CN108018276A - A kind of deep-sea bacterium keratinase and its encoding gene, zymoprotein production engineering bacterium and application - Google Patents

Abstract

The invention discloses a kind of deep-sea bacterium keratinase and its encoding gene, zymoprotein production engineering bacterium and application.The present invention provides the protease of the amino acid sequence composition shown in SEQ ID NO.2 or SEQ ID NO.5, or by substituting, lacking or add one or several amino acid and there is protein derived from keratinase activity, and the gene order of its coding.A kind of deep-sea bacterium keratinase gene kr0631, has the nucleotide sequence described in sequence table SEQ ID NO.1, its Protease sequences encoded is SEQ ID NO.2.The protease has the characteristic of degraded keratin, and a kind of combination of signal peptide sequence and protease gene, is significantly improved the extracellular yield of recombinase.The present invention has in terms of environment discards the processing of difficult degradation albumen type organic to have been widely used.

Description

A kind of deep-sea bacterium keratinase and its encoding gene, zymoprotein production engineering bacterium and Using

Technical field：

The present invention relates to a kind of keratinase in deep-sea bacterium source new gene and its encode zymoprotein production method, The recombinant protein of acquisition can be used for the hydrolysis of environment waste eggshell white matter, belong to biological technical field.

Background technology：

Keratin (keratin) is a kind of solid structure albumen with high structural stability, is widely present in animal In hair, nail and skin.China's keratin resource enriches, and China's production poultry meat product in 2016 is counted according to United States Department of Agriculture 13400000 tons, feather typically constitutes from birds weight 5-7%, and keratin content in feather is 80% or so, thus produces number every year Million tons of keratin.However, since keratin molecule inside is there are substantial amounts of disulfide bond, hydrophobic effect and hydrogen bond, it is difficult to quilt Degraded utilizes, and causes a large amount of keratin to cause environmental pollution and the waste of protein resource by abandoned piles.The resource of keratin Change and feather be converted into feather meal as fertilizer or feed addictive using after current mainly high temperature and pressure combination strong acid alkali process, High energy consumption and adjoint serious side reaction, influence product quality.

Keratinase can hydrolysis of keratin in a mild condition, be the green utilization mode for generally acknowledging keratin waste resource. Keratinase studies the more deep keratinase for being derived from bacillus licheniformis PWD-1 at present, which belongs to Subtilisin family protein enzymes, the keratinase for having a variety of bacillus sources in addition are reported.Deep-Sea Microorganisms are difficult drops Solve the potential important producer of organic matter hydrolase.The organic matter of sea surface is constantly dropped during sedimentation is to deep-sea Solution, polymerization, and the final settlement of difficult degradation organic matter is to seabed, the heterotrophic microorganism in halmeic deposit is evolved to obtain nutrition Go out to secrete the ability of efficient organic hydrolase water macromolecule organic matter, realize that the Biogeochemistry of difficult degradation organic matter is followed Ring.Thus, halmeic deposit is the potential valuable source for excavating rigid keratin degrading enzyme-producing bacteria strain.

The content of the invention：

The object of the present invention is to provide a kind of gene for encoding keratinase, a kind of keratinase production engineering bacterium and its answer With.

The gene is from 06063 genomes of deep-sea bacterium Bacillus sp.SCSIO by degenerate PCR and TAIL-PCR Expand the gene of the new encoding proteins enzyme obtained.The production engineering bacterium is by the keratin maturation peptide gene and signal peptide of acquisition Obtained after encoding gene combination by table vector introduction bacillus subtilis.The keratinase gene can be applied to genetic recombination For the hydrolysis of protein or in host cell, the great expression gene is to produce protease, the keratinase in bacterium Production engineering bacterium, which can be used for efficiently obtaining, recombinates keratinase, and applied to the hydrolysis of environment waste eggshell white matter.

The present invention reaches above-mentioned purpose by the following technical programs：

The complete genome kr0631 (SEQ ID NO.1) of coded protease be using degenerate primer PCR, TAIL-PCR from Expand and obtain in 06063 genomic DNAs of marine bacteria Bacillus sp.SCSIO.The initiation codon of kr0631 genes is ATG, terminator codon TAA, a total of 1272 deoxyribonucleotides composition.

The protein of SEQ ID NO.2 is the protease product KR0632 of gene kr0631 codings, by 423 amino acid groups Into, it is signal peptide from the 1-29 amino acids of N-terminal, is S8 protease leader peptide sequences from the 30-165 amino acids of N-terminal, From the catalytic domain sequence that the 166-423 amino acids of N-terminal are S8 protease.

1-87 positions deoxyribonucleotide in gene kr0631 is replaced with one section 126 from bacillus subtilis A deoxyribonucleotide signal coding sequence, combination form new gene kr0633, its nucleotide sequence such as SEQ ID Listed by NO.3, used signal coding sequence is as listed by SEQ ID NO.4.

The protein of SEQ ID NO.5 is the protease product KR0635 of gene kr0633 codings, by 436 amino acid groups Into, it is signal peptide from the 1-42 amino acids of N-terminal, is S8 protease leader peptide sequences from the 43-178 amino acids of N-terminal, From the catalytic domain sequence that the 179-436 amino acids of N-terminal are S8 protease.

The recombinant protein product that gene kr0631 and kr0633 are expressed in bacillus subtilis can degrade rigid protein.

Recombinant expression carrier is derived by expression vector pWB980 to be obtained, by the gene insertion vector P43 promoters of the present invention Downstream.Recombinant expression carrier is used for the host for converting gene of the present invention, forms the engineering bacteria for being used for producing recombinant products.

Typical engineering bacterium fermentation nutrient media components is sodium chloride 5-15g/L, peptone 5-20g/L, dusty yeast 5-20g/ L, calcium chloride 1-5g/L.Typical fermentation process is 25-37 DEG C, 50-200r/min shaking table shaken cultivations 48h.

Therefore first purpose of the present invention is to provide the keratinase of following (a) or (b),

(a) keratinase of the amino acid sequence composition as shown in SEQ ID NO.2；

(b) amino acid sequence in (a) is by substituting, lacking or add one or several amino acid and have keratin The protein as derived from (a) of enzymatic activity.

Second object of the present invention is to provide the gene for encoding above-mentioned keratinase.

It is preferred that the gene, its nucleotide sequence is as shown in SEQ ID NO.1.

Third object of the present invention is to provide the keratinase of following (a) or (b),

(a) keratinase of the amino acid sequence composition as shown in SEQ ID NO.5；

(b) amino acid sequence in (a) is by substituting, lacking or add one or several amino acid and have keratin The protein as derived from (a) of enzymatic activity.

Fourth object of the present invention is to provide the gene for encoding above-mentioned keratinase.

It is preferred that the gene, it is to replace the gene kr0631 by the coding nucleotide sequence of a segment signal peptide Partial sequence, the coding nucleotide sequence of the signal peptide has the nucleotide sequence or its work(shown in SEQ ID NO.4 Can equivalent variant.

Further preferably, the nucleotide sequence of the gene is as shown in SEQ ID NO.3.

The 5th purpose of the present invention is to provide a kind of engineering bacteria, it contains the withered of the expression vector that can express said gene Careless bacillus.

The 6th purpose of the present invention is to provide the engineering bacteria in production keratinase or to containing protein material Application in processing.

The 7th purpose of the present invention is to provide the keratinase in protein degradation and/or to containing protein material Processing in application.

Beneficial effects of the present invention are as follows：

The present invention provides a kind of new protease gene, the protease of the coded by said gene has the spy of degraded keratin Property, a kind of combination of signal peptide sequence and protease gene, is significantly improved the extracellular yield of recombinase.The present invention is in ring Border has in terms of discarding the processing of difficult degradation albumen type organic and has been widely used.

Brief description of the drawings

Fig. 1 is keratinase gene kr0631 (pWB980-kr0631 in the figure) and kr0633 (pWB980- in figure Kr0633 the tablet) expressed in hay bacillus WB600 shines.

Fig. 2 is the polyacrylamide gel electrophoresis figure of purifying restructuring keratinase KR0635.

Fig. 3 is degradation effect figures of the restructuring keratinase KR0635 to feather.

Embodiment

Technical scheme is described in further detail below by way of specific embodiment.

The embodiment of offer is for a better understanding of the present invention, and to should not be construed as limited to the purpose of the present invention.

Used material includes in an embodiment of the present invention：Marine bacteria Bacillus sp.SCSIO 06063 are Laboratory where the present inventor is isolated from marine sediment and preservation；Bacillus subtilis WB600 (commercially available), Expression vector pWB 980 (it is commercially available, it can be bought from each Reagent Company, such as can be from Hunan Ke Ai Medical Devices Co., Ltd.s (excellent precious biology) is bought)；LA taq enzymes, pMD18-T carriers, restriction enzyme are purchased from TaKaRa companies, Pfu DNA polymerizations Enzyme, Steamless are seamlessly connected kit and are purchased from Beijing Quan Shijin bio tech ltd；Plastic recovery kit is purchased from OMEG Company A.

Embodiment 1：

1st, the extraction of 06063 genomic DNAs of Bacillus sp.SCSIO

With reference to《Molecular Cloning:A Laboratory guide》

(1) culture of 5ml actinomyces Bacillus sp.SCSIO 06063 is cultivated, takes the culture 12000rpm of 1ml Centrifuge 2min；

(2) 567 μ L TE buffer are added in sediment, piping and druming repeatedly is allowed to be resuspended.Add 30 μ L 20mg/ml bacteriolyzes Enzyme, 37 DEG C of water-bath 1h；

(3) 300 μ L 10%SDS and 30 μ L 20mg/ml Proteinase Ks are added, are mixed, 37 DEG C of water-bath 1h；

(4) 100 μ L5MNaCl are added, fully mixes, adds 80 μ L CTAB/NaCl solution, are mixed, 65 degree of water-baths 10min；

(5) isometric phenol/chloroform is separately added into, chloroformic solution extracts once；

(6) 0.6 times of volume isopropanol is added, is gently mixed, 12000rpm centrifugation 5min, abandon supernatant, the washing of 70% ethanol Twice, super-clean bench air-dries；

(7) 50 μ L TE buffer solutions are added, 4 DEG C of overnight dissolving DNAs, obtain 06063 genomes of Bacillus sp.SCSIO DNA。

2nd, the partial sequence of degenerate primer PCR cloned proteins enzyme gene kr0631

Two degenerate primer 063S8-sense are designed according to bacillus S8 family protein enzymes conserved amino acid: GTAGCTGT(AC)(TC)T(GT)GATAC(AT)GGA；063S8-antisense:CA(TG)(TC)GG(AG)ACC(AG) GAATT (AT) CCTGC, with 063S8-sense, 063S8-antisense is primer, 06063 bases of Bacillus sp.SCSIO Because group DNA is template, PCR amplification.PCR reaction conditions are 94 DEG C, 5min；94 DEG C, 1min, 55 DEG C, 1min, 72 DEG C, 2min, 30 circulations；72 DEG C, extend 10min.The fragment of about 400bp is obtained, glue reclaim connects pMD18-T carriers and surveyed after purification Sequence, it is homologous compare find to obtain 426bp sequences and the S8 family protein enzymes of bacillus in Genebank have it is higher similar Property.

3rd, the full genome of TAIL-PCR clones kr0631 is utilized

3 specific primers are separately designed according to the gene order of acquired 426bp to expand 5 ' terminal sequences (kr063-5-1,5’-GAAGACCAACCACCAGGATCTGG-3’；kr063-5-2,5’- GGGGCTCCTATCCCCATTGAGAGATGGAAG；kr063-5-3,5’-GGCGATGAAGGAACAGGAATCTACGGAG-3’) With 33 ' end-specificity primer (kr063-3-1,5 '-GCCGCTACTACAAGGGTGCCATTC-3 '；kr063-3-2,5’- CTGATCCAAGCGACATGGAAATAAC-3’；Kr063-3-3,5 '-CGTGTCGGATCGCAGCTGCAATG-3 '), TAIL- Universal primer used in PCR is AD-1:5’-ACGATGGACTCCAGAGVNVNNNGGAA-3’；AC1:5’- ACGATGGACTCCAGAG-3’。

After two groups of TAIL-PCR, the fragment of about 2000bp and 1500bp, connection pMD18-T carrier sequencings are obtained respectively With previously obtained 437bp fragment assemblies into complete kr0631 genes.

4th, the nucleotide sequence analysis of protease gene kr0631

With NCBI (National Center for Biotechnology Information, http:// Www.ncbi.nlm.nih.gov/ software such as ORF finder, Blast on) analyze DNA sequence dna.Protease gene The open reading frame of kr0631 is made of 1272 deoxynucleotides, and sequence is as shown in SEQ ID NO.1.Wherein initiation codon For ATG, terminator codon TAA.

5th, the amino acid sequence analysis of protease gene kr0631 coded products KR0632

Protease gene kr0631 encodes the protein containing 423 amino acid, is named as Proteinase K R0632 (its ammonia Base acid sequence is as shown in SEQ ID NO.2), use Blast (http://blast.ncbi.nlm.nih.gov/) search GenBank databases, with the highest bacillus SG-1 (Bacillus of Proteinase K R0632 catalytic domain similitudes Sp.SG-1 annotation) is subtilisin-like S8 family protein enzymes, its amino acid identity is 83%, current and sterile The activity data in strain SG-1 sources.

With modular construction research tool Pfam (http://pfam.sanger.ac.uk/search) analysis derive from deep-sea The modular construction of 06063 Proteinase K R0632 of bacterium Bacillussp.SCSIO, the results show are made of 423 amino acid, from The 1-29 amino acids of N-terminal are signal peptide, are S8 protease leader peptide sequences from the 30-165 amino acids of N-terminal, from N-terminal 166-423 amino acids be S8 protease catalytic domain sequence.

6th, the clone of protease gene kr0631 and expression

Use primer kr063-980-sense:5’- GAGACATGAACGATGACAAAAGTGAAGAGAAAAGCGAAATGG-3 ', kr063-980-antisense:5’- GAAGCTAGCT TTATTGTTTTACTGTCGGGAA-3 ' are using 06063 genomic DNAs of Bacillus sp.SCSIO as template PCR amplification protease gene kr0631 (its nucleotide sequence is as shown in SEQ ID NO.1), and carry out nothing with linearisation pWB980 Seam connection.Connection product is converted into bacillus subtilis WB 600, is applied to the LB oxen containing 100 μ g/ml ampicillins Screening and cloning on milk culture medium flat plate.Plasmid DNA is further extracted, name recombinant plasmid is after double digestion verification is correct pWB980-kr0631。

600 single bacterium colonies of Bacillus subtilis WB containing recombinant plasmid pWB980-kr0631 are seeded to 5ml Received containing card in the LB culture mediums of mycin, 37 DEG C of shaken cultivations are stayed overnight.Overnight culture is forwarded to by fermentation training with 2% inoculum concentration Support in base (10g peptones, 5g dusty yeasts, 10g sodium chloride, 1g calcium chloride, 1L water), 37 DEG C, 200rpm shaken cultivations 48h. 9000 revs/min centrifuge 10 minutes, and supernatant is the crude enzyme liquid of KR0632.

7th, signal peptide is replaced

Use primer SP-sense:5’-GAGACATGAACGATGGCGAAACCACTATCAAAAGGG-3’,SP- antisense:5 '-TTTGCATC AGCGTCTGCCGCGGGTAAAC-3 ' are with 600 genomes of Bacillus subtilis WB DNA is template amplification signal peptide (sequence is as shown in SEQ ID NO.4), and carries out seamless company with linearisation pWB980-kr0631 Connect.Connection product is converted into bacillus subtilis WB 600, is applied to the LB milk training containing 100 μ g/ml ampicillins Support screening and cloning on base tablet.Plasmid DNA is further extracted, name recombinant plasmid is pWB980- after double digestion verification is correct (it is the nucleotides sequence that the 1-87 positions shown in SEQ ID NO.1 are replaced with the signal peptide sequence shown in SEQ ID NO.4 to kr0633 Row, for replaced sequence as shown in SEQ ID NO.3, plasmid pWB980-kr0633 is actually the core shown in SEQ ID NO.3 In nucleotide sequence insertion pWB980 expression vectors).The signal peptide of the replacement may also include from bacillus subtilis α starch (signal peptide sequence can be public by NCBI for enzyme signal peptide, lipase enzyme signal peptide, neutral protease signal peptide, pectase signal peptide Database retrieval obtains altogether), the replacement of above-mentioned signal peptide sequence will not cause the forfeiture of proteinase activity and influence catalyzing hydrolysis The function of keratin.

600 single bacterium colonies of Bacillus subtilis WB containing recombinant plasmid pWB980-kr0633 are seeded to 5ml Received containing card in the LB culture mediums of mycin, 37 DEG C of shaken cultivations are stayed overnight.Overnight culture is forwarded to by fermentation training with 2% inoculum concentration Support in base (10g peptones, 5g dusty yeasts, 10g sodium chloride, 1g calcium chloride, water 1L), 37 DEG C, 200rpm shaken cultivations 48h. 9000 revs/min centrifuge 10 minutes, and supernatant is the crude enzyme liquid of KR0635.

By the Bacillus subtilis WB 600 containing recombinant plasmid pWB980-kr0633 and contain recombinant plasmid The Bacillus subtilis WB 600 of pWB980-kr0631, which are inoculated on LB solid mediums, to be cultivated, wherein angle egg White enzyme gene kr0631 and kr0633 are as shown in Figure 1.

8th, the measure of keratinase enzyme activity

Crude enzyme liquid (crude enzyme liquid of KR0632 or the crude enzyme liquid of KR0635) is purified through ion-exchange chromatography and molecular sieve gel After obtain the pure enzyme liquid of electrophoresis (Fig. 2), take the liquid of protease of 300 μ l dilution certain multiples, be added to the reddish black angle egg of 300 μ l 2% In white solution, when 40 DEG C of shaking table oscillating reactions 1 are small after, add 600 μ L20% (w/V) solution of trichloroacetic acid, be stored at room temperature 20min, 12000r/min centrifuge 10min.200 μ l supernatants are taken, microplate reader measures the light absorption value in 595nm.One enzyme-activity unit (U) it is defined as the enzyme amount under the above-described reaction conditions needed for light absorption value raising 0.01 per minute.

Obtain two kinds of engineering bacteria Bacillus subtilis WB 600 (containing plasmid pWB980-kr0631) and Keratin activity is respectively 0.4U/mL in Bacillus subtilis WB 600 (containing plasmid pWB980-kr0633) zymotic fluid And 1.8U/mL, signal peptide replace relief angle proteinase production and improve 3.5 times；Keratinase KR0632 (protease i.e. above ) and KR0635 (the nucleotide sequence coded albumen i.e. shown in SEQ ID NO.3, specific amino acid sequence such as SEQ KR0632 Shown in ID NO.5) ratio live be 20.6U/mg albumen and 20.8U/mg albumen.

9th, degradation effect of the keratinase to feather

Take the close feather of two sizes, when ultra-pure water immersion 1 is small after again with ultrapure water 3 times.Feather is put respectively Enter in the test tube with ground stopper equipped with 10mL Gly-NaOH (pH10.0) buffer solution, control group adds 100 μ LGly-NaOH (pH10.0) Buffer solution, experimental group adds the keratinases (keratinase KR0632 or KR0635) of 100 μ L after purification, in 50 DEG C of water-baths 24h, observes and records the change of feather state.Keratinase KR0632 and KR0635 can make degradation of feather make its loosely organized (Fig. 3), keratinase KR0632 is produced and what keratinase KR0635 was similar makes degradation of feather make its loosely organized effect, And the feather of control group is not degraded.

Substitution, missing and the addition of subregion are carried out to the corresponding nucleotide of protease gene kr0631 to be caused Substitution, missing and the addition of amino acid residue, do not interfere with the function of obtaining protease hydrolytic keratin generally.Keratin enzyme Substitution, missing and the addition of amino acid residue in KR0632, for example it is substituted by alanine, or including the 217th leucine 284 proline are substituted by glycine, or the 354th threonine is substituted by aspartic acid, or in the 283rd amino acids and Add serine and tyrosine between 284 amino acids, or by the 310th, the 311st, the 312nd, the 312nd, the 313rd Position, the 314th amino acids lack at the same time, or above-mentioned substitution, missing, the combination of addition, and the keratinase of acquisition is with reference to above-mentioned angle Protease proves the Degrading experiment of feather the keratinase obtained after these mutation all there is degradation of feather to make its loosely organized Effect.Substitution, missing on keratinase KR0635 with the amino acid residue of above-mentioned keratinase KR0632 opposite positions And addition, the keratinase obtained after these mutation all there is degradation of feather to make its loosely organized effect.

Sequence table

<110>Chinese Academy of Science Nanhai Ocean Research Institute

<120>A kind of deep-sea bacterium keratinase and its encoding gene, zymoprotein production engineering bacterium and application

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1272

<212> DNA

<213>Bacillus 06063 (Bacillus sp. SCSIO 06063)

<400> 1

atgacaaaag tgaagagaaa agcgaaatgg ttaggttcac tgctagtagg ggcagctctt 60

gtgacccctt cattgggagc acaggcagat gcaaaggtac agaatgagat caaagggcaa 120

gacaacatca gggtatacat acaatcggat aacacctcta tcaaaaatga agcaaagagt 180

aaatatggga cgagatggaa tctggatgaa gacactttct ccactaccgt aaatcaaagc 240

caatttgaag ccctacagaa aaataaaaat ctgtcggttc aaaaagtgtc aaacgtacag 300

gtggatctcc tttgggactc caataaatcc gttaccccca ctgaccaaac accatgggga 360

atcgaggcaa tgtatgaaga tcccgccatt caagcgacaa gtggtggaga aaacattcgt 420

gtagctgtat tggatacagg agtgaagacc aaccaccagg atctggagaa tcggtcagaa 480

cagtgtaaag acttcacggg gctcctatcc ccattgagag atggaagttg ttctgatttg 540

catggccatg gtacccatgt tgcccgcagt gtactggctg atggaggcga tgaaggaaca 600

ggaatctacg gagtcgctcc agatgctaag ctttgggctt ataaggtcct cggggacaca 660

ggaatgggct tctccgatga cattgcagct gcgatccgac acgcttccga tgaagctaat 720

cgccttggag tgaacctggt tatttccatg tcgcttggat cagacggaaa ggacgaactg 780

atttctgaag cagtaacata cgctaacaag aatggcaccc ttgtagtagc ggctgcagga 840

aattccggtc ccgatgaaaa cacgatcggg taccctggtg gtctgaaaga agcagtggcg 900

gttgctgcat tagaagacac agttgaaaac ggaacgtacc gaatcgctga cttctcttcc 960

agagggaatc cttcaacaga tggtgattat atcatcggag aacaggatgt agaggtttcg 1020

gctccaggaa aaaacatcct atcaacctgg aatgacggaa catataatac gatcagtggg 1080

acgtcaatgg cgactccaca tgtatcgggc ctggcagcta agatttgggc agcgaacccg 1140

ggcttaacga acacacagct gagatcagag cttcaaaaca gagccaaagc gaaagacatc 1200

ctcggagggc tacatgcagc tcaaggagat gacatcgctt ctggattcgg tttcccgaca 1260

gtaaaacaat aa 1272

<210> 2

<211> 423

<212> PRT

<213>Bacillus SCSIO 06063 (Bacillus sp. SCSIO 06063)

<400> 2

Met Thr Lys Val Lys Arg Lys Ala Lys Trp Leu Gly Ser Leu Leu Val

1 5 10 15

Gly Ala Ala Leu Val Thr Pro Ser Leu Gly Ala Gln Ala Asp Ala Lys

20 25 30

Val Gln Asn Glu Ile Lys Gly Gln Asp Asn Ile Arg Val Tyr Ile Gln

35 40 45

Ser Asp Asn Thr Ser Ile Lys Asn Glu Ala Lys Ser Lys Tyr Gly Thr

50 55 60

Arg Trp Asn Leu Asp Glu Asp Thr Phe Ser Thr Thr Val Asn Gln Ser

65 70 75 80

Gln Phe Glu Ala Leu Gln Lys Asn Lys Asn Leu Ser Val Gln Lys Val

85 90 95

Ser Asn Val Gln Val Asp Leu Leu Trp Asp Ser Asn Lys Ser Val Thr

100 105 110

Pro Thr Asp Gln Thr Pro Trp Gly Ile Glu Ala Met Tyr Glu Asp Pro

115 120 125

Ala Ile Gln Ala Thr Ser Gly Gly Glu Asn Ile Arg Val Ala Val Leu

130 135 140

Asp Thr Gly Val Lys Thr Asn His Gln Asp Leu Glu Asn Arg Ser Glu

145 150 155 160

Gln Cys Lys Asp Phe Thr Gly Leu Leu Ser Pro Leu Arg Asp Gly Ser

165 170 175

Cys Ser Asp Leu His Gly His Gly Thr His Val Ala Arg Ser Val Leu

180 185 190

Ala Asp Gly Gly Asp Glu Gly Thr Gly Ile Tyr Gly Val Ala Pro Asp

195 200 205

Ala Lys Leu Trp Ala Tyr Lys Val Leu Gly Asp Thr Gly Met Gly Phe

210 215 220

Ser Asp Asp Ile Ala Ala Ala Ile Arg His Ala Ser Asp Glu Ala Asn

225 230 235 240

Arg Leu Gly Val Asn Leu Val Ile Ser Met Ser Leu Gly Ser Asp Gly

245 250 255

Lys Asp Glu Leu Ile Ser Glu Ala Val Thr Tyr Ala Asn Lys Asn Gly

260 265 270

Thr Leu Val Val Ala Ala Ala Gly Asn Ser Gly Pro Asp Glu Asn Thr

275 280 285

Ile Gly Tyr Pro Gly Gly Leu Lys Glu Ala Val Ala Val Ala Ala Leu

290 295 300

Glu Asp Thr Val Glu Asn Gly Thr Tyr Arg Ile Ala Asp Phe Ser Ser

305 310 315 320

Arg Gly Asn Pro Ser Thr Asp Gly Asp Tyr Ile Ile Gly Glu Gln Asp

325 330 335

Val Glu Val Ser Ala Pro Gly Lys Asn Ile Leu Ser Thr Trp Asn Asp

340 345 350

Gly Thr Tyr Asn Thr Ile Ser Gly Thr Ser Met Ala Thr Pro His Val

355 360 365

Ser Gly Leu Ala Ala Lys Ile Trp Ala Ala Asn Pro Gly Leu Thr Asn

370 375 380

Thr Gln Leu Arg Ser Glu Leu Gln Asn Arg Ala Lys Ala Lys Asp Ile

385 390 395 400

Leu Gly Gly Leu His Ala Ala Gln Gly Asp Asp Ile Ala Ser Gly Phe

405 410 415

Gly Phe Pro Thr Val Lys Gln

420

<210> 3

<211> 1311

<212> DNA

<213>Bacillus SCSIO 06063 (Bacillus sp. SCSIO 06063)

<400> 3

atggcgaaac cactatcaaa agggggaatt ttggtgaaaa aagtattgat tgcaggtgca 60

gtaggaacag cagttctttt cggaaccctt tcatcaggta taccaggttt acccgcggca 120

gacgctgatg caaaggtaca gaatgagatc aaagggcaag acaacatcag ggtatacata 180

caatcggata acacctctat caaaaatgaa gcaaagagta aatatgggac gagatggaat 240

ctggatgaag acactttctc cactaccgta aatcaaagcc aatttgaagc cctacagaaa 300

aataaaaatc tgtcggttca aaaagtgtca aacgtacagg tggatctcct ttgggactcc 360

aataaatccg ttacccccac tgaccaaaca ccatggggaa tcgaggcaat gtatgaagat 420

cccgccattc aagcgacaag tggtggagaa aacattcgtg tagctgtatt ggatacagga 480

gtgaagacca accaccagga tctggagaat cggtcagaac agtgtaaaga cttcacgggg 540

ctcctatccc cattgagaga tggaagttgt tctgatttgc atggccatgg tacccatgtt 600

gcccgcagtg tactggctga tggaggcgat gaaggaacag gaatctacgg agtcgctcca 660

gatgctaagc tttgggctta taaggtcctc ggggacacag gaatgggctt ctccgatgac 720

attgcagctg cgatccgaca cgcttccgat gaagctaatc gccttggagt gaacctggtt 780

atttccatgt cgcttggatc agacggaaag gacgaactga tttctgaagc agtaacatac 840

gctaacaaga atggcaccct tgtagtagcg gctgcaggaa attccggtcc cgatgaaaac 900

acgatcgggt accctggtgg tctgaaagaa gcagtggcgg ttgctgcatt agaagacaca 960

gttgaaaacg gaacgtaccg aatcgctgac ttctcttcca gagggaatcc ttcaacagat 1020

ggtgattata tcatcggaga acaggatgta gaggtttcgg ctccaggaaa aaacatccta 1080

tcaacctgga atgacggaac atataatacg atcagtggga cgtcaatggc gactccacat 1140

gtatcgggcc tggcagctaa gatttgggca gcgaacccgg gcttaacgaa cacacagctg 1200

agatcagagc ttcaaaacag agccaaagcg aaagacatcc tcggagggct acatgcagct 1260

caaggagatg acatcgcttc tggattcggt ttcccgacag taaaacaata a 1311

<210> 4

<211> 126

<212> DNA

<213>Bacillus subtilis WB600 (Bacillus subtilis WB600)

<400> 4

atggcgaaac cactatcaaa agggggaatt ttggtgaaaa aagtattgat tgcaggtgca 60

gtaggaacag cagttctttt cggaaccctt tcatcaggta taccaggttt acccgcggca 120

gacgct 126

<210> 5

<211> 436

<212> PRT

<213>Bacillus SCSIO 06063 (Bacillus sp. SCSIO 06063)

<400> 5

Met Ala Lys Pro Leu Ser Lys Gly Gly Ile Leu Val Lys Lys Val Leu

1 5 10 15

Ile Ala Gly Ala Val Gly Thr Ala Val Leu Phe Gly Thr Leu Ser Ser

20 25 30

Gly Ile Pro Gly Leu Pro Ala Ala Asp Ala Asp Ala Lys Val Gln Asn

35 40 45

Glu Ile Lys Gly Gln Asp Asn Ile Arg Val Tyr Ile Gln Ser Asp Asn

50 55 60

Thr Ser Ile Lys Asn Glu Ala Lys Ser Lys Tyr Gly Thr Arg Trp Asn

65 70 75 80

Leu Asp Glu Asp Thr Phe Ser Thr Thr Val Asn Gln Ser Gln Phe Glu

85 90 95

Ala Leu Gln Lys Asn Lys Asn Leu Ser Val Gln Lys Val Ser Asn Val

100 105 110

Gln Val Asp Leu Leu Trp Asp Ser Asn Lys Ser Val Thr Pro Thr Asp

115 120 125

Gln Thr Pro Trp Gly Ile Glu Ala Met Tyr Glu Asp Pro Ala Ile Gln

130 135 140

Ala Thr Ser Gly Gly Glu Asn Ile Arg Val Ala Val Leu Asp Thr Gly

145 150 155 160

Val Lys Thr Asn His Gln Asp Leu Glu Asn Arg Ser Glu Gln Cys Lys

165 170 175

Asp Phe Thr Gly Leu Leu Ser Pro Leu Arg Asp Gly Ser Cys Ser Asp

180 185 190

Leu His Gly His Gly Thr His Val Ala Arg Ser Val Leu Ala Asp Gly

195 200 205

Gly Asp Glu Gly Thr Gly Ile Tyr Gly Val Ala Pro Asp Ala Lys Leu

210 215 220

Trp Ala Tyr Lys Val Leu Gly Asp Thr Gly Met Gly Phe Ser Asp Asp

225 230 235 240

Ile Ala Ala Ala Ile Arg His Ala Ser Asp Glu Ala Asn Arg Leu Gly

245 250 255

Val Asn Leu Val Ile Ser Met Ser Leu Gly Ser Asp Gly Lys Asp Glu

260 265 270

Leu Ile Ser Glu Ala Val Thr Tyr Ala Asn Lys Asn Gly Thr Leu Val

275 280 285

Val Ala Ala Ala Gly Asn Ser Gly Pro Asp Glu Asn Thr Ile Gly Tyr

290 295 300

Pro Gly Gly Leu Lys Glu Ala Val Ala Val Ala Ala Leu Glu Asp Thr

305 310 315 320

Val Glu Asn Gly Thr Tyr Arg Ile Ala Asp Phe Ser Ser Arg Gly Asn

325 330 335

Pro Ser Thr Asp Gly Asp Tyr Ile Ile Gly Glu Gln Asp Val Glu Val

340 345 350

Ser Ala Pro Gly Lys Asn Ile Leu Ser Thr Trp Asn Asp Gly Thr Tyr

355 360 365

Asn Thr Ile Ser Gly Thr Ser Met Ala Thr Pro His Val Ser Gly Leu

370 375 380

Ala Ala Lys Ile Trp Ala Ala Asn Pro Gly Leu Thr Asn Thr Gln Leu

385 390 395 400

Arg Ser Glu Leu Gln Asn Arg Ala Lys Ala Lys Asp Ile Leu Gly Gly

405 410 415

Leu His Ala Ala Gln Gly Asp Asp Ile Ala Ser Gly Phe Gly Phe Pro

420 425 430

Thr Val Lys Gln

435

Claims (10)

1. The keratinase of following 1. (a) or (b), it is characterised in that：

   (a) keratinase of the amino acid sequence composition as shown in SEQ ID NO.2；

   (b) amino acid sequence in (a) is by substituting, lacking or add one or several amino acid and have keratinase activity The protein as derived from (a) of property.
2. 2. encode the gene of the keratinase described in claim 1.
3. 3. gene according to claim 2, it is characterised in that its nucleotide sequence is as shown in SEQ ID NO.1.
4. The keratinase of following 4. (a) or (b), it is characterised in that：

   (a) keratinase of the amino acid sequence composition as shown in SEQ ID NO.5；

   (b) amino acid sequence in (a) is by substituting, lacking or add one or several amino acid and have keratinase activity The protein as derived from (a) of property.
5. 5. encode the gene of the keratinase described in claim 4.
6. 6. gene according to claim 5, it is characterised in that it is the coding nucleotide sequence replacement by a segment signal peptide The partial sequence of gene described in claim 2, the coding nucleotide sequence of the signal peptide have shown in SEQ ID NO.4 Nucleotide sequence or its functional equivalent variant.
7. 7. gene according to claim 5, it is characterised in that the nucleotide sequence of the gene such as SEQ ID NO.3 It is shown.
8. 8. a kind of engineering bacteria, it is characterised in that it contains the expression vector that can express the gene of claim 2,3,5,6 or 7 Bacillus subtilis.
9. 9. the engineering bacteria described in claim 8 is in production keratinase or to the application in the processing containing protein material.
10. 10. the keratinase described in claim 1 or 4 is in protein degradation and/or to answering in the processing containing protein material With.