CN107475277A - Fusion protein DAMP4 LfcinB, recombinant vector, recombinant bacterial strain and preparation method thereof - Google Patents

Fusion protein DAMP4 LfcinB, recombinant vector, recombinant bacterial strain and preparation method thereof Download PDF

Info

Publication number
CN107475277A
CN107475277A CN201710845751.7A CN201710845751A CN107475277A CN 107475277 A CN107475277 A CN 107475277A CN 201710845751 A CN201710845751 A CN 201710845751A CN 107475277 A CN107475277 A CN 107475277A
Authority
CN
China
Prior art keywords
lfcinb
damp4
fusion protein
recombinant
expression carrier
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201710845751.7A
Other languages
Chinese (zh)
Inventor
汪晶
于虎
王珏
朱伟云
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing Agricultural University
Original Assignee
Nanjing Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing Agricultural University filed Critical Nanjing Agricultural University
Priority to CN201710845751.7A priority Critical patent/CN107475277A/en
Publication of CN107475277A publication Critical patent/CN107475277A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/79—Transferrins, e.g. lactoferrins, ovotransferrins
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Wood Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Toxicology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention discloses a kind of fusion protein DAMP4 LfcinB gene order.The invention also discloses a kind of fusion protein DAMP4 LfcinB and preparation method thereof.Invention additionally discloses the recombinant expression carrier of fusion protein DAMP4 LfcinB gene order, transgenic cell system or transgenosis recombinant bacterium.The invention also discloses a kind of transgenosis recombinant bacterium.The invention also discloses a kind of host cell.The invention also discloses the application of said gene sequence, above-mentioned recombinant expression carrier, transgenic cell system or transgenosis recombinant bacterium in LfcinB is produced.The present invention carries out amalgamation and expression in Escherichia coli using New Fusion label DAMP4 with LfcinB, fusion protein is carried out using DAMP4 special nature heating purified.

Description

Fusion protein DAMP4-LfcinB, recombinant vector, recombinant bacterial strain and preparation method thereof
Technical field
The present invention relates to technical field of agriculture science, and in particular to fusion protein DAMP4-LfcinB, recombinant vector, restructuring Bacterial strain and preparation method thereof.
Background technology
Lactoferrin (Lactoferrin, abbreviation LF) is to be widely present in mammal milk to have a variety of biological work( A kind of macro-molecular protein of energy, has antibacterial, viral infection resisting function；LF can adjust gut flora, promote Bifidobacterium Breed and suppress the pernicious bacterias such as enterobacteria, so as to produce beneficial effect to animal intestinal tract health.
There is the presence that document confirms lactoferrin active peptides, this lactoferricin is named as Lactoferricin (Lfcin), also known as newborn iron element, much stronger than lactoferrin 400 times of its antibacterial activity.Wherein, cow's milk iron element LfcinB antibacterial is lived Property is most strong.LfcinB is made up of 25 amino acid residues, and its amino acid sequence is FKCRRWQWRMKKLGAPSITCVRRAF, table Reveal very strong cationic, water can be dissolved in well.LfcinB possesses complete lactoferrin bLF all biological activities, It is not likely to produce the resistance to the action of a drug, almost do not have toxicity to eukaryotic, is a kind of novel antimicrobial peptide with broad prospect of application, but Naturally isolated LfcinB yields poorly, complex process, costly, and at present, LfcinB preparation method is using lactoferrin the bottom of as Thing, hydrolysis, centrifuge, supernatant is freeze-dried, obtains the semifinished product of newborn iron element.The purification process of newborn iron element is conventional to be had Two kinds：One kind is reversed-phased high performace liquid chromatographic, and only analysis experiment provides sample；Another method is ion-exchange, is One of method for producing medicinal newborn iron element, but this method rate of recovery is low, and technique is more complicated, and cost is higher.It is and artificial synthesized LfcinB expenses are higher, can not mass produce, so as to restrict the extensive use of Bovine lactoferricin.With modern biotechnology Development, using transgenic technology large-scale production Bovine lactoferricin will be solve industrial LfcinB sources deficiency it is most effective Approach.
The content of the invention
Goal of the invention：First purpose of the present invention is to provide a kind of for encoding fusion protein DAMP4-LfcinB's DNA molecular, its nucleotide sequence such as SEQ ID NO：Shown in 1.
It is another object of the present invention to provide a kind of fusion protein DAMP4-LfcinB, its amino acid sequence such as SEQ ID NO：Shown in 2.
Another object of the present invention is to provide the above-mentioned DNA molecular for encoding fusion protein DAMP4-LfcinB Recombinant expression carrier, transgenic cell line or transgenosis recombinant bacterium.
A further object of the present invention is to provide a kind of transgenosis recombinant bacterium, and the recombinant bacterium is by described recombination expression In vector introduction Escherichia coli, screening obtains transgenosis recombinant bacterium.
It is another object of the present invention to provide a kind of host cell.
It is another object of the present invention to provide above-mentioned DNA molecular, above-mentioned recombinant expression carrier, transgenosis are thin The application of born of the same parents' system or transgenosis recombinant bacterium in fusion protein DAMP4-LfcinB is produced.
It is yet another object of the invention to provide the preparation method of fusion protein DAMP4-LfcinB a kind of and LfcinB albumen Preparation method.
Technical scheme：In order to solve the above problems, the technical scheme is that providing one kind is used for encoding fusion protein DAMP4-LfcinB DNA molecular, its nucleotide sequence such as SEQ ID NO：Shown in 1.
Present invention also contains a kind of fusion protein DAMP4-LfcinB, its amino acid sequence such as SEQ ID NO：2 institutes Show.
Present invention also contains the recombinant expression carrier of described fusion protein DAMP4-LfcinB DNA molecular, turned Gene cell system or transgenosis recombinant bacterium.
Present invention also includes DNA molecular being inserted into coli expression carrier obtaining containing fusion protein The recombinant expression carrier of DAMP4-LfcinB DNA molecular.
Wherein, above-mentioned coli expression carrier is pET30a (+).
Present invention also includes a kind of transgenosis recombinant bacterium, and the recombinant bacterium is by described recombinant expression carrier importing In Escherichia coli, screening obtains transgenosis recombinant bacterium.
Escherichia coli of the present invention are BL21 (DE3).
Present invention also includes described DNA molecular, described recombinant expression carrier, transgenic cell system or turns base Because of application of the recombinant bacterium in fusion protein DAMP4-LfcinB is produced.
Present invention also includes a kind of preparation method of DAMP4-LfcinB fusion proteins, specifically includes following steps：
1) core of fusion protein DAMP4-LfcinB DNA molecular, is designed according to DAMP4 and LfcinB amino acid sequence Nucleotide sequence, the nucleotide sequence of fusion protein DAMP4-LfcinB SEQ ID NO as mentioned：Shown in 1；
2) the recombinant expression carrier structure of the gene order, containing fusion protein DAMP4-LfcinB；
3), recombinant expression carrier, which is transformed into Escherichia coli, carries out induced expression acquisition fusion protein DAMP4-LfcinB；
4), fusion protein DAMP4-LfcinB, which is purified, produces.
A kind of preparation method of LfcinB albumen, include the preparation method of above-mentioned DAMP4-LfcinB fusion proteins, so Fusion protein DAMP4-LfcinB obtained above is subjected to acid cleavage afterwards, purifies and produces LfcinB albumen.
Last MIC experiments measure further isolates and purifies the fungistatic effect of LfcinB albumen.
The fusion protein DAMP4-LfcinB of the present invention specific preparation method is as follows：
1) fusion protein DAMP4-LfcinB gene order, institute are designed according to DAMP4 and LfcinB amino acid sequence State gene order and carry out full genome synthesis fusion in Shanghai life work；
2) by the fusion of full genome synthesis and expression vector pET30a (+) respectively with two identical restriction enzyme (Bam HI and NdeI) double digestion processing is carried out, the fragment after processing is entered using Ago-Gel QIAquick Gel Extraction Kit to target gene fragment Row recovery, finally is attached to obtain linked system, is transformed into DH5 α competent cells using T4 ligases；
3) recombinant vector is transferred to the structure that recombinant bacterial strain is carried out in e. coli bl21 competence, picking positive colony enters Row double digestion and DNA sequencing analysis；
4) picking positive colony is incubated overnight in 5mL LB culture mediums.Next day, it is new to be inoculated into 100mL by 1% inoculum concentration Culture is enlarged in fresh 2YT culture mediums, IPTG derivants (final concentration 0.5mM) are added after 4 hours and carry out recombinant protein Induced expression；
5) bacterium solution of 6 hours after induction is centrifuged, carries out thalline and supernatant separation.By thalline deionized water resuspension, Add Na2SO4To final concentration 1M.Na will be added2SO4Thalline re-suspension liquid carry out high-temperature heating treatment (90 DEG C of water-baths) 30 minutes Sample is centrifuged again afterwards, precipitation is collected and Supernatant samples carries out electrophoresis detection.
Beneficial effect：The present invention has advantages below relative to prior art：The present invention utilizes New Fusion label DAMP4 carries out amalgamation and expression in Escherichia coli with LfcinB, fusion protein heat using DAMP4 special nature pure Change.The present invention test result indicates that：1st, fusion protein DAMP4-LfcinB successfully obtains secreting, expressing in Escherichia coli, Antibacterial testing result shows that LfcinB has bacteriostatic activity.2nd, supernatant is heated using high temperature and high salt, under this condition Most albuminous degenerations precipitation but fusion protein DAMP4-LfcinB still keep solvable so as to having reached the purpose of purifying.3rd, will melt After hop protein DAMP4-LfcinB carries out acid cleavage purification, product has bacteriostatic activity.
Brief description of the drawings
Fig. 1, gene order containing fusion protein DAMP4-LfcinB recombinant expression carrier structure figure；
Fig. 2, gene order containing fusion protein DAMP4-LfcinB recombinant expression carrier double digestion qualification figure, swimming lane 1 is double digestion recombinant vector；Swimming lane 2 is Marker；
Fig. 3, gene order containing fusion protein DAMP4-LfcinB recombinant expression carrier DNA sequencing comparison result Figure；The gene order and the comparison of sequencing result of the present invention that specially embodiment 1 designs；
Fig. 4, the correct fusion protein DAMP4-LfcinB of the checking recombinant expression carrier of gene order are successfully transferred to In e. coli bl21；
Fig. 5, SDS-PAGE analyze the effect that different IPTG induced concentrations influence when inducing 6h on fusion protein expression Figure；Swimming lane 1：Albumen Marker；Swimming lane 2：0.05mM；Swimming lane 3：0.1mM；Swimming lane 4：0.25mM；Swimming lane 5：0.5mM；Swimming lane 6： 0.75mM；Swimming lane 7：1mM；
The expression effect figure of different induction time points under Fig. 6, SDS-PAGE analysis 0.1mM IPTG induced concentrations；Swimming lane 1： Albumen Marker；Swimming lane 2：2h；Swimming lane 3：4h；Swimming lane 4：6h；Swimming lane 5：8h；Swimming lane 5：10h；
Fig. 7, SDS-PAGE analysis the fusion protein DAMP4-LfcinB through acid cleavage effect and LfcinB after purification；
The protein concentration result of DAMP4 protein lysates is gone in Fig. 8, BCA method measurement.
Fig. 9, MIC, which test the LfcinB that qualitative analysis acts on after purification through acid cleavage, has the design sketch of bacteriostasis.
Embodiment
The present invention is further described below in conjunction with the accompanying drawings.
The reagent and bacterial strain that the present invention uses
Embodiment 1：According to DAMP4 and LfcinB amino acid sequence, known acid cleavage amino acid sites DPS and large intestine Bacillus designs the Preference of codon the base sequence of DAMP4-DPS-LfcinB fusion proteins, will using DN AMAN softwares Amino acid sequence translation into base sequence, for Escherichia coli codon preference and a kind of amino acid correspond to it is several Bu Tong close Numeral principle optimizes translated base sequence using professional codon optimization website regulation G/C content, dilute to reduce Escherichia coli There are codon or low frequency codon, improve protein expression efficiency and stability.By the base sequence commission Shanghai life work of optimization Biotech firm carries out the synthesis of gene；The sequence of the design such as SEQ ID NO：Shown in 1.Wherein, " GAACCGTCTATGAAACAA CTGGCGGACAGCCTGCACCAGCTGGCGCGCCAGGTTAGCCGTCTGGAACACGCGGAACCGAGCATGAAACAGCTGGC GGATTCTCTGCATCAGCTGGCTCGTCAGGTTTCTCGCCTGGAACATGCGGAACCGTCTATGAAACAACTGGCGGATA GCCTGCACCAGCTGGCGCGTCAGGTTAGCCGTCTGGAGCACGCGGAACCGAGCATGAAACAGCTGGCGGATAGCCTG CATCAGCTGGCGCGTCAGGTTTCTCGTCTGGAACACGCA " partly optimizes base sequence for DAMP4；" GATCCGTCT " portion It is divided into DPS optimization base sequences；“TTCAAATGCCGTCGTTGGCAGTGGCGTATGAAAAAACTGGGCGCGCCGAGCATCAC CTGCGTTCGTCGTGCGTTC " is that LfcinB optimizes base sequence；Codon optimization network address http://www.jcat.de/.
Conclusion：Present invention innovation is artificial DAMP4 albumen, acid cleavage amino acid sites DPS and LFcinB is corresponding Base sequence carry out codon optimization, reduce Escherichia coli rare codon and low frequency codon, improve GC in base sequence Content, obtain relatively optimal gene order so that recombinant DNA is more suitable for E. coli translation expression.Gene sequencing result with NCBI gene pools compare display synthesis base sequence and matched completely with design base sequence.
The structure of the recombinant expression carrier of gene order of the embodiment 2 containing fusion protein DAMP4-LfcinB
1st, target gene and expression vector double digestion
First by the fusion and the intrinsic expression vector pET30a in this laboratory of the full genome synthesis of Shanghai Sheng Gong companies (+) carries out double digestion processing respectively with two identical restriction enzymes (Bam HI and NdeI), cuts the purpose base on conventional carrier Because of fragment and pET30a (+) is transformed simultaneously.Target gene and expression vector plasmid are carried out by following digestion system：
37 DEG C of water-bath 30min.
2nd, target gene and expression vector double digestion fragment are reclaimed respectively.Utilize Ago-Gel QIAquick Gel Extraction Kit Reclaim target gene fragment；Comprise the following steps that：
(1) purpose fragment digestion products are subjected to 1% gel electrophoresis, expression vector digestion products is subjected to 1% gel electricity Swimming, reclaimed using Tiangen gel reclaims kits, carried out according to kit operation manual；
(2) gel containing target DNA fragment is cut under uviol lamp, cuts off unnecessary gel as far as possible, is put into advance title In the 1.5mL centrifuge tubes of weight；
(3) centrifuge tube equipped with gel piece is weighed again, the quality of calculated for gel block, 600 is added by every 100mg gel pieces μ L ratio adds sol solutionses PN, is placed on water-bath 10min in 50 DEG C of thermostat water baths, and gently overturn every 2~3min Centrifuge tube once, until gel piece is completely dissolved；
(4) previous step resulting solution is added in the adsorption column CA2 being placed in collecting pipe, after room temperature places 2min, in 12 000rpm centrifuge 1min, and the waste liquid in collecting pipe is outwelled, adsorption column CA2 is put back in collecting pipe again；
(5) 600 μ L rinsing liquids PW, 12 000rpm centrifugation 1min are added into adsorption column CA2, are outwelled useless in collecting pipe Liquid, then adsorption column is put into collecting pipe；
(6) previous action is repeated；
(7) adsorption column CA2 is put back into collecting pipe, 12 000rpm centrifugation 2min, eliminates rinsing liquid as far as possible.By adsorption column CA2 It is placed in room temperature and places about 15min, thoroughly dry, prevents the rinsing liquid of residual from influenceing the experiment of next step；
(8) adsorption column is reentered into a clean 1.5mL centrifuge tube, 50 μ L eluents is added in adsorption column center EB, 12 000rpm centrifuge 1min, and the centrifugate containing DNA is stored for future use in -20 DEG C；
3rd, the connection of purpose fragment and carrier
Generally the mol ratio of target gene and carrier framework is 10:1 and 3:Between 1.This experiment mole used Ratio is：Target gene and expression vector pET30a (+) in molar ratio 5:1, target gene is cloned into Bacillus coli expression and carried Between body pET30a (+) polyclone enzyme enzyme site NdeI and Bam HI, so as to build recombinant expression carrier.
The volume calculation formula of added carrier framework and target gene is：
Volume number added by carrier framework (μ L)=0.03pmoles × carrier segments length × 10-3bp × 0.66/, which is reclaimed, to be carried The concentration (ng/mL) of body skeleton
Volume number added by target gene (μ L)=(0.09-0.3) pmoles × target gene length × 10-3bp × 0.66/ Reclaim target gene concentration (ng/mL).
Purpose fragment and carrier are finally attached using T4 ligases.
The linked system of target gene and expression vector is as follows：
4 DEG C of connections overnight obtain connecting mix products.
3rd, connection mix products and DH5 α competent cells are mixed and converted
(1) competent cell melted on 50 μ L ice baths is taken, target DNA is added, gently mixes, ice bath 30min；
(2) 42 DEG C of water-bath heat shocks 45 seconds, are then quickly moved to 2min in ice bath, process not shake centrifuge tube；
(3) 500 μ LLB culture mediums (being free of antibiotic) are added into each centrifuge tube, 37 DEG C are placed in after mixing, 200rpm Culture one hour.
(4) draw the competent cell that 100 μ L have been converted to be added on the LB agar mediums containing kanamycins, smoothen, 37 DEG C are incubated overnight.
The fusion of the present embodiment synthesis is successfully embedded into expression vector pET30a (+), and DNA sequencing result shows weight Group plasmid pET30a (+)/DAMP4-LfcinB is successfully constructed.Concrete outcome as shown in Figure 1, Figure 2, Fig. 3；It will be built into Escherichia coli The recombinant expression carrier of work(is transferred in expressive host bacterium e. coli bl21 (Fig. 4) using chemical method, picking positive colony Induced expression is carried out after being incubated overnight.
Conclusion：As a result show that the success of DAMP4-LfcinB DNA fragmentations is connected with pET30a (+) carrier.
Embodiment 3：The structure of expressed fusion protein DAMP4-LfcinB recombinant bacterial strain
The correct recombinant vector of sequencing result in embodiment 2 is transformed into expressive host bacterium e. coli bl21, picking Positive colony is incubated overnight to obtain recombinant bacterial strain in 5mL LB culture mediums.
1st, the preparation of e. coli bl21 competent cell：
The preparation of TB solution：
(1) the e. coli bl21 single bacterium colony of the fresh cultured of picking one is inoculated in that (every liter contains equipped with 100mL NZY nutrient solutions 10g caseinhydrolysates, 5g yeast extracts, 8g sodium chloride, pH value 7.0 ± 0.2 (25 DEG C)) 500mL triangular flasks in, 18 DEG C, 130-150r/min shaken cultivations；
(2) cultivate to optical density OD600Value 0.8-0.9, triangular flask is placed into 10min on ice；
(3) and then bacterium solution is transferred to 4800r/min in centrifuge tube and centrifuges 10min, removed supernatant, reclaim cell；
(4) with ice-cold TB solution 6mL suspension cells, save backup, cell now is e. coli bl21 impression State cell.
(5) pay attention to：The current now processing transformation efficiency of competent cell is higher.
2nd, the recombinant plasmid transformed of embodiment 2 is entered into e. coli bl21 competent cell：
(1) 10 μ L recombinant plasmids are added in 100 μ L e. coli bl21 competent cells, plasmid volume is no more than sense By the 1/20 of state cell suspension volume, mix；
30~60min is stood in (2) 37 DEG C of water-baths；
(3) 37 DEG C of 2~4h of 200r/min concussion and cultivates；
Competence is coated on the LB solid mediums containing kanamycins (50 μ g/mL), every 100 μ L transformation systems are coated onto Flat board, 37 DEG C of inversion overnight incubations.Positive bacterium colony is transgenosis recombinant bacterial strain.
3rd, upgrading grain carries out double digestion checking, gene sequencing：
(1) the positive single bacterium colony in picking step 2, it is transferred in the LB culture mediums that 10mL contains 50ug kanamycins, 37 DEG C, 180rpm, overnight incubation.
(2) double digestion is carried out with reference to the method extraction plasmid in embodiment 2, digestion products is then subjected to SDS-PAGE glue Checking is (referring to Fig. 2).
(3) plasmid of extraction is separately served into the sequencing of Hai Sheng works biotech firm.
Conclusion：Positive bacterium colony extraction plasmid double digestion, gene sequencing result show recombinant vector successful conversion into BL21 (referring to Fig. 2,3,4).
Embodiment 4：IPTG induced expression fusion protein DAMP4-LfcinB and its purifying
The recombinant bacterial strain that embodiment 3 obtains is inoculated into the fresh 2YT culture medium (tryptones of 50mL by 1% inoculum concentration 16g, dusty yeast 10g, NaC l5g；Deionized water is settled to 1L) in be enlarged culture, after 4 hours add IPTG derivants (final concentration is respectively 0.05mM, 0.1mM, 0.25mM, 0.5mM, 0.75mM, 1mM) carries out the induced expression of recombinant protein.Induction The bacterium solution of 6 hours carries out centrifugation and carries out thalline and supernatant separation afterwards.After obtaining a certain amount of thalline, suspend again, to re-suspension liquid Middle addition Na2SO4(final concentration 1M).Na will be added2SO4Bacterium solution supernatant carry out high-temperature heating treatment (90 DEG C of water-baths) 30 minutes Sample is centrifuged again afterwards, precipitation is collected and Supernatant samples carries out electrophoresis detection.
Centrifuged supernatant is adjusted into pH value to 3.0 with 1M hydrochloric acid, stands 1 hour at room temperature, 2000G, 4 DEG C of 15 points of centrifugations Clock, remove supernatant and (remove Na2SO4), gained precipitation is fusion protein DAMP4-LfcinB, will with 0.01M PBSs It is stand-by that its resuspension obtains re-suspension liquid.
IPTG pairs of the present embodiment use (final concentration is respectively 0.05mM, 0.1mM, 0.25mM, 0.5mM, 0.75mM, 1mM) E. coli bl21 containing recombinant plasmid pET30a (+)/DAMP4-LfcinB carries out induced expression.As a result SDS-PAGE is passed through Analysis shows (Fig. 5), find after 2h, 4h, 6h, 8h, 10h induction, 6 hour induction rear fusion protein DAMP4- LfcinB (about 14.3Kda) exists (referring to Fig. 6) with inclusion bodies.
Fusion protein DAMP4-LfcinB re-suspension liquids are added to final concentration of 60mM with 1M hydrochloric acid, and 60 DEG C crack 48 hours, Analyzed using SDS-PAGE, occur DAMP4 and LfcinB band (Fig. 7) between 11.2Kda and 3.1Kda.Lysate is adjusted PH to 7.4 is saved, after being stored at room temperature one hour, 20000G centrifugation 15min, supernatant centrifuges 30min with 6KD super filter tube 4000G, MIC result of the tests show that LfcinB albumen has bacteriostatic activity.As a result it is as shown in Figure 9.
Conclusion：Fusion protein DAMP4-LfcinB succeeds expression；By expression condition optimization, IPTG optimal induction Dosage is 0.1mM-0.2mM；4-6h expression quantity is relatively large after induction.
Embodiment 5：The detection for the LfcinB bacteriostatic activities that fusion protein is purified into through acid cleavage
By acid cleavage purified product measured in advance protein concentration in embodiment 4, quantitative determined according to the total protein of the present invention Kit (BCA methods) operational manual operates, and adds reagent and testing sample in 96 orifice plates, mixes, and 37 DEG C are incubated 30 points Clock, each hole light absorption value is determined with ELIASA.In Fig. 8, the first hole is blank control, and the second hole is standard items, and the 3rd hole is to be measured Sample original liquid concentration；It is respectively later 1/2 original liquid concentration, 1/4 original liquid concentration, 1/10 original liquid concentration, 1/20 per hole sample concentration Original liquid concentration, 1/40 original liquid concentration；Wherein, blank control is distilled water, and the concentration of standard items is 563 μ g/mL.Total protein concentration Calculation formula is：Total protein concentration (μ g/mL)=(measure OD values-blank OD values)/(standard OD values-blank OD values) X standard items Extension rate before concentration (563 μ g/mL) X test sample.The light absorption value that reference picture 8 determines, it is to be measured that experiment is calculated through formula Sample original liquid concentration is about 200 μ g/mL.
Then acid cleavage purified product in embodiment 4 is subjected to MIC experiments, specific implementation method is as follows：1st, select respectively The existing gram-positive bacteria ATCC25923 (staphylococcus aureus) in this laboratory and Gram-negative bacteria E.coli BL21 The experimental strain of (Escherichia coli) as this experiment；Two kinds of bacterial strains are activated into (overnight) first, thalline is collected by centrifugation in 4000G, uses Double MHB (casein hydrolyzate 17.5g/L, starch 1.5g/L, beef leachate 5g/L) resuspension, 10000 times of dilution is stand-by, Cell concentration is about 105-7cfu/mL.2nd, 96 hole steril cell culture plates the 1st, 2 holes add stoste to be measured, and the 2nd hole adds 100 μ L sterile Water, 100 μ L to the 3rd hole are suctioned out after mixing, carry out 2 times of dilutions successively, the double MHB dilutions bacterium solutions of 100 μ L are then added per hole；Finally Holes left blank as negative control group and positive controls.3rd, 36 DEG C of incubation 12h, the resazurin solutions of 10 μ L 0.1% are added per hole, 36 DEG C It is incubated 2h.4th, result is observed.MIC result of the tests reference picture 9, as a result shows：Thick purified product is surveyed in two kinds of bacterial strains after acid cleavage It is identical on test result, there is bacteriostatic activity from original concentration to 1/4 original concentration, it is identical with negative control group color, it is deep Blueness (represents asepsis growth or bacteria growing inhibiting)；And 1/8 original concentration, 1/16 original concentration and positive controls color It is identical, it is red (indicating bacteria growing).The MIC value is about 50 μ g/mL.
Described above is only the preferred embodiment of the present invention, it should be pointed out that：For the ordinary skill people of the art For member, under the premise without departing from the principles of the invention, some improvements and modifications can also be made, these improvements and modifications also should It is considered as protection scope of the present invention.
Sequence table
<110>Agricultural University Of Nanjing
<120>Fusion protein DAMP4-LfcinB, recombinant vector, recombinant bacterial strain and preparation method thereof
<130> 17NJ1V0310073
<141> 2017-09-19
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 390
<212> DNA
<213>Fusion protein DAMP4-LfcinB (artificial synthesized sequence)
<220>
<221> misc_feature
<222> (1)..(390)
<400> 1
catatggaac cgtctatgaa acaactggcg gacagcctgc accagctggc gcgccaggtt 60
agccgtctgg aacacgcgga accgagcatg aaacagctgg cggattctct gcatcagctg 120
gctcgtcagg tttctcgcct ggaacatgcg gaaccgtcta tgaaacaact ggcggatagc 180
ctgcaccagc tggcgcgtca ggttagccgt ctggagcacg cggaaccgag catgaaacag 240
ctggcggata gcctgcatca gctggcgcgt caggtttctc gtctggaaca cgcagatccg 300
tctttcaaat gccgtcgttg gcagtggcgt atgaaaaaac tgggcgcgcc gagcatcacc 360
tgcgttcgtc gtgcgttcta ataaggatcc 390
<210> 2
<211> 125
<212> PRT
<213>Fusion protein DAMP4-LfcinB (artificial synthesized sequence)
<400> 2
Met Glu Pro Ser Met Lys Gln Leu Ala Asp Ser Leu His Gln Leu Ala
1 5 10 15
Arg Gln Val Ser Arg Leu Glu His Ala Glu Pro Ser Met Lys Gln Leu
20 25 30
Ala Asp Ser Leu His Gln Leu Ala Arg Gln Val Ser Arg Leu Glu His
35 40 45
Ala Glu Pro Ser Met Lys Gln Leu Ala Asp Ser Leu His Gln Leu Ala
50 55 60
Arg Gln Val Ser Arg Leu Glu His Ala Glu Pro Ser Met Lys Gln Leu
65 70 75 80
Ala Asp Ser Leu His Gln Leu Ala Arg Gln Val Ser Arg Leu Glu His
85 90 95
Ala Asp Pro Ser Phe Lys Cys Arg Arg Trp Gln Trp Arg Met Lys Lys
100 105 110
Leu Gly Ala Pro Ser Ile Thr Cys Val Arg Arg Ala Phe
115 120 125

Claims (10)

1. a kind of DNA molecular for encoding fusion protein DAMP4-LfcinB, its nucleotide sequence such as SEQ ID NO：1 institute Show.
2. a kind of fusion protein DAMP4-LfcinB, its amino acid sequence such as SEQ ID NO：Shown in 2.
3. the recombinant expression carrier of the DNA molecular containing the fusion protein DAMP4-LfcinB described in claim 1, transgenosis Cell line or transgenosis recombinant bacterium.
4. recombinant expression carrier according to claim 3, the DNA molecular described in claim 1 is inserted into Escherichia coli The recombinant expression carrier of the DNA molecular containing fusion protein DAMP4-LfcinB is obtained in expression vector.
5. recombinant expression carrier according to claim 4, it is characterised in that the coli expression carrier pET30a (+)。
6. a kind of transgenosis recombinant bacterium, the recombinant bacterium is that the recombinant expression carrier described in claim 4 or 5 is imported into large intestine bar In bacterium, screening obtains transgenosis recombinant bacterium.
7. a kind of host cell, the host cell is that the recombinant expression carrier described in claim 4 or 5 is imported into Escherichia coli In obtain.
8. recombinant expression carrier, transgenic cell line or the transgenosis described in DNA molecular, claim 3 described in claim 1 Application of the recombinant bacterium in fusion protein DAMP4-LfcinB is produced.
9. a kind of fusion protein DAMP4-LfcinB preparation method, it is characterised in that comprise the following steps：
1) nucleosides of fusion protein DAMP4-LfcinB DNA molecular, is designed according to DAMP4 and LfcinB amino acid sequence Acid sequence, the nucleotide sequence SEQ ID NO as claimed in claim 1 of the fusion protein DAMP4-LfcinB：Shown in 1；
2) structure of the recombinant expression carrier of the nucleotide sequence, containing fusion protein DAMP4-LfcinB；
3), recombinant expression carrier, which is transformed into Escherichia coli, carries out induced expression acquisition fusion protein DAMP4-LfcinB；
4), fusion protein DAMP4-LfcinB, which is purified, produces.
A kind of 10. preparation method of LfcinB albumen, it is characterised in that the preparation method including claim 9, and will obtain Fusion protein DAMP4-LfcinB carry out acid cleavage, purify and produce LfcinB albumen.
CN201710845751.7A 2017-09-19 2017-09-19 Fusion protein DAMP4 LfcinB, recombinant vector, recombinant bacterial strain and preparation method thereof Pending CN107475277A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710845751.7A CN107475277A (en) 2017-09-19 2017-09-19 Fusion protein DAMP4 LfcinB, recombinant vector, recombinant bacterial strain and preparation method thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710845751.7A CN107475277A (en) 2017-09-19 2017-09-19 Fusion protein DAMP4 LfcinB, recombinant vector, recombinant bacterial strain and preparation method thereof

Publications (1)

Publication Number Publication Date
CN107475277A true CN107475277A (en) 2017-12-15

Family

ID=60585467

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710845751.7A Pending CN107475277A (en) 2017-09-19 2017-09-19 Fusion protein DAMP4 LfcinB, recombinant vector, recombinant bacterial strain and preparation method thereof

Country Status (1)

Country Link
CN (1) CN107475277A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116693700A (en) * 2023-08-01 2023-09-05 百葵锐(深圳)生物科技有限公司 Protein RNA complex for hair directional binding and delivery
CN117164722A (en) * 2023-08-09 2023-12-05 东北农业大学 Spiral bundle DAMP4-PR-FO fusion protein D2L and preparation method and application thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106366201A (en) * 2016-09-20 2017-02-01 南京农业大学 Gene sequence, carrier, recombination strain and recombination protein of fusion protein DAMP4-IGF-1 and preparing method thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106366201A (en) * 2016-09-20 2017-02-01 南京农业大学 Gene sequence, carrier, recombination strain and recombination protein of fusion protein DAMP4-IGF-1 and preparing method thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
CHUN-XIA ZHAO 等: "A Simple and Low-Cost Platform Technology for Producing Pexiganan Antimicrobial Peptide in E. coli", 《BIOTECHNOLOGY AND BIOENGINEERING》 *
XING-JUN FENG ET AL: "Fusion expression of bovine lactoferricin in Escherichia coli", 《PROTEIN EXPRESSION AND PURIFICATION》 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116693700A (en) * 2023-08-01 2023-09-05 百葵锐(深圳)生物科技有限公司 Protein RNA complex for hair directional binding and delivery
CN116693700B (en) * 2023-08-01 2023-09-29 百葵锐(深圳)生物科技有限公司 Protein RNA complex for hair directional binding and delivery
CN117164722A (en) * 2023-08-09 2023-12-05 东北农业大学 Spiral bundle DAMP4-PR-FO fusion protein D2L and preparation method and application thereof
CN117164722B (en) * 2023-08-09 2024-04-09 东北农业大学 Spiral bundle DAMP4-PR-FO fusion protein D2L and preparation method and application thereof

Similar Documents

Publication Publication Date Title
CN103509729B (en) A kind of produce the construction method of coenzyme Q10 engineering bacteria, engineering bacteria and application thereof
CN110845603A (en) Human collagen 17-type polypeptide, production method and use thereof
CN107245494A (en) Efficient soluble expression and purification method of Abeta 42 in escherichia coli
CN106967659A (en) A kind of structure and fermentation process of the antibiotic-free resistance recombined bacillus subtilis for expressing glutamate decarboxylase
CN104211799B (en) Human Epidermal growth factor domain protein and its application
CN103555729B (en) Trail dna sequence, expression and the application of a kind of transformation
CN106497897A (en) A kind of engineered strain construction method for improving Heparinase I activity
CN106967660A (en) A kind of genetic engineering bacterium for producing Resuscitation-promoting Factor and its application
CN107475277A (en) Fusion protein DAMP4 LfcinB, recombinant vector, recombinant bacterial strain and preparation method thereof
CN106496333A (en) One kind expresses hybrid peptide and preparation method and application using bacillus subtilis
CN110468143A (en) The preparation method and application of antibacterial peptide NZX
CN104195157A (en) High-efficiency recombination expression and purification method of biological active peptide in prokaryotic cells
CN107446941A (en) Cecropin A antibacterial peptide based on self-aggregation short-peptide induction and preparation method thereof
CN110295211A (en) A kind of preparation method and application of bacterium selenium-enriched protein
CN106478785A (en) A kind of chick anemia virus apoptosis element merges recombiant protein and its preparation method and application
CN105622763A (en) Antimicrobial peptide fusion protein and preparation method and application thereof
CN108998458A (en) The preparation method of rh-insulin
CN112239760A (en) Recombinant engineering bacterium for efficiently expressing recombinant hGH (human growth hormone) and construction method and application thereof
CN109371047A (en) Method for constructing and expressing heat-resistant antibacterial peptide fusion protein by using protein IHF- α
CN108484749A (en) A kind of recombinant soluble human source Bone targeting gamma interferon 1-b and preparation method thereof
CN104611343A (en) Isolated antiviral natural immune protein TRIM32 (tripartite motif 32) for carps and antiviral activity
CN104163865A (en) Optimized DNA sequences of recombinant human bone morphogenetic protein-2 and coded protein thereof
CN108117599A (en) The recombination expression and purification process of Ssm6a and its fusion protein used
CN104818283B (en) The gene of porcine interferon alpha 8 and its expression of a kind of optimization
CN104804074B (en) A kind of plectasin mutant and its gene, preparation method and application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20171215