CN108070599A - High efficient expression and its application of the Recombinant Swine interleukin-22 2 in Escherichia coli - Google Patents
High efficient expression and its application of the Recombinant Swine interleukin-22 2 in Escherichia coli Download PDFInfo
- Publication number
- CN108070599A CN108070599A CN201810086942.4A CN201810086942A CN108070599A CN 108070599 A CN108070599 A CN 108070599A CN 201810086942 A CN201810086942 A CN 201810086942A CN 108070599 A CN108070599 A CN 108070599A
- Authority
- CN
- China
- Prior art keywords
- recombinant
- interleukin
- expression
- swine interleukin
- coli
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/54—Interleukins [IL]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/19—Cytokines; Lymphokines; Interferons
- A61K38/20—Interleukins [IL]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Gastroenterology & Hepatology (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Toxicology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a kind of genes for encoding Recombinant Swine interleukin-22 2.Invention additionally discloses the recombinant expression carrier containing the recombination, transgenic cell system, transgenosis recombinant bacterium and host cells.Invention additionally discloses Recombinant Swine interleukin-22 2 and its method for extraction and purification.Invention additionally discloses recombinant plasmid pET 32a（+）PIL 22, recombinant bacterial strain, recombinant protein is in anti-apoptotic and the application of anti-coli-infection.The carrier pET 32a for the expression Recombinant Swine interleukin-22 2 that the present invention is built（+）In containing His labels, 2 albumen of Recombinant Swine interleukin-22 extracted from Escherichia coli is connected with His labels, and highly purified 2 albumen of Recombinant Swine interleukin-22 can be obtained by the pillar of His；2 protein expression yield of Recombinant Swine interleukin-22 passes through Quantity One software statistics, high purity 95.7%.
Description
Technical field
The present invention relates to the Escherichia coli of the interleukin-22 2 of expression pig, belong to biotechnology genetic engineering field；Specific bag
It includes：The structure of plasmid pET-32a (+)-pIL-22 of Recombinant Swine interleukin-22 2 is expressed, the extraction of expression Recombinant Swine interleukin-22 2 is pure
Change and the porcine interleukin 22 of the recombination expression can be in apoptosis that anti-deoxynivalenol (DON) induces and anti-big
Application in Enterobacteriaceae infections.
Background technology
1st, the progress of porcine interleukin 22
Porcine interleukin 22 is one of IL-10 family member, it is mainly by the leaching in the innate immunity and adaptive immunity
Bar system cells system generates, including α β T cells, gamma delta T cells, natural killer cells and naive Tlymphocytes (ILCs), except leaching
Bar tissue is outer, and macrophage, neutrophil leucocyte can also generate interleukin-22 2.Research report IL-22 has different physiological roles, it
The expression of congenital antibiotic (alexin, Reg family molecules, S100 albumen) and mucin (Muc1, Muc3, Muc10 can be induced
And Muc13) secretion, functional barrier is played to intestinal mucosa, meanwhile, IL-22 can with antibacterial defence element, mucosa-immune it is disease-resistant
Poison cell factor IFN- λ synergy, the common tissue barrier for improving IEC, to mitigate the infection of mucosal virus.It is right in recent years
The research of IL-22 is concentrated mainly on people source and mouse source, but the research of pig IL-22 is rarely reported.Can related porcine interleukin 22 lead to
Overactivation STAT3 signals and the research of anti-apoptotic and whether anti-coli-infection is unclear.
2nd, porcine interleukin 22 is anti-deoxynivalenol (DON) is apoptosis-induced and anti-coli-infection effect
Deoxynivalenol (DON) is trichothecene, the secondary metabolite that sickle-like bacteria generates,
It is present in crops and food and feed, causes vomiting, diarrhea, hemorrhage of gastrointestinal tract of animal etc., serious threat animal
Health, and pig is most sensitive animal to DON, and research shows that relatively low concentration (>=50 μ g/kg b.w.) can cause pig
Vomiting, while DON can induce swine intestinal epithelium apoptosis, so as to destroy gut barrier, promote enterovirus, shuttle
The invasion of the pathogenic microorganisms such as bacterium, Escherichia coli.And people source or mouse source interleukin-22 2 confirm that it can induce on people and mouse
Body generates the antibacterial materials such as congenital antibiotic, mucin, so as to repair the damage of chronic colitis and acute intestinal.And pig is white
Whether whether interleukin 22 can resist the apoptosis of deoxynivalenol (DON) induction and anticolibacillary can infect still
It is unclear.
The content of the invention
Goal of the invention：There is provided a kind of bases for encoding Recombinant Swine interleukin-22 2 for the technical problems to be solved by the invention
Cause.
There is provided a kind of bases containing the coding Recombinant Swine interleukin-22 2 for the present invention also technical problems to be solved
Recombinant expression carrier, transgenic cell system or the transgenosis recombinant bacterium of cause.
There is provided gene, the restructuring tables of coding Recombinant Swine interleukin-22 2 for the present invention also technical problems to be solved
Up to the application of carrier, transgenic cell system or transgenosis recombinant bacterium in Recombinant Swine interleukin-22 2 is produced.
Also there is provided a kind of structures of recombinant plasmid pET-32a (+)-pIL-22 for technical problems to be solved by the present invention.
Also there is provided a kind of method for extraction and purification of Recombinant Swine interleukin-22 2 for technical problems to be solved by the present invention.
Technical solution：In order to solve the above technical problem, the present invention provides a kind of bases for encoding Recombinant Swine interleukin-22 2
Cause, base sequence such as SEQ ID NO：Shown in 1.
Present invention further includes the recombinant expression carrier of the gene containing the coding Recombinant Swine interleukin-22 2, turns base
Because of cell system or transgenosis recombinant bacterium.
Wherein, the recombinant expression carrier is that the gene is inserted into coli expression carrier to be contained
There is the expression vector of the gene of Recombinant Swine interleukin-22 2.
Wherein, above-mentioned coli expression carrier is pET-32a (+).
Present invention further includes a kind of transgenosis recombinant bacterium, and the recombinant bacterium is to import the recombinant expression carrier
In Escherichia coli, screening obtains transgenosis recombinant bacterium.
Present invention further includes a kind of host cell, and the host cell is to import the recombinant expression carrier greatly
It is obtained in enterobacteria.
Present invention further includes a kind of recombinant protein, and the recombinant protein is by the transgenosis recombinant bacterium or institute
The host cell expression stated obtains.
The gene of described coding Recombinant Swine interleukin-22 2, the recombinant expression carrier, transgenic cell system turn
Application of the gene recombination bacterium in Recombinant Swine interleukin-22 2 is produced.
Present invention further includes a kind of method for extraction and purification of Recombinant Swine interleukin-22 2, comprises the following steps：
1) acquisition of 2 gene of Recombinant Swine interleukin-22；
2) structure of recombinant plasmid pET-32a (+)-pIL-22；
3) expression of recombination bacillus coli；
4) extraction and purifying of Recombinant Swine interleukin-22 2.
Wherein, 2 gene of Recombinant Swine interleukin-22 be by 22 gene of porcine interleukin carry out codon optimization, and
Gene order both ends add in the homology arm of the pET-32a (+) containing restriction enzyme site Kpn I and Hind III, are obtained by artificial synthesized
；
Wherein, the construction method of recombinant plasmid pET-32a (+)-pIL-22 is as follows：With restriction enzyme Kpn I
With Hind III by pET-32a (+) plasmid linearization, the Recombinant Swine that pET-32a (+) plasmid of linearisation and step 1) are synthesized
2 genetic fragment of interleukin-22 connects, and obtains pET-32a (+)-pIL-22 plasmids.The expression porcine interleukin 22 built in the present invention
It is connected in carrier pET-32a (+) containing His labels, porcine interleukin 22 with His labels, height can be obtained by the pillar of His
The porcine interleukin 22 of purifying.
Wherein, the expression of recombination bacillus coli is as follows：Described recombinant plasmid pET-32a (+)-pIL-22 is imported
Expression in E. coli BL21 (DE3) carries out verification by bacterium colony PCR and obtains positive restructuring Escherichia coli.
Wherein, the step of extraction and purifying of Recombinant Swine interleukin-22 2 is as follows：The recombination bacillus coli for verifying positive is lured
Lead expression and obtain thalline, by thalline add in PBS be resuspended centrifugation, re-suspension liquid carry out ultrasonication, broken obtained bacterium solution from
The heart collects supernatant precipitation and carries out SDS-PAGE verifications, it is found that destination protein largely exists in inclusion body, almost do not have in supernatant
Have, by inclusion body precipitate it is urea-denatured after, then by gradient dialysis renaturation, collect the liquid after renaturation and cross His pillars, purify
To porcine interleukin 22.
Above-mentioned recombinant expression carrier, transgenosis recombinant bacterium, host cell and recombinant protein is in anti-apoptotic and anti-large intestine bar
Application in bacterium infection.
Advantageous effect：Compared with prior art, the present invention have the advantages that following characteristic and：
1st, the present invention is optimized 22 gene order of porcine interleukin using codon-optimization techniques, beneficial to recombination pig
Interleukin-22 2 is more likely to give expression to the recombinant protein close to native conformation.
2nd, this experiment structure plasmid pET-32a (+)-pIL-22 be at present domestic and international first with pET-32a (+) for carry
The plasmid for being capable of high efficient expression porcine interleukin 22 of body.
3rd, the present invention successfully constructs plasmid pET-32a (+)-pIL-22 of expression porcine interleukin 22, and is transformed into large intestine
Bacillus E.coli BL21 (DE3).It can in E. coli BL21 (DE3) by SDS-PAGE verification porcine interleukins 22
With by successful expression, and highly purified porcine interleukin 22 can be obtained by His labels.
4th, the present invention ensures that inclusion body protein is stabilized with soluble status using the dialysis renaturation method of optimization.
5th, the porcine interleukin 22 for the expression of recombinant e. coli that high efficient expression of the present invention obtains can resist deoxynivalenol
Bacterium enol (DON) is apoptosis-induced, while can resist sticking to enterocyte for Escherichia coli ETEC K88, this expression
Porcine interleukin 22 protects body to provide a kind of new approach from the injury of pathogenic microorganism to safeguard gut barrier.
Therefore the application is expected to provide new method and thinking in anti-apoptotic and anti-infective aspect for porcine interleukin 22.
Description of the drawings
Fig. 1：Express plasmid pET-32a (+)-pIL-22 digestion verification electrophoretograms of Recombinant Swine interleukin-22 2；Swimming lane 1：M tables
Show the DNA Marker of 5000bp；Swimming lane 2：Represent plasmid pET-32a (+)-pIL-22；Swimming lane 3：Represent plasmid pET-32a
Product after (+)-pIL-22 digestions (is digested, endonuclease bamhi is distinguished from top to bottom with restriction enzyme Kpn I and Hind III
For：Carrier framework 5847bp and target fragment 477bp)；
Fig. 2：Vector plasmid pET-32a (+)-pIL-22 schematic diagrames of structure；
Fig. 3：It is transferred to recombination bacillus coli E.coli BL21 (DE3) bacterium colony of vector plasmid pET-32a (+)-pIL-22
PCR verifies electrophoretogram；Swimming lane 1：M represents the DNA Marker of 15000bp, swimming lane 2：Negative control, swimming lane：3~10 represent bacterium
Fall the product after PCR (purpose band size 477bp)；
Fig. 4：The SDS-PAGE electrophoresis of Recombinant Swine interleukin-22 2；Swimming lane 1：Albumen Marker；Swimming lane 2：BSA(1μg)；Swimming
Road 3：BSA(2μg)；Swimming lane 4：The cell pyrolysis liquid not induced；Swimming lane 5：Cell pyrolysis liquid in the case where 15 DEG C of 16h are induced；Swimming lane
6：Cell pyrolysis liquid in the case where 37 DEG C of 4h are induced；Swimming lane 7：The cell lysate supernatant not induced；Swimming lane 8：The cell not induced
Crack liquid precipitate；Swimming lane 9：Cell lysate supernatant in the case where 15 DEG C of 16h are induced；Swimming lane 10：Cell in the case where 15 DEG C of 16h are induced
Crack liquid precipitate；Swimming lane 11：Cell lysate supernatant in the case where 37 DEG C of 4h are induced；Swimming lane 12：Cell in the case where 37 DEG C of 4h are induced
Crack liquid precipitate；
Fig. 5：The Western blot figures of Recombinant Swine interleukin-22 2：Swimming lane 1：Western blot Marker；Swimming lane 2：
Cell pyrolysis liquid under 15 DEG C of 16h inductions；Swimming lane 3：Cell pyrolysis liquid in the case where 37 DEG C of 4h are induced；Swimming lane 4：It is lured in 15 DEG C of 16h
Cell lysate supernatant under leading；Swimming lane 5：Cell cracking liquid precipitate in the case where 15 DEG C of 16h are induced；Swimming lane 6：It is induced in 37 DEG C of 4h
Under cell lysate supernatant；Swimming lane 7：Cell cracking liquid precipitate in the case where 37 DEG C of 4h are induced；
Fig. 6：It is transferred to recombination bacillus coli E.coli BL21 (DE3) expression of vector plasmid pET-32a (+)-pIL-22
The SDS-PAGE electrophoresis of the purified product verification of porcine interleukin 22；Swimming lane 1：Recombinant Swine interleukin-22 2 after inclusion body denaturation
(purity 72.73%)；Swimming lane 2：Recombinant Swine interleukin-22 2 (purity 77.65%) after renaturation；Swimming lane 3：) His label Ni column purifications
Porcine interleukin 22 (purity 95.7%) afterwards；Swimming lane 4：Albumen Marker；
Fig. 7：The Recombinant Swine interleukin-22 2 of Western blot detection expression activates STAT3 results on IPEC-J2 cells
Figure and statistical chart；
Fig. 8：The Recombinant Swine interleukin-22 2 of flow cytometer detection expression is in anti-deoxynivalenol (DON) apoptosis-induced knot
Fruit is schemed；
Fig. 9：2 anti-Escherichia coli ETECK88 of colony counting method statistics Recombinant Swine interleukin-22 is to enterocyte adhesion results
Figure；
Figure 10：The Recombinant Swine interleukin-22 2 of real-time fluorescence quantitative PCR detection expression is to the shadow of porcine defensin pBD-1 expression quantity
Ring result figure.
Specific embodiment
Below by specific embodiment and attached drawing, the present invention is further described.In following embodiments method therefor for example without
It illustrates, is conventional method.The material and reagent being specifically related to are as follows：
E. coli BL21 (DE3) competent cell is purchased from Nuo Weizan bio tech ltd；pET-32a
(+) plasmid is purchased from Life Technologies；
Reagent：Agarose Gel DNA Purification Kit, restriction enzyme, reverse transcription reagent box is purchased from treasured
Bioengineering (Dalian) Co., Ltd；Ampicillin flies upward bioengineering Co., Ltd (Omega Bio-Tek generations purchased from Guangzhou
Reason)；II One Step Cloning Kit position clonings kits only praise biotechnology purchased from Nanjing promise to be had
Limit company.
The structure of embodiment 1 recombinant plasmid pET-32a (+)-pIL-22
1st, the acquisition of 2 genetic fragment of Recombinant Swine interleukin-22
With reference to gene order (the GenBank numbers of logging in delivered:KX588234.1 OptimumGene) is usedTMGene is set
Count software, according to the Preference of host e. coli E.coli BL21, remove Escherichia coli rare codon (AGA, GGA,
CCC, CTA), the adjustment to sequence G/C content carries out codon optimization, designs 2 gene order of Recombinant Swine interleukin-22 as SEQ
ID NO:1, then in SEQ ID NO:1 gene order both ends are separately added into the pET- through Kpn I and the linearisation of III enzymes of Hind
The homology arm CAGCCCAGATCTGG of 32a (+) carrierGTACC(SEQ ID NO:And CGAGTGCGGCCGCA 2)AGCTT(SEQ
ID NO:3) sequence is carried out artificial synthesized (Jin Sirui biotechnologies company synthesizes by Nanjing) by (underscore is restriction enzyme site)
Obtain the target fragment of the gene of Recombinant Swine interleukin-22 2.
2nd, the structure of recombinant plasmid pET-32a (+)-pIL-22
With restriction enzyme Kpn I and Hind III by pET-32a (+) plasmid linearization.Reaction condition is I Hes of Kpn
Hind III each 5 μ L, pET-32a (+) plasmid of 2 μ L, 10 × buffer, 5 μ L (1 μ g of total amount), ultra-pure water 36 μ L, 37 DEG C of digestion 2h,
Digestion products are recycled to pET-32a (+) plasmid linearized.By pET-32a (+) plasmid of linearisation with it is artificial synthesized
The segment of 2 gene of Recombinant Swine interleukin-22 according to connection kit (II One Step Cloning Kit are purchased
Buy in Nanjing Vazyme Biotechnology Co., Ltd.) specification is attached, and obtains pET-32a (+)-pIL-22 plasmids, it limits
Property restriction endonuclease Kpn I and III digestion verifications of Hind are correct, as shown in Figure 1.By III digestion products of restriction endonuclease Kpn I and Hind
The obtained sequence of verification is through the BLAST and DNAstar and sequence SEQ ID NO for carrying out codon optimization:1 compares, as a result table
Bright cloned 22 recombination sequence of porcine interleukin and SEQ ID NO:1 sequence is completely the same.Obtained recombinant plasmid pET-
32a (+)-pIL-22, structure diagram are as shown in Figure 2.
Embodiment 2 expresses the verification of 22 recombination bacillus coli E.coli BL21 (DE3) of porcine interleukin
1 μ L (200ng/ μ L) recombinant plasmid pET-32a (+)-pIL-22 is taken to be added to 50 μ L E. colis BL21
(DE3) in chemical conversion competent cell, flick it is several under, can not inhale and blow, in placing 30min on ice.42 DEG C of heat shocks in water-bath
90s adds in 900 μ L SOC culture mediums after being incubated 5min on ice, gently overturns mixing, is put into 37 DEG C of constant incubators and recovers
The bacterium solution of recovery is positioned in 37 DEG C of shaking tables, 150rpm by 10min, cultivates 40min, takes out bacterium solution, 5000rpm, centrifugation
5min, supernatant discarding take 100 μ L bacterium solutions to be coated on ammonia benzyl chloramphenicol resistance total amount of binder culture medium LB tablets, the visible sun of 12-16h
Property bacterium colony.Picking colony is verified that such as Fig. 3,2-9 are the bacterium colony for carrying out PCR verifications, and the results show is the positive, and 1 is feminine gender
Control, the primer of PCR verifications are as follows：
P1：CCCAGATCTGGGTACCATGGTCCCG(SEQ ID NO:4)
P2：CGCCTTTAATACGACATTGGGACAGTT(SEQ ID NO:5)
More than primer is synthesized by Nanjing Jin Sirui biotechnologies company.
The extraction and purifying of the Recombinant Swine interleukin-22 2 of 3 recombination bacillus coli E.coli BL21 (DE3) of embodiment expression
The positive bacterium colony for the recombination bacillus coli E.coli BL21 (DE3) that picking embodiment 2 obtains, mould containing ammonia benzyl
It is incubated overnight in the LB culture mediums of plain (50 μ g/mL).By the bacterium solution being incubated overnight with 1:100 ratio is inoculated in new LB cultures
It is cultivated in base, when bacterium solution OD values reach 0.5, adds in the table of 22 albumen of porcine interleukin in IPTG induction recombination bacillus colis
It reaches, in two kinds of conditions of 15 DEG C of Fiber differentiation 16h and 37 DEG C of Fiber differentiation 4h.8000rpm, 10min, thalline were collected by centrifugation.It adds in
The thalline that PBS resuspensions are collected by centrifugation, re-suspension liquid carry out ultrasonication.After broken, 14000rpm, 30min, centrifugation.In collection
Cleer and peaceful precipitation carries out SDS-PAGE and Western blot verifications, the results showed that and destination protein largely exists in inclusion body, on
In clear almost without, will collection inclusion body be denatured after pass through dialysis renaturation (dialysis renaturation liquid again：50mM Tris-HCl、
300mM NaCl, 0.5%TritonX-100,0.5M arginine, 3mM reduced glutathiones, 0.6mM oxidizeds form of glutathione,
20mM imidazoles, various concentration urea), denaturation destination protein urea containing 8M, 6M urea, 4M urea, 2M urea, 1M urea,
Gradient is dialysed in 0.5M urea, PBS, is finally existed with the state that can melt, then the liquid that dialysis renaturation is collected crosses His pillars, pure
Change extraction and obtain Recombinant Swine interleukin-22 2.The protein concentration of porcine interleukin 22 is measured by BCA methods, the albumen obtained after purification is dense
It spends for 8mg/ml, is computed, the total amount that 100ml bacterium solutions inducible expression is simultaneously purified into porcine interleukin 22 is 5mg.Through SDS-PAGE
Electrophoresis verifying purpose albumen porcine interleukin 22 exists, as shown in fig. 6, swimming lane 1 is to have converted pET-32a (+)-pIL-22 plasmids
E. coli BL21 (DE3) thalline inclusion body precipitates；Swimming lane 2 is that the pig of progress renaturation after inclusion body is denatured is situated between in vain
Element 22；Swimming lane 3 is the porcine interleukin 22 that Ni column purifications finally obtain, after purification 22 molecular weight of porcine interleukin with His labels
It is consistent with SDS-PAGE and Western blot results for 35.6kd, by Quantity One software gray analysis, after purification
22 high purity 95.7% of porcine interleukin.
Embodiment 4Western blot detect the STAT3 phosphorylations after Recombinant Swine interleukin-22 2 acts on IPEC cells for 24 hours
It is horizontal
The preferable IPEC-J2 cells of the state of having recovered (buying in Guangzhou Ji Niou bio tech ltd) are spread respectively
Into 6 porocyte culture plates, 2.5 × 106/ hole.Blank control group：Add the PBS (0.01M, PH=7.2) of 2 μ l per hole；Pig is situated between in vain
Plain 22 processing groups：One group adds the porcine interleukin 22 (10ng/ml) that 2 μ l embodiments 3 purify, and another group adds what 2 μ l embodiments 3 purified
Porcine interleukin 22 (100ng/ml)；Porcine interleukin 22 is with IPEC-J2 cells in 37 DEG C of 5%CO2Incubator act on and for 24 hours after, abandon
Supernatant is removed, PBS is added to wash 3 times, adds 200 μ l protein lysates (protein lysate RIPA per hole：Protease inhibitors PMSF=100：
1) albumen sample is collected, 5xSDS-buffer albumen 100 DEG C of heat denatured 10min of buffer solution is added in, then passes through Western
Blot results can be seen that compared with blank control group, and 22 processing group of porcine interleukin is 10ng/ml and 100ng/ml in concentration
When, effect IPEC-J2 cells can be such that STAT3 phosphorylation levels substantially increase for 24 hours, and the STAT3 phosphorylations in 100ng/ml
Higher level.(referring to Fig. 7).
Embodiment 5：The porcine interleukin 22 of flow cytometer detection expression is apoptosis-induced in anti-deoxynivalenol (DON)
The preferable IPEC-J2 cells of the state of having recovered (buying in Guangzhou Ji Niou bio tech ltd) are spread respectively
Into 6 porocyte culture plates, 2.5 × 106A/hole.Blank control group：10 μ L 0.5%DMSO are added in per hole；DON processing groups：
Add the deoxynivalenol (25 μM) of 10 μ l per hole；IL-22 processing groups：Add in the porcine interleukin of 2 μ l embodiments 3 purifying
22(100ng/ml)；After 37 DEG C of 5%CO2 incubators effects for 24 hours, 2 μ lPBS (0.01M, PH=are added in blank control group
7.2), added in DON processing groups 2 μ l embodiments 3 purifying porcine interleukin 22 (100ng/ml) continue effect (IL-22 is repaiied for 24 hours
Multiple group) after, cell conditioned medium is collected respectively, and 200 μ l/ holes is added to be free of 0.25% pancreatin (the limited public affairs of Vicente biotechnology of EDTA
Department, article No. 325-040-EL) cell is digested after discard pancreatin, with the PBS cleaning cell 1 time of 0.01M PH7.2, will receive
The cell 1300rpm together of the supernatant digestion of collection, centrifuges 10min, (biotechnology is only praised in Nanjing promise to be had according to apoptosis kit
Limit company, article No. A211-01) specification operated.It adds in 1mlBinding buffer and cleaning 1 time is carried out to cell,
1300rpm centrifuges 10min, abandons cell conditioned medium, 100 μ lBinding buffer are added in cell precipitation, resuspension is flicked with finger
Cell.10 μ l Annexin V-FITC are added in, after gently blowing and beating mixing, after 37 DEG C are protected from light effect 15min, use Binding
Buffer is cleaned 1-2 times, adds in 500 μ lBinding buffer and cell is resuspended, be finally measured with flow cytometer, before survey
Add in 5 μ l nucleic acid dye propidium iodides PI.The experimental results showed that：Apoptotic cell quantity counts, blank control group 18.6%,
IL-22 processing group is 17.11%, and deoxynivalenol (DON) processing group is that 66.9, IL-22 reparations group is 39.5%
With deoxynivalenol) sickle-like bacteria enol (DON) induction apoptosis (Fig. 8).
Embodiment 6：2 anti-Escherichia coli ETEC K88 of Recombinant Swine interleukin-22 enterocyte is sticked in effect
The preferable IPEC-J2 cells of the state of having recovered are taped against respectively in 12 porocyte culture plates, treat every hole cell fusion
Rate is rinsed 2 times with the PBS of ImL sterilizings up to 90% or so, adds in the minimal medium that 2mL is free of antibiotic, blank control group：
The PBS of 2 μ l is added in per hole；3 processing groups：Concentration is separately added into for the pig that 10ng/ml and 100ng/ml embodiments 3 purify in vain to be situated between
22 each 2 μ l effects 12h of element, is then separately added into 10 in blank control group and experimental group8CFU Escherichia coli ETECK88 (Jiangsu
Province academy of agricultural sciences animal doctor is presented) it is put into cell incubator and is incubated 2.5h jointly, three multiple holes (obtain 3 processing groups：Respectively
ETECK88 groups, 10ng/mlIL-22+ETECK88 groups, 100ng/mlIL-22+ETECK88 groups)；Then each processing group cell is used
Culture medium rinsing time 3 times, 0.5%TritonX-100200 μ l is placed on cell incubator and is incubated 8min with cell lysis；Add in nothing
250 μ l of bacterium distilled water repeatedly suction out sample suspension after blowing and beating repeatedly, by 10-7With 10-6Agar plate is coated with after doubling dilution to put
Culture 18 in 37 DEG C of constant-temperature bacterial culture boxes~count clump count afterwards for 24 hours.The experimental results showed that：Porcine interleukin 22 is in 10ng/ml
Adherency of the Escherichia coli to enterocyte can be effectively reduced with 100ng/ml.(**P<0.01) (referring to Fig. 9)
Embodiment 7：Real-time fluorescence quantitative PCR Detection and Extraction Recombinant Swine interleukin-22 2 can improve the expression quantity of porcine defensin
The preferable IPEC-J2 cells of the state of having recovered are taped against respectively in 6 porocyte culture plates, treat every hole cell confluency
Up to 90% or so, 2.5 × 106A/hole is rinsed 2 times with the PBS of 1mL sterilizings, adds in the minimal medium that 2mL is free of antibiotic；
Blank control group：2 μ lPBS are added in per hole；Processing group：IL-22 processing group adds in what the purifying of 2 μ l 100ng/ml embodiments 3 obtained
Porcine interleukin 22 acts on 12h, and Escherichia coli ETEC K88 (academy of agricultural sciences of Jiangsu Province animal doctor is presented) groups add in 2 μ lPBS；After 12h
2.5 × 10 are added in Escherichia coli ETEC K88 groups and IL-22 processing group8CFU ETECK88 are put into cell incubator jointly
It is incubated 2.5h and respectively obtains Escherichia coli ETEC K88 groups and IL-22+ETEC K88 groups, then each processing group cell culture medium
3 times after rinsing time, the RNA of 1mlRNA extraction agents TRIzol extraction different disposal groups is added in per hole, cDNA is obtained after reverse transcription
Again by real-time fluorescence quantitative PCR, real-time fluorescence quantitative PCR reaction system is 20 μ L, and reaction system is as follows：SYBR 10μl、
0.4 μ l of Rox-I, cDNA 2 μ l, sense primer P3 (SEQ ID NO:6) 0.4 μ l, anti-sense primer P4 (SEQ ID NO:7)0.4μ
6.8 μ l of l and water.(real-time fluorescence quantitative PCR kit be Nanjing Vazyme Biotechnology Co., Ltd., article No.：Q111-02),
PCR reaction conditions：95 DEG C of pre-degenerations 5min, 95 DEG C of 10sec, 60 DEG C of 30sec, 30 Xun Huans, 95 DEG C of 10sec, 60 DEG C of 1min, 95
DEG C 15sec quantitatively detects the relative expression quantity of porcine defensin pBD-1 in each processing group.The experimental results showed that with blank control group
It compares, Recombinant Swine interleukin-22 2 can raise the expression of pBD-1, while Recombinant Swine interleukin-22 2 can improve Escherichia coli ETEC
Downwards of the K88 to pBD-1.(**P<0.01, * P<0.5) (referring to Figure 10)
The embodiment that the present invention selects is above are only, there is no need and unable to be illustrated to all embodiments.For
For those of ordinary skill in the art, without departing from the principle of the present invention, it can also make other various forms of
Variation changes, these should also be belonged to the scope of protection of the present invention.
Sequence table
<110>Agricultural University Of Nanjing
<120>High efficient expression and its application of the Recombinant Swine interleukin-22 2 in Escherichia coli
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 477
<212> DNA
<213>Recombinant Swine interleukin-22 2 (Artificial Sequence)
<400> 1
atggtcccga ttacgcatca ctgcaaactg gatcagagca atttccaaca accgtatatt 60
accaaccgta cctttacgct ggcgcaggaa gcctcactgg cagataacaa tacggacgtt 120
cgcctgatcg gcaacaacct gtttcagggt gtcaatcaaa tgcgtgaacg ctgctatctg 180
gtgaaacagg ttctgaactt caccctggaa gaagtgctgt ttccgaattc ggatcgtttc 240
catccgtaca tgcaggaagt tgcgagtttt ctggacagcc tgtctaaaaa actgtcccaa 300
tgtcgtatta aaggcgatga ccagcacatc caacgcaacg tcaacaattt caaagatacg 360
gtgaaaaaac tgggcgaatc tggtgaaatt aaagtcatcg gtgaactgta cctgctgttt 420
atggctctga aaaatgaatg tacgctgccg ggtcactcgt ggaaaatgga caattaa 477
<210> 2
<211> 19
<212> DNA
<213>Upstream homology arm (Artificial Sequence)
<400> 2
cagcccagat ctgggtacc 19
<210> 3
<211> 19
<212> DNA
<213>Downstream homology arm (Artificial Sequence)
<400> 3
cgagtgcggc cgcaagctt 19
<210> 4
<211> 25
<212> DNA
<213>The primer P1 (Artificial Sequence) of PCR verifications
<400> 4
cccagatctg ggtaccatgg tcccg 25
<210> 5
<211> 27
<212> DNA
<213>The primer P2 (Artificial Sequence) of PCR verifications
<400> 5
cgcctttaat acgacattgg gacagtt 27
<210> 6
<211> 20
<212> DNA
<213>The sense primer P3 (Artificial Sequence) of pBD-1
<400> 6
ctcctccttg tattcctcct 20
<210> 7
<211> 18
<212> DNA
<213>The anti-sense primer P4 (Artificial Sequence) of pBD-1
<400> 7
ggtgccgatc tgtttcat 18
Claims (10)
- A kind of 1. gene for encoding Recombinant Swine interleukin-22 2, which is characterized in that its base sequence such as SEQ ID NO：Shown in 1.
- 2. recombinant expression carrier, the transgenic cell line of the gene containing coding Recombinant Swine interleukin-22 2 described in claim 1 System or transgenosis recombinant bacterium.
- 3. recombinant expression carrier according to claim 2, which is characterized in that be inserted into gene described in claim 1 The expression vector of the gene containing Recombinant Swine interleukin-22 2 is obtained in coli expression carrier.
- 4. recombinant expression carrier according to claim 3, which is characterized in that the coli expression carrier is pET- 32a（+）.
- 5. a kind of transgenosis recombinant bacterium, which is characterized in that the recombinant bacterium is to carry the recombination expression described in claim 3 or 4 Body is imported in Escherichia coli, and screening obtains transgenosis recombinant bacterium.
- 6. a kind of host cell, the host cell is that the recombinant expression carrier described in claim 3 or 4 is imported Escherichia coli In obtain.
- 7. a kind of recombinant protein, which is characterized in that the recombinant protein be by the transgenosis recombinant bacterium described in claim 5 or Host cell expression described in claim 6 obtains.
- 8. the gene described in claim 1 for encoding Recombinant Swine interleukin-22 2, the recombinant expression carrier described in claim 2 turn The application of gene cell system or transgenosis recombinant bacterium in Recombinant Swine interleukin-22 2 is produced.
- 9. a kind of method for extraction and purification of Recombinant Swine interleukin-22 2, which is characterized in that comprise the following steps：1）The acquisition of 2 gene of Recombinant Swine interleukin-22；2）Recombinant plasmid pET-32a（+）The structure of-pIL-22；3）The expression of recombination bacillus coli；4）The extraction and purifying of Recombinant Swine interleukin-22 2.
- 10. the transgenosis recombinant bacterium described in recombinant expression carrier, claim 5, claim 6 institute described in claim 3 or 4 The host cell stated, application of the recombinant protein in anti-apoptotic and anti-coli-infection described in claim 7.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810086942.4A CN108070599B (en) | 2018-01-30 | 2018-01-30 | High-efficiency expression of recombinant porcine interleukin 22 in escherichia coli and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810086942.4A CN108070599B (en) | 2018-01-30 | 2018-01-30 | High-efficiency expression of recombinant porcine interleukin 22 in escherichia coli and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108070599A true CN108070599A (en) | 2018-05-25 |
| CN108070599B CN108070599B (en) | 2021-07-02 |
Family
ID=62156927
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810086942.4A Active CN108070599B (en) | 2018-01-30 | 2018-01-30 | High-efficiency expression of recombinant porcine interleukin 22 in escherichia coli and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108070599B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108866145A (en) * | 2018-06-01 | 2018-11-23 | 河南德邻生物制品有限公司 | Saccharomyces cerevisiae and DON interaction reduce detecting step and its application of IPEC-J2 Apoptosis |
| CN110746501A (en) * | 2019-11-11 | 2020-02-04 | 南京农业大学 | Application of porcine interleukin 11 in resisting porcine epidemic diarrhea virus infection |
| CN111346218A (en) * | 2018-12-24 | 2020-06-30 | 四川华德生物工程有限公司 | Application of recombinant porcine interleukin 22 in preparation of medicament for improving production performance of pigs |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030100076A1 (en) * | 2000-05-22 | 2003-05-29 | Genentech, Inc. | Interleukin-22 polypeptides, nucleic acids encoding the same and methods for the treatment of pancreatic disorders |
| CN103182072A (en) * | 2011-12-27 | 2013-07-03 | 健能隆医药技术（上海）有限公司 | Application of interleukin-22 in treating and preventing nerve injuries and neurodegeneration diseases |
| CN106146668A (en) * | 2015-04-01 | 2016-11-23 | 中国人民解放军第二军医大学 | The preparation method and its usage of long-acting interleukin II 2 |
| AU2016259423A1 (en) * | 2007-11-07 | 2016-12-08 | Genentech, Inc. | Compositions and methods for treatment of microbial disorders |
-
2018
- 2018-01-30 CN CN201810086942.4A patent/CN108070599B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030100076A1 (en) * | 2000-05-22 | 2003-05-29 | Genentech, Inc. | Interleukin-22 polypeptides, nucleic acids encoding the same and methods for the treatment of pancreatic disorders |
| AU2016259423A1 (en) * | 2007-11-07 | 2016-12-08 | Genentech, Inc. | Compositions and methods for treatment of microbial disorders |
| CN103182072A (en) * | 2011-12-27 | 2013-07-03 | 健能隆医药技术（上海）有限公司 | Application of interleukin-22 in treating and preventing nerve injuries and neurodegeneration diseases |
| CN106146668A (en) * | 2015-04-01 | 2016-11-23 | 中国人民解放军第二军医大学 | The preparation method and its usage of long-acting interleukin II 2 |
Non-Patent Citations (5)
| Title |
|---|
| CAI,H等: "Sus scrofa domesticus breed Landrace interleukin 22 mRNA, complete cds", 《GENBANK》 * |
| HEIKO MÜHL等: "IL-22 in tissue-protective therapy", 《BRITISH JOURNAL OF PHARMACOLOGY》 * |
| 小荷: "大肠杆菌偏爱密码子", 《HTTPS://WWW.DOC88.COM/P-1856889423160.HTML》 * |
| 应兰等: "猪IL-22的原核表达及其活性研究 ", 《中国预防兽医学报》 * |
| 肖安吉: "猪白细胞介素22的克隆及其表达研究", 《中国优秀硕士学位论文全文数据库农业科技版（电子期刊）》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108866145A (en) * | 2018-06-01 | 2018-11-23 | 河南德邻生物制品有限公司 | Saccharomyces cerevisiae and DON interaction reduce detecting step and its application of IPEC-J2 Apoptosis |
| CN108866145B (en) * | 2018-06-01 | 2022-03-08 | 河南德邻生物制品有限公司 | Detection step for reducing IPEC-J2 cell apoptosis by saccharomyces cerevisiae and DON interaction and application thereof |
| CN111346218A (en) * | 2018-12-24 | 2020-06-30 | 四川华德生物工程有限公司 | Application of recombinant porcine interleukin 22 in preparation of medicament for improving production performance of pigs |
| CN110746501A (en) * | 2019-11-11 | 2020-02-04 | 南京农业大学 | Application of porcine interleukin 11 in resisting porcine epidemic diarrhea virus infection |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108070599B (en) | 2021-07-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108070599A (en) | High efficient expression and its application of the Recombinant Swine interleukin-22 2 in Escherichia coli | |
| CN106282216B (en) | A kind of preparation method of recombinant long-acting chicken interferon α | |
| US6855683B1 (en) | Hypersensitive response elicitor from Erwinia amylovora, its use, and encoding gene | |
| CN105200028B (en) | Endolysin and its application from vibrio parahaemolyticus phage | |
| CN106497897A (en) | A kind of engineered strain construction method for improving Heparinase I activity | |
| CN108660148A (en) | A kind of method and its application for expressing external source drug based on genetic modification probiotics | |
| CN102250255A (en) | Genetic engineering protein TAT-VP28-GH capable of resisting white spot syndrome virus (WSSV) as well as preparation and application thereof | |
| CN105237630A (en) | Pesticin and phage lysozyme fusion protein and encoding gene and application thereof | |
| CN100485036C (en) | Fennero penaeus chinensis antibacterial protein gene and recombinant expression and use | |
| CN102586286B (en) | Expression system of bacillus thur ingiens (Bt) insecticidal protein Cry1Ac-a | |
| CN101280021B (en) | Engineered protein VP28-C against shrimp white spot syndrome virus, preparation and use thereof | |
| CN107474142A (en) | Promote polypeptide and its relevant biological material and the application of destination protein secretion | |
| CN102492714A (en) | Method for preparing recombinant Chinese rural dog interferon-alpha | |
| CN108864292A (en) | A kind of interferon recombination fusion albumen and its application | |
| CN103387992A (en) | Gene for coding recombinant porcine beta-defensin-1 and preparation method of porcine beta-defensin-1 | |
| WO2023159887A1 (en) | METHOD FOR PREPARING PIFN-δ5 AND USE OF PIFN-δ5 | |
| CN101319223A (en) | Calcitonin-gene-related peptide and trout calcitonin amalgamation polypeptide transgenic sequence, and transgenic engineering bacterial strain | |
| CN104277114B (en) | A kind of new fusion protein and the legionella pneumophilia vaccine with its preparation | |
| CN101525629A (en) | Gene engineering preparation method of bioactive peptide containing human alpha defensin 5 | |
| CN102181472B (en) | Fungus expression vector and construction and screening method thereof | |
| CN106222178A (en) | A kind of recombinant interferon λ 4 coded cDNA sequence and its preparation method and application | |
| CN108130320A (en) | Verticillium dahliae pathogenesis related protein and its encoding gene, application and mutant | |
| CN107475277A (en) | Fusion protein DAMP4 LfcinB, recombinant vector, recombinant bacterial strain and preparation method thereof | |
| CN101798573B (en) | Totally-gene-synthesized dog alpha interferon gene and protein expression | |
| CN102344900A (en) | Engineering bacterium for expressing antihypertensive peptide and method for preparing antihypertensive peptide |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |