substantially increases (Fig. 8) after transfection circRNF13 in Tca8113 cells, this is also CircRNF13 inhibits one of the reason for Tca8113 cells growth.And it strikes low circRNF13 and has then obtained opposite result.

3rd, circRNF13 expresses downward in Dendritic cell mdr cell

We by some months are cultivated by being stepped up cis-platin concentrations in the medium, and successfully induction obtains Tca8113 and Cal27 has detected the expression of circRNF13 in cell to the cell of cisplatin resistance, real-time quantitative PCR, sends out Existing expression of the circRNF13 in drug-resistant cell strain has significantly lowered (Fig. 9) compared with initial cell strain.

4th, Tca8113 cells drug-resistant phenotype can be reversed by being overexpressed circRNF13

The expression (si-circRNF13) of low circRNF13 is struck in original Tca8113 cells (NC) or in mdr cell (CR) after being overexpressed circRNF13 (OE-circRNF13) in, with the cisplatin treated cell of same concentrations, then flow cytometer Apoptosis situation is detected, the expression for finding to strike low circRNF13 can increase tolerance (apoptosis reduction) of the cell to cis-platinum, and The drug resistance (Figure 10) of mdr cell can then be significantly reduced by being overexpressed circRNF13.

Sequence table

<110>Central South University

<120>A kind of carrier for expression of eukaryon for expressing circular rna

<160> 14

<170> SIPOSequenceListing 1.0

<210> 3

<211> 45

<212> DNA

<213>Unknown (Unknown)

<400> 3

gtgctgggat tacaggtgtg agctaccacc cccggcccac ttttt 45

<210> 4

<211> 47

<212> DNA

<213>Unknown (Unknown)

<400> 4

gaaaagaatt aggctcggca cggtagctca cacctgtaat cccagca 47

<210> 5

<211> 85

<212> DNA

<213>Unknown (Unknown)

<400> 5

cttaagcttg gtaccgagct cggatccaca tcgattggtg gaattctgca gatatccacc 60

gcggtggcgg ccgctcgagt ctaga 85

<210> 6

<211> 177

<212> DNA

<213>Unknown (Unknown)

<400> 6

gtgctgggat tacaggtgtg agctaccacc cccggcccac tttttcttaa gcttggtacc 60

gagctcggat ccacatcgat tggtggaatt ctgcagatat ccaccgcggt ggcggccgct 120

cgagtctaga gaaaagaatt aggctcggca cggtagctca cacctgtaat cccagca 177

<210> 7

<211> 5515

<212> DNA

<213>Unknown (Unknown)

<400> 7

gacggatcgg gagatctccc gatcccctat ggtgcactct cagtacaatc tgctctgatg 60

ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg 120

cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc 180

ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt 240

gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 300

tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 360

cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 420

attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt 480

atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 540

atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 600

tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg 660

actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 720

aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg 780

gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca 840

ctgcttactg gcttatcgaa attaatacga ctcactatag ggagacccaa gctggctagc 900

gtgctgggat tacaggtgtg agctaccacc cccggcccac ttttttttaa acttaagctt 960

ggtaccgagc tcggatccac atcgattggt ggaattctgc agatatccac cgcggtggcg 1020

gccgctcgag tctagagaaa agaattaggc tcggcacggt agctcacacc tgtaatccca 1080

gcagggcccg tttaaacccg ctgatcagcc tcgactgtgc cttctagttg ccagccatct 1140

gttgtttgcc cctcccccgt gccttccttg accctggaag gtgccactcc cactgtcctt 1200

tcctaataaa atgaggaaat tgcatcgcat tgtctgagta ggtgtcattc tattctgggg 1260

ggtggggtgg ggcaggacag caagggggag gattgggaag acaatagcag gcatgctggg 1320

gatgcggtgg gctctatggc ttctgaggcg gaaagaacca gctggggctc tagggggtat 1380

ccccacgcgc cctgtagcgg cgcattaagc gcggcgggtg tggtggttac gcgcagcgtg 1440

accgctacac ttgccagcgc cctagcgccc gctcctttcg ctttcttccc ttcctttctc 1500

gccacgttcg ccggctttcc ccgtcaagct ctaaatcggg ggctcccttt agggttccga 1560

tttagtgctt tacggcacct cgaccccaaa aaacttgatt agggtgatgg ttcacgtagt 1620

gggccatcgc cctgatagac ggtttttcgc cctttgacgt tggagtccac gttctttaat 1680

agtggactct tgttccaaac tggaacaaca ctcaacccta tctcggtcta ttcttttgat 1740

ttataaggga ttttgccgat ttcggcctat tggttaaaaa atgagctgat ttaacaaaaa 1800

tttaacgcga attaattctg tggaatgtgt gtcagttagg gtgtggaaag tccccaggct 1860

ccccagcagg cagaagtatg caaagcatgc atctcaatta gtcagcaacc aggtgtggaa 1920

agtccccagg ctccccagca ggcagaagta tgcaaagcat gcatctcaat tagtcagcaa 1980

ccatagtccc gcccctaact ccgcccatcc cgcccctaac tccgcccagt tccgcccatt 2040

ctccgcccca tggctgacta atttttttta tttatgcaga ggccgaggcc gcctctgcct 2100

ctgagctatt ccagaagtag tgaggaggct tttttggagg cctaggcttt tgcaaaaagc 2160

tcccgggagc ttgtatatcc attttcggat ctgatcaaga gacaggatga ggatcgtttc 2220

gcatgattga acaagatgga ttgcacgcag gttctccggc cgcttgggtg gagaggctat 2280

tcggctatga ctgggcacaa cagacaatcg gctgctctga tgccgccgtg ttccggctgt 2340

cagcgcaggg gcgcccggtt ctttttgtca agaccgacct gtccggtgcc ctgaatgaac 2400

tgcaggacga ggcagcgcgg ctatcgtggc tggccacgac gggcgttcct tgcgcagctg 2460

tgctcgacgt tgtcactgaa gcgggaaggg actggctgct attgggcgaa gtgccggggc 2520

aggatctcct gtcatctcac cttgctcctg ccgagaaagt atccatcatg gctgatgcaa 2580

tgcggcggct gcatacgctt gatccggcta cctgcccatt cgaccaccaa gcgaaacatc 2640

gcatcgagcg agcacgtact cggatggaag ccggtcttgt cgatcaggat gatctggacg 2700

aagagcatca ggggctcgcg ccagccgaac tgttcgccag gctcaaggcg cgcatgcccg 2760

acggcgagga tctcgtcgtg acccatggcg atgcctgctt gccgaatatc atggtggaaa 2820

atggccgctt ttctggattc atcgactgtg gccggctggg tgtggcggac cgctatcagg 2880

acatagcgtt ggctacccgt gatattgctg aagagcttgg cggcgaatgg gctgaccgct 2940

tcctcgtgct ttacggtatc gccgctcccg attcgcagcg catcgccttc tatcgccttc 3000

ttgacgagtt cttctgagcg ggactctggg gttcgaaatg accgaccaag cgacgcccaa 3060

cctgccatca cgagatttcg attccaccgc cgccttctat gaaaggttgg gcttcggaat 3120

cgttttccgg gacgccggct ggatgatcct ccagcgcggg gatctcatgc tggagttctt 3180

cgcccacccc aacttgttta ttgcagctta taatggttac aaataaagca atagcatcac 3240

aaatttcaca aataaagcat ttttttcact gcattctagt tgtggtttgt ccaaactcat 3300

caatgtatct tatcatgtct gtataccgtc gacctctagc tagagcttgg cgtaatcatg 3360

gtcatagctg tttcctgtgt gaaattgtta tccgctcaca attccacaca acatacgagc 3420

cggaagcata aagtgtaaag cctggggtgc ctaatgagtg agctaactca cattaattgc 3480

gttgcgctca ctgcccgctt tccagtcggg aaacctgtcg tgccagctgc attaatgaat 3540

cggccaacgc gcggggagag gcggtttgcg tattgggcgc tcttccgctt cctcgctcac 3600

tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta tcagctcact caaaggcggt 3660

aatacggtta tccacagaat caggggataa cgcaggaaag aacatgtgag caaaaggcca 3720

gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg tttttccata ggctccgccc 3780

ccctgacgag catcacaaaa atcgacgctc aagtcagagg tggcgaaacc cgacaggact 3840

ataaagatac caggcgtttc cccctggaag ctccctcgtg cgctctcctg ttccgaccct 3900

gccgcttacc ggatacctgt ccgcctttct cccttcggga agcgtggcgc tttctcatag 3960

ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca 4020

cgaacccccc gttcagcccg accgctgcgc cttatccggt aactatcgtc ttgagtccaa 4080

cccggtaaga cacgacttat cgccactggc agcagccact ggtaacagga ttagcagagc 4140

gaggtatgta ggcggtgcta cagagttctt gaagtggtgg cctaactacg gctacactag 4200

aagaacagta tttggtatct gcgctctgct gaagccagtt accttcggaa aaagagttgg 4260

tagctcttga tccggcaaac aaaccaccgc tggtagcggt ttttttgttt gcaagcagca 4320

gattacgcgc agaaaaaaag gatctcaaga agatcctttg atcttttcta cggggtctga 4380

cgctcagtgg aacgaaaact cacgttaagg gattttggtc atgagattat caaaaaggat 4440

cttcacctag atccttttaa attaaaaatg aagttttaaa tcaatctaaa gtatatatga 4500

gtaaacttgg tctgacagtt accaatgctt aatcagtgag gcacctatct cagcgatctg 4560

tctatttcgt tcatccatag ttgcctgact ccccgtcgtg tagataacta cgatacggga 4620

gggcttacca tctggcccca gtgctgcaat gataccgcga gacccacgct caccggctcc 4680

agatttatca gcaataaacc agccagccgg aagggccgag cgcagaagtg gtcctgcaac 4740

tttatccgcc tccatccagt ctattaattg ttgccgggaa gctagagtaa gtagttcgcc 4800

agttaatagt ttgcgcaacg ttgttgccat tgctacaggc atcgtggtgt cacgctcgtc 4860

gtttggtatg gcttcattca gctccggttc ccaacgatca aggcgagtta catgatcccc 4920

catgttgtgc aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca gaagtaagtt 4980

ggccgcagtg ttatcactca tggttatggc agcactgcat aattctctta ctgtcatgcc 5040

atccgtaaga tgcttttctg tgactggtga gtactcaacc aagtcattct gagaatagtg 5100

tatgcggcga ccgagttgct cttgcccggc gtcaatacgg gataataccg cgccacatag 5160

cagaacttta aaagtgctca tcattggaaa acgttcttcg gggcgaaaac tctcaaggat 5220

cttaccgctg ttgagatcca gttcgatgta acccactcgt gcacccaact gatcttcagc 5280

atcttttact ttcaccagcg tttctgggtg agcaaaaaca ggaaggcaaa atgccgcaaa 5340

aaagggaata agggcgacac ggaaatgttg aatactcata ctcttccttt ttcaatatta 5400

ttgaagcatt tatcagggtt attgtctcat gagcggatac atatttgaat gtatttagaa 5460

aaataaacaa ataggggttc cgcgcacatt tccccgaaaa gtgccacctg acgtc 5515

<210> 7

<211> 716

<212> RNA

<213>Homo sapiens (Homo sapiens)

<400> 7

gugauuuuac aacgagaugc ugcucuccau agggaugcuc augcugucag ccacacaagu 60

cuacaccauc uugacugucc agcucuuugc auucuuaaac cuacugccug uagaagcaga 120

cauuuuagca uauaacuuug aaaaugcauc ucagacauuu gaugaccucc cugcaagauu 180

ugguuauaga cuuccagcug aagguuuaaa ggguuuuuug auuaacucaa aaccagagaa 240

ugccugugaa cccauagugc cuccaccagu aaaagacaau ucaucuggca cuuucaucgu 300

guuaauuaga agacuugauu guaauuuuga uauaaagguu uuaaaugcac agagagcagg 360

auacaaggca gccauaguuc acaauguuga uucugaugac cucauuagca ugggauccaa 420

cgacauugag guacuaaaga aaauugacau uccaucuguc uuuauuggug aaucaucagc 480

uaauucucug aaagaugaau ucacauauga aaaagggggc caccuuaucu uaguuccaga 540

auuuagucuu ccuuuggaau acuaccuaau ucccuuccuu aucauagugg gcaucugucu 600

caucuugaua gucauuuuca ugaucacaaa auuuguccag gauagacaua gagcuagaag 660

aaacagacuu cguaaagauc aacuuaagaa acuuccugua cauaaauuca agaaag 716

<210> 9

<211> 18

<212> DNA

<213>Unknown (Unknown)

<400> 9

gtgattttac aacgagat 18

<210> 8

<211> 18

<212> DNA

<213>Unknown (Unknown)

<400> 8

ctttcttgaa tttatgta 18

<210> 9

<211> 28

<212> DNA

<213>Unknown (Unknown)

<400> 9

aggaatcgat gtgattttac aacgagat 28

<210> 10

<211> 28

<212> DNA

<213>Unknown (Unknown)

<400> 10

atgcccgcgg ctttcttgaa tttatgta 28

<210> 11

<211> 20

<212> DNA

<213>Unknown (Unknown)

<400> 11

gtccaggata gacatagagc 20

<210> 12

<211> 20

<212> DNA

<213>Unknown (Unknown)

<400> 12

gtgtagactt gtgtggctga 20

<210> 13

<211> 20

<212> DNA

<213>Unknown (Unknown)

<400> 13

accacagtcc atgccatcac 20

<210> 14

<211> 20

<212> DNA

<213>Unknown (Unknown)

<400> 14

tccaccaccc tgttgctgta 20

Claims (7)

1. a kind of carrier for expression of eukaryon for expressing circular rna, which is characterized in that it builds by the following method：

(1) according to the Forming Mechanism of circRNA and the fundamentum of eucaryote RNA montages, design suitable for circRNA tables The upstream and downstream loop-forming sequences reached；According to the sequence information of carrier, multiple cloning sites are designed；

Upstream loop-forming sequences：

GTGCTGGGATTACAGGTGTGAGCTACCACCCCCGGCCCACTTTTT；

Downstream loop-forming sequences：

GAAAAGAATTAGGCTCGGCACGGTAGCTCACACCTGTAATCCCAGCA,

It is multiple cloning sites sequence among the loop-forming sequences of upstream and downstream, multiple cloning sites sequence needs cyclization for digestion insertion Sequence；It is artificial synthesized so as to obtain completely realize circRNA be overexpressed DNA sequence dna；

(2) restriction enzyme site sequence is added at the both ends of the DNA sequence dna realized circRNA and be overexpressed of above-mentioned synthesis, passes through double enzymes It is built into after cutting in carrier, obtains pcCirc empty plasmids, sequencing confirms that plasmid is correct；

(3) restriction enzyme site in multiple cloning sites sequence is selected for digestion pcCirc empty plasmids, and the sequence that cyclization will be needed Between the upstream and downstream loop-forming sequences of row insertion carrier.

2. the carrier for expression of eukaryon of expression circular rna according to claim 1, which is characterized in that the specific mistake of step (3) Journey is as follows：

1) loop-forming sequences are needed through double digestion rear electrophoresis, glue recycling by what is amplified；

2) pcCirc empty plasmids recycle target fragment through the identical double digestion rear electrophoresis glue of step 1)；

3) with the connection of T4DNA ligases 1) and 2) step glue recovery product to get to the carrier for expression of eukaryon of expression circular rna.

4) by the eukaryon expression plasmid transformed competence colibacillus Escherichia coli comprising loop-forming sequences that 3) step obtains, to expand plasmid.

3. the carrier for expression of eukaryon of expression circular rna according to claim 1, which is characterized in that

Initial carrier is pcDNA3.1 in step (1), and multiple cloning sites regional sequence is：

CTTAAGCTTGGTACCGAGCTCGGATCCACATCGATTGGTGGAATTCTGCAGATATCCACCGCGGTGGCGGCCG CTCGAGTCTAGA；Successively include AflII, HindIII, KpnI, BamHI, ClaI, EcoRI, EcoRV, SacII, NotI, XhoI, XbaI restriction enzyme enzyme recognition site.

4. the carrier for expression of eukaryon of expression circular rna according to claim 1, which is characterized in that

Step (2) realizes that NheI restriction enzyme site sequences, the other end are added in DNA sequence dna one end that circRNA is overexpressed by synthesis ApaI restriction enzyme site sequences are added, by being built into after NheI and ApaI digestions in pcDNA3.1 carriers, obtain pcCirc blank Plasmid, sequencing confirm that plasmid is correct.

5. the carrier for expression of eukaryon of the expression circular rna according to claim 1 or 3 or 4, which is characterized in that

Step (3) selection Cla I and Sac II restriction enzyme sites will need loop-forming sequences to insert for digestion pcCirc empty plasmids Between the upstream and downstream loop-forming sequences for entering carrier.

6. the carrier for expression of eukaryon of expression circular rna according to claim 1, which is characterized in that expression circRNF13 is true The building process of nuclear expression carrier is as follows：

(1) according to the Forming Mechanism of circRNA and the fundamentum of eucaryote RNA montages, design suitable for circRNA tables The loop-forming sequences reached；According to the sequence information of commercial carrier pcDNA3.1, multiple cloning sites are designed, so as to obtain complete reality The DNA sequence dna that existing circRNA is overexpressed is as follows：

GTGCTGGGATTACAGGTGTGAGCTACCACCCCCGGCCCACTTTTTCTTAAGCTTGGTACCGAGCTCGGATCCA CATCGATTGGTGGAATTCTGCAGATATCCACCGCGGTGGCGGCCGCTCGAGTCTAGAGAAAAGAATTAGGCTCGGCA CGGTAGCTCACACCTGTAATCCCAGCA, intermediate underscore part are multiple cloning sites, and both ends are respectively upstream and downstream cyclization Sequence；

(2) above-mentioned synthesis is realized that NheI restriction enzyme site sequences, the other end are added in DNA sequence dna one end that circRNA is overexpressed ApaI restriction enzyme site sequences are added, by being built into after NheI and ApaI digestions in pcDNA3.1 carriers, obtain pcCirc blank Plasmid, sequencing confirm that plasmid is correct, sequence such as SEQ NO:Shown in 5；

(3) Cla I and Sac II restriction enzyme sites are selected for digestion pcCirc empty plasmids, and circRNF13 sequences are inserted into Between the upstream and downstream loop-forming sequences of carrier, step (3) detailed process is as follows：

1) using Tca8113 cells Tca8113 cDNA as template, TaKaRa LA are utilizedEnzyme carries out PCR amplification overall length CircRNF13 sequences；CircRNF13 full length sequence amplimers are as follows：

Sense primer：5’-GTGATTTTACAACGAGAT-3’；

Anti-sense primer：5’-CTTTCTTGAATTTATGTA-3’；

After restriction enzyme Cla I and Sac II recognition sites and protection base being added at 5 ' ends of upstream and downstream primer respectively, Primer sequence is as follows：

Sense primer：5’-AGGAATCGATGTGATTTTACAACGAGAT-3 ', underscore part are Cla I recognition sites；

Anti-sense primer：5’-ATGCCCGCGGCTTTCTTGAATTTATGTA-3 ', underscore part are Sac II recognition sites；

2) PCR amplification, circRNF13 full length sequences, PCR reaction conditions are as follows：

PCR reaction steps

5 return to the 2nd step, carry out 39 cycling of secondary response altogether；

3) by through Cla I and Sac II double digestion rear electrophoresis, glue recycles again after PCR product electrophoresis, glue recycling target fragment；

4) pcCirc empty plasmids recycle target fragment through Cla I and Sac II double digestion rear electrophoresis glue；

5) with the connection of T4 DNA ligases 3) and 4) step glue recovery product to get to the eukaryon expression plasmid of expression circRNF13；

6) by the eukaryon expression plasmid transformed competence colibacillus Escherichia coli comprising circRNF13 full length sequences that 5) step obtains, with Expand plasmid.

7. the carrier for expression of eukaryon of expression circular rna according to claim 6, which is characterized in that step is synthesizing in (2) Realize circRNA be overexpressed DNA sequence dna both ends in addition to add NheI and ApaI restriction enzyme site sequences or add it is original Close to other restriction enzyme sites of two endpoints in vector multiple cloning site region；Purpose is to make the realization circRNA mistakes of synthesis The DNA sequence dna of expression replaces the multiple cloning sites region in initial carrier.