CN108048577A - Gene containing SEC62 is used to improve the detection kit of Altai Sheep Meat Quality - Google Patents
Gene containing SEC62 is used to improve the detection kit of Altai Sheep Meat Quality Download PDFInfo
- Publication number
- CN108048577A CN108048577A CN201711463968.8A CN201711463968A CN108048577A CN 108048577 A CN108048577 A CN 108048577A CN 201711463968 A CN201711463968 A CN 201711463968A CN 108048577 A CN108048577 A CN 108048577A
- Authority
- CN
- China
- Prior art keywords
- sec62
- sheep
- altai
- altai sheep
- improve
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
It is used to improve the detection kit of Altai Sheep Meat Quality the invention discloses gene containing SEC62, utilizes mRNA sequence voluntarily engineer's specific primer of sheep SEC62 genes, forward primer：5'‑GATAGCAGCCACCCTCTTCC‑3'；Reverse primer：5'ACGAGCAACAGCAAGGAGAA 3', PCR amplification is carried out by template of sample genomic dna, fluorescence quantitative PCR detection is carried out to amplified production, and its expression quantity and Amino acid and protein content are associated analysis, the meat of selection and breeding raising Altai Sheep is carried out with this；The foundation of the present invention; for selection and breeding Altai Sheep improved seeds; while theoretical foundation and the technical support of marker assisted selection are provided, there is actual application value for the improved seeds resource, raising peasants and herdsmen income, quickening Sheep development for protecting Altai Sheep.
Description
Technical field
The present invention relates to the identification method of animal hereditary and selection, specifically, the present invention relates to a kind of Altai Sheeps to produce meat
The technical field of the kit of energy selection and breeding.
Background technology
Altai Sheep is the outstanding naked eyed test in Xinjiang place, is branch's product in ancient Kazakh Sheep kind
System is raised after B.C. by the ancestors (Wu Sunren) of Kazak.Lamb has prominent precocious feature, is given birth to suitable for mutton
Production belongs to meat, fat dual-purpose kind.The major production areas of Altai Sheep concentrate on the Altay Prefecture Fuhai County of In The North of Xinjiang, Fuyun County,
The ground such as Qinghe County, are distributed in the counties such as Altay, Burqin, Jeminay and Habahe County, but with introducing a fine variety between field and section is handed over
Stream, Altay are all distributed substantially in full boundary now.Altai Sheep physique is big, and constitution is solid.Chest breadth is deep, and the back of the body is straight, muscle hair
It educates good.Four limbs are high and solid, and muscle of thigh is plentiful.It protrudes character and is mainly reflected on meat-producing traits, and Altai Sheep
Physique is big, meat production performance is high, have the characteristics that resistance to crude feed, be apt to trek, anti-severe cold, constitution are solid, suitable for herding.Altay
Sheep belongs to large-scale naked eyed test, also slightly better compared with the sheep kind in domestic each pastoral area.Local breeding Ba Shibai in the area of Xinjiang
The Mongolian sheep of breeding outside sheep, Ba Yin Brooker Yang Ji areas, including its hypotype such as sheep known for its fine thick wool, cold sheep, same to sheep, sheep etc., Mean liveweight
Below Altai Sheep.Altai Sheep is as the principal item in my pastoral industry animal species structure.Altai Sheep kind is located in
Long-term low temperature, winter are up to nearly half a year, and reachable -35 to -40 DEG C most cold, and since natural conditions are severe, many improved seeds exist
Here can not survive, and Altai Sheep be exactly it is such a it is special under conditions of, by long-term nature and artificial selection and
It is formed, how selection and breeding improve Altai Sheep meat production, are to speed up improving the key for recovering the excellent meat production of Altai Sheep,
This is actually the common problem of the current generally existing in this field, how to be solved extremely urgent.
In the protein of livestock and poultry meat, the species and content ratio of amino acid plays protein nutritive value to pass weight
The effect wanted.Mutton is full of nutrition, and protein content is high, and nutritive value is high, and containing abundant amino acid, with pork, beef
Closely, fine and tender taste is easy to digest and absorbs, and domestic and foreign scholars pass through the analysis to mutton protein and amino acid, chevon
In have many amino acid.The important evaluation index of pork nutritive value is amino acid content and composition and meat in meat
The important factor in order of matter.And glycine, isoleucine, proline, serine, alanine and glutamic acid etc. in amino acid content
6 kinds of Fresh ear fields are to form precusor amino acids necessary to meat fragrance, and the flavor with meat has very big contact, particularly fresh
Taste substance glutamic acid, can neutralize it is salty with it is sour, meat is made to become more delicious.
At present, the research at home and abroad on SEC62 genes is more common in the mankind and mouse, is rarely reported in sheep,
And based at present for the big tail sheep of Fu Hai, i.e., the particularity for the improvement of Altai Sheep special Xinjiang typicalness kind meat,
The prior art using SEC62 genes as the candidate gene for influencing domestic animal Meat Quality in Altai Sheep meat production there is not yet select
Application in educating.
The content of the invention
Applied in Altai Sheep meat production selection and breeding specifically for SEC62 genes for having not been reported in the prior art and
The state of the art of the particularity of Altai Sheep kind, the present invention intends to provide gene containing SEC62 to improve Altay mutton
The detection kit of matter character, for improving Altai Sheep meat production.
In order to achieve the goal above, the technical solution adopted in the present invention is：
The present invention provides the detection kit that gene containing SEC62 is used to improve Altai Sheep Meat Quality, and kit includes：
(1) specific primer：
SEC62 specific primers：
Sense primer F：5'-GATAGCAGCCACCCTCTTCC-3'；
Anti-sense primer R：5'-ACGAGCAACAGCAAGGAGAA-3'.
(2) cDNA templates.
(3) fluorescence quantitative PCR reaction solution and without RNase water.
Preferably, the kit includes 2.5 × Real Master Mix10 μ l, each 0.4 μ l of upstream and downstream primer,
1.5 μ l of cDNA templates.
Further, the present invention provides answering for the detection kit that gene containing SEC62 is used to improve Altai Sheep Meat Quality
With comprising the following steps：
(1) cDNA is extracted：Altai Sheep blood sample 5ml is taken, extracts RNA, in -80 DEG C of preservations；Reverse transcription is cDNA, with interior
Join Gene A CTB and carry out PCR amplification.
(2) SEC62 gene PCRs expand：Two segments of specific amplification SEC62 genes；Reaction condition is：94 DEG C of pre- changes
Property 5min, 94 DEG C denaturation 30s, annealing temperature 30s, 72 DEG C extension 1min, cycle 31 times, 72 DEG C extension 5min, 4 DEG C preservation.
(3) fluorescence quantitative PCR detection：Quantitative fluorescent PCR reaction system is separately added into 96 orifice plates：2.5×
10 μ l of RealMasterMix (SYBR Green), each 1.5 μ l of 0.4 μ l, cDNA template of upstream and downstream primer, add water to 20 μ of total volume
l；Cycling condition is 95 DEG C of pre-degeneration 30s；95 DEG C of denaturation 5s；60 DEG C of annealing 30s are cycled for 42 totally；Finally 95 DEG C of 10s, 65 DEG C
5s, 94 DEG C of 5s, make melting curve.
(4) association analysis of gene expression amount and protein content and amino acid content：To SEC62 genes in Altai Sheep
Expression quantity in quadriceps muscle of thigh carries out significance test with necessary amino acid content.
In the present invention, in the design of Altai Sheep SEC62 gene-specific primers, pass through International Molecular biological information website
NCBI (National Center for Biotechnology), retrieval obtain the cDNA sequence of sheep SEC62 gene sums
(GenBank accession number：SEC62:NM_004003175.3), by known software Primer5.0, voluntarily engineer is specific
Primer, primer sequence are voluntarily synthesized.
By using the technical solution of above-mentioned offer, the present invention obtains following advantageous effect：
(1) gene containing SEC62 provided by the invention is used to improve the detection kit of Altai Sheep Meat Quality, and passes through
Designed, designed primer is analyzed, Amplification Analysis obtains expression quantity in Altai Sheep longissimus dorsi muscle and contains with intramuscular fat acid content, moisture
Amount and longissimus dorsi muscle shearing force related coefficient be 0.8-1.0, extremely strong correlation；In other kind sheep longissimus dorsi muscles expression quantity with it is intramuscular
Content of fatty acid, moisture and longissimus dorsi muscle shearing force related coefficient are 0.0-0.2, without apparent correlation, illustrate the present invention
The detection kit that the gene containing SEC62 provided is used to improve Altai Sheep Meat Quality has preferable specificity.
(2) present invention is used to improve the detection kit process of Altai Sheep Meat Quality by providing gene containing SEC62
Using, the expression quantity of Altay, Xinjiang sheep SEC62 genes is detected, in Altai Sheep group, the expression of SEC62 genes
Measure, P significantly correlated with the meat of Altai Sheep<0.05；This result shows that, SEC62 genes can be used as Altai Sheep influence meat
One molecular labeling of matter, the detection kit of the gene provided by the invention containing SEC62 improve the meat of Altai Sheep for selection and breeding
Matter performance has practicability.The foundation of the present invention for selection and breeding Altai Sheep improved seeds, is providing the theory of marker assisted selection
While basis and technical support, the improved seeds resource, raising peasants and herdsmen income, quickening for protecting Altai Sheep are new
The development of boundary Sheep has actual application value.
Description of the drawings
Fig. 1 is total serum IgE product electrophoretogram.
Fig. 2 is pcr amplification product electrophoretogram, and in figure, M be DL2000 DNA Marker, swimming lane 1-10 for PCR amplification production
Object.
Fig. 3 is the melting curve figure of SEC62 genes.
Specific embodiment
In the following, illustrating the present invention for embodiment, still, the present invention is not limited to following embodiments.Setting in the present invention
Standby and material has：
Main raw material(s) and related reagent of use etc.：Trizol Total RNA Reagent total RNA extraction reagents by
Beijing Tiangeng company provides；Serum Clot Activator vacuum blood collection serum tubes are by Austria
Greiner Bio-One companies provide；2 × Taq PCR MasterMix are provided by Bo Maide biological (PC0912)；DL2000
DNA Marker are provided by village alliance biological (ZM404-1)；EB is provided by the precious letter in Xinjiang.
Key instrument equipment：TG16-W high speed centrifugal machine for minim originates from Changsha Xiang Yi centrifuges Instrument Ltd.；DYCZ-
24F types electrophoresis tank and DYY-6C type electrophoresis apparatuses originate from Beijing Liuyi Instrument Factory；AL204-IC electronic balances originate from plum Teller-support
Strangle (Shanghai) Co., Ltd. of multiple instruments factory；JY04S gel imagers originate from Beijing Jun Yi east electrophoresis equipment Co., Ltd；Constant temperature
Case thermostatic control oscillator vibration originates from Beijing Sang Yi laboratory apparatus research institute.
All raw and auxiliary materials, reagent and the instrument selected in the present invention, equipment are all well known in the art selection, but unlimited
The implementation of the present invention is made, other some reagents well known in the art and equipment are applied both to the reality of implementation below of the present invention
It applies.
Embodiment one：
The present invention provides the detection kit that gene containing SEC62 is used to improve Altai Sheep Meat Quality, and kit includes：
(1) specific primer：
SEC62 specific primers：
Sense primer F：5'-GATAGCAGCCACCCTCTTCC-3'；
Anti-sense primer R：5'-ACGAGCAACAGCAAGGAGAA-3'.
(2) cDNA templates.
(3) fluorescence quantitative PCR reaction solution and without RNase water.
Including 2.5 × Real Master Mix10 μ l, each 1.5 μ l of 0.4 μ l, cDNA template of upstream and downstream primer.
Embodiment two：
1st, geneome RNA extracts：
Gather Altai Sheep jugular vein blood 5ml to be measured, sodium citrate anti-freezing, Liquid nitrogen storage；
RNA is extracted, in -80 DEG C of preservations；Reverse transcription is cDNA, and PCR amplification is carried out with reference gene ACTB.
Prepare 0.8% Ago-Gel：Agarose 0.8g, is dissolved in 0.5 × TBE of 100ml, and micro-wave oven is heated to fully molten
Solution, waits to be cooled to room temperature to pour into and is inserted in the glue groove of comb, for use after cooled and solidified.
Electrophoresis detection, voltage 100V, electric current 50mA, electrophoresis 30 minutes are carried out using 0.8% Ago-Gel of preparation.Through
Bromination ingot dye 15 minutes after, irradiated under gel imager ultraviolet lamp, referring to shown in attached drawing 1, observe band size and
Brightness judges the extraction quality of cDNA.
2nd, PCR amplification：
(1) design of primers and synthesis
According to mRNA sequence (the GenBank accession number of sheep SEC62 genes：SEC62:NM_004003175.3), utilize
Software Primer5.0 independent design primers, the synthesis of primer designed, designed.The sequence of the primer of design is respectively：
Upstream primer sequence F：5'-GATAGCAGCCACCCTCTTCC-3',
Downstream primer sequence R：5'-ACGAGCAACAGCAAGGAGAA-3'；Amplified fragments size be 155bp, base referring to
The gene order table of attached offer.
(2) pcr amplification reaction system and program optimization
According to the primer of design, two segments of specific amplification SEC62 genes.PCR reaction systems are：Mix 10.0μ
L, each 0.4 μ l of upstream and downstream primer, 1.5 μ l of DNA profiling add water to 20 μ l of total volume；Reaction condition is：94 DEG C of pre-degeneration 5min,
94 DEG C of denaturation 30s, annealing temperature 30s, 72 DEG C of extension 1min cycle 31 times, 72 DEG C of extension 5min, 4 DEG C of preservations.
The annealing temperature of pcr amplification reaction program is optimized.In the case where other reaction conditions are constant, in PCR
Gradient is set on instrument to annealing temperature, and gradient scope is 55 DEG C -65 DEG C, i.e., average each plate hole transformation temperature is 1 DEG C.Through
1.5% agarose gel electrophoresis detects, and observes brightness and the purity of amplified band, and the most suitable annealing temperature of final definite primer is
60℃。
The product of specific amplification is detected by 1.5% agarose gel electrophoresis, voltage 100V, electrophoresis 30min, through bromination
After ingot EB dyeing 15min, irradiated under Bio-RAD gel imager ultraviolet lamps, observe size and the brightness of amplified band, judged
PCR product expands quality.As a result referring to attached drawing 2.
3rd, fluorescence quantitative PCR detection：
Quantitative fluorescent PCR reaction system is separately added into 96 orifice plates：2.5×RealMasterMix(SYBR
Green) 10 μ l, each 1.5 μ l of 0.4 μ l, cDNA template of upstream and downstream primer, add water to 20 μ l of total volume；Entire reaction is in BIO-RAD
It is carried out in quantitative fluorescent PCR sequence amplification instrument, cycling condition is 95 DEG C of pre-degeneration 30s；95 DEG C of denaturation 5s；60 DEG C of annealing 30s are total to
42 Xun Huans；Finally in 95 DEG C of 10s, 65 DEG C of 5s, 94 DEG C of 5s, make melting curve, as shown in Figure 3.To ensure the expansion of specificity
Increase, it is desirable that only there are one peaks for obtained melting curve.
4th, association analysis：
Using software SPSS20.0, the expression quantity of gene and Amino acid and protein content are associated analytical control,
As a result such as the following table 1：
Table 1:The expression quantity of Altai Sheep SEC62 genes and Amino acid and protein content association analysis
| Protein content | It must amino acid content | Nonessential amino acid content | |
| Altai Sheep | 0.94 | 0.76* | 0.94 |
Note：* significantly correlated (P is represented<0.05).
As it can be seen from table 1 in Altay, Xinjiang sheep, the expression quantity of SEC62 genes and the meat of Altai Sheep
It is significantly correlated, P<0.05；This result shows that, SEC62 genes can as Altai Sheep influence meat a molecular labeling, this
The detection kit that the gene containing SEC62 that invention provides is used to improve Altai Sheep Meat Quality has practicability.
Embodiment three：
Based on embodiment two, the gene containing SEC62 provided using above-described embodiment is used to improve Altai Sheep Meat Quality
Detection kit be applied to mouse, Small-fat-tail sheep, Karacul and field sheep, Kazakh sheep, in Ba Yin Brooker sheep, see
Survey expression quantity of the SEC62 genes in its longissimus dorsi muscle and intramuscular fat acid content, moisture and longissimus dorsi muscle shearing force
The degree of association.Specifically it is shown in Table 2：
Table 2:SEC62 gene expression amounts and the related coefficient of part meat index
| Content of fatty acid | Moisture | Longissimus dorsi muscle shearing force | |
| Altai Sheep | 0.93 | 0.82 | 0.99 |
| Mouse | 0.47 | 0.42 | 0.55 |
| Small-fat-tail sheep | 0.15 | 0.18 | 0.08 |
| Karacul | 0.15 | 0.09 | 0.17 |
| With field sheep | 0.12 | 0.04 | 0.13 |
| Kazakh sheep | 0.08 | 0.17 | 0.19 |
| Ba Yin Brooker sheep | 0.07 | 0.09 | 0.06 |
Note：0.0-0.2 is without correlation, the moderate correlations of 0.4-0.6, the extremely strong correlations of 0.8-1.0.
It is analyzed from table 2, expression quantity and intramuscular fat acid content, moisture and the back of the body be most in Altai Sheep longissimus dorsi muscle
Long flesh shearing force related coefficient is 0.8-1.0, represents extremely strong correlation；SEC62 genes expression quantity and flesh in mouse longissimus dorsi muscle
Interior content of fatty acid related coefficient is 0.4-0.6, represents moderate correlation, expression quantity and flesh in other kind sheep longissimus dorsi muscles
Interior content of fatty acid, moisture and longissimus dorsi muscle shearing force related coefficient are 0.0-0.2, without apparent correlation, illustrate this hair
The detection kit that the gene containing SEC62 of bright offer is used to improve Altai Sheep Meat Quality has preferable specificity.
Example IV：
The blood sample 5ml of Altai Sheep individual to be measured is gathered, extracts RNA, and reverse transcription is cDNA；The sequence of primer is obtained,
PCR amplification is carried out, wherein annealing temperature is 60 DEG C；Its expression quantity is detected using fluorescent quantitative PCR technique, by its table
Up to amount analysis is associated with Amino acid and protein content.It is low for the gene expression amount, it can eliminate；Expression quantity is high,
It can continue to employ, the meat of selection and breeding raising Altai Sheep is carried out with this.
Table 3:Different Altai Sheep individual SEC62 gene expression amounts
As shown in Table 3, the SEC62 gene expression amounts of No. 5 Altai Sheeps can be continued to employ apparently higher than other；Other Altays
Sheep SEC62 gene expression amounts are relatively low, can eliminate, and the meat of selection and breeding raising Altay, Xinjiang sheep is carried out with this.
The SEC62 kit genes for being applicable in Altai Sheep meat production selection and breeding provided by above-described embodiment, it is seen that this
It is strong to invent the primer specificity provided, expanding effect and reproducible, its expansion of SEC62 kit genes fluorescence quantitative PCR detection
Increase curve and melting curve performance is good, the expression quantity of Altay, Xinjiang sheep SEC62 genes is detected in addition, intramuscular fat
Content and content of fatty acid and mutton meat quality close association, SEC62 is as the gene for influencing fat metabolism, in lipid-metabolism
It plays an important role in the process.The foundation of the present invention for selection and breeding Altai Sheep improved seeds, provides marker assisted selection
Theoretical foundation and while technical support, for protect the improved seeds resource of Altai Sheep, improve peasants and herdsmen's income,
Accelerating the development of Xinjiang meat sheep industry has actual application value.
As described above, you can preferably realize the present invention, the above embodiments are only the side of being preferably implemented to the present invention
Formula is described, and not the scope of the present invention is defined, and on the premise of design spirit of the present invention is not departed from, this field is general
The various changes and improvement that logical technical staff makes technical scheme, should all fall into present invention determine that protection domain
It is interior.
Sequence table
<110>Xinjiang Agricultural Univ
<120>Gene containing SEC62 is used to improve the detection kit of Altai Sheep Meat Quality
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<220>
<221> primer_bind
<222>(1) .. (20)
<223>SEC62 upstream region of gene primers
<400> 1
gatagcagcc accctcttcc 20
<210> 2
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<220>
<221> primer_bind
<222>(1) .. (20)
<223>SEC62 downstream of gene primers
<400> 2
acgagcaaca gcaaggagaa 20
Claims (4)
1. gene containing SEC62 is used to improve the detection kit of Altai Sheep Meat Quality, which is characterized in that the kit
Including：
（1）Specific primer：
SEC62 specific primers：
Sense primer F：5'-GATAGCAGCCACCCTCTTCC-3'；
Anti-sense primer R：5'-ACGAGCAACAGCAAGGAGAA-3'；
（2）CDNA templates；
（3）Fluorescence quantitative PCR reaction solution and without RNase water.
2. gene containing SEC62 is used to improve the detection kit of Altai Sheep Meat Quality as described in claim 1, feature exists
In the fluorescence quantitative PCR reaction solution is 2.5 × Real Master Mix.
3. gene containing SEC62 is used to improve the detection kit of Altai Sheep Meat Quality as described in claim 1, feature exists
In the kit includes 2.5 × Real Master Mix10 μ l, each 1.5 μ l of 0.4 μ l, cDNA template of upstream and downstream primer.
4. a kind of gene containing SEC62 as described in claim 1 is used to improve answering for the detection kit of Altai Sheep Meat Quality
With, which is characterized in that comprise the following steps：
（1）CDNA is extracted：Altai Sheep blood sample 5ml is taken, extracts RNA, in -80 DEG C of preservations；Reverse transcription is cDNA, with internal reference base
Because ACTB carries out PCR amplification；
（2）SEC62 gene PCRs expand：Two segments of specific amplification SEC62 genes；Reaction condition is：94 DEG C of pre-degenerations
5min, 94 DEG C of denaturation 30s, annealing temperature 30s, 72 DEG C of extension 1min cycle 31 times, 72 DEG C of extension 5min, 4 DEG C of preservations；
（3）Fluorescence quantitative PCR detection：Quantitative fluorescent PCR reaction system is separately added into 96 orifice plates：2.5×
10 μ l of RealMasterMix (SYBR Green), each 1.5 μ l of 0.4 μ l, cDNA template of upstream and downstream primer, add water to total volume 20
μl；Cycling condition is 95 DEG C of pre-degeneration 30s；95 DEG C of denaturation 5s；60 DEG C of annealing 30s are cycled for 42 totally；Finally 95 DEG C of 10s, 65
DEG C 5s, 94 DEG C of 5s, make melting curve；
（4）The association analysis of gene expression amount and protein content and amino acid content：To SEC62 genes in Altai Sheep stock four
Expression quantity in head flesh carries out significance test with necessary amino acid content.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711463968.8A CN108048577A (en) | 2017-12-28 | 2017-12-28 | Gene containing SEC62 is used to improve the detection kit of Altai Sheep Meat Quality |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711463968.8A CN108048577A (en) | 2017-12-28 | 2017-12-28 | Gene containing SEC62 is used to improve the detection kit of Altai Sheep Meat Quality |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108048577A true CN108048577A (en) | 2018-05-18 |
Family
ID=62128620
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711463968.8A Pending CN108048577A (en) | 2017-12-28 | 2017-12-28 | Gene containing SEC62 is used to improve the detection kit of Altai Sheep Meat Quality |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108048577A (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103525920A (en) * | 2013-09-29 | 2014-01-22 | 新疆农业大学 | Molecular marker method for breeding meat performance of Aletail sheep and application thereof |
-
2017
- 2017-12-28 CN CN201711463968.8A patent/CN108048577A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103525920A (en) * | 2013-09-29 | 2014-01-22 | 新疆农业大学 | Molecular marker method for breeding meat performance of Aletail sheep and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| GENBANK: "Ovis aries SEC62 homolog,preprotein translocation factor(SEC62),mRNA", 《GENBANK》 * |
| 方国松等: "《统计学》", 31 July 2017, 华南理工大学出版社 * |
| 沈定霞: "《医学重要真菌鉴定指南 第5版》", 30 September 2016, 中华医学电子音像出版社 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105274099B (en) | The primer of 9 kinds of animal derived materials, probe compositions, kit and its detection method and application in Rapid identification food or feed | |
| CN105274246B (en) | The detection kit of several species kind derived components in calf-derived Cyclospora identification and its product | |
| CN105296647A (en) | Detection kit for sheep origin component identification and detection of multi-species origin components in products | |
| CN105296648B (en) | Fox derived component identify and animal product in fox, rabbit, dog ingredient multiple PCR detection kit | |
| CN105063021B (en) | The SNP marker related to label of pig fat deposition description and its application | |
| CN105969845B (en) | The molecular labeling of eye muscle area character related gene SVEP1 and its application | |
| CN105238859A (en) | Method for acquiring chicken whole genome high-density SNP marker sites | |
| CN110129452A (en) | The molecular labeling and its identification method of a kind of early stage identification duck slaughter paramenter and application | |
| CN103525920A (en) | Molecular marker method for breeding meat performance of Aletail sheep and application thereof | |
| CN108342495A (en) | Sheep and goat source property synchronizes the primer and probe and kit of detection in meat products | |
| CN103898231B (en) | A kind of SNP marker relevant to pork pH proterties and application thereof | |
| CN107841566A (en) | Composite amplification system, kit and the application of rapid mutation Y chromosome STR | |
| CN107557438A (en) | A kind of method based on high-flux sequence detection freshwater shrimp enteron aisle lactic acid bacteria | |
| CN106434988A (en) | Wu-he dipsacus asper ISSR-PCR molecule marking method | |
| CN107955837B (en) | AFLP primer combination product, kit and method for identifying individual and variety of pig | |
| CN107988392A (en) | Gene containing SEC61A1 is used for the kit for improving Altai Sheep meat production | |
| CN108048577A (en) | Gene containing SEC62 is used to improve the detection kit of Altai Sheep Meat Quality | |
| CN110157818B (en) | Molecular marker related to high-yield characteristics of porcine eye muscles and application thereof | |
| CN107904319A (en) | Gene containing PRKAA1 is used for the detection kit for improving Altai Sheep Meat Quality | |
| CN107988393A (en) | Gene containing COL1A1 improves the detection kit of Altai Sheep Meat Quality | |
| CN108192980A (en) | Gene containing ACSL1 is used to improve the detection kit of the black mutton quality character in Turfan | |
| CN110144406A (en) | A kind of method and its application of screening section treasured broiler chicken DNA bar code | |
| CN107893121A (en) | Gene containing ACSL4 is used for the detection kit for improving the black mutton quality character in Turfan | |
| CN105296646A (en) | Detection kit for pig origin component identification and detection of multi-species origin components in products | |
| CN109055588A (en) | Specific primer, kit and the PCR detection method of the outstanding Bordetella of a pair of detection uncle |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Liu Wujun Inventor after: Wang Yanxin Inventor after: Ma Haiyu Inventor after: Fang Chao Inventor after: Fang Lijun Inventor after: Zhao Guoyi Inventor after: Liu Lingling Inventor after: Yu Qian Inventor after: Chu Hongzhong Inventor after: Xu Dong Inventor before: Liu Wujun Inventor before: Ma Haiyu Inventor before: Fang Chao Inventor before: Fang Lijun Inventor before: Zhao Guoyi Inventor before: Liu Lingling Inventor before: Yu Qian Inventor before: Chu Hongzhong |
|
| CB03 | Change of inventor or designer information | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20180518 |
|
| WD01 | Invention patent application deemed withdrawn after publication |