CN106350530A - Keratinase and gene sequence and application method thereof - Google Patents

Abstract

The invention provides a keratinase and its gene coding sequence and application method mined based on the metagenomic technology. The full length of the keratinase gene is 1,152bp, encoding 384 amino acids; taking Escherichia coli E.coli as an example, the heterologous expression of the keratinase gene was successfully realized. The acquisition method of the keratinase gene is convenient and feasible. The gene is recombined and expressed, and the recombinant strain constructed can secrete keratinase after being induced, which can effectively hydrolyze soluble keratin, casein, wool, feather and other substrates. It has good application value in fields such as biodegradation, feed processing, detergent additives, material biosynthesis, and transdermal drug preparation. The optimum reaction temperature of the keratinase is 55° C., and the optimum reaction pH is 10.0, and the keratinase shows good tolerance to surfactants, and the enzyme stability is good. The recombinant bacterium has a short fermentation cycle and is suitable for large-scale industrial production.

Description

A kind of keratinase and its gene sequence and application method

technical field

The invention provides a keratinase and its gene coding sequence and application method mined based on the metagenomic technology. The invention belongs to the technical field of genetic engineering and enzyme engineering.

Background technique

Keratin is a kind of fibrous protein with connective and protective functions mainly found in the tissues of reptiles, birds, amphibians and mammals, rich in cysteine, lysine, proline and serine. Keratin Protein is the main component of feathers, hair, nails, horns, hooves, bones, fur, claws, hides, beaks, skin, wool, scales, and bristles. Since keratin contains more bismuth that acts as a cross-link Sulfur bonds, so it has high mechanical strength, is not easy to be degraded, and has strong resistance to the hydrolysis of pepsin, trypsin, and papain. In fact, thousands of tons of feathers are discarded every year. The environment has caused huge pollution, so finding a fast, simple, cheap and green degradation method has become a research hotspot in this field.

Keratinases mostly belong to extracellular serine proteases, which are enzymes that can hydrolyze stubborn proteins such as keratin more effectively than other proteases. Keratinases have both disulfide bond reductase and polypeptide hydrolase activities, and can specifically degrade keratin . Therefore, the use of keratinase to degrade keratin waste such as feathers is not only an environmentally friendly biological treatment process, but also the hydrolyzate can be recycled and used as animal feed to create benefits.

The production of the reported natural keratinase production strains is not high overall, and it also brings some challenges to the isolation and purification of keratinase. With the rapid development of molecular biology and genetic engineering technology, the study of keratinase gene in heterologous hosts The cloning and high-efficiency expression of Bacillus licheniformis have become the current development trend in this field. Liu et al. recombined the keratinase in Bacillus licheniformis into Bacillus subtilis WB600 and carried out high-efficiency expression, and applied it in the wool textile industry (Liu B., et al. al, World Journal of Microbiology and Biotechnology, 2013,29(5):825-832); HSIN-HUNG LIN etc. transferred the keratin gene in Pseudomonas aeruginosa into Pichia pastoris and successfully expressed it, and No glycosylation modification occurred (Lin H.H., Journal of Agricultural & Food Chemistry, 2009, 57(17): 7779-7784), and the group also transferred this gene into Bacillus subtilis DB104 and Escherichia coli AD494(DE3)pLsS respectively, All achieved successful expression (Lin H.H.,, Journal of Agricultural & Food Chemistry, 2009,57(9):3506-11); Lian Yang et al. constructed a strain that rapidly degrades feathers, and they transferred the Bacillus subtilis SCK6 keratinase gene into In its relative strain Bacillus amyloliquefaciens K11, overexpression was achieved (Yang L., et al, Journal of Agricultural & Food Chemistry, 2016, 64(1):78–84).

At present, domestic keratinase research is mostly in the stage of isolation, screening, separation and purification of keratinase, and research on physical and chemical properties. In terms of molecular biology, there are relatively few reports on the cloning and expression of related genes. The present invention obtains a keratinase and its coding gene through the metagenomic technology, and performs heterologous expression of the keratinase gene in a heterologous host, studies its enzymatic properties, and investigates the industrial application potential of the enzyme, It laid the foundation for future research on keratinase. Although this section of gene has high homology with keratinase coding genes such as Bacillus tequilensis, Bacillus pumilus, Bacillus circulans, Bacillus safensis reported in the NCBI database, the keratinase used in the present invention shows differences with reported similar enzymes The optimum reaction temperature of the keratinase is 55°C, and the optimum reaction pH is 10.0; different metal ions have different effects on the enzyme activity; the keratinase encoded by the keratinase gene shows better surfactant Tolerance; and the enzyme has a wider substrate spectrum, low collagen activity, high keratin activity, showing good application prospects.

Contents of the invention

The purpose of the present invention is to provide a kind of keratinase and its gene coding sequence and application method excavated based on metagenomic technology. The invention provides a plasmid containing the gene of the present invention, a host cell containing the expression plasmid, and a method for expressing and producing keratinase using the recombinant strain.

Technical scheme of the present invention is:

Based on metagenomic technology, the keratinase gene in soil metagenomics was screened by constructing Fosmid library. Using the soil metagenome as a template, a gene library was established, and the target keratinase gene was obtained by screening. According to the sequencing results, primers were further designed and the coding gene sequence was amplified by PCR technology. After electrophoresis identification, the purified PCR product was recovered and cloned into the pMD19-T vector to construct recombination Plasmid: Transform the recombinant plasmid into E.coli JM 109, pick multiple positive transformants and put them in LB liquid medium (Amp ^r ) at 37°C, 220rpm and culture for 10-12h, extract the plasmid and carry out double enzyme digestion and PCR verification. The correct recombinant plasmids will be digested by BamH Ⅰ and Hind Ⅲ and connected to the vector plasmids that have been digested by the same double enzymes. The selected vector plasmids include pET series, pMA5, pWB series, pPICZα, PIC9K, pDXW series, etc. The ligation product is transformed into competent cells of host bacteria Escherichia coli, but not limited to Escherichia coli, but also includes filamentous fungi, Bacillus subtilis, Corynebacterium glutamicum, Corynebacterium blunt tooth, Pichia pastoris, Saccharomyces cerevisiae, etc., after High-efficiency expression of keratinase was achieved after cultivation.

(1) Screening of keratinase genes by metagenomic technology

Soil samples were collected from the place where furs were piled up in the tannery, the total DNA of the samples was extracted, and the Fosmid library was constructed. The milk plate was used for primary screening, and soluble keratin was used as the substrate to determine the enzyme activity. The positive transformants were re-screened and showed keratinase activity. The transformants were extracted and sequenced to obtain the gene encoding keratinase.

(2) PCR amplification of keratinase gene

Using the soil metagenome as a template, primers (P1, P2) were designed according to the nucleotide sequence obtained by sequencing, and the coding gene of keratinase was amplified by PCR:

Primer P1: 5'-CGCGGATCCTGAAAAAAGCTATATTGTTGG-3'(BamH Ⅰ)

Primer P2: 5'-CCCAAGCTTCTCGAGTTAGTTAGAAGCTG-3'(HindⅢ)

The PCR amplification reaction was carried out in a 50 μL system, and 25 μL of Ex was added to the reaction system (Premix), 20 μL ddH2O, 2 μL template DNA, 1.5 μL upstream and downstream primers. The reaction conditions were 30 cycles of denaturation at 94°C for 3 minutes: denaturation at 94°C for 30 s, annealing at 57°C for 30 s, extension at 72°C for 1 min, and a total of 30 cycles; final extension at 72°C for 10 min. The PCR products were identified by nucleic acid electrophoresis, recovered and purified by tapping the gel, and the recovered products were cloned into the pMD19-T vector to construct a recombinant cloning plasmid. The plasmid was transformed into E.coli JM 109, and multiple positive transformants were picked and placed in LB liquid medium (Amp ^r ) at 37° C., 220 rpm for 10-12 hours, and after extracting the plasmid, double enzyme digestion and PCR verification were performed on the plasmid, and sequence determination was performed to verify correctness.

(3) Construction of recombinant expression plasmids

In this study, the expression plasmid pET-28a(+) was taken as an example. This plasmid has a T7 promoter and a 6×His-tag tag. Ⅰ and HindⅢ were subjected to double enzyme digestion, 37°C for 3 hours, followed by nucleic acid electrophoresis verification and gel tapping to recover the target gene and target plasmid. The recovered product was ligated with T4 DNA ligase at 16°C overnight, and the ligated product was transformed into E.coli JM 109 competent Cells were cultured overnight in LB containing kanamycin resistance (50mg/L), and multiple positive transformants were picked and cultured in LB liquid medium containing kanamycin at 37°C and 220rpm for 10 ~12h later, the plasmid was extracted and named pET-28a(+)-ker.

(4) Construction and screening of recombinant expression strains

In this study, taking Escherichia coli as an example, the recombinant plasmid pET-28a(+)-ker was transformed into E. coli host E.coli BL21(DE3) competent cells after heat shock at 42°C for 90s. (50mg/L) LB was cultured overnight, and the positive transformant E.coli BL21(DE3)/pET-28a(+)-ker was screened by PCR verification, and inoculated to the cells containing kanamycin resistance (50mg/L) overnight in LB medium. The next day, transfer 1% of the inoculum to 50 mL of fresh LB liquid medium (containing Kan ^r 50 mg/L), culture at 37°C for about 3 hours, and when the OD600nm is about 0.6-0.8, add 50 μL of 0.5 mM inducer IPTG, 20 After induction at ℃ for 16 hours, the recombinant bacteria showed keratinase activity.

(5) Separation and purification of recombinant keratinase

Centrifuge the recombinant bacterial fermentation broth obtained above at 4°C and 8,000rpm for 20min, remove the supernatant to collect the cell pellet, wash the cell with 10mL Tris-HCl (pH 9.0) buffer to remove impurities, and centrifuge at 8,000rpm for 10min. Remove the supernatant again to collect the bacterial precipitate, suspend it with 5mL Tris-HCl (pH9.0) buffer solution, and prepare a bacterial suspension. Place the bacterial suspension in an ice-water bath and use a cell ultrasonic disruptor for ultrasonic disruption. The conditions are: : Work 200 cycles under 200W power, each cycle works for 3s and stops for 7s. The broken sample was stained with crystal violet and examined under the microscope until the cell rupture was complete. The lysed cells were centrifuged at 4°C and 8,000 rpm for 30 minutes, and the obtained supernatant was the crude enzyme solution. Filter the cell-free extract with a 0.22 μm water membrane to prepare the loading sample, wash the Ni-NTA agarose gel column with Binding Buffer (20mM NaH2PO4, 500mM NaCl, 10mM imidazole, 8M urea) for 10 column bed volumes, The flow rate is 5mL/min until equilibrium; load the sample to be purified, the flow rate is 1.5mL/min; wash 10 column bed volumes with Binding Buffer, the flow rate is 5mL/min; use 0-100% Elution Buffer (20mM NaH2PO4, 500mM NaCl, 500mM imidazole, 8M urea) for linear elution, elution of 25 column bed volumes, flow rate of 5mL/min, real-time monitoring of the elution process UV _280nm , collecting elution peak samples, and analyzing angles by SDS-PAGE The molecular weight and purity of protease purification samples.

(6) Study on the Enzymatic Properties of Recombinant Keratinase

A. Determination of optimum pH and pH stability of recombinant keratinase

Prepare 100mM B-R buffer solution with different pH, prepare 1% keratin solution with different pH buffer, and dilute the enzyme solution with different pH buffer, then measure the enzyme activity under the above pH conditions, the one with the highest enzyme activity as 100%.

Take an appropriate amount of enzyme solution and dilute it to an appropriate concentration with buffer solutions of different pH, and let it stand at 40°C for 1 hour. Measure the remaining enzyme activity according to the enzyme activity assay method to investigate the pH stability of the enzyme. The enzyme activity after standing for 0 hour is taken as 100 %.

B. Determination of optimum temperature and temperature stability of recombinant keratinase

Measure the activity of keratinase with an appropriate amount of diluted enzyme solution at 30, 40, 50, 60, 70, and 80°C to determine the optimum action temperature of the enzyme. The highest enzyme activity is taken as 100%.

Take an appropriate amount of diluted enzyme solution and place it in six different temperatures of 30, 40, 50, 60, 70, and 80°C for 30 minutes, and then measure the residual enzyme activity at this temperature. The enzyme activity at 0 minutes of incubation is taken as 100%.

C. Effect of metal ions on the activity of recombinant keratinase

Different metal ions (Fe2+, Fe3+, Co2+, Ca2+, Ni2+, Na+, Cu2+, K+, Mg2+, Al3+, Ba2+, Zn2+, Sn2+, Sr2+, Ag+, Pb2+, La3+, Li+, Mn2+ were added to the enzyme activity assay reaction system. ), so that the final concentration reached 1mM respectively, placed at room temperature for 30min, and measured the enzyme activity respectively. The reaction tube without adding metal ions was taken as 100%. live. The reaction tube without metal ions was taken as 100%.

D. Effects of protease inhibitors and surfactants on recombinant keratinase activity

Different kinds of protease inhibitors PMSF, EDTA, DTT, β-mercaptoethanol and different kinds of surfactants SDS, Tween 20, Tween 40, Tween 60, Tween 80, TritonX-100, Triton X-114, H ₂ O ₂ make the final concentration reach 1mM and 1% respectively (H2O2 reaches 15%), leave it at room temperature for 30min, and measure the enzyme activity according to the enzyme activity assay method. The reaction tube without compound is taken as 100% .

E. Effect of substrate specificity on enzyme activity

In the enzyme activity assay reaction system, wool, feather, hair, 1% soluble keratin, 1% casein, 0.5% BSA, 2% gelatin, and 2% collagen were used as substrates to measure enzyme activity, and 1% soluble keratin Protease activity as 100%.

(7) Application of recombinant keratinase for feather degradation

Weigh 0.5g of feathers and place them in 250mL Erlenmeyer flasks, numbered 1, 2, 3, 4, 5, 6, and put the following solutions into each Erlenmeyer flask:

Bottle 1: 50mL deionized water;

Bottle No. 2: 50mL recombinant keratinase fermentation concentrate (~200U/mL);

Bottle No. 3: 1.43mg papain dissolved in 50mL deionized water;

Bottle No. 4: 4.2g pepsin dissolved in 50mL deionized water;

Bottle No. 5: Dissolve 24.2mg of neutral protease in 50mL of deionized water;

Bottle No. 6: 2mg trypsin dissolved in 50mL deionized water;

The above 6 Erlenmeyer flasks were respectively placed in a shaker at 40°C and 220rpm to digest and decompose the feathers for 20 hours, and the degradation of the feathers was observed.

Advantages and beneficial effects of the present invention:

The invention provides a keratinase and its gene coding sequence and application method mined based on the metagenomic technology. It has the nucleotide sequence shown in SEQ ID NO:1, with a full length of 1,152 nucleotides, encoding 384 amino acids. Using pET-28a(+) as the expression plasmid and E.coli BL21(DE3) as the expression host, the high-efficiency expression of the surfactant-resistant keratinase gene was realized. The recombinant strain E.coli BL21(DE3)/pET-28a( +)-ker exhibits keratinase activity, can effectively degrade soluble keratin, casein, wool, feather and other substrates, and can be used in biodegradation of keratin waste, feed, detergent, materials, transdermal drugs, etc. The field has good application value. And the keratinase showed better tolerance to surfactants. The optimum reaction temperature of the keratinase is 55 DEG C, the optimum reaction pH is 10.0, the stability of the enzyme activity is good, the fermentation period of the recombinant bacteria is short, and it is suitable for large-scale industrial production.

Description of drawings

Fig. 1 is the electrophoresis pattern of PCR amplified keratinase coding gene nucleic acid.

M: 5,000bp DNA Marker; lane 1: amplified keratinase gene.

Fig. 2 is the SDS-PAGE pattern before and after separation and purification of recombinant keratinase.

M: standard protein molecular weight; lane a1 is the cell-free extract of an empty plasmid control strain that does not contain the target gene; lane a2 is the cell-free extract of keratinase from the recombinant strain; lane b1 is the purified keratinase.

Figure 3 shows the optimum pH and pH stability of keratinase.

Figure 4 shows the optimum temperature and temperature stability of keratinase.

Figure 5 is the substrate spectrum of keratinase.

1: 2% collagen; 2: 2% gelatin; 3: 2% casein; 4: 2% soluble keratin; 5: 2% BSA; 6: wool; 7: feather; 8: hair.

Figure 6 shows the degradation of feathers by keratinase and other common proteases.

A: deionized water; B: recombinant keratinase fermentation concentrate; C: papain; D: pepsin; E: neutral protease; F: trypsin.

detailed description

The present invention will be further described below in conjunction with examples, but the present invention is not limited by these examples.

Example 1

This example illustrates a method for screening keratinase genes based on metagenomic technology.

Soil samples were collected from the place where furs were piled up in the tannery, the total DNA of the samples was extracted, the Fosmid library was constructed, and a milk plate was used for primary screening; soluble keratin was used as the substrate to determine the enzyme activity, and the positive transformants were re-screened, and those showing keratinase activity The transformants were extracted and sequenced to obtain the gene encoding keratinase.

Example 2

This example illustrates the cloning method of the gene encoding keratinase.

Using the soil metagenome as a template, primers (P1, P2) were designed according to the nucleotide sequence obtained by sequencing, and the coding gene of keratinase was amplified by PCR:

Primer P1: 5'-CGCGGATCCTGAAAAAAGCTATATTGTTGG-3'(BamH Ⅰ)

Primer P2: 5'-CCCAAGCTTCTCGAGTTAGTTAGAAGCTG-3'(HindⅢ)

The PCR amplification reaction was carried out in a 50 μL system, and 25 μL of Ex was added to the reaction system (Premix), 20 μL ddH2O, 2 μL template DNA, 1.5 μL upstream and downstream primers. The reaction conditions were 30 cycles of denaturation at 94°C for 3 minutes: denaturation at 94°C for 30 s, annealing at 57°C for 30 s, extension at 72°C for 1 min, and a total of 30 cycles; final extension at 72°C for 10 min. The PCR product was identified by nucleic acid electrophoresis, recovered and purified by tapping the gel, and the recovered product was cloned into the pMD19-T vector to construct a recombinant cloning plasmid, which was transformed into E.coliJM 109, and multiple positive transformants were picked and put into LB liquid medium (Amp ^r ) Cultivate at 37°C and 220rpm for 10-12 hours. After extracting the plasmid, perform double enzyme digestion and PCR verification to verify the correct sequence. Nucleic acid electrophoresis results showed that the keratinase gene sequence was effectively amplified (Figure 1).

Example 3

This example takes pET-28a(+) as an example to illustrate the construction process of the recombinant expression plasmid.

The pET-28a(+) plasmid has a T7 promoter and a 6×His-tag tag. The pET-28a(+) plasmid and the verified recombinant cloned plasmid containing the target gene are simultaneously digested with BamH Ⅰ and Hind Ⅲ. After digestion at 37°C for 3 hours, carry out nucleic acid electrophoresis verification and tap gel to recover the target gene and target plasmid. The recovered product was ligated with T4 DNA ligase at 16°C overnight, and the ligated product was transformed into E.coli JM 109 competent cells. Cultivate the LB culture of resistance (50mg/L) overnight, pick multiple positive transformants into the LB liquid medium containing kanamycin, culture at 37°C, 220rpm for 10-12h, extract the plasmid and name it pET-28a(+)-ker.

Example 4

This example uses Escherichia coli as an example to illustrate the construction and screening methods of recombinant expression strains.

The recombinant plasmid pET-28a(+)-ker was transformed into host strain E.coli BL21(DE3) competent cells by heat shock at 42°C for 90s, and cultured overnight in LB containing kanamycin resistance (50mg/L) Cultivate, and screen positive transformants E.coli BL21(DE3)/pET-28a(+)-ker by PCR verification, inoculate into LB medium containing kanamycin resistance (10mg/L) and culture overnight. The next day, transfer 1% of the inoculum to 50 mL of fresh LB liquid medium (containing Kan ^r 50 mg/L), culture at 37°C for about 3 hours, and when the OD600nm is about 0.6-0.8, add 0.5 mM inducer IPTG 50 μL, After induction at 20°C for 16 hours, the recombinant bacteria showed keratinase activity.

Example 5

This example illustrates the separation and purification process of keratinase.

Centrifuge the recombinant bacterial fermentation broth obtained above at 4°C and 8,000rpm for 20min, remove the supernatant to collect the cell pellet, wash the cell with 10mL Tris-HCl (pH 9.0) buffer to remove impurities, and centrifuge at 8,000rpm for 10min. Remove the supernatant again to collect the bacterial precipitate, suspend it with 5mL Tris-HCl (pH9.0) buffer solution, and prepare a bacterial suspension. Place the bacterial suspension in an ice-water bath and use a cell ultrasonic disruptor for ultrasonic disruption. The conditions are: : Work 200 cycles under 200W power, each cycle works for 3s and stops for 7s. The broken sample was stained with crystal violet and examined under the microscope until the cell rupture was complete. The lysed cells were centrifuged at 4°C and 8,000 rpm for 30 minutes, and the obtained supernatant was the crude enzyme solution. Filter the cell-free extract with a 0.22 μm water membrane to prepare the loading sample, wash the Ni-NTA agarose gel column with Binding Buffer (20mM NaH2PO4, 500mM NaCl, 10mM imidazole, 8M urea) for 10 column bed volumes, The flow rate is 5mL/min until equilibrium; load the sample to be purified, the flow rate is 1.5mL/min; wash 10 column bed volumes with Binding Buffer, the flow rate is 5mL/min; use 0-100% Elution Buffer (20mM NaH2PO4, 500mM NaCl, 500mM imidazole, 8M urea) for linear elution, elution of 25 column bed volumes, flow rate of 5mL/min, real-time monitoring of the elution process UV _280nm , collecting elution peak samples, and analyzing angles by SDS-PAGE The molecular weight and purity of the protease purification sample showed that the apparent molecular weight of keratinase was about 27,000 Daltons, reaching electrophoretic purity (Figure 2).

Example 6

This example illustrates the catalytic characteristics of keratinases.

(1) Dilute the enzyme solution and substrate with B-R buffer solution of pH 5-11 to determine the enzyme activity. The optimal reaction pH value of the enzyme is 10, and the highest enzyme activity can be achieved in the range of pH 6-12 70% to 100%. After standing at 40° C. for 1 hour, the remaining enzyme activity was measured, and the recombinant keratinase was relatively stable under the condition of pH 7-12, and could maintain about 80% of the relative enzyme activity ( FIG. 3 ).

(2) Put the appropriately diluted enzyme solution under the temperature conditions of 30, 40, 50, 60, 70, and 80°C to measure the activity of keratinase, and the optimum reaction temperature of the enzyme is 55°C. Take appropriately diluted enzyme solutions and place them in water baths at the above temperatures for 30 minutes, then measure the residual enzyme activity at each temperature. The enzyme activity is relatively stable under the condition of 40-60° C., and can maintain 80% of the relative enzyme activity ( FIG. 4 ).

(3) Add different metal ions to the reaction system of enzyme activity measurement to make the final concentration reach 1mM, after standing for 30min, measure the enzyme activity respectively, the results are shown in Table 1, compared with the blank control group without adding any metal ions Compared with that, there are 7 kinds of metal ions (Ca ²⁺ , Mn ²⁺ , Ag ⁺ , Na ⁺ , Mg ²⁺ , Li ⁺ , Sn ²⁺ ) that can promote the enzyme activity, among which Ca ²⁺ ions have a positive effect on the activity of recombinant keratinase The promoting effect was the most obvious, and the relative enzyme activity reached 266.4%. Cu ²⁺ and Pb ²⁺ ions obviously inhibited the enzyme activity.

Table 1 Effect of metal ions on enzyme activity

Metal ion Relative enzyme activity (%) Metal ion Relative enzyme activity (%) Fe ²⁺ 76.5±3.1 Cu ²⁺ — Fe ³⁺ 24.2±4.2 Na ⁺ 161.5±3.5 Ca ²⁺ 266.4±3.6 Co ²⁺ 68.0±2.9 Ba ²⁺ 54.6±2.4 Li ⁺ 105.2±2.3 Mn ²⁺ 126.8±2.1 Mg ²⁺ 115.7±3.6 K ⁺ 60.3±3.9 Sr ²⁺ 96.7±1.7 Al ³⁺ 48.9±1.5 Pb ²⁺ — Zn ²⁺ 74.4±4.1 Ni ²⁺ 60.8±2.8 La ³⁺ 98.8±3.2 Sn ²⁺ 180.2±2.4 Ag ⁺ 129.5±2.5

(4) Different protease inhibitors and surfactants were added to the enzyme activity measurement reaction system, and the enzyme activities were measured after standing at room temperature for 30 minutes. The results are shown in Table 2. PMSF showed complete inhibition of the enzyme, indicating that the Recombinant keratinase belongs to the class of serine proteases; surfactants such as Tween and Triton can promote recombinant keratinase, and the good stability of the enzyme in surfactants makes it a good application in the field of detergents prospect.

The impact of table 2 protease inhibitors and surfactants on enzyme activity

Reagent concentration Relative enzyme activity/% Reagent concentration Relative enzyme activity/% PMSF 1mM — Tween 40 1% 131.9±1.4 EDTA 1mM 14.4±2.3 Tween 60 1% 141.2±2.6 DTT 1mM 19.8±3.1 Tween 80 1% 128.0±2.1 β-ME 0.05% 19.7±2.4 Triton X-100 1% 113.7±1.4 SDS 1mM 86.2±1.4 Triton X-114 1% 157.7±3.1 Tween 20 1% 130.8±3.2

(5) 2% collagen, 2% gelatin, 2% casein, 2% soluble keratin, 2% BSA, wool, feather, and hair were used as substrates to measure enzyme activity. Compared with soluble keratin, casein showed the highest enzyme activity at about 205 U/mL when it was used as a substrate, while the enzyme activity was lower at 27 U/mL when collagen was used as a substrate (Fig. 5). Therefore, it can be seen that the recombinant keratinase has a broad substrate spectrum, can utilize both insoluble substrates and soluble substrates, and has low collagenase activity, which is beneficial to its application in the pharmaceutical industry.

Example 7

This example illustrates the application of recombinant keratinase to a feather degradation test.

Weigh 0.5g of feathers and place them in 250mL conical flasks, add 50mL of deionized water, recombinant keratinase fermentation broth, papain solution, pepsin solution, neutral protease solution, and trypsin solution in each conical flask , and then put the above 6 Erlenmeyer flasks in a shaker at 40°C and 220rpm to digest and decompose the feathers for 20 hours. As shown in Figure 6, the feathers in the recombinant keratinase fermentation broth were basically completely degraded, leaving only a small amount of rachis , while deionized water and other proteases did not degrade feathers, indicating that this enzyme has a good application prospect in the feed industry. At the same time, it can also be used in the biological preparation of keratin materials, or in the washing industry, to remove protein and keratin stains, and in transdermal drugs, mainly used to hydrolyze and remove epidermal keratin to promote drugs Osmotic absorption.

The present invention is not limited to these disclosed embodiments, and the present invention will cover the scope described in the technical solution, as well as various modifications and equivalent changes in the scope of the claims, without departing from the technical solution of the present invention, the present invention is made Any modifications or improvements that can be easily realized by those skilled in the art belong to the scope of protection claimed by the present invention.

SEQ ID NO: 1

SEQ: 1152 bp;

Composition: 339 A; 271 C; 252 G; 290 T; 0 OTHER

Percentage: 29.4% A; 23.5% C; 21.9% G; 25.2% T;

Molecular Weight (kDa): ssDNA: 355.49 dsDNA: 710.16

ORIGIN

1 ATGTGCGTGA AAAAGAAAAA TGTGATGACA AGTGTTTTAT TGGCTGTCCC TCTTCTGTTT

61 TCAGCAGGGT TTGGAGGCTC CATGGCAAAT GCCGAGACGG TCTCCAAAAC AGATAGTGAA

121 AAAAGCTATA TTGTTGGTTTTAAAGCCTCTGCCACCACAAACAGCTCTAAAAAACAAGCT

181 GTCATTCAAA ATGGTGGAAA ACTAGAAAAA CAATACCGCC TCATTAATGC TGCACAAGTG

241 AAAATGTCCG AACAAGCCGC CAAAAAACTT GAACATGACC CTAGCATTGC TTACGTAGAA

301 GAAGACCATA AAGCAGAAGC ATATGCACAA ACCGTCCCTT ATGGAATCCC TCAAATCAAA

361 GCTCCAGCTG TACACGCTCA AGGTTATAAA GGTGCTAATG TCAAAGTAGC TGTCCTTGAT

421 ACTGGAATCC ACGCTGCACA CCCTGATTTA AATGTTGCAG GCGGTGCGAG CTTCGTCCCT

481 TCAGAGCCAA ATGCCACCCA AGACTTTTCAA TCACATGGAA CTCACGTAGC TGGAACCATT

541 GCTGCCCTTG ATAACACAAT TGGTGTACTC GGGGTCGCTC CAAGCGCTTC CCTATATGCT

601 GTAAAGTAT TAGACCGCTA TGGCGACGGA CAATACAGCT GGATTATTAG CGGTATTGAA

661 TGGGCTGTAG CCAATAATAT GGATGTCATC AATATGAGCT TAGGCGGACC AAGCGGTTCA

721 ACTGCGCTTA AAAATGCCGT CGATACAGCG AATAACCGTG GAGTCGTTGT TGTGGCAGCC

781 GCAGGTAATT CTGGCTCTAG CGGCTCTAGC AGTACAGTTG GCTATCCAGC AAAATACGAT

841 TCTACAATTG CTGTTGCCAA TGTAAACAGT AACAATGTCA GAAACTCATC TTCTAGCGCA

901 GGTCCTGAAT TAGATGTTTC TGCACCTGGT ACTTCTATTT TAAGTACAGT GCCAAAGCAGT

961 GGATACACTT CTTTGAACGG AACGTCAATG GCTTCTCCTC ATGTAGCGGG AGCAGCAGCT

1021 TTGATCTTGT CAAAACATCC GAACCTTTCA GCTTCACAAG TCCGCAACCG TCTCTCCAGC

1081 ACGGCGACTT ATTTGGGAAG CTCCTTCTAC TATGGGAAAG GTCTGATCAA TGTCGAAGCT

1141 GCCGCTCAAT AA

SEQ ID NO: 2

Universal code

Total amino acid number: 384, MW=39420

The protein of mature keratinae starts at ‘AQPVT’ for 267 amino acids, MW=26750

1 MCVKKKNVMT SVLLAVPLLF

21 SAGFGGSMAN AETVSKTDSE

41 KSYIVGFKAS ATTNSSKKQA

61 VIQNGGKLEK QYRLINAAQV

81 KMSEQAAKKL EHDPSIAYVE

101 EDHKAEAYAQ TVPYGIPQIK

121 APAVHAQGYK GANVKVAVLD

141 TGIHAAHPDL NVAGGASFVP

161 SEPNATQDFQ SHGTHVAGTI

181 AALDNTIGVL GVAPSASLYA

201 VKVLDRYGDG QYSWIISGIE

221 WAVANNMDVI NMSLGGPSGS

241 TALKNAVDTA NNRGVVVVAA

261 AGNSGSSGSS STVGYPAKYD

281 STIAVANVNS NNVRNSSSSA

301 GPELDVSAPG TSILSTVPSS

321 GYTSLNGTSM ASPHVAGAAA

341 LILSKHPNLS ASQVRNRLSS

361 TATYLGSSFY YGKGLINVEA

381 AAQ

Claims (5)

1. A gene encoding keratinase, characterized in that the nucleotide sequence is as shown in SEQ ID NO:1. 2. A gene encoding keratinase, the amino acid sequence of which is shown in SEQ ID NO:2. 3. A plasmid for carrying a gene encoding keratinase, characterized in that: the plasmid can be selected from any one of pET series, pMA5, pWB series, pPICZα, PIC9K, pDXW series, and contains the nucleosides of claim 1 acid sequence. 4. A recombinant bacterial strain for producing keratinase is characterized in that: the plasmid in claim 3 is introduced in the exogenous host, and the exogenous host can be selected from Escherichia coli Escherichia, bacillus Bacillus, Corynebacterium Corynebacterium, Any of Yeasts and filamentous fungi. 5. A method in which keratinase is applied to degrade keratin, is characterized in that: the keratinase enzyme liquid produced by the recombinant bacterium described in claim 4 and feathers are placed in a reactor, and the optimum reaction temperature is 55° C. The suitable reaction pH is 10.0, and feathers can be completely digested and decomposed. It can be used in the feed industry to increase the amino acid content in the feed, or in the biological preparation of keratin materials, and can also be used in the washing industry to remove protein stains. As well as the application of transdermal drugs to promote drug penetration and absorption.