CN107988393A - Gene containing COL1A1 improves the detection kit of Altai Sheep Meat Quality - Google Patents
Gene containing COL1A1 improves the detection kit of Altai Sheep Meat Quality Download PDFInfo
- Publication number
- CN107988393A CN107988393A CN201711461786.7A CN201711461786A CN107988393A CN 107988393 A CN107988393 A CN 107988393A CN 201711461786 A CN201711461786 A CN 201711461786A CN 107988393 A CN107988393 A CN 107988393A
- Authority
- CN
- China
- Prior art keywords
- col1a1
- sheep
- altai
- pcr
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the detection kit that gene containing COL1A1 improves Altai Sheep Meat Quality, according to mRNA sequence voluntarily engineer's specific primer using sheep COL1A1 genes, sense primer：5'‑ TACAGCGTCACCTACGACGG‑3'；Anti-sense primer：5'AAGCCGAATTCCTGGTCTG 3', PCR amplification is carried out by template of sample genomic dna, fluorescence quantitative PCR detection is carried out to pcr amplification product, and the association analysis of gene expression amount and intramuscular fat acid content, moisture and longissimus dorsi muscle shearing force is carried out, show that the present invention has Altai Sheep preferable specificity；The present invention has not only filled up the blank of the domestic and international research field, but also for protecting the improved seeds development of resources of Altai Sheep and sustainable use establishes molecular theory basis, accelerates the development of Xinjiang meat sheep industry and be of great significance and actual application value.
Description
Technical field
The present invention relates to the identification method of animal hereditary and selection, specifically, the present invention relates to a kind of Altai Sheep succulence
The technical field of the kit of shape selection and breeding.
Background technology
Xinjiang is one of five big pastoral area of China, and mutton total output occupies the leading place in the whole country；Xinjiang is regional as a small number of name races at the same time,
The demand of mutton increases in rigidity so that mutton production amount is difficult to the demand for meeting that people are growing in region.For solution
Certainly this problem, the genetic mechanism parsing for depending on the abundant and unique sheep variety in Xinjiang are particularly important.A Le
Safe sheep it is with a long history, be commonly called as the big tail sheep of Fu Hai, be the principal item in Xinjiang Animal Husbandry animal species structure, and obtained geographical mark
Will, incorporates《Chinese geography famous special product grand ceremony》.Major production areas concentrates on Altay Prefecture Fuhai County, the Fuyun of In The North of Xinjiang
The ground such as county, Qinghe County, but with introducing a fine variety between field and section exchanges, Altai Sheep is all distributed substantially in full boundary now.Ah
Strangle safe sheep and belong to fat stern sheep variety, belong to meat dual-purpose coarse-wooled sheep, have that resistance to crude feed, anti-severe cold, resistance is strong, fit for depasturing,
And the features such as constitution is solid, Lamb Growth is fast, muscle development is good, production meat amount is high.
Altai Sheep has its unique as Xinjiang representativeness improved seeds, should carry out effective protection of variety source,
But due to being improved for a long time without selection and breeding in recent years, its excellent production meat characteristic is not developed reasonably, greatly unfavorable
In the reasonable development of variety source and the development of Xinjiang meat sheep industry.At present, with advanced technology means, with reference to modern breeding skill
Art and traditional breeding way, Development in Xinjiang advantage Characteristic Stockbreeding, improves sheep improved variety degree, cultivates mutton sheep specialization product
Kind, improve Mutton yield and meat is horizontal, be to speed up the effective means of Xinjiang Sheep industry development.
Intramuscular fat (Intramuscular fat, IMF), refers specifically to the fat deposition in intramuscular fiber and muscle bundle,
Positive correlation is presented with the mouthfeel and quality of meat, in general, intramuscular fat content significantly affects the quality of meat, is particularly tenderness and succulence
Property.The increase of intramuscular fat content, significantly affects marbled scoring (P<0.05).Generally, adipose tissue can be distributed in flesh
On the exomysium of meat, connective fiber distance is set to become remote, by heat treatment, adipocyte is destroyed, and when trial test can produce ratio
Relatively slide tender, fresh, succulence mouthfeel.
COL1A1 genes (Collagen type I alpha 1, COL1A1) are positioned at No. 11 chromosomes of sheep, it is encoded
Be COL1 1 chains of α, Type I collagen albumen is to form extracellular matrix main group of (Extracellular Matrix, ECM)
Into component, provide support for biological organs form, play a significant role between cell development and cell in interaction.At it
Also there is part research for the gene on his animal, the erythrocyte distribution width and dressing percentage (DP%) of COL1A1 gene pairs pigs are deposited
In certain regulating and controlling effect, wide to the point of the buttocks of ox have certain regulating and controlling effect, to beef cattle difference marbling grade point
Found in the research of handset, longissimus dorsi muscle marbling is rated 1 grade and marbling is rated between two groups of 6 grades
COL1A1 genes have differences expression, and it is the weight for participating in Meat Quality difference before and after regulation and control Qinchuan Cattle is castrated to illustrate COL1A1 genes
Want controlling gene.Research on sheep there is no the gene pairs Altay mutton primarily directed to the research of disease prevention and cure process
The research that matter influences, and the particular research for the improvement of Altai Sheep special Xinjiang typicalness kind meat.The prior art
Research and the report that selection and breeding raising is carried out using COL1A1 gene pairs Altai Sheeps Meat Quality are not had not seen at home and abroad.
The content of the invention
The dividing in Altai Sheep Meat Quality selection and breeding specifically for COL1A1 genes is reported for having no in the prior art
The state of the art of the particularity of sub- marker research and Altai Sheep kind, it is contemplated that being improved to provide gene containing COL1A1
The detection kit of Altai Sheep Meat Quality, the meat guality of Altai Sheep is improved for selection and breeding.
In order to realize the above object the technical solution adopted in the present invention is：
The present invention provides the detection kit that gene containing COL1A1 improves Altai Sheep Meat Quality, and kit passes through following
The system of building together builds up acquisition：
(1) primer pair is designed：Using the mRNA sequence of sheep COL1A1 genes, voluntarily engineer's specific primer.
(2) PCR reaction reagents：Mix, upstream and downstream primer, cDNA templates and without RNase water.
Preferably, the specific primer described in system of building together (1) is as follows：
COL1A1 primers：
Sense primer F：5'-TACAGCGTCACCTACGACGG-3'；
Anti-sense primer R：5'-AAGCCGAATTCCTGGTCTG-3'.
Further, the present invention provides the application that gene containing COL1A1 improves the detection kit of Altai Sheep Meat Quality,
Comprise the following steps：
(1) Altai Sheep longissimus dorsi muscle RNA is extracted：Altai Sheep longissimus dorsi muscle 30-50mg is taken, RNA is extracted, -80
DEG C preserve；Reverse transcription is cDNA, and PCR amplification, 1.5% agarose gel electrophoresis detection, through bromination are carried out with reference gene ACTB
After ingot dyeing, irradiated under gel imager ultraviolet lamp, observe size and the brightness of band, judge the extraction and transcription of cDNA
Quality.
(2) COL1A1 gene PCRs expand：According to the two pairs of primers designed in the system of building together, specific amplification COL1A1 bases
Two fragments of cause；PCR reaction systems are：10.0 μ l of Mix, each 1.5 μ l of 0.4 μ l, cDNA template of upstream and downstream primer, add no RNA
Enzyme water is to 20 μ l of cumulative volume；Reaction condition is：94 DEG C of pre-degeneration 5min, 94 DEG C of denaturation 30s, annealing temperature 30s, 72 DEG C of extensions
1min, circulates 35 times, 72 DEG C of extension 5min, 4 DEG C of preservations；Two PCR products of specific amplification are by 1.5% Ago-Gel
Electrophoresis detection, after bromination ingot dyeing, irradiates under gel imager ultraviolet lamp, observes size and the brightness of amplified band, sentence
Disconnected PCR product amplification quality.
(3) fluorescence quantitative PCR detection：Quantitative fluorescent PCR reaction system is separately added into 96 orifice plates：2.5×
10 μ l of RealMasterMix (SYBR Green), each 1.5 μ l of 0.4 μ l, cDNA template of upstream and downstream primer, add no RNase water to total
20 μ l of volume；Whole reaction carries out in BIO-RAD quantitative fluorescent PCR sequence amplification instrument, and cycling condition is 95 DEG C of pre-degenerations
30s；95 DEG C of denaturation 5s；60 DEG C of annealing 30s totally 40 circulations；Finally in 95 DEG C of 10s, 65 DEG C of 5s, 94 DEG C of 5s, make melting curve.
(4) gene expression amount and the association analysis of intramuscular fat acid content, moisture and longissimus dorsi muscle shearing force：Draw
Expression quantity of the COL1A1 genes in Altai Sheep longissimus dorsi muscle is with intramuscular fat acid content, longissimus dorsi muscle shearing force in significantly just
Related (P ＜ 0.05) is in significantly negatively correlated (P ＜ 0.05) with moisture, shows the meat of COL1A1 gene pairs Altay mutton
Matter plays certain regulating and controlling effect.Illustrate the effect gene Altai Sheep muscle nutrition metabolism, can be used as influences to determine A Le
The molecular labeling of safe mutton quality character.
In the present invention, the fluorescent quantitative PCR technique of application is known in the art technological means, is ordinary skill people
The common technique means that member uses.
In the present invention, in the design of Altai Sheep COL1A1 gene-specific primers, pass through International Molecular biological information website
NCBI (National Center for Biotechnology), retrieval obtain sheep COL1A1 genes and cDNA sequence, by
Known software Primer5.0, voluntarily engineer's specific primer, primer sequence are voluntarily synthesized.
By using the technical solution of above-mentioned offer, the present invention obtains following beneficial effect：
(1) in the present invention, in a kind of kit for selection and breeding Altai Sheep Meat Quality is built, existing skill is being used
COL1A1 genes as influence Stock genetics and breeding candidate gene and build kit in art, particularly suitable for being applicable in sheep
Technology in terms of carrying out selection and breeding raising with Altai Sheep Meat Quality has no report, since Altai Sheep kind is located in long-term low temperature,
Winter is up to nearly half a year, and most cold reachable -35 DEG C to -40 DEG C, and since natural conditions are severe, many improved seeds herein can not
Existence；It can be seen that Altai Sheep is under extremely severe habitat conditions, it is only and what is formed by long-term nature and artificial selection
Special germ plasm resource.Based on this, gene detecting kit containing COL1A1 provided by the invention is applied to pig, octave Brooker
In sheep, Tashkurgan sheep, Ba Shibai sheep, Xinjiang Merino, Kirgiz sheep and field sheep, Analysis for CO L1A1 gene expression amounts
With the degree of association of intramuscular fat acid content, moisture and longissimus dorsi muscle shearing force, the results showed that only Altai Sheep COL1A1
The degree of association of gene expression amount and intramuscular fat acid content, moisture and longissimus dorsi muscle shearing force is in table between 0.8-1.0
It is now extremely strong correlation, remaining animal COL1A1 gene expression amount is cut with intramuscular fat acid content, moisture and longissimus dorsi muscle
The degree of association of shear force shows as non-correlation between being in 0.0-0.2.Therefore gene detection reagent containing COL1A1 provided by the invention
Box has preferable specificity for Altai Sheep, this improves Altai Sheep meat guality for selection and breeding and reasonably optimizing germplasm provides
Source has important and far-reaching technical contribution and realistic function.
(2) present invention improves the detection kit of Altai Sheep Meat Quality, profit by specifically providing gene containing COL1A1
The expression quantity of Altay, Xinjiang sheep COL1A1 genes is detected with kit gene, and with intramuscular fat acid content, moisture
The association analysis of content and longissimus dorsi muscle shearing force, draws expression quantity and flesh of the COL1A1 genes in Altai Sheep longissimus dorsi muscle
Interior content of fatty acid, longissimus dorsi muscle shearing force are in notable negative correlation (P ＜ in notable positive correlation (P ＜ 0.05) and moisture
0.05), show that the meat of COL1A1 gene pairs Altay mutton plays regulating and controlling effect.Illustrate the effect gene Altai Sheep flesh
Meat nutrient metabolism, can be contained with present invention offer accordingly as the molecular labeling for influencing decision Altai Sheep Meat Quality
COL1A1 gene detecting kits improve the meat guality of Altai Sheep.This has not only filled up the sky of this domestic and international research field
In vain, and for protecting the improved seeds development of resources of Altai Sheep and sustainable use to establish molecular theory basis, accelerating newly
The development of boundary Sheep is of great significance and actual application value.
Brief description of the drawings
Fig. 1 is total serum IgE product electrophoretogram.
Fig. 2 is pcr amplification product electrophoretogram, and in figure, M is that DL2000 DNA Marker, swimming lane 1-10 produce for PCR amplification
Thing.
Embodiment
In the following, illustrating the present invention for embodiment, still, the present invention is not limited to following embodiments.Setting in the present invention
Standby and material has：
Main raw material(s) and related reagent of use etc.：Trizol Total RNA Reagent total RNA extraction reagents by
Beijing Tiangeng company provides；Serum Clot Activator vacuum blood collection serum tubes are by Austria
Greiner Bio-One companies provide；2 × Taq PCR MasterMix are provided by Bo Maide biological (PC0912)；DL2000
DNA Marker are provided by village alliance biological (ZM404-1)；EB is provided by the precious letter in Xinjiang；2.5×RealMasterMix(SYBR
Green) provided by Japanese Takara companies.
Key instrument equipment：TG16-W high speed centrifugal machine for minim originates from Changsha Xiang Yi centrifuges Instrument Ltd.；DYCZ-
24F types electrophoresis tank and DYY-6C type electrophoresis apparatuses originate from Beijing Liuyi Instrument Factory；AL204-IC electronic balances originate from plum Teller-support
Strangle (Shanghai) Co., Ltd. of multiple instruments factory；JY04S gel imagers originate from Beijing Jun Yi east electrophoresis equipment Co., Ltd；Constant temperature
Case thermostatic control oscillator vibration originates from Beijing Sang Yi laboratory apparatus research institute；CFX-96 fluorescence quantitative PCR instruments originate from U.S. Bio-Rad
Company.
All raw and auxiliary materials, reagent and the instrument selected in the present invention, equipment are all well known in the art selection, but unlimited
The implementation of the present invention is made, other some reagents well known in the art and equipment are applied both to the reality of implementation below of the present invention
Apply.
Embodiment one：
Gene containing COL1A1 improves the detection kit of Altai Sheep Meat Quality, and kit is especially by following body of building together
System builds up acquisition：
(1) primer pair is designed：Using the mRNA sequence of sheep COL1A1 genes, voluntarily engineer's specific primer, draws
Thing is as follows：
COL1A1 primers：
Sense primer F：5'-TACAGCGTCACCTACGACGG-3'；
Anti-sense primer R：5'-AAGCCGAATTCCTGGTCTG-3'.
(2) PCR reaction reagents：Mix, upstream and downstream primer, cDNA templates and without RNase water.
Embodiment two：
The present invention provides the application that gene containing COL1A1 improves the detection kit of Altai Sheep Meat Quality, including following
Step：
(1) geneome RNA extracts：
Gather Altai Sheep longissimus dorsi muscle 30-50mg to be measured, Liquid nitrogen storage；RNA is extracted, in -80 DEG C of preservations；Reverse transcription is
CDNA, PCR amplification is carried out with reference gene ACTB.
Prepare 1.5% Ago-Gel：Agarose 1.5g, is dissolved in 0.5 × TBE of 100ml, and micro-wave oven is heated to fully molten
Solution, waits to be cooled to room temperature to pour into and is inserted with the glue groove of comb, stand-by after cooled and solidified.
Electrophoresis detection, voltage 100V, electric current 50mA, electrophoresis 35 minutes are carried out using 1.5% Ago-Gel of preparation.Through
After bromination ingot dyeing 15 minutes, irradiated under gel imager ultraviolet lamp, observe size and the brightness of band, judge cDNA's
Extract quality.As a result referring to attached drawing 1.
(2) PCR amplification：
Pcr amplification reaction system and program optimization.According to the two pairs of primers designed in above-mentioned system of building together, specific amplification
Two fragments of COL1A1 genes.PCR reaction systems are：Mix10.0 μ l, each 0.4 μ l of upstream and downstream primer, 1.5 μ l of DNA profiling,
Add no RNase water to 20 μ l of cumulative volume；Reaction condition is：94 DEG C of pre-degeneration 5min, 94 DEG C of denaturation 30s, annealing temperature 30s, 72
DEG C extension 1min, circulate 35 times, 72 DEG C extension 5min, 4 DEG C preservation.
The annealing temperature of the pcr amplification reaction program of primer is optimized.In the case where other reaction conditions are constant,
Gradient is set in PCR instrument to annealing temperature, and gradient scope is 55 DEG C -65 DEG C, i.e., average each plate hole transformation temperature is 1 DEG C.
Detected through 1.5% agarose gel electrophoresis, observe brightness and the purity of amplified band, the most suitable annealing temperature of final definite primer
For 60 DEG C.
Two groups of PCR products of specific amplification are detected by 1.5% agarose gel electrophoresis, voltage 100V, electrophoresis
35min, after ingot EB dyes 15min through bromination, irradiates under Bio-RAD gel imager ultraviolet lamps, observes amplified band
Size and brightness, judge that PCR product expands quality.As a result referring to attached drawing 2.
(3) fluorescence quantitative PCR detection：
Quantitative fluorescent PCR reaction system is separately added into 96 orifice plates：2.5×RealMa ster Mix(SYBR
Green) 10 μ l, each 1.5 μ l of 0.4 μ l, cDNA template of upstream and downstream primer, add water to 20 μ l of cumulative volume；Entirely react in BIO-RAD
Carried out in quantitative fluorescent PCR sequence amplification instrument, cycling condition is 95 DEG C of pre-degeneration 30s；95 DEG C of denaturation 5s；60 DEG C of annealing 30s are total to
40 circulations；Finally in 95 DEG C of 10s, 65 DEG C of 5s, 94 DEG C of 5s, make melting curve.To ensure specific amplification, it is desirable to obtain
Solubility curve only has a peak.
(4) association analysis：
Using software SPSS21.0, the expression quantity of gene and intramuscular fat acid content, moisture and longissimus dorsi muscle are cut
The association analysis of shear force is examined, as a result such as table 1 below：
Table 1:The expression quantity of Altai Sheep COL1A1 genes and the association analysis of part meat index
| Content of fatty acid | Moisture | Longissimus dorsi muscle shearing force | |
| Altai Sheep | 1.000* | -0.997* | 0.99* |
Note：* significantly correlated (P is represented<0.05)；* represents extremely significantly correlated (P<0.01).
As it can be seen from table 1 in Altay, Xinjiang sheep, in the expression quantity and Altai Sheep muscle of COL1A1 genes
Intramuscular fat acid content, longissimus dorsi muscle shearing force are in significant positive correlation (P<0.05), with moisture in significant negatively correlated
(P<0.01).Shown with this, COL1A1 genes can influence a molecular labeling of meat as Altay, Xinjiang sheep, using this hair
The gene detecting kit containing COL1A1 of bright offer can be used for the meat guality of selection and breeding raising Altai Sheep.
Embodiment three：
Based on embodiment two, the gene containing COL1A1 provided using above-described embodiment improves the inspection of Altai Sheep Meat Quality
Test agent box is respectively applied to pig, octave Brooker sheep, Tashkurgan sheep, Ba Shibai sheep, Xinjiang Merino, Kirgiz
In sheep and field sheep, expression quantity and intramuscular fat acid content, moisture and the back of the body of the observation COL1A1 genes in its longissimus dorsi muscle
The degree of association of eye muscle shearing force.Specifically it is shown in Table 2：
Table 2:COL1A1 gene expression amounts and the association analysis of part meat index
| Content of fatty acid | Moisture | Longissimus dorsi muscle shearing force | |
| Altai Sheep | 1.000* | -0.997* | 0.99* |
| Pig | 0.192 | 0.120 | 0.162 |
| Octave Brooker sheep | 0.141 | 0.041 | 0.106 |
| Tashkurgan sheep | 0.157 | 0.113 | 0.105 |
| Ba Shibai sheep | 0.121 | 0.085 | 0.046 |
| Xinjiang Merino | 0.092 | 0.102 | 0.073 |
| Kirgiz sheep | 0.185 | 0.068 | 0.076 |
| With field sheep | 0.056 | 0.097 | 0.175 |
Note：The extremely strong correlations of 0.8-1.0；0.0-0.2 is without correlation.
Being analyzed according to table 2 must be in addition to Altai Sheep, COL1A1 genes expression quantity and intramuscular fat in other animal longissimus dorsi muscles
Fat acid content, moisture and longissimus dorsi muscle shearing force illustrate that gene containing COL1A1 provided by the invention carries without obvious correlation
The detection kit of high Altai Sheep Meat Quality has preferable specificity.
Example IV：
The longissimus dorsi muscle 30-50mg of Altai Sheep individual No. 1 to No. 10 to be measured is gathered, extracts RNA, and reverse transcription is
cDNA；Primer sequence is obtained, carries out PCR amplification, wherein annealing temperature is 60 DEG C；It is expressed using fluorescent quantitative PCR technique
Amount is detected, by the association analysis pair of its expression quantity and intramuscular fat acid content, moisture and longissimus dorsi muscle shearing force
It is low in the gene expression amount, it can eliminate；Expression quantity is high, can continue to employ, and the meat of selection and breeding raising Altay, Xinjiang sheep is taken with this
Matter.
Table 3:Altai Sheep individual COL1A1 gene expression amounts and the association analysis of part meat index
| Altai Sheep | Content of fatty acid+moisture+longissimus dorsi muscle shearing force |
| No. 1 | 0.835 |
| No. 2 | 0.893 |
| No. 3 | 0.862 |
| No. 4 | 0.917 |
| No. 5 | 0.912 |
| No. 6 | 0.903 |
| No. 7 | 0.899 |
| No. 8 | 0.996 |
| No. 9 | 0.875 |
| No. 10 | 0.950 |
Understood according to table 3, the degree of association of No. 8 Altai Sheep individual COL1A1 gene expression amounts and part meat index is most
Greatly, show that expression effect of the COL1A1 genes in No. 8 Altai Sheep individuals is best, using base containing COL1A1 provided by the invention
Carry out the meat that selection and breeding improve Altay, Xinjiang sheep because detection kit can continue to employ and have and obtain notable good technique effect.
The dividing in Altai Sheep Meat Quality selection and breeding specifically for COL1A1 genes is reported for having no in the prior art
The state of the art of sub- marker research, it is contemplated that in order to provide the detection that gene containing COL1A1 improves Altai Sheep Meat Quality
Kit, is detected the COL1A1 gene expression amounts of Altay, Xinjiang sheep using kit gene, and and intramuscular fatty acid
Content, moisture and longissimus dorsi muscle shearing force are associated analysis, analyze COL1A1 genes expression quantity and Altai Sheep
Intramuscular fat acid content, longissimus dorsi muscle shearing force are in significant positive correlation (P in muscle<0.05), with moisture in significant
Negative correlation (P<0.01).Show to carry available for selection and breeding using gene detecting kit containing COL1A1 provided by the invention by experiment
The meat guality of high Altai Sheep simultaneously obtains significantly prominent technique effect.This has not only filled up the sky of this domestic and international research field
In vain, and for protecting the reasonable development of Altai Sheep improved seeds resource and sustainable use, accelerating the development of Xinjiang meat sheep industry
It is of great significance and actual application value.
As described above, you can preferably realize the present invention, the above embodiments are only the side of being preferable to carry out to the present invention
Formula is described, and not the scope of the present invention is defined, and on the premise of design spirit of the present invention is not departed from, this area is general
The various changes and improvement that logical technical staff makes technical scheme, should all fall into present invention determine that protection domain
It is interior.
Sequence table
<110>Xinjiang Agricultural Univ
<120>Gene containing COL1A1 improves the detection kit of Altai Sheep Meat Quality
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<220>
<221> primer_bind
<222>(1) .. (20)
<223>COL1A1 upstream region of gene primers
<400> 1
tacagcgtca cctacgacgg 20
<210> 2
<211> 19
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<220>
<221> primer_bind
<222>(1) .. (19)
<223>COL1A1 downstream of gene primers
<400> 2
aagccgaatt cctggtctg 19
Claims (5)
1. a kind of gene containing COL1A1 improves the detection kit of Altai Sheep Meat Quality, it is characterised in that the reagent
Box builds up acquisition by the following system of building together：
（1）Design primer pair：Using the mRNA sequence of sheep COL1A1 genes, voluntarily engineer's specific primer；
（2）PCR reaction reagents：Mix, upstream and downstream primer, cDNA templates and without RNase water.
2. gene containing COL1A1 improves the detection kit of Altai Sheep Meat Quality as claimed in claim 1, its feature exists
In the specific primer sequence is as follows：
Sense primer F：5'- TACAGCGTCACCTACGACGG -3'；
Anti-sense primer R：5'- AAGCCGAATTCCTGGTCTG -3'.
3. a kind of gene containing COL1A1 as claimed in claim 1 improves the application of the detection kit of Altai Sheep Meat Quality,
It is characterised in that it includes following steps：
Altai Sheep longissimus dorsi muscle RNA is extracted：Altai Sheep longissimus dorsi muscle 30-50 mg are taken, extract RNA, in -80 DEG C of preservations；
Reverse transcription is cDNA, carries out PCR amplification with reference gene ACTB, the detection of 1.5% agarose gel electrophoresis, ingot dyes through bromination
Afterwards, irradiated under gel imager ultraviolet lamp, observe size and the brightness of band, judge extraction and the transcription quality of cDNA；
（2）COL1A1 gene PCRs expand：According to the two of design pairs of primers, specific PCR expands two pieces of COL1A1 genes
Section, two PCR products of specific amplification are detected by 1.5% agarose gel electrophoresis, after bromination ingot dyeing, in gel
Irradiated under imager ultraviolet lamp, observe size and the brightness of amplified band, judge that PCR product expands quality；
（3）Fluorescence quantitative PCR detection：Quantitative fluorescent PCR reaction system is separately added into 96 orifice plates：2.5×
10 μ l of RealMasterMix (SYBR Green), each 1.5 μ l of 0.4 μ l, cDNA template of upstream and downstream primer, add no RNase water
To 20 μ l of cumulative volume；Whole reaction carries out in BIO-RAD quantitative fluorescent PCR sequence amplification instrument, and cycling condition is 95 DEG C of pre- changes
Property 30s；95 DEG C of denaturation 5s；60 DEG C of annealing 30s totally 40 circulations；Finally in 95 DEG C of 10s, 65 DEG C of 5s, 94 DEG C of 5s, make to melt bent
Line；
（4）Gene expression amount and the association analysis of intramuscular fat acid content, moisture and shearing force.
4. gene containing COL1A1 improves the application of the detection kit of Altai Sheep Meat Quality as claimed in claim 3, it is special
Sign is that the reaction system of the PCR amplification is：
10.0 μ l of Mix, each 1.5 μ l of 0.4 μ l, cDNA template of upstream and downstream primer, add no RNase water to 20 μ l of cumulative volume.
5. gene containing COL1A1 improves the application of the detection kit of Altai Sheep Meat Quality as claimed in claim 3, it is special
Sign is that the reaction condition of the PCR amplification is as follows：
94 DEG C of pre-degeneration 5min, 94 DEG C of denaturation 30s, annealing temperature 30s, 72 DEG C of extension 1min, are circulated 35 times, 72 DEG C of extensions
5min, 4 DEG C of preservations.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711461786.7A CN107988393A (en) | 2017-12-28 | 2017-12-28 | Gene containing COL1A1 improves the detection kit of Altai Sheep Meat Quality |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711461786.7A CN107988393A (en) | 2017-12-28 | 2017-12-28 | Gene containing COL1A1 improves the detection kit of Altai Sheep Meat Quality |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107988393A true CN107988393A (en) | 2018-05-04 |
Family
ID=62043176
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711461786.7A Pending CN107988393A (en) | 2017-12-28 | 2017-12-28 | Gene containing COL1A1 improves the detection kit of Altai Sheep Meat Quality |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107988393A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109022257A (en) * | 2018-08-16 | 2018-12-18 | 新疆农业大学 | NUMB gene is used to screen kit and its application of Kazak horse milk performance |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103525920A (en) * | 2013-09-29 | 2014-01-22 | 新疆农业大学 | Molecular marker method for breeding meat performance of Aletail sheep and application thereof |
| CN105838795A (en) * | 2016-04-27 | 2016-08-10 | 华中农业大学 | Molecular marker of related gene SVEP1 of back fat thickness and intramuscular fat traits and application of molecular marker |
-
2017
- 2017-12-28 CN CN201711461786.7A patent/CN107988393A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103525920A (en) * | 2013-09-29 | 2014-01-22 | 新疆农业大学 | Molecular marker method for breeding meat performance of Aletail sheep and application thereof |
| CN105838795A (en) * | 2016-04-27 | 2016-08-10 | 华中农业大学 | Molecular marker of related gene SVEP1 of back fat thickness and intramuscular fat traits and application of molecular marker |
Non-Patent Citations (3)
| Title |
|---|
| H. LIAO等: "The relationships of collagen and ADAMTS2 expression levels with meat quality traits in cattle", 《INDIAN JOURNAL OF ANIMAL RESEARCH》 * |
| K. S. LIM等: "Identification of differentially expressed genes in longissimus muscle of pigs with high and low intramuscular fat content using RNA sequencing", 《ANIMAL GENETICS》 * |
| S. DHORNE-POLLET等: "A functional genomic approach to the study of the milking ability in dairy sheep", 《ANIMAL GENETICS》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109022257A (en) * | 2018-08-16 | 2018-12-18 | 新疆农业大学 | NUMB gene is used to screen kit and its application of Kazak horse milk performance |
| CN109022257B (en) * | 2018-08-16 | 2021-12-31 | 新疆农业大学 | Kit for screening Kazakh horse lactation performance by NUMB gene and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Masoudzadeh et al. | Dlk1 gene expression in different Tissues of lamb | |
| CN103525920B (en) | A kind of molecule marking method for seed selection Altai Sheep meat production and application thereof | |
| CN105063021B (en) | The SNP marker related to label of pig fat deposition description and its application | |
| Ren et al. | Myostatin regulates fatty acid desaturation and fat deposition through MEF2C/miR222/SCD5 cascade in pigs | |
| CN105296648B (en) | Fox derived component identify and animal product in fox, rabbit, dog ingredient multiple PCR detection kit | |
| CN108949907A (en) | One kind SNP marker primer pair relevant to Suhuai pig intramuscular fat content and its application | |
| CN109943646A (en) | The method and its application of ox PLAG1 gene C NV molecular labeling auxiliary detection growth traits | |
| CN109811063A (en) | One kind SNP marker relevant to growth speed of pigs and its application | |
| CN101921856B (en) | Method for detecting cattle ANGPTL4 gene single nucleotide polymorphism | |
| CN108998541A (en) | One kind SNP marker primer pair relevant to Suhuai pig leg hip circumference character and its application | |
| Sun et al. | Emerging roles of heat-induced circRNAs related to lactogenesis in lactating sows | |
| CN103898231A (en) | SNP (Single Nucleotide Polymorphism) molecular marker related to pork pH characteristics and application thereof | |
| CN107988393A (en) | Gene containing COL1A1 improves the detection kit of Altai Sheep Meat Quality | |
| CN110468217A (en) | SNP marker relevant to pig muscle pH and drip loss character and its application | |
| CN107858443B (en) | Primer, probe and kit for quantitatively detecting sources of sheep, cattle and pigs in meat products | |
| CN109182558A (en) | It can indicate and identify the molecular labeling primer pair and application of sheep wool natural length | |
| CN103276098B (en) | Molecular marking method for predicting and identifying length of sheep wool | |
| CN110029172B (en) | Double PCR detection kit for equine and donkey-derived components | |
| CN103146830B (en) | Molecular marking method capable of simultaneously predicting and identifying fineness and crimpness of sheep wool | |
| CN101921848A (en) | Method for detecting single nucleotide polymorphism (SNP) of cattle MGAT2 gene | |
| CN107988392A (en) | Gene containing SEC61A1 is used for the kit for improving Altai Sheep meat production | |
| Guan et al. | Establishment and biological characterization of fibroblast cell line from the Langshan chicken | |
| CN107988394A (en) | Gene containing COL1A1 improves the detection kit of the black mutton quality character in Turfan | |
| CN109825600A (en) | One kind SNP marker relevant to Suhuai pig muscle drip loss and detection method | |
| CN105671045A (en) | Method for increasing HR (Homologous Recombination) repairing frequency of ovine embryo fibroblasts after gene editing |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180504 |