CN105200028B - Endolysin and its application from vibrio parahaemolyticus phage - Google Patents
Endolysin and its application from vibrio parahaemolyticus phage Download PDFInfo
- Publication number
- CN105200028B CN105200028B CN201510448177.2A CN201510448177A CN105200028B CN 105200028 B CN105200028 B CN 105200028B CN 201510448177 A CN201510448177 A CN 201510448177A CN 105200028 B CN105200028 B CN 105200028B
- Authority
- CN
- China
- Prior art keywords
- endolysin
- vibrio
- qdvp001
- vibrio parahaemolyticus
- vibrio parahaemolytious
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/51—Lyases (4)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Veterinary Medicine (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Virology (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Gastroenterology & Hepatology (AREA)
- Molecular Biology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to biotechnologies, and in particular to a kind of endolysin and its application from vibrio parahaemolyticus phage.A kind of endolysin from vibrio parahaemolyticus phage, amino acid sequence are SEQ ID No：All or part of amino acid sequence shown in 1.By Sequence structure analysis, show that the enzyme for the lyases that can crack bacteria cell wall in bacteriophage, is experimentally verified that, the albumen which forms has preferable bactericidal activity.The endolysin of the present invention is expressed, after purification by existing suitable expression vector in the market, shows significant bactericidal effect to vibrio parahaemolytious in vitro, the preparation available for vibrio parahaemolytious bacteriostatic agent.
Description
Technical field
The invention belongs to biotechnologies, and in particular to a kind of endolysin from vibrio parahaemolyticus phage and its
Using.
Background technology
Vibrio parahemolyticus is the polymorphic bacillus of Gram-negative or slightly bent vibrios, is two level harmful microorganism, is subordinate to
Vibrio in vibrionaceae, it is a kind of infecting both domestic animals and human germ, is widely present in inshore seawater, bottom sediment and fish
Among the marine products such as class, shellfish.With a large amount of of antibiotic and it is used for a long time, in food and environment, the drug resistance that is on the rise
Can type vibrio parahaemolytious have influenced the treatment of human infection's vibrio parahaemolytious disease, work out novel biological bacteriostatic agent to replace
It is the challenge that current scientific research personnel faces for chemobiotic.
Bacteriophage endolysin is a kind of lyases that can crack bacteria cell wall.Although in nineteen fifty-seven bacteriophage endolysin
The ability of cracking bacterium is just reported, but for the first time until the recombination endolysin for just confirming to purify such as Nelson in 2001 can conduct
Antiseptic effectively controls rat infection A races streptococcus.Up to the present, endolysin has been used to prevention and control and has detected the food in food
Borne pathogen such as staphylococcus aureus, Listeria and clostridium.With using small molecule antibiotic for antibacterial
Treatment or prevention are compared, and the endolysin of specificity does not easily lead to the quick appearance of resistant strain.In bacterial drug resistance getting worse
It is present, especially in market, the demand to antibacterial agent unprecedentedly improves, and endolysin is not easy to produce resistance and cracks specificity
Feature makes it have certain advantage as antibacterial agent.
Although there has been certain progress in the country using the work of technique for gene engineering structure endolysin production bacterial strain,
The problem of being important present in research and production process is that it is thin that most of endolysin of preparation all concentrates on Gram-positive
The prevention and detection of bacterium, it is still less for the prevention and control research of gramnegative bacterium especially vibrio parahaemolytious.So for pair
The problem of drug resistance of hemolysis vibrion is on the rise and related endolysin lacks, the present invention, which develops, can efficiently crack secondary haemolysis
The endolysin of vibrios or endolysin gene.
Invention content
The present invention provides a kind of endolysin with notable fungistatic effect from vibrio parahaemolyticus phage.
The present invention also provides application of the endolysin in bacteriostatic agent is prepared.
The technical solution adopted by the present invention to solve the technical problems is：
A kind of bacteriophage with environment disinfected ability, the phage monomer are vibrio parahaemolyticus phage, and Latin is entitled
Vibrio parahaemolyticus phage, are named as qdvp001, deposit number：CCTCC NO：M2011143, preservation
Date is on April 26th, 2011.Vibrio parahaemolyticus phage qdvp001 is virulent phage, has cracking vibrio parahaemolytious
Function.
The bacteriophage has strong splitting action to vibrio parahaemolytious, is killed for industrialized production bacteriophage and for sterilizing
Bacterium provides bacteriophage source.
A kind of endolysin from above-mentioned vibrio parahaemolyticus phage, amino acid sequence are SEQ ID No：Shown in 1
All or part of amino acid sequence.By Sequence structure analysis, show the enzyme for bacterial cell can be cracked in bacteriophage
The lyases of wall, is experimentally verified that, the albumen which forms has preferable bactericidal activity.
The gene of the coding endolysin, the nucleotide sequence such as SEQ ID No of the gene：Shown in 2.
Expression vector, engineering bacteria or cell line containing the gene.
The procaryotic cell expression carrier is pET-30a (+).
The engineering bacteria is Escherichia coli Rosseta (DE3).
A kind of application of endolysin in bacteriostatic agent is prepared.Vibrio parahaemolytious is disclosed there has been no document at present to bite
Thalline qdvp001 can generate the lyases of cracking vibrio parahaemolytious cell wall, and the endolysin of the present invention has the function of this, right
Vibrio parahaemolytious has effective bactericidal activity.
The beneficial effects of the invention are as follows：The endolysin of the present invention is expressed by existing suitable expression vector in the market, is pure
After change, significant bactericidal effect is shown to vibrio parahaemolytious in vitro, the preparation available for vibrio parahaemolytious bacteriostatic agent.
Description of the drawings
Fig. 1 carries out structure domain analysis prognostic chart for endolysin albumen；
Fig. 2 is endolysin albumen in E. coli collection of illustrative plates, and M marker, 1 is thin to be induced without IPTG
Bacterium total protein, 2,3,4,5 cross the eluent collected during column, and 6 be the fusion protein after ni-sepharose purification, and 7 is de- to be concentrated by ultrafiltration
Fusion protein after salt, 8 be the total bacterial protein by induction；
The light absorption value that Fig. 3 is endolysin protein cleavage vibrio parahaemolytious ATCC17802 changes collection of illustrative plates；
The turbidity that Fig. 4 is endolysin protein cleavage vibrio parahaemolytious ATCC17802 changes collection of illustrative plates.
Specific embodiment
Below by specific embodiment, technical scheme of the present invention is described in further detail.It should be appreciated that this hair
Bright implementation is not limited to the following examples, and the accommodation in any form made to the present invention and/or changed will all be fallen
Enter the scope of the present invention.
In the present invention, if not refering in particular to, all parts, percentage are unit of weight, used equipment and raw material etc.
It is commercially available or commonly used in the art.Method in following embodiments is the normal of this field unless otherwise instructed
Rule method.
The bacterial strain that present invention experiment is related to：Vibrio parahaemolytious VP17802 (preserving number ATCC17802), buys in the U.S.
ATCC centers, vibrio parahaemolytious VIB304, vibrio parahaemolytious VIB461, vibrio parahaemolytious VIB800 and vibrio parahaemolytious VPl4-
90th, VP1.2, VP2.1, VP3.2, VP4.1 are maintained in Chinese Marine University's food security laboratory.
Vibrio parahaemolyticus phage of the present invention, the bacteriophage qdvp001 are stored in China typical culture collection
Center, address：Wuhan, China, Wuhan University, deposit number：CCTCC NO：M2011143, preservation date are April 26 in 2011
Day, taxology name：Vibrio parahaemolyticus phage qdvp001 (Vibrio parahaemolyticus phage qdvp001).
2216E culture mediums, Qingdao Hai Bo biotechnologys Co., Ltd；
LB fluid nutrient mediums, Beijing Luqiao Technology Co., Ltd.；
Plasmid pET 30a and Escherichia coli Rosetta (DE3), Beijing health are ShiJi Co., Ltd；
Ni Sepharose TM6Fast Flow fillers, GE companies of the U.S.；
Isopropyl-β-D-thiogalactoside (IPTG), Beijing Suo Laibao Science and Technology Ltd.
Embodiment 1：Endolysin protein function prediction
The present inventor isolates the virulent phage qdvp001 of one plant of vibrio parahaemolytious from sewage.It is surveyed through full-length genome
Sequence and analysis, identify the bacteriophage ORF60 coding albumen on amino acid sequence with Vibriophage ICP1 substrates and tail portion
Hydrolase has 56% similarity.Structural domain prediction is carried out to the albumen Lys qdvp001 that ORF60 is encoded using SMART softwares
Analysis.Structural domain prediction result is as shown in Figure 1, the 9-65 amino acid section of Lys qdvp001 for highly conserved functional area, belongs to
In PG_binding (PF01471) domain, which is combined related with whole cell peptidoglycan.The 123-216 amino of Lys qdvp001
Sour section is highly conserved functional area, belongs to CHAP families (PF05257), the family and prokaryotic cell whole cell peptidoglycan
It hydrolyzes related.
Embodiment 2：High efficient expression of the endolysin in Escherichia coli
1st, the structure of recombinant plasmid
According to endolysin gene order (SEQ ID No：2) primer, sense primer, are designed：
CGGGATCCATGACTTTAATTCGTAAGGGTAGTCG(SEQ ID No：3), downstream primer：
CCGCTCGAGTTAAGCTTCGTTATTACTAGTTACATCTGA(SEQ ID No：4) limit, is set separately at upstream and downstream primer end
Property restriction endonuclease BamH I and Xho I processed.Endolysin gene magnification is carried out using PCR, 25 μ L PCR recovery products are cloned into pET-
Between the multiple cloning sites BamH I of 30a carriers and Xho I, recombinant plasmid is obtained, is converted into Escherichia coli Rosetta (DE3).
37 DEG C of shaken cultivation 5h in picking monoclonal to LB fluid nutrient mediums send to Shanghai life work and are sequenced.Sequencing result shows matter
There is SEQ ID No in grain：The albumen of the gene expression is named as Lys qdvp001, the base by the nucleotide sequence shown in 2
Because encoding SEQ ID No：Amino acid residue sequence shown in 1.It will identify that correct recombinant plasmid is named as pET-30a-Lys
qdvp001。
2nd, the preparation of recombinant protein
Recombinant plasmid is named as pET-30a-Lys qdvp001 conversion Escherichia coli Rosetta (DE3), and screening obtains can
The engineering bacteria Rosetta (Lysqdvp001) of endolysin is expressed, inoculation single bacterium falls within 5mL LB fluid nutrient mediums (containing 50 μ g/mL
Kanamycins) in, 37 DEG C, 150r/min, overnight shaking culture, next day, according to 1:Bacterium solution is added to fresh by 50 ratio
In 300mL LB fluid nutrient mediums (containing 50 μ g/mL kanamycins), 37 DEG C of cultures to OD600nm0.6 or so, IPTG is added in (to end
A concentration of 1mmol/L), carry out induced expression under the conditions of 37 DEG C, after 150r/min shaken cultivations 4h, 3381g, under the conditions of 4 DEG C
It centrifuges 15min and obtains cell.Cell precipitation obtained by 300mL bacterium solutions is suspended from 30mL buffer solutions (20mmol/L pH
8.0NaH2PO3, NaCl containing 500mmol/L), it after abundant mixing, is crushed with sonicator, centrifugation removal is insoluble
Cell fragment, supernatant cross 0.22 μm of sterilised membrane filter, obtain crude enzyme liquid.Using Ni SepharoseTM6Fast Flow are carried out
Purifying carries out desalting processing using 10kD ultra-filtration centrifuge tubes and obtains the higher recombinant protein of purity.The results are shown in Figure 2, recombination
Albumen Lys qdvp001 obtain high efficient expression.M is marker in Fig. 2, and 1 is the total bacterial protein induced without IPTG, 2,3,4,
5 cross the eluent collected during column, and 6 be the fusion protein after ni-sepharose purification, and 7 be the fusion protein after ultrafiltration concentration desalination, and 8
For the total bacterial protein by induction
Embodiment 3：Endolysin LysVPp1 fungistatic effects are tested by target bacteria of vibrio parahaemolytious ATCC17802
Picking vibrio parahaemolytious ATCC17802 single bacteriums are dropped down onto in 300mL2216E culture mediums, are incubated overnight, thalline centrifugation,
Melted again with 100mM EDTA, 5min, cell centrifugation is cleaned twice with pure water, then -80 DEG C of preservations, will be thin before measuring activity
Bacterium precipitation is melted again with 50mmol/L pH 8.2Tris, X-100 containing 0.1%Triton.By 100 μ L recombinant proteins Lys
Qdvp001 solution (400 μ g/mL) is added to 100 μ L bacteriums and melts in liquid again, using buffer solution and lysozyme (400 μ g/mL) as sky
White group and positive controls melt liquid mixing again with bacterium respectively, are cultivated under the same terms, and OD450 values, extinction are measured with microplate reader
The decline reflection bacterium of value is cleaved.
The results are shown in Figure 3, and the light absorption value of recombinant protein Lys qdvp001 test groups and positive controls is fast in 5min
Speed reduces, also, the turbidity of bacterium is reduced about 0.66 by Lys qdvp001 solution in 15min, and lysozyme soln reduces by 0.66
Left and right.By the way that shown in Fig. 4, after 37 DEG C of culture 15min, the bacterium solution of Lys qdvp001 test groups and positive controls is significantly than sky
White group clarification.Prove that there is antibacterial activity in vitro by the endolysin Lys qdvp001 that clonal expression obtains.
Embodiment 4：It is antibacterial that endolysin LysVPp1 is measured using different serotypes vibrio parahaemolytious and Escherichia coli as target bacteria
Effect
Picking vibrio parahaemolytious ATCC17802 single bacteriums are dropped down onto in 300mL2216E culture mediums, are incubated overnight, thalline centrifugation,
Melted again with 100mM EDTA, 5min, cell centrifugation is cleaned twice with pure water, then -80 DEG C of preservations, will be thin before measuring activity
Bacterium precipitation is melted again with 50mmol/L pH 8.0Tris, X-100 containing 0.1%Triton.By 100 μ L recombinant proteins Lys
Qdvp001 solution (400 μ g/mL) is added to 100 μ L bacteriums and melts in liquid again, measures OD450 values.Lys qdvp001 enzyme activity force value
=Δ 450nm (Lys qdvp001 experimental groups decreasing value)-Δ 450nm (buffer blank group decreasing value).
Using vibrio parahaemolytious ATCC17802 as antibacterial positive criteria, antibacterial work of the detection Lys qdvp001 to multi-strain bacteria strain
Property, shown in table 1, Lys qdvp001 can crack the vibrio parahaemolytious of remaining 5 kinds of different serotypes.
1 endolysin Lys qdvp001 fungistatic effects of table are analyzed
Embodiment described above is a kind of preferable scheme of the present invention, and not the present invention is made in any form
Limitation also has other variants and remodeling under the premise of without departing from the technical solution recorded in claim.
Claims (6)
1. a kind of endolysin from vibrio parahaemolyticus phage, amino acid sequence is SEQ ID No：Amino shown in 1
Acid sequence.
2. the gene of coding endolysin described in claim 1, the nucleotide sequence such as SEQ ID No of the gene：Shown in 2.
3. expression vector, engineering bacteria or cell line containing the gene described in claim 2.
4. expression vector according to claim 3, it is characterised in that：The procaryotic cell expression carrier is pET-30a
(+)。
5. engineering bacteria according to claim 3, it is characterised in that：The engineering bacteria is Escherichia coli Rosseta (DE3).
6. a kind of application of endolysin described in claim 1 in vibrio parahaemolytious bacteriostatic agent is prepared.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510448177.2A CN105200028B (en) | 2015-07-27 | 2015-07-27 | Endolysin and its application from vibrio parahaemolyticus phage |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510448177.2A CN105200028B (en) | 2015-07-27 | 2015-07-27 | Endolysin and its application from vibrio parahaemolyticus phage |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105200028A CN105200028A (en) | 2015-12-30 |
| CN105200028B true CN105200028B (en) | 2018-06-08 |
Family
ID=54947990
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510448177.2A Active CN105200028B (en) | 2015-07-27 | 2015-07-27 | Endolysin and its application from vibrio parahaemolyticus phage |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105200028B (en) |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108410884A (en) * | 2018-03-07 | 2018-08-17 | 中国科学院南海海洋研究所 | The application of bacteriophage Vp670 perforin genes holA |
| CN108410840A (en) * | 2018-04-03 | 2018-08-17 | 大连理工大学 | A kind of Pseudomonas aeruginosa phage endolysin and its encoding gene and application |
| CN109385406A (en) * | 2018-11-12 | 2019-02-26 | 中国海洋大学 | One plant of vibrio parahaemolyticus phage and its application in terms of enhancing aquatic livestock immunity |
| CN111909917B (en) * | 2019-05-10 | 2022-10-14 | 中国科学院微生物研究所 | Endolysin Lysmeta1 and coding gene and application thereof |
| CN111304181B (en) * | 2020-02-17 | 2021-11-23 | 华东理工大学 | Genetically engineered vibrio parahemolyticus phage lyase and preparation method and application thereof |
| CN112813058B (en) * | 2021-01-11 | 2022-03-08 | 武汉轻工大学 | Vibrio parahaemolyticus lyase, coding gene thereof and application thereof |
| CN113730561A (en) * | 2021-08-16 | 2021-12-03 | 中国海洋大学 | Preparation method of phage endolysin-loaded cationic guar gum liposome |
| CN113750223A (en) * | 2021-08-16 | 2021-12-07 | 中国海洋大学 | Phage endolysin-loaded cationic guar gum liposome, coating solution and application thereof |
| CN116732006B (en) * | 2023-08-09 | 2023-11-17 | 山东省农业科学院畜牧兽医研究所 | Vibrio parahaemolyticus phage depolymerase and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101798568A (en) * | 2009-04-03 | 2010-08-11 | 珠海市晋平科技有限公司 | Separated vibrio parahaemolyticus phage and applications in sterilization and microbe-proofing thereof |
-
2015
- 2015-07-27 CN CN201510448177.2A patent/CN105200028B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101798568A (en) * | 2009-04-03 | 2010-08-11 | 珠海市晋平科技有限公司 | Separated vibrio parahaemolyticus phage and applications in sterilization and microbe-proofing thereof |
Non-Patent Citations (2)
| Title |
|---|
| Genome Sequences of Two Closely Related Vibrio parahaemolyticus Phages, VP16T and VP16C;Victor Seguritan等;《Journal of Bacteriology》;20031130;第185卷(第21期);6434-6447 * |
| The complete sequence of marine bacteriophage VpV262 infecting Vibrio parahaemolyticus indicates that an ancestral component of a T7 viral supergroup is widespread in the marine environment;Stephen C. Hardies等;《Virology》;20030223;第310卷(第2期);359-371 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105200028A (en) | 2015-12-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105200028B (en) | Endolysin and its application from vibrio parahaemolyticus phage | |
| CN104593346B (en) | A kind of endolysin and its application from vibrio parahaemolyticus phage | |
| CN104830825B (en) | A kind of endolysin and its application from salmonella bacteriophage | |
| Ahmad et al. | The filamentous phage XacF1 causes loss of virulence in Xanthomonas axonopodis pv. citri, the causative agent of citrus canker disease | |
| Kirschner et al. | Rapid growth of planktonic Vibrio cholerae non-O1/non-O139 strains in a large alkaline lake in Austria: dependence on temperature and dissolved organic carbon quality | |
| CN108486089A (en) | Derived from the wide range lyases and its antibacterial applications of salmonella bacteriophage | |
| CN109536458A (en) | For treating and controlling the method and composition of plant disease | |
| CN106854247A (en) | A kind of preparation method of the bacterial virus catenase that can crack Escherichia coli and salmonella | |
| CN102191256A (en) | Hypha mycin gene and karyogamy gene-engineering bacteria thereof | |
| CN111420037B (en) | Application of phage lyase Lysep3 in preparation of broad-spectrum antibacterial drugs | |
| CN101812459A (en) | Nucleic acid for encoding antimicrobial peptide Lactoferricin B and prokaryotic expression method thereof | |
| CN108396030B (en) | Lifobinopenaeus antibacterial peptide gene Lv-BigPEN and recombinant protein and application thereof | |
| Pavankumar et al. | Scaling-up the production of recombinant Moringa oleifera coagulant protein for large-scale water treatment applications | |
| CN104726429B (en) | A kind of bacterial virus catenase of the fungistatic effect with enhancing | |
| CN104805066A (en) | Staphylococcus lyase and application thereof | |
| CN104862331B (en) | A kind of method of solubility expression Rhodococcus equi Disease-causing gene VapA albumen | |
| CN103387992A (en) | Gene for coding recombinant porcine beta-defensin-1 and preparation method of porcine beta-defensin-1 | |
| CN102604993A (en) | Immunologic adjuvant-Helicobacter pylori antigen fused protein oral vaccine and preparation method thereof | |
| CN105400791A (en) | Optimized gene of zebrafish defensin defbl3 and preparation method of recombinant protein thereof | |
| CN1406278A (en) | Expression of recombinant mature lysostaphin | |
| CN107602686A (en) | A kind of polypeptide resistant to gram-positive bacteria | |
| CN104073478A (en) | Enzymatic antibiotic for killing gram-positive bacteria and preparation and use of enzymatic antibiotic | |
| CN101565462B (en) | Large yellow croaker BPI-BN protein, primer and applications thereof in preparing antibiotic drugs | |
| Adhikari et al. | Biochemical and PCR assay for detection of pathogenic bacteria at shrimp and shrimp farms in Bangladesh | |
| CN103012578A (en) | Recombinant porcine interleukin 2, and encoding gene and expression method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |