CN108085328A - A kind of method of DNA sequence dna editor - Google Patents

Abstract

The present invention provides a kind of methods of DNA sequence dna editor, specifically method of the invention carries out DNA sequence dna editor using two step Shift Methods, wherein the first step is the one section of sequence (or being the DNA sequence dna for being inserted into one section of external source) replaced near target site, the exogenous DNA array that second step will replace (or insertion) is cut, exogenous DNA recombinant fragments carry out DNA with genome and recombinate the cell obtained afterwards, so as to which the sequence near above-mentioned target site replaces with target sequence.With reference to CRISPR technologies or other technologies, the present invention can efficiently, rapidly carry out the arbitrary site of chromosome, and can carry out any type of mutation (including being mutated, deleting, being inserted into exogenous DNA array) etc..

Description

A kind of method of DNA sequence dna editor

Technical field

The present invention relates to biological technical field, specifically the present invention relates to a kind of DNA sequence dna editor method more particularly to A kind of method that can quickly, efficiently carry out genome rite-directed mutagenesis, deletion and fixed point insertion exogenous DNA array.

Background technology

Genome editor refers to carry out the mutation of specific site in the genome, knocks in, deletes.The technology is not only in section The field of grinding receives very big attention, and is also concerned in the potentiality of agricultural and medical field.Specific application includes：(1) Forming types animal helps scientific research；(2) character of plant modification improves crop yield and stress tolerance ability etc.；(3) Detection and the gene of transformation people achieve the purpose that precisely medical treatment etc..

Have benefited from the homologous recombination of host itself, scientist can carry out gene knockout to genomic DNA, exogenous DNA is inserted The experiments such as enter.However, due to homologous recombination efficiency than relatively low, it is necessary to introduce selection markers (such as resistance gene DNA sequence) For subsequent screening, the purpose being inserted into so as to fulfill gene knockout and DNA.By 2000, Barry L.Wanner were real It tests room and develops Red recombination systems, substantially increase the efficiency of DNA restructuring, also reduce to the DNA homology arm lengths of restructuring It is required that (homologous sequence for only needing 36-50nt) (Kirill A.Datsenko and Barry L.Wanner (2000) .One-step inactivation of chromosomal genes in Escherichia coli K-12using PCR products.PNAS,97,6640-6645).Nevertheless, when carrying out genome editor, it is desired nonetheless to introduce resistant gene etc. Selection markers for positive colony screening.In order to remove the selection markers sequence in positive colony, it is necessary in selection markers Sequence both ends add in the recombination sites such as FRT, and carry out site-specific between two FRT sites by introducing Flp recombinases to mediate Property restructuring, with delete two FRT sites between selection markers sequence.Similar site-specific recombination system further includes Cre weights Group enzyme and LoxP recombination sites etc..Although this kind of technology can successfully eliminate selection markers sequence, a FRT weight can be left Group site (or other similar recombination sites) can not realize the demand of the seamless editor's (such as rite-directed mutagenesis) of genome.

However, it is still cumbersome to carry out the fixed point experiments such as editor on the genome of mammalian cell, Er Qiexiao Rate is very low.

The content of the invention

It is an object of the invention to provide a kind of DNA sequence dna editor method and be applicable in the kit of this method.

The first aspect of the present invention provides a kind of DNA sequence dna edit methods, the method includes the steps：

The first DNA recombinant fragments are provided, the first DNA recombinant fragments have the first selection markers and for cleavage The first DNA recombinant fragments are integrated into the one side in DNA sequence dna site to be edited by homologous recombination by cleavage site；

2nd DNA recombinant fragments are provided, the 2nd DNA recombinant fragments have in the first DNA recombinant fragments The homology arm of cleavage site both sides sequence homology；

Cleavage is integrated into the first DNA recombinant fragments of the DNA sequence dna, and notch is formed in the cleavage site, The 2nd DNA recombinant fragments are integrated into DNA sequence dna to be edited by homologous recombination, are compiled so as to fulfill the DNA sequence dna Volume.

In another preference, " integration " includes replacing one section of sequence of target dna sequence or to target dna sequence The DNA sequence dna of one section of external source of middle insertion.

In another preference, the 2nd DNA recombinant fragments include alternative sequence, will be to be edited by homologous recombination Site replaces with the alternative sequence.

In another preference, the method includes the steps：

(1) the first recognition site is set in DNA sequence dna to be edited

First recognition site is located on the one side or the site of location proximate to be edited；

(2) the first DNA recombinant fragments are provided

The first DNA recombinant fragments are with the first selection markers, the second recognition site and positioned at the described first screening mark Remember the homology arm of both sides, the homology arm and the sequence homology of the first recognition site both sides；

(3) first time homologous recombination

DNA sequence dna to be edited is cut in first recognition site, by homologous recombination by the first DNA recombinant fragments It is integrated into the one side in site to be edited；

(4) the 2nd DNA recombinant fragments are provided

The 2nd DNA recombinant fragments have the homology arm with the second recognition site both sides sequence homology；

(5) second of homologous recombination

DNA sequence dna is cut in second recognition site, is integrated into the 2nd DNA recombinant fragments by homologous recombination In DNA sequence dna to be edited, so as to fulfill the DNA sequence dna editor.

In another preference, the 2nd DNA recombinant fragments include alternative sequence, pass through second in step (5) The site to be edited is replaced with the alternative sequence by secondary homologous recombination.

In another preference, second recognition site is located in first selection markers.

In another preference, by whole in second of homologous recombination removal first time homologous recombination in the step (5) The exogenous DNA array being incorporated into.

In another preference, the DNA sequence dna edit methods are into the method for edlin to genome specific site.

In another preference, the length of the homology arm is more than 39bp；Preferably from about 40bp-1000bp.

In another preference, first recognition site and second recognition site are separately selected from：Digestion Site (being preferably I-SceI, I-CeuI such as playback endonuclease restriction enzyme site), CRISPR systems cleavage site, TALEN are cut Cut any one or a few in site, ZFN cleavage sites, Argonaute cleavage sites.

In another preference, first recognition site and second recognition site are respectively different CRISPR systems System cleavage site.

In another preference, in the step (3), cut by CRISPR systems in first recognition site and wait to compile Collect DNA sequence dna.

In another preference, in the step (5), treated by CRISPR systems in second recognition site incision Edit DNA sequence dna.

In another preference, the CRISPR systems are CRISPR/Cas9 systems.

In another preference, the CRISPR systems are CRISPR/Cpf1 systems.

In another preference, first selection markers are selected from：Antibiotics resistance gene, fluorescent protein expression gene, Auxotroph screening-gene and negative screening-gene.

In another preference, the DNA sequence dna is prokaryotic gene group.

In another preference, the DNA sequence dna is eukaryotic gene group, is preferably mammalian cell gene group.

In another preference, the DNA sequence dna includes the DNA sequence dna in addition to genome, includes but not limited to：Plasmid, Cosmid, fosmid, BAC, YAC, other artificial chromosomes etc..

In another preference, the homologous recombination is the efficient homologous recombination of λ-RED mediations.

The second aspect of the present invention, provides a kind of kit for DNA sequence dna editor, and the kit is used to perform Method described in first aspect present invention.

In another preference, the kit includes：

(A) the first DNA recombinant fragments

The first DNA recombinant fragments are with the first selection markers, the second recognition site and positioned at the described first screening mark Remember the homology arm of both sides, the homology arm and the sequence homology of the first recognition site both sides；And/or

(B) the 2nd DNA recombinant fragments

The 2nd DNA recombinant fragments have the homology arm with the sequence homology of the second recognition site both sides.

In another preference, the kit further includes：DNA enzymatic cuts reagent.

In another preference, the DNA enzymatic is cut reagent and is selected from the group：Endonuclease enzymatic reagent is (such as playback endonuclease Enzymatic reagent is preferably I-SceI, I-CeuI), CRISPR-Cas reagents, TALEN reagents, ZFN reagents and Argonaute reagents.

It is to be understood that within the scope of the present invention, above-mentioned each technical characteristic of the invention and have in below (eg embodiment) It can be combined with each other between each technical characteristic of body description, so as to form new or preferred technical solution.As space is limited, exist This no longer tires out one by one states.

Description of the drawings

Fig. 1 is the flow diagram of genome fixed point editor in an embodiment of the present invention；

Fig. 2 is the electrophoresis picture that the present invention verifies transformant positive colony by PCR method；

Fig. 3 is that the present invention verifies that the sequencing result of positive colony analyzes picture by PCR method；

Fig. 4 is the fluorescence picture that amilGFP is inserted into bacterial strain and wild type control strain obtained in the embodiment of the present invention 3.

Fig. 5 a are to be inserted into ammonia benzyl antibiotics resistance gene and RBS in the embodiment of the present invention 4 before frr gene GTG promoters The sequencing of sequence compares picture；Fig. 5 b are to be inserted into 6 His codings in the embodiment of the present invention 4 behind frr gene GTG promoters The sequencing result figure of gene.

Specific embodiment

The present inventor and in-depth study, obtains a kind of efficient gene editing method by extensive, and this method uses two Step Shift Method carries out genome editor, and wherein the first step be that the one section of sequence replaced near target site (or is be inserted into one section The DNA sequence dna of external source), the exogenous DNA array that second step will replace (or insertion) is cut, exogenous DNA recombinant fragments and base Because of the cell that group progress DNA restructuring obtains afterwards, so as to which the sequence near above-mentioned target site replaces with target sequence.With reference to CRISPR technologies (or other technologies), the present invention can efficiently, rapidly carry out the arbitrary site of chromosome (no matter nearby whether contain Have the required PAM sequences of CRISPR systems), any type of mutation is carried out (including being mutated, deleting, being inserted into exogenous DNA sequence Row) etc..

Before describing the present invention, it should be understood that the invention is not restricted to the specific method and experiment condition, because this Class method and condition can change.It should also be understood that its purpose of the term as used herein is only that description specific embodiment, and And it is not intended to be restricted, the scope of the present invention will be limited only by the claims which follow.

Unless otherwise defined, otherwise whole technologies used herein are respectively provided with scientific terminology such as fields of the present invention The normally understood identical meanings of those of ordinary skill.As used herein, in use, term in the numerical value specifically enumerated is mentioned " about " mean that the value can change not more than 1% from the value enumerated.For example, as used herein, statement " about 100 " includes 99 Hes 101 and between whole values (for example, 99.1,99.2,99.3,99.4 etc.).

Although it can be used and heretofore described similar or of equal value any method in the implementation or test of the present invention And material, herein place enumerate preferred method and material.

With Zinc finger nuclease technology (ZFN), activating transcription factor sample effector nucleic acid zymotechnic (TALEN) and The discovery and application of CRISPR systems, the genome editor of eukaryocyte become relatively convenient.By being contaminated in specific site Colour solid is cut, and can realize the mutation of genome specific gene.It is screened by using selection markers, and inhibits cell simultaneously The nonhomologous end engagement vigor (NHEJ) of itself can realize that the knockout of target gene, the insertion etc. of exogenous DNA array are real It tests.During CRISPR technologies carry out gene editing, if region to be edited does not have available Cas9 recognition sites (e.g., not have Have PAM sequences or without suitable spacer sequences), it is general using deleting or substituting a segment, site to be edited is changed The site that can be cut by Cas9 is caused, then carries out gene mutation.

The present invention provides a kind of method of genome editor, especially to genome specific site into the side of edlin Method carries out genome editor using two step Shift Methods, and wherein the first step is that the one section of sequence replaced near target site (or is It is inserted into the DNA sequence dna of one section of external source), the exogenous DNA array that second step will replace (or insertion) is cut, exogenous DNA restructuring Segment carries out DNA with genome and recombinates the cell obtained afterwards, so as to which the sequence near above-mentioned target site replaces with target sequence Row.With reference to CRISPR technologies (or other technologies), the present invention can efficiently, rapidly carry out the arbitrary site of chromosome (regardless of attached It is near whether to contain the required PAM sequences of CRISPR systems), any type of mutation is carried out (outside being mutated, deleting, be inserted into Source DNA sequence) etc..

Term

Term " CRISPR " refers to cluster, regular intervals short palindrome repetitive sequence (clustered regularly Interspaced short palindromic repeats), it is related with the acquired immunity of prokaryotes.

Term " crRNA " refers to CRISPR RNA, is RNAs of the short guiding Cpf1 to targeting DNA sequence dna.

Term " PAM " refer to before between region sequence adjacent to motif (protospacer-adjacent motif), be that Cpf1 is cut It is necessary to cut institute, the PAM of FnCpf1 is TTN sequences.

Term " indispensable gene " refers to for gene necessary to cell growth (essential gene), and clpp gene is carried out to it Remove or gene disruption after can influence the growth of thalline.

CRISPR/Cas systems

The system is to have now been found that be present in most of bacteriums and a kind of acquired immune system in all ancient bacterium, to disappear It goes out external plastid or bacteriophage, and leaves alien gene segment in autogene group and be used as " memory ".It is complete it is entitled often between Palindrome repetitive sequence gathers together/often between palindrome repetitive sequence gather together related protein system (clustered regularly interspaced short palindromic repeats/CRISPR-associated proteins)。

Have now been found that three kinds of different types of CRISPR/Cas systems, be present in about 40% and 90% be sequenced it is thin In bacterium and ancient bacterium.The composition of wherein Second-Type is relatively simple, is forming for core with Cas9 albumen and guide RNA (gRNA), Due to its characteristic to DNA interference (DNAi), it is actively used at present in genetic engineering, as genosome editing instrument, It is engaged (NHEJ) also with nonhomologous end with Zinc finger nuclease (ZFN) and class transcriptional activators nuclease (TALEN) Mechanism, in genosome generate nuclifort bifilar fracture with sharp editing.Two type CRISPR/Cas and via heredity The restoration and reuse of engineering is in the genosome editing of mammalian cell and zebra fish.It designs the simple and easy characteristic of operation Biggest advantage.Future will can be applicable among a variety of model organisms.

The genome of referred to as CRISPR repeats to gather together, i.e. repetitive sequence of growing thickly in prokaryotes nucleoid DNA chain, 1987 On being described for the first time in a research report of E.coli.2000, similar repetitive sequence was thin in other eubacterias and Gu It is found in bacterium and is named as short interval repetitive sequence (Short Regularly Spaced Repeats, SRSR).2002 Year, SRSR was renamed into CRISPR.The albumen of a portion gene code is nuclease and unwindase.These related proteins (CAS, CRISPR-associated proteins) and CRISPR constitute CRISPR/CAS systems.

CRISPR/Cas technologies

So-called " CRISPR/Cas technologies " of the invention, " CRISPR/Cas systems " refer both to utilize CRISPR/Cas systems The genome editing technique that principle is transformed target gene.

Cas9 albumen

The core of CRISPR/Cas9 is exactly Cas9 albumen and guide RNA (gRNA).It can be utilized in different plant species CRISPR/Cas systems carry out genome editor, for example heterogenous expression has the Cas9 albumen of DNA shearing enzymatic activitys in the species, Then gRNA and target spot homologous sequence is obtained to guide Cas9 to target spot progress DNA shearings.Specific operating method is this field Known to technical staff.

Cas9 albumen from Streptococcus pyogenes is a kind of multi-functional Cas albumen of Multidomain, Its N-terminal has the structural domain of class RuvC nucleases, and middle part has HNH nuclease domains.Cas9 albumen and gRNA combination energy It is enough to realize the cutting DNA at specific site, from the CRISPR/Cas system identification sequences of Streptococcus pyogenes 23bp is classified as, and 20bp can be targeted, 3 NGG sequences of recognition site most end are referred to as PAM (protospacer adjacent Motif) sequence is cut extremely important for DNA.Current most of eucaryotes are (including silkworm, arabidopsis, yeast, nematode Deng) CRISPR/Cas systems initially both be derived from Streptococcus pyogenes, Cas9 albumen is then by humanization Transformation.

It is expressed in host for the ease of Cas9 genes, it can also be in construction of expression vector, by the Cas9 gene structures of optimization It build strong constitutive promoter in (such as：Pdc promoters (Li et al.Microbial Cell Factories 2012,11: 84), but not limited to this) and strong inducible promoter is (such as：Cbh1 promoters (Zou et al.Microbial Cel l Factories2012,11:21), but not limited to this) downstream.

The DNA recombinant fragments of the present invention include cDNA, genomic DNA or artificial synthesized DNA.DNA can be single-stranded Or double-strand.DNA can be coding strand or noncoding strand.

Nucleic acid fragment involved in DNA recombinant fragments of the present invention can usually use PCR amplification method, recombination method or manually close Into method obtain.Once obtain related sequence, it is possible to obtain related sequence in large quantity with recombination method.This is usually It is to be cloned into carrier, then is transferred to cell, it is then isolated related from the host cell after multiplication by conventional method Sequence.In addition, related sequence can be also synthesized with artificial synthesized method, when especially fragment length is shorter.In general, pass through elder generation Multiple small fragments are synthesized, the very long segment of sequence can be obtained by being then attached again.

Prior art quickly and cheaply (can not be particularly eukaryocyte, such as mammalian cell in the genome On genome) carry out fixed point editor (e.g., specific site mutation and deletion and fixed point insertion exogenous DNA array), the present invention Provide a kind of new genome edit methods, it is especially a kind of to genome specific site into the method for edlin.

The method of gene editing provided by the present invention, especially to genome specific site into the method for edlin, institute Mutation that editor can be DNA sequence dna is stated, deletes, knock in any one or a few in exogenous DNA array.

One in the present invention is preferably carried out in mode, and the method for the genome editor is especially special to genome Anchor point into edlin method, including：

It determines to need the site to be edited into edlin in genome to be edited, in the arbitrary one side in the site to be edited Or recognition site is found in both sides；

One section of exogenous DNA array (the first DNA recombinant fragments) is inserted near recognition site or with the exogenous DNA Sequence replaces the section of DNA sequence near the recognition site；

New recognition site is found in exogenous DNA array；New homologous recombination DNA sequence dna is provided, contain in sequence with The position in the homologous left and right two-arm DNA sequence dna of genome and site to be edited replaces with edited DNA sequence dna；

New homologous recombination DNA sequence dna (the 2nd DNA recombinant fragments) is introduced into exogenous DNA array (the first DNA with above-mentioned Recombinant fragment) after genome carry out homologous recombination, by exogenous DNA array (sequences of such as selection markers) remove, and profit The DNA sequence dna in original site to be edited is substituted with DNA sequence dna after editor.

In the above of the present invention, the recognition site in the exogenous DNA array being introduced into can be carried in exogenous DNA array Recognition site, can also be the recognition site that is newly formed after the exogenous DNA array introduced is combined with genome sequence to be edited.

Also, the recognition site in exogenous DNA array is different from the recognition site in genome sequence to be edited, and can To be separately：Restriction enzyme site (being preferably I-SceI, I-CeuI such as playback endonuclease), the cutting of CRISPR systems Site, any one or a few in TALEN cleavage sites, ZFN cleavage sites, Argonaute cleavage sites, and be preferably CRISPR system cleavage sites.

The present invention one be preferably carried out in mode, by CRISPR technologies the site to be edited with it is neighbouring One section of exogenous DNA array is inserted between CRISPR/Cas9 recognition sites (the spacer sequences containing PAM sequences) or uses institute State the section of DNA sequence between the exogenous DNA array replacement site to be edited and recognition site.

One of the present invention is preferably carried out in mode, and new Cas9 digestions position is found in the exogenous DNA array being introduced into The exogenous DNA array of introducing by Cas9 enzymes is cut, and converts and contain to DNA sequence dna and a left side after target site editor by point The DNA sequence dna of right two-arm homologous DNA sequence carries out homologous recombination.

One of the present invention is preferably carried out in mode, and the exogenous DNA array is preferably the gene containing selection markers Sequence.

One in the present invention is preferably carried out in mode, and described containing selection markers, (in the context of the invention, screening is marked Note can also become marker gene) gene order can be antibiotics resistance gene, fluorescent protein expression gene, negative screen base Cause or the CRISPR/Cas9 cleavage sites sequence containing PAM sites arbitrarily contain rare playback restriction endonuclease The sequence in (Homing endonuclease) site either sequence arbitrarily containing ZFN or TALEN restriction enzyme sites or arbitrary Sequence containing Argonaute restriction enzyme sites；It can also be the combination of arbitrary selection markers sequence and above-mentioned restriction enzyme site sequence.

It is in an advantageous embodiment, described that containing selection markers, (in the context of the invention, selection markers can also become Marker gene) gene order, including at least the group of antibiotics resistance gene (or fluorescent protein expression gene), negative screening-gene It closes.

Wherein, " playback restriction endonuclease ", " enzyme cutting of playback Restriction Enzyme " have identical meaning in the context of the invention, refer to A kind of double-stranded DNA restriction enzyme can identify larger non-palindromic sequence (more than 12bp), and generate the viscosity of the non-palindrome End.

Wherein, playback restriction endonuclease citing include I-SceI enzymes, can specifically I-SceI recognition sites carry out double-strand cut It cuts.Wherein it is preferred to the DNA core sequences of I-SceI identifications and digestion include following sequence (or its reverse complementary sequence)： 5’-ATTACCCTGTTATCCCTA-3’(SEQ ID NO.44)。

Wherein, playback restriction endonuclease citing include I-CeuI enzymes, can specifically I-CeuI recognition sites carry out double-strand cut It cuts.Wherein it is preferred to the DNA core sequences of I-SceI identifications and digestion include following sequence (or its reverse complementary sequence)： 5’-CGTAACTATAACGGTCCTAAGGTAGCGAA-3’(SEQ ID NO.45)。

Wherein, the citing of the resistant gene includes but is not limited to antibiotics resistance gene, such as G418 resistant genes, tide Mycin resistant gene, tetracycline resistance gene, ampicillin resistance gene, chloramphenicol resistance gene, kanamycins (or are " card receive mycin ") resistant gene etc..

In the above of the present invention, the CRISPR systems are preferably CRISPR/Cas9 systems.

In the above of the present invention, the genome can be one in gene of eucaryote cell group, prokaryotic cell genome Kind is several, more preferably mammalian cell gene group.

In the present invention, the exogenous DNA array, the DNA sequence dna progress target site that can use any external source are attached Near the replacement of nearly DNA sequence dna or insertion target site；Can also use some selection markers (such as resistance gene sequences or Person's fluorescent protein expression gene or selection markers and the composite sequence in rare restriction enzyme site etc.) it is screened, so as to significantly Degree improves the speed and success rate of chromosome editor.

The present invention during (either be inserted into) exogenous DNA array is replaced using CRISPR technologies (or TALEN, ZFN, Argonaute technology etc.) fracture of double-stranded DNA is caused near mutational site, introduce exogenous DNA array so as to improve Efficiency；In homologous recombination process, using CRISPR technologies (or playback endonuclease such as I-SceI, TALEN, ZFN, Argonaute etc.), it is specifically cut for exogenous DNA array, the screening efficiency of second step replacement can be improved.

In addition, in the exogenous array, negative selection markers can also be added in, and after homologous recombination, utilize negative screening Mark carries out cell negative screening, the cell chosen successfully completed second step and replaced, and improves the accuracy rate of screening.

The present invention use two steps to replace (first step or for insertion exogenous array) method to carry out genome editor, wherein first Walk to replace one section of sequence (or be the DNA sequence dna for being inserted into one section of external source) near target site, second step will be replaced (or slotting Enter) exogenous DNA array cut, screen the DNA recombinant fragments containing sequence after target site editor and genome and carry out DNA weights The cell that group obtains afterwards, so as to which the sequence near above-mentioned target site replaces with target sequence.With reference to CRISPR technologies (or its Its technology), the present invention can efficiently, rapidly carry out the arbitrary site of chromosome and (know no matter nearby whether containing CRISPR systems Not required PAM site sequences), carry out any type of editor (including being mutated, deleting, being inserted into exogenous DNA array) etc..

Genome edit methods provided by the present invention carry out gene editing using two step Shift Methods, can efficiently, quickly Ground carries out the arbitrary site of chromosome and carries out any type of mutation, and efficient fixed point is especially carried out to mammalian cell and is compiled Volume.The present invention is also applied for the extrachromosomal DNA sequence dna (such as plasmid, artificial chromosome etc.) of cell inner stablity heredity simultaneously Editor.

Main advantages of the present invention are：

(1) present invention in two-step method genome edit methods can to arbitrary site on chromosome into edlin (without Dependent on PAM sites)；In addition, λ-RED recombinases can significantly improve the editorial efficiency of this method.

(2) this method is using antibiotics resistance gene as selection markers, and the wherein first step is as positive selection marker, and the Cutting target (negative selection markers) of two steps as enzymes such as Cas9 substantially increases the screening efficiency of two steps.

(3) method that designs in the present invention, by that plus independent RBS sequences, can be realized at the end of resistant gene 3 ' pair The editor that indispensable gene 5 ' is held (editor of indispensable gene 3 ' is identical with common gene).

With reference to specific embodiment, the further old present invention in detail.It is to be understood that these embodiments are merely to illustrate the present invention Rather than it limits the scope of the invention.The experimental method of detailed conditions is not specified in the following example, usually according to conventional strip The part such as works such as U.S. Sambrook.J《Molecular Cloning: A Laboratory room guide》(Huang Peitang etc. is translated, Beijing：Science Press, 2002) Described in condition or according to the condition proposed by manufacturer.Unless otherwise stated, otherwise percentage and number be by weight It calculates.Experiment material and reagent used can obtain unless otherwise instructed from commercially available channel in following embodiment.

The present invention is by the way of being inserted into or replacing one section of sequence, then in the exogenous DNA array for being inserted into or replacing Suitable Cas9 cleavage sites or other nucleic acid cleavage sites are found, then carry out Cas9 digestions, it is homologous with mediated dna Restructuring is for genome editor.In the present invention, since the exogenous DNA array of introducing can contain selection markers encoding gene, greatly Prokaryotic cell is improved greatly, the efficiency that the genome fixed point of mammalian cell is edited.

With reference to the accompanying drawings, the method for gene editing of the present invention is described in detail and illustrated.

Embodiment 1：Escherichia coli MG1655 genome lacZ gene initiation codons ATG is sported into TAA

As shown in Figure 1, method includes：

Step 1

Escherichia coli MG1655 genome lacZ genes segment (SEQ ID No.1) is cloned in, in its initiation codon ATG PAM (protospacer adjacent motifs) site TGG nearby is found, and designs corresponding 1 (SEQ of spacer sequences ID No.2)。

LacZ gene promoter region sequence (SEQ ID No.1)：

agcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgt ctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccat gtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcaga tggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgac gataccgaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccag cgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaa gaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacga caggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccagg ctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctat gaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatc gccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttg cgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtgcga tcttcctgaggccgatactgtcgtcgtcccctcaaactggcagatgcacggttacgatgcgcccatctacaccaacg tgacctatcccattacggtcaatccgccgtttgttcccacggagaatccgacgggttgttactcgctcacatttaat gttgatgaaagctggctacaggaaggccagacgcgaattatttttgatggcgttaactcggcgtttcatctgtggtg caacgggcgctgggtcggttacggccaggacagtcgtttgccgtctgaatttgacctgagcgcatttttacgcgccg gagaaaaccgcctcgcggtgatggtgctgcgctggagtgacggcagttatctggaag。

Spacer1 sequences (SEQ ID No.2)：

tcgttttacaacgtcgtgac。

Design primer pair LacZsgRNA-F (SEQ ID No.3) and LacZsgRNA-R (SEQ ID No.4)；Using fixed point The method of mutation, with pTargetF plasmids (Yu Jiang et al., Multigene Editing in the Escherichia coli Genome via the CRISPR-Cas9System,Applied and Environmental Microbiology, 2015,81:It is 2506-2514) template, structure sgRNA carriers 1 (pTargetF-1).

lacZsgRNA-F(SEQ ID No.3)：

TCCTAGGTATAATACTAGTtcgttttacaacgtcgtgacGTTTTAGAGCTAGAAATAGC；

LacZsgRNA-R(SEQ ID No.4)：

ACTAGTATTATACCTAGGACTGAGCTAGCTGTCAAG。

Step 2,

Build recombinant dna fragment 1：It is sieved with Amp-F (SEQ ID No.5) and Amp-R (SEQ ID No.6) primer pair amplifies Select flag sequence --- ampicillin resistance gene sequence (Amp).

With lacZ-UF (SEQ ID No.7) and lacZ-UR (SEQ ID No.8) primer pair amplifies Cas9 nicking sites Fragment upstream；With lacZ-DF (SEQ ID No.9) and lacZ-DR (SEQ ID No.10) primer pair amplifies Cas9 nicking sites Segments downstream；Three DNA fragmentations are subjected to fusion DNA vaccine amplification, obtain recombinant dna fragment 1 (SEQ ID No.11).

Amp-F(SEQ ID No.5)：

Ctggccgtcgttttacaacgtcgtgacgaaagggcctcgtgatacg；

Amp-R(SEQ ID No.6)：

ttaccaatgcttaatcagtgaggca；

lacZ-UF(SEQ ID No.7)：

agcatctggtcgcattgggtca；

LacZ-UR(SEQ ID No.8)：

Acgacgttgtaaaacgacggccagt；

LacZ-DF(SEQ ID No.9)：

Ctcactgattaagcattggtaagactgggaaaaccctggcgttac；

LacZ-DR(SEQ ID No.10)：

CTTCCAGATAACTGCCGTCA；

Recombinant dna fragment 1 (SEQ ID No.11):

agcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgt ctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccat gtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcaga tggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgac gataccgaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccag cgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaa gaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacga caggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccagg ctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctat gaccatgattacggattcactggccgtcgttttacaacgtcgtgacgaaagggcctcgtgatacgcctatttttata ggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctattt gtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattga aaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttt tgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactgg atctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctg ctatgtggcgcggtattatcccgtgttgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatga cttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgcca taaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttg cacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcg tgacaccacgatgcctgcagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttccc ggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctgg tttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagcc ctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagatag gtgcctcactgattaagcattggtaagactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccc cctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcga atggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtgcgatcttcctgaggccgata ctgtcgtcgtcccctcaaactggcagatgcacggttacgatgcgcccatctacaccaacgtgacctatcccattacg gtcaatccgccgtttgttcccacggagaatccgacgggttgttactcgctcacatttaatgttgatgaaagctggct acaggaaggccagacgcgaattatttttgatggcgttaactcggcgtttcatctgtggtgcaacgggcgctgggtcg gttacggccaggacagtcgtttgccgtctgaatttgacctgagcgcatttttacgcgccggagaaaaccgcctcgcg gtgatggtgctgcgctggagtgacggcagttatctggaag。

Step 3

Prepare Cas9 expression plasmids pCas (Yu Jiang et al., Multigene Editing in the Escherichia coli Genome via the CRISPR-Cas9System,Applied and Environmental Microbiology,2015,81:2506-2514).PCas is transformed into Escherichia coli MG1655 bacterial strains, 30 DEG C of cultures make Resistance screening is received with card；Picking positive clone molecule prepares electricity and turns competent cell, adds in 10mM's when before being collected by centrifugation 1 is small Arabinose induces the expression of λ-RED recombinases.

Electricity conversion recombinant dna fragment 1 and pTargetF-1, when 30 DEG C of recoveries 1 are small after, receive resistance and ammonia benzyl to contain card The LB tablets of penicillin resistance are screened.

PCR verifications are carried out again to the transformant grown after being incubated overnight：Drawn with amplification lacZ gene homology arm upstream forward direction Object lacZ-UF and homology arm reverse downstream primer lacZ-DR carries out PCR amplification, is to judge bacterium colony according to the size of PCR fragment It is no to be cloned for positive candidate；Then PCR product is sent to sequencing, the right-on clone of sequence is then positive colony.

Positive colony, which connects, receives the LB liquid of resistance containing card, adds in the IPTG of final concentration of 10mM, induces on pCas plasmids The transcription of the sgRNA of pTargetF-1 is oriented to, 30 DEG C of overnight incubations, line divides monoclonal, and is to spectinomycin using bacterium colony No sensitivity verifies the elimination of plasmid pTargetF-1.Wherein, the bacterium colony of spectinomycin sensitivity is what pTargetF-1 was eliminated Bacterium colony.

Step 4

PAM sites are found in the DNA sequence dna of selection markers Amp and design suitable (the SEQ ID of spacer sequences 2 No.12)；Primer AmpsgRNA-F (SEQ ID No.13) and AmpsgRNA-R (SEQ ID No.14) is designed, with pTargetF Plasmid is template, and sgRNA carriers 2 (pTargetF-2) are built using the method for rite-directed mutagenesis.

Spacer sequences 2 (SEQ ID No.12)：

aaagatgctgaagatcagtt；

AmpsgRNA-F(SEQ ID No.13)：

TCCTAGGTATAATACTAGTaaagatgctgaagatcagttGTTTTAGAGCTAGAAATAGC；

AmpsgRNA-R(SEQ ID No.14)：

ACTAGTATTATACCTAGGACTGAGCTAGCTGTCAAG。

Step 5

One section of edited target dna sequence of genome is provided, the left and right two-arm of the sequence respectively contains to be verified with above-mentioned PCR One section of homologous sequence of the genome sequence that is obtained in step, for homologous recombination；And in the sequence, in corresponding lacZ bases Because the position in initiation codon ATG sites replaces with TAA.

Homologous recombination concretely comprises the following steps：With lacZ-UF (SEQ ID No.7) and lacZ-mutation-UR (SEQ ID No.15 upstream DNA fragment) is expanded；With lacZ-mutation-DF (SEQ ID No.16) and lacZ-DR (SEQ ID No.10) Expand downstream DNA segment；Upstream and downstream DNA fragmentation is subjected to fusion DNA vaccine amplification, obtains recombinant dna fragment 2a (SEQ ID No.17)。

lacZ-mutation-UR(SEQ ID No.15)：

gtaatcatggtttaagctgtttcct；

lacZ-mutation-DF(SEQ ID No.16)：

atttcacacaggaaacagcttaaaccatga；

Recombinant dna fragment 2a (SEQ ID No.17)：

agcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgt ctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccat gtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcaga tggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgac gataccgaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccag cgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaa gaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacga caggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccagg ctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctta aaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatc gccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttg cgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtgcga tcttcctgaggccgatactgtcgtcgtcccctcaaactggcagatgcacggttacgatgcgcccatctacaccaacg tgacctatcccattacggtcaatccgccgtttgttcccacggagaatccgacgggttgttactcgctcacatttaat gttgatgaaagctggctacaggaaggccagacgcgaattatttttgatggcgttaactcggcgtttcatctgtggtg caacgggcgctgggtcggttacggccaggacagtcgtttgccgtctgaatttgacctgagcgcatttttacgcgccg gagaaaaccgcctcgcggtgatggtgctgcgctggagtgacggcagttatctggaag。

Step 6

The bacterial strain (bacterial strain of spectinomycin sensitivity) that step 3 obtains prepares Electroporation-competent cells, 1 before being collected by centrifugation Hour adds in the expression of the arabinose induction λ-RED recombinases of 10mM.Electricity conversion recombinant dna fragment 2a and pTargetF- After when 2,30 DEG C of recoveries 1 are small, the Double tablet of resistance and Spectinomycin resistance is received to contain card and is screened.

PCR verifications are carried out to clone after being incubated overnight：Utilize lacZ-UF (SEQ ID No.7) and lacZ-DR (SEQ ID No.10) primer pair progress PCR amplification, judge whether bacterium colony is positive candidate clone according to the size of PCR fragment.It is positive Clone can amplify 1.2kb bands；And the PCR stripe sizes that the bacterial strain of the original resistance containing Amp amplifies are 2.3kb (Fig. 2 electricity Photo top TAA mutation of swimming are compared with wild type).Send the PCR product of correct size to sequencing, the right-on clone of sequence is then For positive colony.

Positive colony, which connects, receives the LB liquid of resistance containing card, adds in the IPTG of final concentration of 10mM, induces on pCas plasmids The transcription of the sgRNA of pTargetF-2 is oriented to, 30 DEG C of overnight incubations, line divides monoclonal, and is to spectinomycin using bacterium colony No sensitivity verifies the elimination of plasmid pTargetF-2.

As there is multiple sites to need to edit on genome, then plasmid pTargetF-2 eliminate successful positive colony again into The genome edit operation of row next round.

37 DEG C of liquid LB overnight incubations are cloned in by what step obtained, after dilution, are coated on LB plates.To being grown in tablet Clone carry out card and receive the sensitive experiment of resistance verifying to confirm the loss of plasmid pCas.It is lost the bacterial strain pair of plasmid pCas Card receive resistance sensitivity, be purpose bacterial strain.

As shown in Fig. 3 (top ATG becomes the sequencing picture that TAA is mutated), DNA sequencing result demonstrates the starting of lacZ gene Codon ATG sites are successfully compiled as TAA sites.

Embodiment 2：By insertion coding 6 behind the initiation codon ATG of Escherichia coli MG1655 genome lacZ genes The DNA sequence dna of histidine residues (6His)：caccaccaccaccaccac.

It is same as Example 1 in addition to step 5.

In the present embodiment, step 5 structure recombinant DNA sequence 2b.

One section of edited target dna sequence of genome is provided, the left and right two-arm of the sequence respectively contains to be verified with above-mentioned PCR One section of homologous sequence of the genome sequence that is obtained in step, for homologous recombination.And in the sequence, in corresponding lacZ bases Because of insetion sequence caccaccaccaccaccac (SEQ ID No.18) behind the position in initiation codon ATG sites.

Homologous recombination concretely comprises the following steps：With lacZ-UF (SEQ ID No.7) and lacZ-insHis-UR (SEQ ID No.19 upstream DNA fragment) is expanded；Expanded with lacZ-insHis-DF (SEQ ID No.20) and lacZ-DR (SEQ ID No.10) Increase downstream DNA segment；Upstream and downstream DNA fragmentation is subjected to fusion DNA vaccine amplification, obtains recombinant dna fragment 2b (SEQ ID No.21). Electricity conversion recombinant dna fragment 2b and pTargetF-2, when 30 DEG C of recoveries 1 are small after, to contain, card receives resistance and spectinomycin resists The Double tablet of property is screened.

PCR verifications are carried out to clone after being incubated overnight：Utilize lacZ-UF (SEQ ID No.7) and lacZ-DR (SEQ ID No.10) primer pair progress PCR amplification, judge whether bacterium colony is positive candidate clone according to the size of PCR fragment.It is positive Clone can amplify 1.2kb bands；And the PCR stripe sizes of original strain are 2.3kb (insertions among Fig. 2 electrophoresis photographs 6His and wild type comparison).

As shown in Fig. 3 (6 His mutation sequencings pictures are inserted at middle part), DNA sequencing result demonstrates the starting of lacZ gene The DNA sequence dna of 6 histidine residues (6His) of coding has been successively inserted into behind codon ATG：caccaccaccaccaccac (SEQ ID NO.18)。

lacZ-insHis-UR(SEQ ID No.19)：

gtgaatccgtaatcatggtgtggtggtggtggtggtgcatagctgtttcctgtgtg；

lacZ-insHis-DF(SEQ ID No.20)：

cacacaggaaacagctatgcaccaccaccaccaccacaccatgattacggattcac；

Recombinant dna fragment 2b (SEQ ID No.21)：

agcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgt ctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccat gtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcaga tggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgac gataccgaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccag cgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaa gaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacga caggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccagg ctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctat gcaccaccaccaccaccacaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctg gcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgat cgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccgga aagctggctggagtgcgatcttcctgaggccgatactgtcgtcgtcccctcaaactggcagatgcacggttacgatg cgcccatctacaccaacgtgacctatcccattacggtcaatccgccgtttgttcccacggagaatccgacgggttgt tactcgctcacatttaatgttgatgaaagctggctacaggaaggccagacgcgaattatttttgatggcgttaactc ggcgtttcatctgtggtgcaacgggcgctgggtcggttacggccaggacagtcgtttgccgtctgaatttgacctga gcgcatttttacgcgccggagaaaaccgcctcgcggtgatggtgctgcgctggagtgacggcagttatctggaag。

Embodiment 3：The initiation codon ATG of Escherichia coli MG1655 genome lacZ genes is previously inserted into one section to carry The DNA sequence dna of the AmilGFP genes of promoter.

It is same as Example 1 in addition to step 5.

In the present embodiment, step 5 structure recombinant DNA sequence 2c.

One section of edited target dna sequence of genome is provided, the left and right two-arm of the sequence respectively contains to be verified with above-mentioned PCR One section of homologous sequence of the genome sequence that is obtained in step, for homologous recombination.And in the sequence, in corresponding lacZ bases DNA sequence dna (the SEQ ID of the amilGFP genes with promoter are previously inserted into because of the position in initiation codon ATG sites No.22)。

Homologous recombination concretely comprises the following steps：With lacZ-UF (SEQ ID No.7) and lacZ-insGFP-UR (SEQ ID No.23 upstream DNA fragment) is expanded；Expanded with lacZ-insGFP-DF (SEQ ID No.24) and lacZ-DR (SEQ ID No.10) Increase downstream DNA segment；With amilGFP-F (SEQ ID No.25) and amilGFP-R (SEQ ID No.26) amplification amilGFP bases Because of segment；Three DNA fragmentations are subjected to fusion DNA vaccine amplification, obtain recombinant dna fragment 2c (SEQ ID No.27).Electricity conversion weight Group DNA fragmentation 2c and pTargetF-2, when 30 DEG C of recoveries 1 are small after, receive the dual anti-of resistance and Spectinomycin resistance to contain card Mild-natured plate is screened.

PCR verifications are carried out to clone after being incubated overnight：Utilize lacZ-UF (SEQ ID No.7) and lacZ-DR (SEQ ID No.10) primer pair progress PCR amplification, judge whether bacterium colony is positive candidate clone according to the size of PCR fragment.It is positive Clone can amplify 2.0kb bands；And the PCR stripe sizes of original strain are 2.3kb (insertions among Fig. 2 electrophoresis photographs AmilGFP genes and wild type comparison).

As shown in Fig. 3 (lower section insertion amilGFP series jump sequencings picture), DNA sequencing result demonstrates lacZ gene Initiation codon ATG be previously inserted into one section with promoter amilGFP genes DNA sequence dna.

After obtained positive strain is cultivated, using fluorescence microscope, it can be found that inserting amilGFP sequences The bacterial strain of row is observed that fluorescence, and control strain MG1655 does not observe fluorescence then；The result fully demonstrates insertion AmilGFP sequences can in bacterial strain normal expression.

The ami lGFP sequences (SEQ ID No.22) of insertion：

Catcggtaagttattcttgacatctcaggggggacgtggtataataactgagtactgtttctagagattaaagagga gaaggatccatgtcttattcaaagcatggcatcgtacaagaaatgaagacgaaataccatatggaaggcagtgtcaa tggccatgaatttacgatcgaaggtgtaggaactgggtacccttacgaagggaaacagatgtccgaattagtgatca tcaagcctgcgggaaaaccccttccattctcctttgacatactgtcatcagtctttcaatatggaaaccgttgcttc acaaagtacccggcagacatgcctgactatttcaagcaagcattcccagatggaatgtcatatgaaaggtcatttct atttgaggatggagcagttgctacagccagctggaacattcgtctcgaaggaaattgcttcatccacaaatccatct ttcatggcgtaaactttcccgctgatggacccgtaatgaaaaagaagacaattgactgggataagtccttcgaaaaa atgactgtgtctaaagaggtgctaagaggtgacgtgactatgtttcttatgctcgaaggaggtggttctcacagatg ccaatttcactccacttacaaaacagagaagccggtcacactgcccccgaatcatgtcgtagaacatcaaattgtga ggaccgaccttggccaaagtgcaaaaggctttacagtcaagctggaagcacatgccgcggctcatgttaaccctttg aaggttaaa；

lacZ-insGFP-UR(SEQ ID No.23)：

agctgtttcctgtgtgaaattgtt；

lacZ-insGFP-DF(SEQ ID No.24)：

tgttaaccctttgaaggttaaaatgaccatgattacggattcact；

ami lGFP-F(SEQ ID No.25)：

taacaatttcacacaggaaacagctcatcggtaagttattcttgaca；

ami lGFP-R(SEQ ID No.26)：

tttaaccttcaaagggttaacat；

Recombinant dna fragment 2c (SEQ ID No.27)

agcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgt ctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccat gtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcaga tggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgac gataccgaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccag cgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaa gaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacga caggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccagg ctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctca tcggtaagttattcttgacatctcaggggggacgtggtataataactgagtactgtttctagagattaaagaggaga aggatccatgtcttattcaaagcatggcatcgtacaagaaatgaagacgaaataccatatggaaggcagtgtcaatg gccatgaatttacgatcgaaggtgtaggaactgggtacccttacgaagggaaacagatgtccgaattagtgatcatc aagcctgcgggaaaaccccttccattctcctttgacatactgtcatcagtctttcaatatggaaaccgttgcttcac aaagtacccggcagacatgcctgactatttcaagcaagcattcccagatggaatgtcatatgaaaggtcatttctat ttgaggatggagcagttgctacagccagctggaacattcgtctcgaaggaaattgcttcatccacaaatccatcttt catggcgtaaactttcccgctgatggacccgtaatgaaaaagaagacaattgactgggataagtccttcgaaaaaat gactgtgtctaaagaggtgctaagaggtgacgtgactatgtttcttatgctcgaaggaggtggttctcacagatgcc aatttcactccacttacaaaacagagaagccggtcacactgcccccgaatcatgtcgtagaacatcaaattgtgagg accgaccttggccaaagtgcaaaaggctttacagtcaagctggaagcacatgccgcggctcatgttaaccctttgaa ggttaaaatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttaccc aacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcc caacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggct ggagtgcgatcttcctgaggccgatactgtcgtcgtcccctcaaactggcagatgcacggttacgatgcgcccatct acaccaacgtgacctatcccattacggtcaatccgccgtttgttcccacggagaatccgacgggttgttactcgctc acatttaatgttgatgaaagctggctacaggaaggccagacgcgaattatttttgatggcgttaactcggcgtttca tctgtggtgcaacgggcgctgggtcggttacggccaggacagtcgtttgccgtctgaatttgacctgagcgcatttt tacgcgccggagaaaaccgcctcgcggtgatggtgctgcgctggagtgacggcagttatctggaag。

Embodiment 4：6 groups will be encoded behind the initiation codon GTG of Escherichia coli MG1655 genome indispensable genes frr The DNA sequence dna of histidine residue (6His)：CACCATCATCACCACCAT.

Step 1

Escherichia coli MG1655 genome frr genetic fragments (SEQ ID No.28) are cloned in, in its initiation codon GTG PAM (protospacer adjacent motifs) site TGG is found in front, and designs corresponding 3 (SEQ of spacer sequences ID No.29)。

Design primer pair pTargetF-frr (SEQ ID No.30) and pTargetF-R (SEQ ID No.31)；Using point The method of mutation using pTargetF plasmids as template, is expanded with High fidelity PCR enzyme, with DpnI digestions to remove after recycling PTargetF plasmid templates；T4PNK is added in, T4DNA Ligase are attached, structure sgRNA carriers 3 (pTargetF-3).

DNA sequence dna (SEQ ID No.28) near Escherichia coli MG1655frr genes：

Agcttgcctgcgtggtatcgaaattgaagccgatgtggtgctgaaagcaaccaaagttgacggcgtgtttaccgctg atccggcgaaagatccaaccgcaaccatgtacgagcaactgacttacagcgaagtgctggaaaaagagctgaaagtc atggacctggcggccttcacgctggctcgtgaccataaattaccgattcgtgttttcaatatgaacaaaccgggtgc gctgcgccgtgtggtaatgggtgaaaaagaagggactttaatcacggaataattcccgtgatggataaataagggta agattccgcgtaagtatcgcgggggcgtaagtctggttataaggcgttattgttgcaggcagtttggtcacggccag cgcgcagcaaccggagcgtacaaaagtacgtgaggatggcgagcactgcccggggccaaaatggcaaataaaatagc ctaataatccagacgattacccgtaatatgtttaatcagggctatacttagcacacttccactgtgtgtgactgtct ggtctgactgagacaagttttcaaggattcgtaacgtgattagcgatatcagaaaagatgctgaagtacgcatggac aaatgcgtagaagcgttcaaaacccaaatcagcaaaatacgcacgggtcgtgcttctcccagcctgctggatggcat tgtcgtggaatattacggcacgccgacgccgctgcgtcagctggcaagcgtaacggtagaagattcccgtacactga aaatcaacgtgtttgatcgttcaatgtctccggccgttgaaaaagcgattatggcgtccgatcttggcctgaacccg aactctgcgggtagcgacatccgtgttccgctgccgccgctgacggaagaacgtcgtaaagatctgaccaaaatcgt tcgtggtgaagcagaacaagcgcgtgttgcagtacgtaacgtgcgtcgtgacgcgaacgacaaagt；

Spacer sequences 3 (SEQ ID No.29)：

gaccagacagtcacacacag；

pTargetF-frr(SEQ ID No.30)：

gaccagacagtcacacacaggttttagagctagaaatagcaag；

pTargetF-R(SEQ ID No.31)：

actagtattatacctaggac。

Step 2,

Build recombinant dna fragment 3：It is expanded with frr-UP-f (SEQ ID No.32) and frr-UP-R (SEQ ID No.33) Frr upstream region of gene DNA fragmentations, Frr_Amp-f (SEQ ID No.34) and Frr_Amp-r (SEQ ID No.35) primer amplification sieve Select flag sequence --- ampicillin resistance gene sequence (Amp), frr-DN-f (SEQ ID No.36) and frr-DN-r (SEQ ID No.37) expands frr downstream of gene DNA fragmentations.Three DNA fragmentations are subjected to fusion DNA vaccine amplification, obtain recombinant DNA Segment 3 (SEQ ID No.38).

frr-UP-f(SEQ ID No.32)：

agcttgcctgcgtggtatcg；

frr-UP-r(SEQ ID No.33)：

cctcacgtacttttgtacgc；

Frr_Amp-f(SEQ ID No.34)：

gcgtacaaaagtacgtgaggGACGAAAGGGCCTCGTGATAC；

Frr_Amp-r(SEQ ID No.35)

CATCTAGTGGGTCCTGTCTTTTTACCAATGCTTAATCAGTGAGGCACCTATC；

frr-DN-f(SEQ ID No.36)：

AAAGACAGGACCCACTAGATGgtgattagcgatatcagaaaagatgctg；

frr-DN-r(SEQ ID No.37)：

actttgtcgttcgcgtcacg；

Recombinant dna fragment 3 (SEQ ID No.38)：

agcttgcctgcgtggtatcgaaattgaagccgatgtggtgctgaaagcaaccaaagttgacggcgtgtttaccgctg atccggcgaaagatccaaccgcaaccatgtacgagcaactgacttacagcgaagtgctggaaaaagagctgaaagtc atggacctggcggccttcacgctggctcgtgaccataaattaccgattcgtgttttcaatatgaacaaaccgggtgc gctgcgccgtgtggtaatgggtgaaaaagaagggactttaatcacggaataattcccgtgatggataaataagggta agattccgcgtaagtatcgcgggggcgtaagtctggttataaggcgttattgttgcaggcagtttggtcacggccag cgcgcagcaaccggagcgtacaaaagtacgtgaggGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATG TCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTT TTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAA GAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACC CAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAAC AGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGG CGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTG AGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATG AGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACAT GGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCA CGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAA TTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGC TGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTA TCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCA CTGATTAAGCATTGGTAAAAAGACAGGACCCACTAGATGgtgattagcgatatcagaaaagatgctgaagtacgcat ggacaaatgcgtagaagcgttcaaaacccaaatcagcaaaatacgcacgggtcgtgcttctcccagcctgctggatg gcattgtcgtggaatattacggcacgccgacgccgctgcgtcagctggcaagcgtaacggtagaagattcccgtaca ctgaaaatcaacgtgtttgatcgttcaatgtctccggccgttgaaaaagcgattatggcgtccgatcttggcctgaa cccgaactctgcgggtagcgacatccgtgttccgctgccgccgctgacggaagaacgtcgtaaagatctgaccaaaa tcgttcgtggtgaagcagaacaagcgcgtgttgcagtacgtaacgtgcgtcgtgacgcgaacgacaaagt。

Step 3

The methods of prepared by pCas9 conversions, competence is the same as example 1.

Electricity conversion recombinant dna fragment 3 and pTargetF-3, when 30 DEG C of recoveries 1 are small after, receive resistance and ammonia benzyl to contain card The LB tablets of penicillin resistance are screened (or puts down receiving the LB of resistance, spectinomycin and amicillin resistance containing card Plate is screened).

PCR verifications are carried out again to the transformant grown after being incubated overnight：PCR is carried out with amplification frr-UP-f and frr-DN-r Amplification judges whether bacterium colony is positive candidate clone according to the size of PCR fragment；Then PCR product is sent to sequencing, sequence is complete The clone of total correctness is then positive colony.

Positive colony, which connects, receives the LB liquid of resistance containing card, adds in the IPTG of final concentration of 10mM, induces on pCas plasmids The transcription of the sgRNA of pTargetF-3 is oriented to, 30 DEG C of overnight incubations, line divides monoclonal, and is to spectinomycin using bacterium colony No sensitivity verifies the elimination of plasmid pTargetF-3.Wherein, the bacterium colony of spectinomycin sensitivity is what pTargetF-3 was eliminated Bacterium colony.

Step 4

One section of edited target dna sequence of genome is provided, the left and right two-arm of the sequence respectively contains to be verified with above-mentioned PCR One section of homologous sequence of the genome sequence that is obtained in step, for homologous recombination；And in the sequence, in corresponding frr bases Because being with the addition of CACCATCATCACCACCAT (SEQ ID No.39) behind initiation codon GTG sites, 6 groups can be encoded Propylhomoserin.

Homologous recombination concretely comprises the following steps：With frr-UP-f (SEQ ID No.32) and frr-UP-His (SEQ ID No.40) Expand upstream DNA fragment；With frr-DN-His (SEQ ID No.41) and frr-DN-r (SEQ ID No.37) amplification downstream DNAs Segment；Upstream and downstream DNA fragmentation is subjected to fusion DNA vaccine amplification, obtains recombinant dna fragment 4 (SEQ ID No.42).

frr-UP-His(SEQ ID No.40)

cacgttacgaatccttgaaaacttg；

frr-DN-His(SEQ ID No.41)

gttttcaaggattcgtaacgtgCACCATCATCACCACCATattagcgatatcagaaaagatgctg；

Recombinant dna fragment 4 (SEQ ID No.42)

Agcttgcctgcgtggtatcgaaattgaagccgatgtggtgctgaaagcaaccaaagttgacggcgtgtttaccgctg atccggcgaaagatccaaccgcaaccatgtacgagcaactgacttacagcgaagtgctggaaaaagagctgaaagtc atggacctggcggccttcacgctggctcgtgaccataaattaccgattcgtgttttcaatatgaacaaaccgggtgc gctgcgccgtgtggtaatgggtgaaaaagaagggactttaatcacggaataattcccgtgatggataaataagggta agattccgcgtaagtatcgcgggggcgtaagtctggttataaggcgttattgttgcaggcagtttggtcacggccag cgcgcagcaaccggagcgtacaaaagtacgtgaggatggcgagcactgcccggggccaaaatggcaaataaaatagc ctaataatccagacgattacccgtaatatgtttaatcagggctatacttagcacacttccactgtgtgtgactgtct ggtctgactgagacaagttttcaaggattcgtaacgtgCACCATCATCACCACCATattagcgatatcagaaaagat gctgaagtacgcatggacaaatgcgtagaagcgttcaaaacccaaatcagcaaaatacgcacgggtcgtgcttctcc cagcctgctggatggcattgtcgtggaatattacggcacgccgacgccgctgcgtcagctggcaagcgtaacggtag aagattcccgtacactgaaaatcaacgtgtttgatcgttcaatgtctccggccgttgaaaaagcgattatggcgtcc gatcttggcctgaacccgaactctgcgggtagcgacatccgtgttccgctgccgccgctgacggaagaacgtcgtaa agatctgaccaaaatcgttcgtggtgaagcagaacaagcgcgtgttgcagtacgtaacgtgcgtcgtgacgcgaacg acaaagt。

Step 5

The bacterial strain (bacterial strain of spectinomycin sensitivity) that step 3 obtains prepares Electroporation-competent cells, 1 before being collected by centrifugation Hour adds in the expression of the arabinose induction λ-RED recombinases of 10mM.Electricity conversion recombinant dna fragment 4 and pTargetF-2 (with example 1), when 30 DEG C of recoveries 1 are small after, receive the Double tablet of resistance and Spectinomycin resistance to contain card and screened.

PCR verifications are carried out to clone after being incubated overnight：PCR expansions are carried out using frr-UP-f and frr-DN-r primer pairs Increase, judge whether bacterium colony is positive candidate clone according to the size of PCR fragment.Positive colony can amplify 1.0kb bands； And the PCR stripe sizes of original strain are 1.9kb.Send the PCR product of correct size to sequencing, the right-on clone of sequence is then For positive colony.

Positive colony, which connects, receives the LB liquid of resistance containing card, adds in the IPTG of final concentration of 10mM, induces on pCas plasmids The transcription of the sgRNA of pTargetF-2 is oriented to, 30 DEG C of overnight incubations, line divides monoclonal, and is to spectinomycin using bacterium colony No sensitivity verifies the elimination of plasmid pTargetF-2.

As there is multiple sites to need to edit on genome, then plasmid pTargetF-2 eliminate successful positive colony again into The genome edit operation of row next round.

37 DEG C of liquid LB overnight incubations are cloned in by what step obtained, after dilution, are coated on LB plates.To being grown in tablet Clone carry out card and receive the sensitive experiment of resistance verifying to confirm the loss of plasmid pCas.It is lost the bacterial strain pair of plasmid pCas Card receive resistance sensitivity, be purpose bacterial strain.

It is successively inserted into as shown in figure 5, DNA sequencing result demonstrates behind the initiation codon GTG sites of frr genes CACCATCATCACCACCAT (SEQ ID NO.39) sequence.

Pay attention to：In the present embodiment, due to frr genes be thalli growth indispensable gene, can not carry out gene disruption or Gene knockout operates；Therefore, this example is previously inserted into ammonia benzyl antibiotics resistance gene in frr genes, meanwhile, the 3 ' of resistant gene End has connected general ribosome bind site (RBS) sequence (SEQ ID No.43) so that frr can utilize resistant gene Promoter is transcribed, and is translated using general RBS sequences, therefore does not influence the expression of Frr albumen and the growth of thalline. For the editor of 3 ' terminal sequence of indispensable gene, method is similar：Suitable PAM sites are found behind 3 ' end terminator codons, if Spacer sequences are counted, resistant gene is then first inserted into, then follow-up editor is carried out by target spot of resistant gene.

BBa_J61101 sequences (SEQ ID No.43)：

AAAGACAGGACCCACTAG。

All references mentioned in the present invention is incorporated herein by reference, independent just as each document It is incorporated as with reference to such.In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can To be made various changes or modifications to the present invention, such equivalent forms equally fall within the model that the application the appended claims are limited It encloses.

Sequence table

<110>Shanghai Inst. of Life Science, CAS

<120>A kind of method of DNA sequence dna editor

<130> P2016-1715

<160> 45

<170> PatentIn version 3.5

<210> 1

<211> 1289

<212> DNA

<213>Artificial sequence

<400> 1

agcatctggt cgcattgggt caccagcaaa tcgcgctgtt agcgggccca ttaagttctg 60

tctcggcgcg tctgcgtctg gctggctggc ataaatatct cactcgcaat caaattcagc 120

cgatagcgga acgggaaggc gactggagtg ccatgtccgg ttttcaacaa accatgcaaa 180

tgctgaatga gggcatcgtt cccactgcga tgctggttgc caacgatcag atggcgctgg 240

gcgcaatgcg cgccattacc gagtccgggc tgcgcgttgg tgcggatatc tcggtagtgg 300

gatacgacga taccgaagac agctcatgtt atatcccgcc gttaaccacc atcaaacagg 360

attttcgcct gctggggcaa accagcgtgg accgcttgct gcaactctct cagggccagg 420

cggtgaaggg caatcagctg ttgcccgtct cactggtgaa aagaaaaacc accctggcgc 480

ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag ctggcacgac 540

aggtttcccg actggaaagc gggcagtgag cgcaacgcaa ttaatgtgag ttagctcact 600

cattaggcac cccaggcttt acactttatg cttccggctc gtatgttgtg tggaattgtg 660

agcggataac aatttcacac aggaaacagc tatgaccatg attacggatt cactggccgt 720

cgttttacaa cgtcgtgact gggaaaaccc tggcgttacc caacttaatc gccttgcagc 780

acatccccct ttcgccagct ggcgtaatag cgaagaggcc cgcaccgatc gcccttccca 840

acagttgcgc agcctgaatg gcgaatggcg ctttgcctgg tttccggcac cagaagcggt 900

gccggaaagc tggctggagt gcgatcttcc tgaggccgat actgtcgtcg tcccctcaaa 960

ctggcagatg cacggttacg atgcgcccat ctacaccaac gtgacctatc ccattacggt 1020

caatccgccg tttgttccca cggagaatcc gacgggttgt tactcgctca catttaatgt 1080

tgatgaaagc tggctacagg aaggccagac gcgaattatt tttgatggcg ttaactcggc 1140

gtttcatctg tggtgcaacg ggcgctgggt cggttacggc caggacagtc gtttgccgtc 1200

tgaatttgac ctgagcgcat ttttacgcgc cggagaaaac cgcctcgcgg tgatggtgct 1260

gcgctggagt gacggcagtt atctggaag 1289

<210> 2

<211> 20

<212> DNA

<213>Artificial sequence

<400> 2

tcgttttaca acgtcgtgac 20

<210> 3

<211> 59

<212> DNA

<213>Artificial sequence

<400> 3

tcctaggtat aatactagtt cgttttacaa cgtcgtgacg ttttagagct agaaatagc 59

<210> 4

<211> 36

<212> DNA

<213>Artificial sequence

<400> 4

actagtatta tacctaggac tgagctagct gtcaag 36

<210> 5

<211> 46

<212> DNA

<213>Artificial sequence

<400> 5

ctggccgtcg ttttacaacg tcgtgacgaa agggcctcgt gatacg 46

<210> 6

<211> 25

<212> DNA

<213>Artificial sequence

<400> 6

ttaccaatgc ttaatcagtg aggca 25

<210> 7

<211> 22

<212> DNA

<213>Artificial sequence

<400> 7

agcatctggt cgcattgggt ca 22

<210> 8

<211> 25

<212> DNA

<213>Artificial sequence

<400> 8

acgacgttgt aaaacgacgg ccagt 25

<210> 9

<211> 45

<212> DNA

<213>Artificial sequence

<400> 9

ctcactgatt aagcattggt aagactggga aaaccctggc gttac 45

<210> 10

<211> 20

<212> DNA

<213>Artificial sequence

<400> 10

cttccagata actgccgtca 20

<210> 11

<211> 2350

<212> DNA

<213>Artificial sequence

<400> 11

agcatctggt cgcattgggt caccagcaaa tcgcgctgtt agcgggccca ttaagttctg 60

tctcggcgcg tctgcgtctg gctggctggc ataaatatct cactcgcaat caaattcagc 120

cgatagcgga acgggaaggc gactggagtg ccatgtccgg ttttcaacaa accatgcaaa 180

tgctgaatga gggcatcgtt cccactgcga tgctggttgc caacgatcag atggcgctgg 240

gcgcaatgcg cgccattacc gagtccgggc tgcgcgttgg tgcggatatc tcggtagtgg 300

gatacgacga taccgaagac agctcatgtt atatcccgcc gttaaccacc atcaaacagg 360

attttcgcct gctggggcaa accagcgtgg accgcttgct gcaactctct cagggccagg 420

cggtgaaggg caatcagctg ttgcccgtct cactggtgaa aagaaaaacc accctggcgc 480

ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag ctggcacgac 540

aggtttcccg actggaaagc gggcagtgag cgcaacgcaa ttaatgtgag ttagctcact 600

cattaggcac cccaggcttt acactttatg cttccggctc gtatgttgtg tggaattgtg 660

agcggataac aatttcacac aggaaacagc tatgaccatg attacggatt cactggccgt 720

cgttttacaa cgtcgtgacg aaagggcctc gtgatacgcc tatttttata ggttaatgtc 780

atgataataa tggtttctta gacgtcaggt ggcacttttc ggggaaatgt gcgcggaacc 840

cctatttgtt tatttttcta aatacattca aatatgtatc cgctcatgag acaataaccc 900

tgataaatgc ttcaataata ttgaaaaagg aagagtatga gtattcaaca tttccgtgtc 960

gcccttattc ccttttttgc ggcattttgc cttcctgttt ttgctcaccc agaaacgctg 1020

gtgaaagtaa aagatgctga agatcagttg ggtgcacgag tgggttacat cgaactggat 1080

ctcaacagcg gtaagatcct tgagagtttt cgccccgaag aacgttttcc aatgatgagc 1140

acttttaaag ttctgctatg tggcgcggta ttatcccgtg ttgacgccgg gcaagagcaa 1200

ctcggtcgcc gcatacacta ttctcagaat gacttggttg agtactcacc agtcacagaa 1260

aagcatctta cggatggcat gacagtaaga gaattatgca gtgctgccat aaccatgagt 1320

gataacactg cggccaactt acttctgaca acgatcggag gaccgaagga gctaaccgct 1380

tttttgcaca acatggggga tcatgtaact cgccttgatc gttgggaacc ggagctgaat 1440

gaagccatac caaacgacga gcgtgacacc acgatgcctg cagcaatggc aacaacgttg 1500

cgcaaactat taactggcga actacttact ctagcttccc ggcaacaatt aatagactgg 1560

atggaggcgg ataaagttgc aggaccactt ctgcgctcgg cccttccggc tggctggttt 1620

attgctgata aatctggagc cggtgagcgt gggtctcgcg gtatcattgc agcactgggg 1680

ccagatggta agccctcccg tatcgtagtt atctacacga cggggagtca ggcaactatg 1740

gatgaacgaa atagacagat cgctgagata ggtgcctcac tgattaagca ttggtaagac 1800

tgggaaaacc ctggcgttac ccaacttaat cgccttgcag cacatccccc tttcgccagc 1860

tggcgtaata gcgaagaggc ccgcaccgat cgcccttccc aacagttgcg cagcctgaat 1920

ggcgaatggc gctttgcctg gtttccggca ccagaagcgg tgccggaaag ctggctggag 1980

tgcgatcttc ctgaggccga tactgtcgtc gtcccctcaa actggcagat gcacggttac 2040

gatgcgccca tctacaccaa cgtgacctat cccattacgg tcaatccgcc gtttgttccc 2100

acggagaatc cgacgggttg ttactcgctc acatttaatg ttgatgaaag ctggctacag 2160

gaaggccaga cgcgaattat ttttgatggc gttaactcgg cgtttcatct gtggtgcaac 2220

gggcgctggg tcggttacgg ccaggacagt cgtttgccgt ctgaatttga cctgagcgca 2280

tttttacgcg ccggagaaaa ccgcctcgcg gtgatggtgc tgcgctggag tgacggcagt 2340

tatctggaag 2350

<210> 12

<211> 20

<212> DNA

<213>Artificial sequence

<400> 12

aaagatgctg aagatcagtt 20

<210> 13

<211> 59

<212> DNA

<213>Artificial sequence

<400> 13

tcctaggtat aatactagta aagatgctga agatcagttg ttttagagct agaaatagc 59

<210> 14

<211> 36

<212> DNA

<213>Artificial sequence

<400> 14

actagtatta tacctaggac tgagctagct gtcaag 36

<210> 15

<211> 25

<212> DNA

<213>Artificial sequence

<400> 15

gtaatcatgg tttaagctgt ttcct 25

<210> 16

<211> 30

<212> DNA

<213>Artificial sequence

<400> 16

atttcacaca ggaaacagct taaaccatga 30

<210> 17

<211> 1289

<212> DNA

<213>Artificial sequence

<400> 17

agcatctggt cgcattgggt caccagcaaa tcgcgctgtt agcgggccca ttaagttctg 60

tctcggcgcg tctgcgtctg gctggctggc ataaatatct cactcgcaat caaattcagc 120

cgatagcgga acgggaaggc gactggagtg ccatgtccgg ttttcaacaa accatgcaaa 180

tgctgaatga gggcatcgtt cccactgcga tgctggttgc caacgatcag atggcgctgg 240

gcgcaatgcg cgccattacc gagtccgggc tgcgcgttgg tgcggatatc tcggtagtgg 300

gatacgacga taccgaagac agctcatgtt atatcccgcc gttaaccacc atcaaacagg 360

attttcgcct gctggggcaa accagcgtgg accgcttgct gcaactctct cagggccagg 420

cggtgaaggg caatcagctg ttgcccgtct cactggtgaa aagaaaaacc accctggcgc 480

ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag ctggcacgac 540

aggtttcccg actggaaagc gggcagtgag cgcaacgcaa ttaatgtgag ttagctcact 600

cattaggcac cccaggcttt acactttatg cttccggctc gtatgttgtg tggaattgtg 660

agcggataac aatttcacac aggaaacagc ttaaaccatg attacggatt cactggccgt 720

cgttttacaa cgtcgtgact gggaaaaccc tggcgttacc caacttaatc gccttgcagc 780

acatccccct ttcgccagct ggcgtaatag cgaagaggcc cgcaccgatc gcccttccca 840

acagttgcgc agcctgaatg gcgaatggcg ctttgcctgg tttccggcac cagaagcggt 900

gccggaaagc tggctggagt gcgatcttcc tgaggccgat actgtcgtcg tcccctcaaa 960

ctggcagatg cacggttacg atgcgcccat ctacaccaac gtgacctatc ccattacggt 1020

caatccgccg tttgttccca cggagaatcc gacgggttgt tactcgctca catttaatgt 1080

tgatgaaagc tggctacagg aaggccagac gcgaattatt tttgatggcg ttaactcggc 1140

gtttcatctg tggtgcaacg ggcgctgggt cggttacggc caggacagtc gtttgccgtc 1200

tgaatttgac ctgagcgcat ttttacgcgc cggagaaaac cgcctcgcgg tgatggtgct 1260

gcgctggagt gacggcagtt atctggaag 1289

<210> 18

<211> 18

<212> DNA

<213>Artificial sequence

<400> 18

caccaccacc accaccac 18

<210> 19

<211> 56

<212> DNA

<213>Artificial sequence

<400> 19

gtgaatccgt aatcatggtg tggtggtggt ggtggtgcat agctgtttcc tgtgtg 56

<210> 20

<211> 56

<212> DNA

<213>Artificial sequence

<400> 20

cacacaggaa acagctatgc accaccacca ccaccacacc atgattacgg attcac 56

<210> 21

<211> 1307

<212> DNA

<213>Artificial sequence

<400> 21

agcatctggt cgcattgggt caccagcaaa tcgcgctgtt agcgggccca ttaagttctg 60

tctcggcgcg tctgcgtctg gctggctggc ataaatatct cactcgcaat caaattcagc 120

cgatagcgga acgggaaggc gactggagtg ccatgtccgg ttttcaacaa accatgcaaa 180

tgctgaatga gggcatcgtt cccactgcga tgctggttgc caacgatcag atggcgctgg 240

gcgcaatgcg cgccattacc gagtccgggc tgcgcgttgg tgcggatatc tcggtagtgg 300

gatacgacga taccgaagac agctcatgtt atatcccgcc gttaaccacc atcaaacagg 360

attttcgcct gctggggcaa accagcgtgg accgcttgct gcaactctct cagggccagg 420

cggtgaaggg caatcagctg ttgcccgtct cactggtgaa aagaaaaacc accctggcgc 480

ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag ctggcacgac 540

aggtttcccg actggaaagc gggcagtgag cgcaacgcaa ttaatgtgag ttagctcact 600

cattaggcac cccaggcttt acactttatg cttccggctc gtatgttgtg tggaattgtg 660

agcggataac aatttcacac aggaaacagc tatgcaccac caccaccacc acaccatgat 720

tacggattca ctggccgtcg ttttacaacg tcgtgactgg gaaaaccctg gcgttaccca 780

acttaatcgc cttgcagcac atcccccttt cgccagctgg cgtaatagcg aagaggcccg 840

caccgatcgc ccttcccaac agttgcgcag cctgaatggc gaatggcgct ttgcctggtt 900

tccggcacca gaagcggtgc cggaaagctg gctggagtgc gatcttcctg aggccgatac 960

tgtcgtcgtc ccctcaaact ggcagatgca cggttacgat gcgcccatct acaccaacgt 1020

gacctatccc attacggtca atccgccgtt tgttcccacg gagaatccga cgggttgtta 1080

ctcgctcaca tttaatgttg atgaaagctg gctacaggaa ggccagacgc gaattatttt 1140

tgatggcgtt aactcggcgt ttcatctgtg gtgcaacggg cgctgggtcg gttacggcca 1200

ggacagtcgt ttgccgtctg aatttgacct gagcgcattt ttacgcgccg gagaaaaccg 1260

cctcgcggtg atggtgctgc gctggagtga cggcagttat ctggaag 1307

<210> 22

<211> 779

<212> DNA

<213>Artificial sequence

<400> 22

catcggtaag ttattcttga catctcaggg gggacgtggt ataataactg agtactgttt 60

ctagagatta aagaggagaa ggatccatgt cttattcaaa gcatggcatc gtacaagaaa 120

tgaagacgaa ataccatatg gaaggcagtg tcaatggcca tgaatttacg atcgaaggtg 180

taggaactgg gtacccttac gaagggaaac agatgtccga attagtgatc atcaagcctg 240

cgggaaaacc ccttccattc tcctttgaca tactgtcatc agtctttcaa tatggaaacc 300

gttgcttcac aaagtacccg gcagacatgc ctgactattt caagcaagca ttcccagatg 360

gaatgtcata tgaaaggtca tttctatttg aggatggagc agttgctaca gccagctgga 420

acattcgtct cgaaggaaat tgcttcatcc acaaatccat ctttcatggc gtaaactttc 480

ccgctgatgg acccgtaatg aaaaagaaga caattgactg ggataagtcc ttcgaaaaaa 540

tgactgtgtc taaagaggtg ctaagaggtg acgtgactat gtttcttatg ctcgaaggag 600

gtggttctca cagatgccaa tttcactcca cttacaaaac agagaagccg gtcacactgc 660

ccccgaatca tgtcgtagaa catcaaattg tgaggaccga ccttggccaa agtgcaaaag 720

gctttacagt caagctggaa gcacatgccg cggctcatgt taaccctttg aaggttaaa 779

<210> 23

<211> 24

<212> DNA

<213>Artificial sequence

<400> 23

agctgtttcc tgtgtgaaat tgtt 24

<210> 24

<211> 45

<212> DNA

<213>Artificial sequence

<400> 24

tgttaaccct ttgaaggtta aaatgaccat gattacggat tcact 45

<210> 25

<211> 47

<212> DNA

<213>Artificial sequence

<400> 25

taacaatttc acacaggaaa cagctcatcg gtaagttatt cttgaca 47

<210> 26

<211> 23

<212> DNA

<213>Artificial sequence

<400> 26

tttaaccttc aaagggttaa cat 23

<210> 27

<211> 2068

<212> DNA

<213>Artificial sequence

<400> 27

agcatctggt cgcattgggt caccagcaaa tcgcgctgtt agcgggccca ttaagttctg 60

tctcggcgcg tctgcgtctg gctggctggc ataaatatct cactcgcaat caaattcagc 120

cgatagcgga acgggaaggc gactggagtg ccatgtccgg ttttcaacaa accatgcaaa 180

tgctgaatga gggcatcgtt cccactgcga tgctggttgc caacgatcag atggcgctgg 240

gcgcaatgcg cgccattacc gagtccgggc tgcgcgttgg tgcggatatc tcggtagtgg 300

gatacgacga taccgaagac agctcatgtt atatcccgcc gttaaccacc atcaaacagg 360

attttcgcct gctggggcaa accagcgtgg accgcttgct gcaactctct cagggccagg 420

cggtgaaggg caatcagctg ttgcccgtct cactggtgaa aagaaaaacc accctggcgc 480

ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag ctggcacgac 540

aggtttcccg actggaaagc gggcagtgag cgcaacgcaa ttaatgtgag ttagctcact 600

cattaggcac cccaggcttt acactttatg cttccggctc gtatgttgtg tggaattgtg 660

agcggataac aatttcacac aggaaacagc tcatcggtaa gttattcttg acatctcagg 720

ggggacgtgg tataataact gagtactgtt tctagagatt aaagaggaga aggatccatg 780

tcttattcaa agcatggcat cgtacaagaa atgaagacga aataccatat ggaaggcagt 840

gtcaatggcc atgaatttac gatcgaaggt gtaggaactg ggtaccctta cgaagggaaa 900

cagatgtccg aattagtgat catcaagcct gcgggaaaac cccttccatt ctcctttgac 960

atactgtcat cagtctttca atatggaaac cgttgcttca caaagtaccc ggcagacatg 1020

cctgactatt tcaagcaagc attcccagat ggaatgtcat atgaaaggtc atttctattt 1080

gaggatggag cagttgctac agccagctgg aacattcgtc tcgaaggaaa ttgcttcatc 1140

cacaaatcca tctttcatgg cgtaaacttt cccgctgatg gacccgtaat gaaaaagaag 1200

acaattgact gggataagtc cttcgaaaaa atgactgtgt ctaaagaggt gctaagaggt 1260

gacgtgacta tgtttcttat gctcgaagga ggtggttctc acagatgcca atttcactcc 1320

acttacaaaa cagagaagcc ggtcacactg cccccgaatc atgtcgtaga acatcaaatt 1380

gtgaggaccg accttggcca aagtgcaaaa ggctttacag tcaagctgga agcacatgcc 1440

gcggctcatg ttaacccttt gaaggttaaa atgaccatga ttacggattc actggccgtc 1500

gttttacaac gtcgtgactg ggaaaaccct ggcgttaccc aacttaatcg ccttgcagca 1560

catccccctt tcgccagctg gcgtaatagc gaagaggccc gcaccgatcg cccttcccaa 1620

cagttgcgca gcctgaatgg cgaatggcgc tttgcctggt ttccggcacc agaagcggtg 1680

ccggaaagct ggctggagtg cgatcttcct gaggccgata ctgtcgtcgt cccctcaaac 1740

tggcagatgc acggttacga tgcgcccatc tacaccaacg tgacctatcc cattacggtc 1800

aatccgccgt ttgttcccac ggagaatccg acgggttgtt actcgctcac atttaatgtt 1860

gatgaaagct ggctacagga aggccagacg cgaattattt ttgatggcgt taactcggcg 1920

tttcatctgt ggtgcaacgg gcgctgggtc ggttacggcc aggacagtcg tttgccgtct 1980

gaatttgacc tgagcgcatt tttacgcgcc ggagaaaacc gcctcgcggt gatggtgctg 2040

cgctggagtg acggcagtta tctggaag 2068

<210> 28

<211> 990

<212> DNA

<213>Artificial sequence

<400> 28

agcttgcctg cgtggtatcg aaattgaagc cgatgtggtg ctgaaagcaa ccaaagttga 60

cggcgtgttt accgctgatc cggcgaaaga tccaaccgca accatgtacg agcaactgac 120

ttacagcgaa gtgctggaaa aagagctgaa agtcatggac ctggcggcct tcacgctggc 180

tcgtgaccat aaattaccga ttcgtgtttt caatatgaac aaaccgggtg cgctgcgccg 240

tgtggtaatg ggtgaaaaag aagggacttt aatcacggaa taattcccgt gatggataaa 300

taagggtaag attccgcgta agtatcgcgg gggcgtaagt ctggttataa ggcgttattg 360

ttgcaggcag tttggtcacg gccagcgcgc agcaaccgga gcgtacaaaa gtacgtgagg 420

atggcgagca ctgcccgggg ccaaaatggc aaataaaata gcctaataat ccagacgatt 480

acccgtaata tgtttaatca gggctatact tagcacactt ccactgtgtg tgactgtctg 540

gtctgactga gacaagtttt caaggattcg taacgtgatt agcgatatca gaaaagatgc 600

tgaagtacgc atggacaaat gcgtagaagc gttcaaaacc caaatcagca aaatacgcac 660

gggtcgtgct tctcccagcc tgctggatgg cattgtcgtg gaatattacg gcacgccgac 720

gccgctgcgt cagctggcaa gcgtaacggt agaagattcc cgtacactga aaatcaacgt 780

gtttgatcgt tcaatgtctc cggccgttga aaaagcgatt atggcgtccg atcttggcct 840

gaacccgaac tctgcgggta gcgacatccg tgttccgctg ccgccgctga cggaagaacg 900

tcgtaaagat ctgaccaaaa tcgttcgtgg tgaagcagaa caagcgcgtg ttgcagtacg 960

taacgtgcgt cgtgacgcga acgacaaagt 990

<210> 29

<211> 20

<212> DNA

<213>Artificial sequence

<400> 29

gaccagacag tcacacacag 20

<210> 30

<211> 43

<212> DNA

<213>Artificial sequence

<400> 30

gaccagacag tcacacacag gttttagagc tagaaatagc aag 43

<210> 31

<211> 20

<212> DNA

<213>Artificial sequence

<400> 31

actagtatta tacctaggac 20

<210> 32

<211> 20

<212> DNA

<213>Artificial sequence

<400> 32

agcttgcctg cgtggtatcg 20

<210> 33

<211> 20

<212> DNA

<213>Artificial sequence

<400> 33

cctcacgtac ttttgtacgc 20

<210> 34

<211> 41

<212> DNA

<213>Artificial sequence

<400> 34

gcgtacaaaa gtacgtgagg gacgaaaggg cctcgtgata c 41

<210> 35

<211> 52

<212> DNA

<213>Artificial sequence

<400> 35

catctagtgg gtcctgtctt tttaccaatg cttaatcagt gaggcaccta tc 52

<210> 36

<211> 49

<212> DNA

<213>Artificial sequence

<400> 36

aaagacagga cccactagat ggtgattagc gatatcagaa aagatgctg 49

<210> 37

<211> 20

<212> DNA

<213>Artificial sequence

<400> 37

actttgtcgt tcgcgtcacg 20

<210> 38

<211> 1918

<212> DNA

<213>Artificial sequence

<400> 38

agcttgcctg cgtggtatcg aaattgaagc cgatgtggtg ctgaaagcaa ccaaagttga 60

cggcgtgttt accgctgatc cggcgaaaga tccaaccgca accatgtacg agcaactgac 120

ttacagcgaa gtgctggaaa aagagctgaa agtcatggac ctggcggcct tcacgctggc 180

tcgtgaccat aaattaccga ttcgtgtttt caatatgaac aaaccgggtg cgctgcgccg 240

tgtggtaatg ggtgaaaaag aagggacttt aatcacggaa taattcccgt gatggataaa 300

taagggtaag attccgcgta agtatcgcgg gggcgtaagt ctggttataa ggcgttattg 360

ttgcaggcag tttggtcacg gccagcgcgc agcaaccgga gcgtacaaaa gtacgtgagg 420

gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt 480

cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt 540

tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat 600

aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt 660

ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg 720

ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga 780

tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc 840

tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac 900

actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg 960

gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca 1020

acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg 1080

gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg 1140

acgagcgtga caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg 1200

gcgaactact tactctagct tcccggcaac aattaataga ctggatggag gcggataaag 1260

ttgcaggacc acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg 1320

gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct 1380

cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac 1440

agatcgctga gataggtgcc tcactgatta agcattggta aaaagacagg acccactaga 1500

tggtgattag cgatatcaga aaagatgctg aagtacgcat ggacaaatgc gtagaagcgt 1560

tcaaaaccca aatcagcaaa atacgcacgg gtcgtgcttc tcccagcctg ctggatggca 1620

ttgtcgtgga atattacggc acgccgacgc cgctgcgtca gctggcaagc gtaacggtag 1680

aagattcccg tacactgaaa atcaacgtgt ttgatcgttc aatgtctccg gccgttgaaa 1740

aagcgattat ggcgtccgat cttggcctga acccgaactc tgcgggtagc gacatccgtg 1800

ttccgctgcc gccgctgacg gaagaacgtc gtaaagatct gaccaaaatc gttcgtggtg 1860

aagcagaaca agcgcgtgtt gcagtacgta acgtgcgtcg tgacgcgaac gacaaagt 1918

<210> 39

<211> 18

<212> DNA

<213>Artificial sequence

<400> 39

caccatcatc accaccat 18

<210> 40

<211> 25

<212> DNA

<213>Artificial sequence

<400> 40

cacgttacga atccttgaaa acttg 25

<210> 41

<211> 65

<212> DNA

<213>Artificial sequence

<400> 41

gttttcaagg attcgtaacg tgcaccatca tcaccaccat attagcgata tcagaaaaga 60

tgctg 65

<210> 42

<211> 1008

<212> DNA

<213>Artificial sequence

<400> 42

agcttgcctg cgtggtatcg aaattgaagc cgatgtggtg ctgaaagcaa ccaaagttga 60

cggcgtgttt accgctgatc cggcgaaaga tccaaccgca accatgtacg agcaactgac 120

ttacagcgaa gtgctggaaa aagagctgaa agtcatggac ctggcggcct tcacgctggc 180

tcgtgaccat aaattaccga ttcgtgtttt caatatgaac aaaccgggtg cgctgcgccg 240

tgtggtaatg ggtgaaaaag aagggacttt aatcacggaa taattcccgt gatggataaa 300

taagggtaag attccgcgta agtatcgcgg gggcgtaagt ctggttataa ggcgttattg 360

ttgcaggcag tttggtcacg gccagcgcgc agcaaccgga gcgtacaaaa gtacgtgagg 420

atggcgagca ctgcccgggg ccaaaatggc aaataaaata gcctaataat ccagacgatt 480

acccgtaata tgtttaatca gggctatact tagcacactt ccactgtgtg tgactgtctg 540

gtctgactga gacaagtttt caaggattcg taacgtgcac catcatcacc accatattag 600

cgatatcaga aaagatgctg aagtacgcat ggacaaatgc gtagaagcgt tcaaaaccca 660

aatcagcaaa atacgcacgg gtcgtgcttc tcccagcctg ctggatggca ttgtcgtgga 720

atattacggc acgccgacgc cgctgcgtca gctggcaagc gtaacggtag aagattcccg 780

tacactgaaa atcaacgtgt ttgatcgttc aatgtctccg gccgttgaaa aagcgattat 840

ggcgtccgat cttggcctga acccgaactc tgcgggtagc gacatccgtg ttccgctgcc 900

gccgctgacg gaagaacgtc gtaaagatct gaccaaaatc gttcgtggtg aagcagaaca 960

agcgcgtgtt gcagtacgta acgtgcgtcg tgacgcgaac gacaaagt 1008

<210> 43

<211> 18

<212> DNA

<213>Artificial sequence

<400> 43

aaagacagga cccactag 18

<210> 44

<211> 18

<212> DNA

<213>Artificial sequence

<400> 44

attaccctgt tatcccta 18

<210> 45

<211> 29

<212> DNA

<213>Artificial sequence

<400> 45

cgtaactata acggtcctaa ggtagcgaa 29

Claims (10)

1. a kind of DNA sequence dna edit methods, which is characterized in that the method includes the steps：

The first DNA recombinant fragments are provided, the first DNA recombinant fragments have the first selection markers and the cutting for cleavage The first DNA recombinant fragments are integrated into the one side in DNA sequence dna site to be edited by homologous recombination by site；

2nd DNA recombinant fragments are provided, the 2nd DNA recombinant fragments have in the first DNA recombinant fragments described in The homology arm of cleavage site both sides sequence homology；

Cleavage is integrated into the first DNA recombinant fragments of the DNA sequence dna, forms notch in the cleavage site, passes through The 2nd DNA recombinant fragments are integrated into DNA sequence dna to be edited by homologous recombination, so as to fulfill the DNA sequence dna editor.

2. the method as described in claim 1, which is characterized in that the method includes the steps：

(1) the first recognition site is set in DNA sequence dna to be edited

First recognition site is located on the one side or the site in site to be edited；

(2) the first DNA recombinant fragments are provided

The first DNA recombinant fragments are with the first selection markers, the second recognition site and positioned at first selection markers two The homology arm of side, the homology arm and the sequence homology of the first recognition site both sides；

(3) first time homologous recombination

DNA sequence dna to be edited is cut in first recognition site, is integrated the first DNA recombinant fragments by homologous recombination Enter the one side in site to be edited；

(4) the 2nd DNA recombinant fragments are provided

The 2nd DNA recombinant fragments have the homology arm with the second recognition site both sides sequence homology；

(5) second of homologous recombination

DNA sequence dna is cut in second recognition site, the 2nd DNA recombinant fragments are integrated by homologous recombination and wait to compile It collects in DNA sequence dna, so as to fulfill the DNA sequence dna editor.

3. method as claimed in claim 2, which is characterized in that the 2nd DNA recombinant fragments include alternative sequence, in step Suddenly the site to be edited is replaced with by the alternative sequence by second of homologous recombination in (5).

4. method as claimed in claim 2, which is characterized in that pass through second homologous recombination removal the in the step (5) The exogenous DNA array being integrated into homologous recombination.

5. method as claimed in claim 2, which is characterized in that first recognition site and second recognition site difference Independently selected from：Restriction enzyme site (being preferably I-SceI, I-CeuI such as playback endonuclease restriction enzyme site), CRISPR systems Any one or a few in cleavage site, TALEN cleavage sites, ZFN cleavage sites, Argonaute cleavage sites.

6. method as claimed in claim 2, which is characterized in that first recognition site and second recognition site difference For different CRISPR system cleavage sites.

7. method as claimed in claim 2, which is characterized in that in the step (3), by CRISPR systems described first Recognition site cuts DNA sequence dna to be edited；And/or

In the step (5), DNA sequence dna to be edited is being cut in second recognition site by CRISPR systems.

8. a kind of kit for DNA sequence dna editor, which is characterized in that the kit is for described in perform claim requirement 1 Method.

9. kit as claimed in claim 8, which is characterized in that the kit includes：

(A) the first DNA recombinant fragments

The first DNA recombinant fragments are with the first selection markers, the second recognition site and positioned at first selection markers two The homology arm of side, the homology arm and the sequence homology of the first recognition site both sides；And/or

(B) the 2nd DNA recombinant fragments

The 2nd DNA recombinant fragments have the homology arm with the sequence homology of the second recognition site both sides.

10. kit as claimed in claim 8, which is characterized in that the kit further includes：DNA enzymatic cuts reagent；It is preferred that Ground, the DNA enzymatic are cut reagent and are selected from the group：Endonuclease enzymatic reagent (it is preferably I-SceI such as playback endonuclease enzymatic reagent, I-CeuI), CRISPR-Cas reagents, TALEN reagents, ZFN reagents and Argonaute reagents.