CN107904319A - Gene containing PRKAA1 is used for the detection kit for improving Altai Sheep Meat Quality - Google Patents

Gene containing PRKAA1 is used for the detection kit for improving Altai Sheep Meat Quality Download PDF

Info

Publication number
CN107904319A
CN107904319A CN201711465725.8A CN201711465725A CN107904319A CN 107904319 A CN107904319 A CN 107904319A CN 201711465725 A CN201711465725 A CN 201711465725A CN 107904319 A CN107904319 A CN 107904319A
Authority
CN
China
Prior art keywords
prkaa1
sheep
altai
altai sheep
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201711465725.8A
Other languages
Chinese (zh)
Inventor
刘武军
方丽君
方超
马海玉
赵国艺
刘玲玲
于茜
褚洪忠
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Xinjiang Agricultural University
Original Assignee
Xinjiang Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Xinjiang Agricultural University filed Critical Xinjiang Agricultural University
Priority to CN201711465725.8A priority Critical patent/CN107904319A/en
Publication of CN107904319A publication Critical patent/CN107904319A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

It is used to improving the detection kit of Altai Sheep Meat Quality the invention discloses gene containing PRKAA1, the present invention is according to utilizing the voluntarily engineer's specific primer of the mRNA sequence using sheep PRKAA1 genes, forward primer：5'‑AGCCCACCTGATTCTTTTCTT‑3'；Reverse primer：5'GCCATTTTGCTTTCCTTACAC 3', PCR amplification is carried out by template of sample genomic dna, carries out fluorescence quantitative PCR detection to amplified production, the Δ Ct values and 2 of PRKAA1 genes in Altai Sheep difference musculature sample are calculated according to the Ct values obtained‑(ΔΔ Ct)；The present invention by detecting the gene abundances of PRKAA1 genes, find out with the relevant molecular labeling of Altai Sheep meat, to improve the meat guality of Altai Sheep, to promote the reasonable development of Altai Sheep variety source to lay the foundation.

Description

Gene containing PRKAA1 is used for the detection kit for improving Altai Sheep Meat Quality
Technical field
The present invention relates to the identification method of animal hereditary and selection, specifically, the present invention relates to a kind of Altai Sheep to produce meat The technical field of the kit of energy selection and breeding.
Background technology
Altai Sheep, is the outstanding naked eyed test in Xinjiang place, is branch's product in ancient Kazakh Sheep kind System, is raised after B.C. by the ancestors (Wu Sunren) of Kazak.Lamb has prominent precocious feature, is given birth to suitable for mutton Production, belongs to meat, fat dual-purpose kind.The major production areas of Altai Sheep concentrate on the Altay Prefecture Fuhai County of In The North of Xinjiang, Fuyun County, The ground such as Qinghe County, are distributed in the counties such as Altay, Burqin, Jeminay and Habahe County, but with introducing a fine variety between field and section is handed over Stream, Altay are all distributed substantially in full boundary now.Altai Sheep physique is big, and constitution is solid.Chest breadth is deep, and the back of the body is straight, muscle hair Educate good.Four limbs are high and solid, and muscle of thigh is plentiful.It protrudes character and is mainly reflected on meat-producing traits, and Altai Sheep Physique is big, meat production performance is high, have the characteristics that resistance to crude feed, be apt to trek, anti-severe cold, constitution is solid, suitably herds.Altay Sheep belongs to large-scale naked eyed test, also slightly better compared with the sheep kind in domestic each pastoral area.Local breeding Ba Shibai in the area of Xinjiang The Mongolian sheep of breeding outside sheep, Ba Yin Brooker Yang Ji areas, including its hypotype such as sheep known for its fine thick wool, cold sheep, same to sheep, sheep etc., Mean liveweight Below Altai Sheep.Altai Sheep is as the principal item in my pastoral industry animal species structure.Altai Sheep kind is located in Long-term low temperature, winter are up to nearly half a year, and reachable -35 to -40 DEG C most cold, and since natural conditions are severe, many improved seeds exist Here can not survive, and Altai Sheep be exactly it is such a it is special under conditions of, by long-term nature and artificial selection and Formed, how selection and breeding improve Altai Sheep meat production, are to speed up improving the key for recovering the excellent meat production of Altai Sheep, This is actually the common problem of the current generally existing in this area, how to be solved extremely urgent.
Good and bad audient's multifactor impact of meat, including heredity, nutrition condition, intramuscular fat content and distribution and meat Retentiveness etc..Wherein, intramuscular fat is considered being positively correlated with meat and mouthfeel, and the height of intramuscular fat content determines meat Tenderness, succulence and flavor etc..AMPK is as cell sensitive energy receptor, controllable downstream and the relevant second of fat metabolism The effect gene fat metabolisms such as acyl coenzyme A carboxylases (ACC), triglyceride hydrolysis enzyme enzyme (ATGL), PRKAA1 are one phosphorus of coding The gene of 1 subunits of adenosine monophosphate activated protein kinase (AMPK) α, plays an important role in Regulating Lipid Metabolism.
At present, the research at home and abroad on PRKAA1 genes is more common in the mankind and mouse, is rarely reported in sheep, Based on for the big tail sheep of Fu Hai, i.e., the particularity improved for the special Xinjiang typicalness kind meat of Altai Sheep is existing at present Technology is there is not yet using PRKAA1 genes as the candidate gene of influence domestic animal Meat Quality in Altai Sheep meat production selection and breeding In application.
The content of the invention
For having no that report applies in Altai Sheep meat production selection and breeding specifically for PRKAA1 genes in the prior art And the state of the art of the particularity of Altai Sheep kind, the present invention intends to provide gene containing PRKAA1 to be used to improve Altai Sheep The detection kit of Meat Quality, for improving Altai Sheep meat production.
In order to realize the above object the technical solution adopted in the present invention is：
The present invention provides the detection kit that gene containing PRKAA1 is used to improve Altai Sheep Meat Quality, kit bag Include：
(1) reference gene ACTB amplimers：
Sense primer F：5'-CGGGAAATCGTCCGTGAC-3'；
Anti-sense primer R：5'-CCGTGTTGGCGTAGAGGT-3'.
(2) target gene PRKAA1 amplimers：
Sense primer F：5'-AGCCCACCTGATTCTTTTCTT-3'；
Anti-sense primer R：5'-GCCATTTTGCTTTCCTTACAC-3'.
(3) cDNA templates.
(4) fluorescence quantitative PCR reaction solution and without RNase water.
Preferably, the kit includes 2.5 × Real Master Mix10 μ l, each 0.4 μ l of upstream and downstream primer, 1.5 μ l of cDNA templates.
Further, the present invention provides answering for the detection kit that gene containing PRKAA1 is used to improve Altai Sheep Meat Quality With comprising the following steps：
(1) extraction and purification of total serum IgE：Using conventional RNA extractions and purification process, from Altai Sheep longissimus dorsi muscle, The total serum IgE purified is extracted in arm triceps and quadriceps muscle of thigh musculature.
(2) synthesis of the first chains of cDNA：Using the total serum IgE of the muscle tissue sample of Altai Sheep as masterplate, using conventional side Method synthesizes the first chains of cDNA.
(3) real-time fluorescence quantitative PCR expands：Quantitative fluorescent PCR reaction system is separately added into 96 orifice plates, is circulated Condition is 95 DEG C of pre-degeneration 30s；95 DEG C of denaturation 5s；60 DEG C of annealing 30s totally 40 circulations；Finally in 95 DEG C of 10s, 65 DEG C of 5s, 94 DEG C 5s, makees melting curve, each sample sets 3 parallel repetitions.
(4) calculating of relative quantification：After the completion of real-time fluorescence quantitative PCR, Altai Sheep is calculated according to the Ct values obtained The Δ Ct values and 2 of PRKAA1 genes in different musculature samples-(ΔΔCt), computational methods are as follows：
Δ Ct=Ct (PRKAA1)-Ct (ACTB)
Δ Δ Ct=Δ Ct (sample A)-Δ Ct (sample B).
In the present invention, the fluorescent quantitative PCR technique of application is known in the art technological means, is ordinary skill people The common technique means that member uses.
In the present invention, in the design of Altai Sheep PRKAA1 gene-specific primers, pass through International Molecular biological information website NCBI (National Center for Biotechnology), retrieval obtain the cDNA sequence of sheep PRKAA1 genes (GenBank accession number：PRKAA1:NC_019473.2), by known software Primer 5.0, voluntarily engineer is specific Primer, primer sequence are synthesized by itself.
By using the technical solution of above-mentioned offer, the present invention obtains following beneficial effect：
(1) the method for the present invention filters out differential gene PRKAA1, and designed, designed by analysis according to biochip technology Primer, primer specificity is strong, in Altai Sheep longissimus dorsi muscle, arm triceps and quadriceps muscle of thigh musculature sample, PRKAA1 The Ct values standard deviation of Duplication is all very small, is respectively less than 0.1, and repeatability is good, and gene containing PRKAA1 is used to improve Altay Its amplification curve of the detection kit fluorescence quantitative PCR detection of mutton quality character and melting curve performance are good, suitable for A Le Safe sheep longissimus dorsi muscle, arm triceps and quadriceps muscle of thigh musculature sample, and previously for the table of Altai Sheep PRKAA1 genes Analyzed up to amount and have no correlative study report and patent disclosure.
(2) present invention by provide gene containing PRKAA1 be used for improve Altai Sheep Meat Quality detection kit and its Using expression quantity and intramuscular fat acid content, moisture and longissimus dorsi muscle shearing force phase relation in Altai Sheep longissimus dorsi muscle Number is 0.8-1.0, represents extremely strong correlation；And expression quantity contains with intramuscular fat acid content, moisture in other kind sheep longissimus dorsi muscles Amount and longissimus dorsi muscle shearing force related coefficient are 0.0-0.2, without obvious correlation, illustrate that the present invention has preferable specificity. The foundation of the present invention, for selection and breeding Altai Sheep improved seeds, there is provided the theoretical foundation of marker assisted selection and technical support Meanwhile have for protecting the improved seeds resource of Altai Sheep, raising peasants and herdsmen income, accelerating the development of Xinjiang meat sheep industry Actual application value.
Brief description of the drawings
Fig. 1 is Altai Sheep longissimus dorsi muscle musculature PRKAA1 gene fluorescence quantitative RT-PCR special primer amplification curves Figure.
Fig. 2 is Altai Sheep arm triceps musculature PRKAA1 gene fluorescence quantitative RT-PCR special primer amplification curves Figure.
Fig. 3 is Altai Sheep quadriceps muscle of thigh musculature PRKAA1 gene fluorescence quantitative RT-PCR special primer amplification curves Figure.
Fig. 4 is Altai Sheep longissimus dorsi muscle musculature PRKAA1 gene fluorescence quantitative RT-PCR special primer melting curves Figure.
Fig. 5 is Altai Sheep arm triceps musculature PRKAA1 gene fluorescence quantitative RT-PCR special primer melting curves Figure.
Fig. 6 is Altai Sheep quadriceps muscle of thigh musculature PRKAA1 gene fluorescence quantitative RT-PCR special primer melting curves Figure.
Embodiment
In the following, illustrating the present invention for embodiment, still, the present invention is not limited to following embodiments.The main original used Material and related reagent etc.：Trizol Total RNA Reagent total RNA extraction reagents are provided by Beijing Tiangeng company；Z Serum Clot Activator vacuum blood collections serum tubes are by Austrian Greiner Bio-One companies There is provided；2 × Taq PCR MasterMix are provided by Bo Maide biological (PC0912)；DL2000 DNA Marker are by village alliance biology (ZM404-1) provide；EB is provided by the precious letter in Xinjiang.
Key instrument equipment：TG16-W high speed centrifugal machine for minim originates from Changsha Xiang Yi centrifuges Instrument Ltd.；DYCZ- 24F types electrophoresis tank and DYY-6C type electrophoresis apparatuses originate from Beijing Liuyi Instrument Factory；AL204-IC electronic balances originate from plum Teller-support Strangle (Shanghai) Co., Ltd. of multiple instruments factory；JY04S gel imagers originate from Beijing Jun Yi east electrophoresis equipment Co., Ltd；Constant temperature Case thermostatic control oscillator vibration originates from Beijing Sang Yi laboratory apparatus research institute.
All reagents, raw material and the instrument selected in the present invention are all well known in the art selection, but do not limit the present invention Implementation, other some reagents well known in the art and equipment are applied both to the implementation of implementation below of the present invention.
Embodiment one：
The present invention, which provides the detection kit that gene containing PRKAA1 is used to improve Altai Sheep Meat Quality, to be included：
(1) reference gene ACTB amplimers：
Sense primer F：5'-CGGGAAATCGTCCGTGAC-3'；
Anti-sense primer R：5'-CCGTGTTGGCGTAGAGGT-3'.
(3) target gene PRKAA1 amplimers：
Sense primer F：5'-AGCCCACCTGATTCTTTTCTT-3'；
Anti-sense primer R：5'-GCCATTTTGCTTTCCTTACAC-3'.
(3) cDNA templates；
(4) fluorescence quantitative PCR reaction solution and without RNase water；
Including 2.5 × Real of fluorescence quantitative PCR reaction solution Master Mix10 μ l, each 0.4 μ l of upstream and downstream primer, 1.5 μ l of cDNA templates.
Embodiment two：
1st, the collection of sample：Gather that rearing conditions to be measured are identical, the longissimus dorsi muscle of the same or like one full year of life ram of weight, Arm triceps and quadriceps muscle of thigh musculature sample 3-5mg, Liquid nitrogen storage is immediately placed in after sampling, treats that subsequent experimental uses.
2nd, the extraction and purifying of total serum IgE：Take Trizol methods extraction total serum IgE and purify.
3rd, the synthesis of the first chains of cDNA：It is cDNA by the total serum IgE reverse transcription extracted, and carries out quality testing.
Prepare 1% Ago-Gel：Agarose 1g, is dissolved in 0.5 × TBE of 100ml, and micro-wave oven is heated to fully melting, treats It is cooled to room temperature to pour into and is inserted with the glue groove of comb, it is stand-by after cooled and solidified.
Electrophoresis detection, voltage 100V, electric current 50mA, electrophoresis 30 minutes are carried out using 1% Ago-Gel of preparation.Through bromine After changing ingot dyeing 15 minutes, irradiated under gel imager ultraviolet lamp, observe size and the brightness of band, judge carrying for cDNA Take quality.
4th, PCR amplification：
(1) design of primers and synthesis；According to mRNA sequence (the GenBank accession number of sheep PRKAA1 genes：PRKAA1: NC_019473.2), voluntarily synthesized using 5.0 independent design primers of software Primer, primer sequence, the primer sequence of design For：
The upstream primer sequence F of primer：5'-AGCCCACCTGATTCTTTTCTT-3', the downstream primer sequence R of primer： 5'-GCCATTTTGCTTTCCTTACAC-3'；Amplified fragments size is 157bp, its base referring to attached offer gene order Table.
(2) pcr amplification reaction system and program optimization
According to designed primer, the fragment of specific amplification NC_019473.2 genes.PCR reaction systems are：Mix 10.0 μ l, each 0.4 μ l of upstream and downstream primer, 1.5 μ l of DNA profiling, add water to 20 μ l of cumulative volume；Reaction condition is：94 DEG C of pre-degeneration 5min, 94 DEG C of denaturation 30s, annealing temperature 30s, 72 DEG C of extension 1min, circulate 31 times, 72 DEG C of extension 5min, 4 DEG C of preservations.
The annealing temperature of primer PCR amplified reaction program is optimized.In the case where other reaction conditions are constant, Gradient is set in PCR instrument to annealing temperature, and gradient scope is 55 DEG C -65 DEG C, i.e., average each plate hole transformation temperature is 1 DEG C.Through 1.5% agarose gel electrophoresis detects, and observes brightness and the purity of amplified band, and the most suitable annealing temperature of final definite primer is 59℃。
The PCR product of specific amplification is detected by 1.5% agarose gel electrophoresis, voltage 100V, electrophoresis 30min, warp Bromination is irradiated under Bio-RAD gel imager ultraviolet lamps after ingot EB dyes 15min, observes the size of amplified band and bright Degree, Altai Sheep longissimus dorsi muscle musculature PRKAA1 gene specific primer amplification curves are shown in attached drawing 1, Altai Sheep arm triceps Musculature PRKAA1 gene specific primer amplification curves are shown in attached drawing 2, Altai Sheep quadriceps muscle of thigh musculature PRKAA1 genes, Special primer amplification curve is shown in attached drawing 3, judges that PCR product expands quality.
5th, fluorescence quantitative PCR detection
(following quantitative fluorescent PCR reaction system is separately added into 96 orifice plates：2.5×Real Master Mix(SYBR Green) 10 μ l, each 1.5 μ l of 0.4 μ l, cDNA template of upstream and downstream primer, add water to 20 μ l of cumulative volume；Entirely react in BIO-RAD Carried out in quantitative fluorescent PCR sequence amplification instrument, cycling condition is 95 DEG C of pre-degeneration 30s；95 DEG C of denaturation 5s；60 DEG C of annealing 30s are total to 40 circulations；Finally in 95 DEG C of 10s, 65 DEG C of 5s, 94 DEG C of 5s, make melting curve.To ensure specific amplification, it is desirable to obtain Melting curve only has a peak.
6th, the calculating of relative expression quantity：After the completion of real-time fluorescence quantitative PCR, different Altai Sheeps are calculated according to Ct values are obtained The Δ Ct values and 2 of PRKAA1 in musculature sample-(ΔΔCt), computational methods are as follows：
Δ Ct=Ct (PRKAA1)-Ct (ACTB)
Δ Δ Ct=Δs Ct (longissimus dorsi muscle)-Δ Ct (arm triceps).
With 2-(ΔΔCt)Value represents that PRKAA1 is relative to the expression quantity of PRKAA1 genes in arm triceps in longissimus dorsi muscle.A Le The expression quantity of the PRKAA1 genes of safe two kinds of musculature samples of sheep is shown in Table 1, table 2.
Table 1:The PRKAA1 genes of Altai Sheep musculature sample and the Ct value tables of reference gene
Table 2：The expression quantity result table of the PRKAA1 genes of Altai Sheep musculature sample
It can be obtained from the interpretation of result of table 1, in Altay, Xinjiang sheep longissimus dorsi muscle, arm triceps and quadriceps muscle of thigh musculature In sample, the Ct values standard deviation of PRKAA1 Duplications is all very small, is respectively less than 0.1, illustrates detection reagent provided by the invention Box has extraordinary repeatability, has very strong practicality when being applicable in Altai Sheep meat production selection and breeding.
2 Altai Sheep musculature sample PRKAA1 genes of table it is expression quantity the results show that Altai Sheep arm triceps PRKAA1 gene expression amounts are higher by 1.8 than PRKAA1 gene expression doses in Altai Sheep longissimus dorsi muscle musculature in musculature Times；PRKAA1 gene expression amounts are than in Altai Sheep longissimus dorsi muscle musculature in Altai Sheep quadriceps muscle of thigh musculature PRKAA1 gene expression doses are 3.89 times high.
Embodiment three：
Mouse, Small-fat-tail sheep, OK a karaoke club are respectively applied to based on embodiment two, and using the kit that above-described embodiment provides In Ku Er sheep and field sheep, Kazakh sheep, Ba Yin Brooker sheep, expression quantity of the observation PRKAA1 genes in its longissimus dorsi muscle with The degree of association of intramuscular fat acid content, moisture and longissimus dorsi muscle shearing force.Specifically it is shown in Table 3：
Table 3:PRKAA1 gene expression amounts and the related coefficient of part meat index
Content of fatty acid Moisture Longissimus dorsi muscle shearing force
Altai Sheep 0.88 0.95 1.00
Mouse 0.54 0.45 0.42
Small-fat-tail sheep 0.05 0.17 0.18
Karacul 0.12 0.04 0.16
With field sheep 0.05 0.14 0.11
Kazakh sheep 0.16 0.16 0.17
Ba Yin Brooker sheep 0.19 0.18 0.12
Note：0.0-0.2 is without correlation, the moderate correlations of 0.4-0.6, the extremely strong correlations of 0.8-1.0.
Analyzed from table 3, expression quantity and intramuscular fat acid content, moisture and the back of the body be most in Altai Sheep longissimus dorsi muscle Long flesh shearing force related coefficient is 0.8-1.0, represents extremely strong correlation；PRKAA1 genes expression quantity and flesh in mouse longissimus dorsi muscle Interior content of fatty acid related coefficient is 0.4-0.6, represents moderate correlation, expression quantity and flesh in other kind sheep longissimus dorsi muscles Interior content of fatty acid, moisture and longissimus dorsi muscle shearing force related coefficient are 0.0-0.2, without obvious correlation, illustrate this hair The detection kit of bright offer has preferable specificity.
Example IV：
The quadriceps muscle of thigh musculature sample 3-5mg of Altai Sheep individual to be measured is gathered, extracts RNA, and reverse transcription is cDNA； Designed, designed primer, carries out PCR amplification, and wherein annealing temperature is 59 DEG C；Using PRKAA1 kit genes to its expression quantity into Row detection.It is low for the gene expression amount, it can eliminate；Expression quantity is high, can continue to employ, and carrys out selection and breeding with this and improves Altay, Xinjiang The meat of sheep.
Table 4:Different Altai Sheep individual PRKAA1 gene expression amounts
As shown in Table 4, the PRKAA1 gene expression amounts of No. 1 and No. 5 Altai Sheep can be continued to employ apparently higher than other；Other Altai Sheep PRKAA1 gene expression amounts are relatively low, can eliminate, and the meat of selection and breeding raising Altay, Xinjiang sheep is carried out with this.
The molecule labelling method for selection and breeding Altai Sheep meat provided by above-mentioned series embodiment, utilizes this hair The PRKAA1 gene detecting kits of bright offer carry out expression quantity inspection to the pcr amplified fragment of Altay, Xinjiang sheep PRKAA1 genes Survey, determine its expression in Altai Sheep musculature, divide so as to find out with the significantly correlated DNA of Altai Sheep meat Son mark, to improve the meat guality of Altai Sheep, have the distinctive specificity of detection kit, specificity and stability and Repeatability, this is for selection and breeding Altai Sheep improved seeds, there is provided while the theoretical foundation of marker assisted selection and technical support, For protecting the improved seeds resource of Altai Sheep, improving peasants and herdsmen's income, the industry development of quickening Xinjiang meat sheep with actual Application value.
As described above, you can preferably realize the present invention, the above embodiments are only the side of being preferable to carry out to the present invention Formula is described, and not the scope of the present invention is defined, and on the premise of design spirit of the present invention is not departed from, this area is general The various changes and improvement that logical technical staff makes technical scheme, should all fall into present invention determine that protection domain It is interior.
Sequence table
<110>Xinjiang Agricultural Univ
<120>Gene containing PRKAA1 is used for the detection kit for improving Altai Sheep Meat Quality
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 18
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<220>
<221> primer_bind
<222>(1) .. (18)
<223>Reference gene ACTB amplimer sense primers
<400> 1
cgggaaatcg tccgtgac 18
<210> 2
<211> 18
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<220>
<221> primer_bind
<222>(1) .. (18)
<223>Reference gene ACTB amplimer anti-sense primers
<400> 2
ccgtgttggc gtagaggt 18
<210> 3
<211> 21
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<220>
<221> primer_bind
<222>(1) .. (21)
<223>Target gene PRKAA1 sense primers
<400> 3
agcccacctg attcttttct t 21
<210> 4
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<220>
<221> primer_bind
<223>Target gene PRKAA1 anti-sense primers
<400> 4
ccattttgct ttccttacac 20

Claims (4)

1. gene containing PRKAA1 is used for the detection kit for improving Altai Sheep Meat Quality, it is characterised in that the reagent Box includes：
（1）Reference gene ACTB amplimers：
Sense primer F：5'-CGGGAAATCGTCCGTGAC-3'；
Anti-sense primer R：5'-CCGTGTTGGCGTAGAGGT-3'；
（2）Target gene PRKAA1 amplimers：
Sense primer F：5'-AGCCCACCTGATTCTTTTCTT-3'；
Anti-sense primer R：5'-GCCATTTTGCTTTCCTTACAC-3'；
（3）CDNA templates；
（4）Fluorescence quantitative PCR reaction solution and without RNase water.
2. gene containing PRKAA1 is used for the detection kit for improving Altai Sheep Meat Quality, its feature as claimed in claim 1 It is, the fluorescence quantitative PCR reaction solution is 2.5 × Real Master Mix.
3. gene containing PRKAA1 is used for the detection kit for improving Altai Sheep Meat Quality, its feature as claimed in claim 1 It is, the kit includes 2.5 × Real Master Mix10 μ l, each 1.5 μ of 0.4 μ l, cDNA template of upstream and downstream primer l。
4. gene containing PRKAA1 is used for the application for improving the detection kit of Altai Sheep Meat Quality, it is characterised in that including Following steps：
（1）The extraction and purification of total serum IgE：Using conventional RNA extractions and purification process, from Altai Sheep longissimus dorsi muscle, arm three The total serum IgE purified is extracted in head flesh and quadriceps muscle of thigh musculature；
（2）The synthesis of the first chains of cDNA：Using the total serum IgE of the muscle tissue sample of Altai Sheep as masterplate, closed using conventional method Into the first chains of cDNA；
（3）Real-time fluorescence quantitative PCR expands：Quantitative fluorescent PCR reaction system, cycling condition are separately added into 96 orifice plates For 95 DEG C of pre-degeneration 30s；95 DEG C of denaturation 5s；60 DEG C of annealing 30s totally 40 circulations；Finally in 95 DEG C of 10s, 65 DEG C of 5s, 94 DEG C of 5s, Make melting curve, each sample sets 3 parallel repetitions；
（4）The calculating of relative quantification：After the completion of real-time fluorescence quantitative PCR, it is different that Altai Sheep is calculated according to the Ct values obtained The Δ Ct values and 2 of PRKAA1 genes in musculature sample-(ΔΔ Ct), computational methods are as follows：
ΔCt = Ct（PRKAA1）- Ct（ACTB）
ΔΔ Ct =ΔCt（Sample A）-ΔCt（Sample B）.
CN201711465725.8A 2017-12-28 2017-12-28 Gene containing PRKAA1 is used for the detection kit for improving Altai Sheep Meat Quality Pending CN107904319A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201711465725.8A CN107904319A (en) 2017-12-28 2017-12-28 Gene containing PRKAA1 is used for the detection kit for improving Altai Sheep Meat Quality

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201711465725.8A CN107904319A (en) 2017-12-28 2017-12-28 Gene containing PRKAA1 is used for the detection kit for improving Altai Sheep Meat Quality

Publications (1)

Publication Number Publication Date
CN107904319A true CN107904319A (en) 2018-04-13

Family

ID=61871963

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201711465725.8A Pending CN107904319A (en) 2017-12-28 2017-12-28 Gene containing PRKAA1 is used for the detection kit for improving Altai Sheep Meat Quality

Country Status (1)

Country Link
CN (1) CN107904319A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108192984A (en) * 2018-02-13 2018-06-22 浙江大学 Molecular labeling relevant with sheep Meat Quality and specific primer pair and application

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108192984A (en) * 2018-02-13 2018-06-22 浙江大学 Molecular labeling relevant with sheep Meat Quality and specific primer pair and application

Similar Documents

Publication Publication Date Title
CN103160537B (en) Application method of long-chain non-coding ribonucleic acid (RNA) gene in preparation of interference inhibitor
CN105063021B (en) The SNP marker related to label of pig fat deposition description and its application
CN105087584B (en) A kind of miRNA related to chicken abdominal fat sediment and its application
CN105969845B (en) The molecular labeling of eye muscle area character related gene SVEP1 and its application
CN108624697B (en) A kind of 21 gene detecting kit of breast cancer and its detection method
CN105112522A (en) Detection primer combination and kit for HER2 (human epidermal growth factor receptor 2) gene amplification
CN103160580A (en) Application method of long-chain non-coding ribonucleic acid (RNA) gene
CN105524983A (en) Marker based on high-throughput sequencing and method and kit for capturing one or multiple specific genes of multiple samples
CN110317880A (en) Molecular labeling relevant to pannage conversion ratio, identification and its application
CN101921856B (en) Method for detecting cattle ANGPTL4 gene single nucleotide polymorphism
CN103898231B (en) A kind of SNP marker relevant to pork pH proterties and application thereof
CN101705290B (en) Single nucleotide polymorphism of SCD genes in dairy goat and detection method thereof
CN111057782A (en) Method for detecting number of soil bacteria based on real-time fluorescent quantitative PCR
CN110029156A (en) A kind of method and its application of detection tea card sheep KAT6A gene C NV label
CN104762403B (en) The GmDGK7 gene molecule markers significantly associated with soybean grease content and its application
CN107904319A (en) Gene containing PRKAA1 is used for the detection kit for improving Altai Sheep Meat Quality
CN109988847A (en) A kind of method and its application of detection tea card sheep SHE gene C NV label
CN101921848B (en) Method for detecting single nucleotide polymorphism (SNP) of cattle MGAT2 gene
CN107988392A (en) Gene containing SEC61A1 is used for the kit for improving Altai Sheep meat production
CN107893121A (en) Gene containing ACSL4 is used for the detection kit for improving the black mutton quality character in Turfan
CN102899390A (en) Small cell lung cancer markers and their detection
CN108048577A (en) Gene containing SEC62 is used to improve the detection kit of Altai Sheep Meat Quality
CN107988393A (en) Gene containing COL1A1 improves the detection kit of Altai Sheep Meat Quality
CN108192980A (en) Gene containing ACSL1 is used to improve the detection kit of the black mutton quality character in Turfan
CN112575095A (en) Chicken slaughter trait-related miRNA and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20180413