CN108004348A - A kind of primer, probe and kit for being used to detect enteric adenovirus - Google Patents
A kind of primer, probe and kit for being used to detect enteric adenovirus Download PDFInfo
- Publication number
- CN108004348A CN108004348A CN201711230467.5A CN201711230467A CN108004348A CN 108004348 A CN108004348 A CN 108004348A CN 201711230467 A CN201711230467 A CN 201711230467A CN 108004348 A CN108004348 A CN 108004348A
- Authority
- CN
- China
- Prior art keywords
- probe
- enteric adenovirus
- primer
- adenovirus
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Abstract
The invention discloses a kind of primer, probe and kit for being used to detect enteric adenovirus, belong to biological technical field.The primer and probe includes：For detecting the forward primer of enteric adenovirus, the reverse primer for detecting enteric adenovirus and the probe for detecting enteric adenovirus.The kit includes above-mentioned primer and probe.The primer, probe and kit, have the characteristic of high sensitivity, can accurately detect whether sample infects enteric adenovirus.
Description
Technical field
The present invention relates to biological technical field, more particularly to a kind of primer, probe and reagent for being used to detect enteric adenovirus
Box.
Background technology
Adenovirus is a kind of common virus infection, has many different clinical manifestations, clinical symptoms are very unique sometimes, can
To make clearly diagnosis, but most case, symptom caused by adenovirus are difficult to be distinguished caused by other cause of diseases.Gland
Virus most often results in the infection of respiratory tract and intestines and stomach.
Since 1981, external Kidd, Takiff etc. isolate enteron aisle type adenovirus from Feces of Patients With Diarrhea earliest
(EAD), later DeTong restriction endonuclease analysis EAD, it is found that it has two kinds of different electrophoresis patterns, entitled Ad-40 and Ad-
41.Adenovirus gastroenteritis is distributed widely in the whole world, and recall rate is 5%~14%, and wherein Ad-40 and Ad-41 account for 70% or so.
The minimum age of onset of adenovirus gastroenteritis is 1 month, and the overwhelming majority betides the infant of less than 3 years old.Ad-40
1 years old or so baby of main infection, Ad-41 then infect slightly larger child, and whole year can fall ill, but adenoviral gastroenteritis generally in
It is sporadic.
In about 10 days incubation periods of adenovirus gastroenteritis, be mainly shown as diarrhea, and amount is less or more, few in watery stool or loose stools
Number patient can discharge mucus, the course of disease 4~8 days, often with vomiting.Some patientss have respiratory symptom, and small number of patients is generated heat, and the course of disease is more
From limit, toxin expelling time about 1 week.Some patient's dehydrations are more serious, and indivedual Severe Dehydration persons can be dead.
Since the pathogenic effects viral to this are paid little attention to, regular growth culture there is no.Though DNA can be used by diagnosing this disease
Restriction enzyme detection method, but this method has certain limitation, is not easy to promote.It is believed that using polyacrylamid gel electrophoresis
Rotavirus in Ad and excrement can be detected, susceptibility is higher than Electronic Speculum.
Treatment to adenoviral gastroenteritis is mainly symptomatic treatment, the oral rehydration of orally available world health organisation recommendations
Salt, gives vein fluid infusion if necessary.
The content of the invention
In order to solve the problems, such as that antibody test is inaccurate in the prior art, it is used to detect an embodiment of the present invention provides one kind
Primer, probe and the kit of enteric adenovirus.The technical solution is as follows：
On the one hand, be used to detecting the primer and probe of enteric adenovirus an embodiment of the present invention provides a kind of, the primer and
Probe includes：For detecting the forward primer of enteric adenovirus, the reverse primer for detecting enteric adenovirus and for detecting enteraden
The probe of virus, wherein,
The forward primer for being used to detect enteric adenovirus is as shown in SEQ ID NO.1 in sequence table；
The reverse primer for being used to detect enteric adenovirus is as shown in SEQ ID NO.2 in sequence table；
The probe for being used to detect enteric adenovirus is as shown in SEQ ID NO.3 in sequence table；
5 ' ends of the probe are connected with fluorophor FAM, HEX, TET, JOE, VIC, ROX, Cy3 or Cy5, the probe
3 ' end be connected with quenching group TAMRA, Eclipse, BHQ1, BHQ2, BHQ3 or DABCYL.
On the other hand, an embodiment of the present invention provides a kind of kit for being used to detect enteric adenovirus, the kit bag
Include above-mentioned primer and probe.
Specifically, the kit further includes：Nucleic acid releasing agent, PCR reaction solution, critical positive quality control product, positive quality control
Product, negative quality-control product and working standard.
Specifically, the working standard includes：Working standard 1, working standard 2, working standard 3 and work mark
Quasi- product 4, wherein,
The working standard 1 is 1 × 107The genetic fragment of the enteric adenovirus of copy/mL；
The working standard 2 is 1 × 106The genetic fragment of the enteric adenovirus of copy/mL；
The working standard 3 is 1 × 105The genetic fragment of the enteric adenovirus of copy/mL；
The working standard 4 is 1 × 104The genetic fragment of the enteric adenovirus of copy/mL.
Specifically, the positive quality control product is 1.0 × 106The T antigen gene fragments of the enteric adenovirus of copy/mL.
Specifically, the final concentration of the forward primer and the reverse primer is 0.05-0.9 μM, the end of the probe
Concentration is 0.05-0.9 μM.
Specifically, the PCR reaction solution each component includes in pcr amplification reaction system：Final concentration of 0.01U/ μ L~
The Taq enzyme of 0.05U/ μ L, the dNTPs of final concentration of 0.2~0.6mM, 10 × PCR buffer solutions and final concentration of 1.5~5.0mM
The solution of the ion containing Mg.
Specifically, the nucleic acid releasing agent includes sterile water, the polyethylene glycol octyl phenyl of final concentration of 0.03-0.3%
Ether, Nonyl pheno (40) ether of final concentration of 0.04-0.4% and pH value are the three of 8.3 final concentration of 0.01-0.1M
(methylol) aminomethane.
Specifically, the critical positive quality control product is 1.0 × 104The genetic fragment of the enteric adenovirus of copy/mL.
Specifically, the negative quality-control product is the physiological saline of concentration 0.8%.
The beneficial effect that technical solution provided in an embodiment of the present invention is brought is：It is provided in an embodiment of the present invention to be used to detect
The primer and probe of enteric adenovirus, has the characteristic of high sensitivity, can accurately detect whether sample infects enteric adenovirus, this hair
The kit for being used to detect enteric adenovirus that bright embodiment provides, has the characteristic of high sensitivity, can accurately detect sample is
No infection enteric adenovirus, fluorescence signal is collected using instrument, avoids the subjectivity that naked eyes judge, its testing result is reliable, carries
The high sensitivity of detection, can also effectively be detected even if the purpose fragment kit that singly copies is only existed；Detection
Speed is fast, whole detection process altogether only need 2~3 it is small when.
Brief description of the drawings
To describe the technical solutions in the embodiments of the present invention more clearly, make required in being described below to embodiment
Attached drawing is briefly described, it should be apparent that, drawings in the following description are only some embodiments of the present invention, for
For those of ordinary skill in the art, without creative efforts, other can also be obtained according to these attached drawings
Attached drawing.
Fig. 1 is the fluorescent amplification curve figure that the embodiment of the present invention 2 provides；
Fig. 2 is the fluorescent amplification curve figure that the embodiment of the present invention 3 provides；
Fig. 3 is the fluorescent amplification curve figure that the embodiment of the present invention 4 provides；
Fig. 4 is the fluorescent amplification curve figure for the standard curve that the embodiment of the present invention 5 provides；
Fig. 5 is the fluorescent amplification curve figure that the embodiment of the present invention 5 provides；
Fig. 6 is the canonical plotting obtained by Fig. 4 that the embodiment of the present invention 5 provides, and Fig. 6 abscissas are Log Starting
Quantity copy number, ordinate are Threshold Cycle.
In figure：Cycles is period, and RFU is fluorescent value, and Log Starting Quantity copy number are water
Acne herpes zoster virus initial concentration to numerical value, Ct (Threshold Cycle) value is period；Sample in 1a- embodiments 2
Sample 4 in Isosorbide-5-Nitrae a- embodiments 2, sample 5 in 5a- embodiments 2, sample 6 in 6a- embodiments 2, sample 7 in 7a- embodiments 2.
Embodiment
To make the object, technical solutions and advantages of the present invention clearer, below in conjunction with attached drawing to embodiment party of the present invention
Formula is described in further detail.Agents useful for same and probe are mainly purchased from precious bioengineering (Dalian) limited public affairs in following embodiments
Department.
A kind of primer and fluorescence probe for the detection of enteric adenovirus nucleic acid quantification of embodiment 1.
An embodiment of the present invention provides a kind of primer and probe for being used to detect enteric adenovirus, primer and probe includes：With
In detection enteric adenovirus forward primer, the reverse primer for detecting enteric adenovirus and the probe for detecting enteric adenovirus,
Wherein,
For detecting the forward primer of enteric adenovirus as shown in SEQ ID NO.1 in sequence table；
For detecting the reverse primer of enteric adenovirus as shown in SEQ ID NO.2 in sequence table；
For detecting the probe of enteric adenovirus as shown in SEQ ID NO.3 in sequence table；
5 ' ends of probe are connected with fluorophor FAM, HEX, TET, JOE, VIC, ROX, Cy3 or Cy5, and 3 ' ends of probe connect
It is connected to quenching group TAMRA, Eclipse, BHQ1, BHQ2, BHQ3 or DABCYL.In embodiments of the present invention, the fluorescence of probe
Reporter group is FAM, and the excitation wavelength of FAM is 485nm, a length of 527nm of received wave；Quenching group is Eclipse.Way of purification
It may be selected from：HAP, PAGE and HPLC way of purification, specifically primer and probe such as following table：
1. enteric adenovirus primer and probe of table
In table 1：F：Forward, it is positive；Enteric adenovirus-F represents the forward primer of enteric adenovirus.R：Reverse, reversely；
Enteric adenovirus-R represents the reverse primer of enteric adenovirus.P：Probe, fluorescence probe (probe)；Enteric adenovirus-P represents enteraden disease
Malicious fluorescence probe, fluorescence probe can be TaqMan-MGB fluorescence probes, LNA fluorescence probes or MGB fluorescence probes.Table 1 is set
The primer and probe of meter entrusts precious bioengineering (Dalian) Co., Ltd to synthesize.
Primer and probe provided in an embodiment of the present invention has the characteristic of high sensitivity, and can accurately detect to treat test sample
The content of enteric adenovirus in product.
A kind of kit for being used to detect enteric adenovirus of embodiment 2.
An embodiment of the present invention provides a kind of kit for being used to detect enteric adenovirus nucleic acid quantification, which includes this
The primer and probe that inventive embodiments 1 provide, the kit further include：Nucleic acid releasing agent, PCR reaction solution, critical positive quality control
Product, positive quality control product, negative quality-control product and working standard.
Specifically, PCR reaction solution each component includes in pcr amplification reaction system：Final concentration of 0.01U/ μ L~
The Taq enzyme of 0.05U/ μ L, the dNTPs of final concentration of 0.2~0.6mM, 10 × PCR buffer solutions and final concentration of 1.5~5.0mM
The solution of the ion containing Mg.In the present embodiment, the proportioning of each component content of PCR reaction solution is：Concentration is the Taq enzyme of 5U/ μ L
0.3 μ L, dNTPs2 μ L, 10 × PCRBuffer5 μ L that concentration is 10mmol/L and the MgCl that concentration is 25mmol/L25 μ of solution
L。
Specifically, the final concentration of forward primer and reverse primer is 0.05-0.9 μM (forward primer and reverse primer is equal
For 0.05-0.9 μM), final concentration of 0.05-0.9 μM of probe.In the present embodiment, concentration adds 2.5 for 10 μm of ol/L primers
μ L, concentration add 2.5 μ L for 10 μm of ol/L probes.
In actual application, primer and probe can together be added and reaction system is formed in PCR reaction solution, then added
It is 49.5 μ L to add sterile water to volume.
Specifically, nucleic acid releasing agent：Triton-X100 (Triton X-100) final concentration of 0.03%, NP-
Final concentration of 0.04% and pH value of 40 (Nonyl pheno (40) ethers) are the Tris-HCL of 8.3 final concentration of 0.01M
(three (methylol) aminomethanes), solvent is sterile water.
Specifically, negative quality-control product is the physiological saline that concentration is 0.8%.Weigh 0.008g solid sodium chlorides and be dissolved in 1ml
Distilled water, mixes, and directly draws 0.5 μ L and makees negative quality-control product.
Specifically, it is 1.0 × 10 that positive quality control product, which is included containing concentration,6The solution of the enteric adenovirus genetic fragment of copy/mL.
Liquid containing enteric adenovirus is taken, strain is by China typical culture collection center (China Center for Type
CultureCollection, CCTCC) provide, after culture, take 100 μ L of liquid containing enteric adenovirus to add isometric nucleic acid release
After agent fully mixes, then 5min, 12000rpm are centrifuged, take supernatant to be quantified with spectrophotometric measurement A260, be then diluted to 1.0
×106Copy/mL, you can as positive quality control product template.
Specifically, critical positive quality control product is 1.0 × 104The DNA fragmentation solution of the enteric adenovirus gene of copy/mL.Take
Liquid containing enteric adenovirus, strain are provided by China typical culture collection center (CCTCC), after culture, take liquid containing enteric adenovirus
100 μ L add isometric nucleic acid releasing agent, after fully mixing, then centrifuge 5min, 12000rpm, take supernatant spectrophotometric
Measurement A260 is quantified, and is then diluted to 1.0 × 104Copy/mL, you can as critical positive quality control product.
Specifically, working standard includes：Working standard 1, working standard 2, working standard 3 and working standard
4, wherein,
Working standard 1 is to contain 1.0 × 107The non-infectious DNA fragmentation of the enteric adenovirus gene of copy/mL；
Working standard 2 is to contain 1.0 × 106The non-infectious DNA fragmentation of the enteric adenovirus gene of copy/mL；
Working standard 3 is to contain 1.0 × 105The non-infectious DNA fragmentation of the enteric adenovirus gene of copy/mL；
Working standard 4 is to contain 1.0 × 104The non-infectious DNA fragmentation of the enteric adenovirus gene of copy/mL.
Working standard, for the pUC57-T recombinant plasmids of the nucleotide fragments of the highly conserved gene containing enteric adenovirus,
Alkaline lysis method of extracting DNA is used after recombinant plasmid transformed bacillus coli DH 5 alpha propagation, through DNA Purification Kits, with light splitting
Luminosity measurement A260 is quantified, and then according to formula scales and is diluted to 1.0 × 108Copy/mL, in -20 DEG C of preservations.Stock concentration
For 1.0 × 108Copy/mL, 10 times are carried out using preceding with sterile saline or 0.1mol/L PBS buffer (pH value 7.6)
Gradient is serially diluted.Working concentration is followed successively by 1.0 × 107Copy/mL, 1.0 × 106 copies/mL, 1.0 × 105Copy/mL and
1.0×104Copy/mL, before use, centrifuging 30s through 10,000rmp, takes supernatant as working standard.The present embodiment provides
Kit components it is as follows：
2. kit of table configures (24 person-portions/box)：
The kit can be stored in -10 DEG C of ± 5 DEG C of lucifuges, avoid multigelation, the quantitative fluorescent PCR which is applicable in
Instrument includes：Roche LightCycler480、ABI7500、ABI7300、Bio-Rad iQ5TM、Stratagene Mx3000P、
Stratagene Mx3005P and Da An 7000 etc..
The kit provided with the embodiment of the present invention 2 detects enteric adenovirus on Bio-RadiQ5TM fluorescence quantitative PCR instruments,
Specific method is as follows：
(1) sample is gathered：Sample derives from Wuhan Infectious Diseases Hospital, wherein 5 are known positive sample after testing
Product, 3 are known negative sample after testing, and sample can be blood plasma, serum or urine, in 5 known positives after testing
It is serum to have 2 samples in sample, and 1 is blood plasma, remaining 2 are urine, have 1 in 3 after testing known negative sample
A sample is serum, and 1 is blood plasma, remaining 1 is urine.
1. the pretreatment of serum：0.5ml blood product are taken to be placed in 1.5ml centrifuge tubes, 2000r/min centrifugation 5min, separation
Go out serum.4 DEG C of centrifuge tube saves backup.
2. the pretreatment of blood plasma：Take 0.5ml blood product to be placed in 1.5ml centrifuge tubes, add anti-coagulants, gently overturn mixed
Even, 2000r/min centrifugation 5min, isolate blood plasma.4 DEG C of centrifuge tube saves backup.
3. urine mark product are handled：The urine sample of collection is vibrated and is mixed, 1ml is transferred in centrifuge tube, 13000rpm from
Heart 10min, abandons supernatant, and 4 DEG C of centrifuge tube saves backup.
Sample storage and transport：If sample is not tested immediately, -20 DEG C should be stored in, avoids multigelation.Sample is long-distance
Transport should use 0 DEG C of curling stone.
(2) sample treatment：Take sample to be tested and after equivalent volumes DNA extracting solutions fully mix, the sample after as handling.
(3) it is loaded：To equipped with PCR reaction solution, primer and probe PCR reaction tubes in be separately added into processing after sample,
Negative quality-control product, positive quality control product, critical positive quality control product and each 0.5 μ L of working standard, PCR reaction solution and the sample after processing
Product, negative quality-control product, positive quality control product, the volume ratio of critical positive quality control product or working standard are 99：1, through 5,000rpm
Centrifuge 10s.
(4) PCR amplification：Each reaction tube is put into the reactive tank of quantitative fluorescent PCR instrument, setting flag fluorophor kind
Class, sample ID and type, define sample well：Negative quality-control product selects NTC；Measuring samples, positive quality control product choosing and the critical positive
Quality-control product selects Unknown.
PCR amplification is carried out by following program：
95 DEG C 3 minutes；
95 DEG C 10 seconds, 60 DEG C 1 minute (collection fluorescence signals), 40 circulation.
(5) analysis judges：
Ct values are the positive less than 28；Ct values are feminine gender more than 32；Ct values are more than or equal to 28 and less than or equal to 32
The critical positive.(Fig. 1 may determine that sample to amplification provided in an embodiment of the present invention when Ct values are 32 as shown in Figure 1
Product result), specific testing result see the table below 3.
Table 3 is the corresponding Ct values of sample that embodiment 2 provides
| Sequence number | Ct values |
| 1 | 26.79 |
| 2 | N/A |
| 3 | N/A |
| 4 | 21.38 |
| 5 | 24.32 |
| 6 | 20.78 |
| 7 | 20.08 |
| 8 | N/A |
Wherein, sample Isosorbide-5-Nitrae, 5,6,7 in positive scope, is positive；N/A represents negative, and sample 2,3,8 is in feminine gender
In the range of, be negative sample, as a result with it is known consistent, it is seen that the kit specificity that the embodiment of the present invention 2 provides is
100%, positive rate 100%, by taking Fig. 1 as an example, in Fig. 1 marks positive amplification, the row in Fig. 2-Fig. 5
Cloth rule is referring to Fig. 1.
A kind of kit for being used to detect enteric adenovirus of embodiment 3.
An embodiment of the present invention provides it is a kind of detect sample mid intestinal gland viral nucleic acid kit, the component of the kit with
Component in the kit provided in embodiment 2 difference lies in：
The proportioning of each component content of PCR reaction solution is：0.1 μ L of Taq enzyme, the concentration 10mmol/L that concentration is 5U/ μ L
1 μ L of dNTPs, 10 × PCR Buffer, 5 μ L and concentration be 25mmol/L MgCl23 μ L of solution.
Concentration is the forward primer and reverse primer 0.25 μ L of each addition of 10 μm of ol/L, and concentration is 10 μm of ol/L probes additions
0.25μL。
In actual application, primer and probe can be together added in PCR reaction solution, then add sterile water to body
Product is 10 μ L.
DNA extracting solutions include Triton-X100 final concentration of 0.1%, NP-40 final concentration of 0.2% and Tris-HCL (pH
It is worth for 8.3) final concentration of 0.05M/L.
The kit configuration (24 person-portions/box) that 4. embodiment 3 of table provides：
Gather sample：Sample derives from Wuhan Infectious Diseases Hospital, wherein 8 are known positive after testing, 2
It is a for known negative sample after testing.Other steps referring to embodiment 2, difference lies in：
Sample-adding：Be separately added into the PCR reaction tubes equipped with 10 μ LPCR reaction solutions the sample after processing, negative quality-control product,
40 μ L of positive quality control product and critical positive quality control product, cover tube cover, 5,000rpm centrifugation 10s.
Above-mentioned 10 samples are operated according to the step in embodiment 2, amplification provided in an embodiment of the present invention
As shown in Fig. 2, obtaining specific testing result is shown in Table 5.
Table 5 is the corresponding Ct values of sample that embodiment 3 provides
| Sequence number | Ct values |
| 1 | 29.55 |
| 2 | 23.79 |
| 3 | 18.56 |
| 4 | N/A |
| 5 | 22.24 |
| 6 | 24.66 |
| 7 | N/A |
| 8 | 22.46 |
| 9 | 21.27 |
| 10 | 30.69 |
In table 5, sample 2,3,5,6,8 and 9 is positive in positive scope；Sample 1 and 10 is in critical positive scope
It is interior, it is critical positive, positive 8 and is consistent totally with known testing result；Sample 4 and 7 is in negative range, for the moon
Property sample, be consistent with known testing result, it is seen that the embodiment of the present invention 3 provide kit specificity be 100%, the positive detection
Rate is 100%.
A kind of kit for being used to detect enteric adenovirus of embodiment 4.
An embodiment of the present invention provides it is a kind of detect sample mid intestinal gland viral nucleic acid kit, the component of the kit with
Component in the kit provided in embodiment 2 difference lies in：
The proportioning of each component content of PCR reaction solution is：0.5 μ L of Taq enzyme, the concentration 10mmol/L that concentration is 5U/ μ L
3 μ L of dNTPs, 10 × PCR Buffer, 5 μ L and concentration be 25mmol/L MgCl210 μ L of solution.
Concentration is the forward primer and reverse primer 4.5 μ L of each addition of 10 μm of ol/L, and concentration is 10 μm of ol/L probes additions
4.5μL。
In actual application, primer and probe can be together added in PCR reaction solution, then add sterile water to body
Product is 45 μ L.
DNA extracting solutions include Triton-X100 final concentration of 0.1%, NP-40 final concentration of 0.2% and Tris-HCL (pH
It is worth for 8.3) final concentration of 0.05M/L.
Remaining reagent is identical with the reagent provided in embodiment 2.
Gather sample：Sample derives from Wuhan Infectious Diseases Hospital, wherein 6 are known positive after testing, 2
It is a for known negative sample after testing.Other steps referring to embodiment 2, difference lies in：
Sample-adding：Be separately added into the PCR reaction tubes equipped with 10 μ LPCR reaction solutions the sample after processing, negative quality-control product,
Positive quality control product and each 5 μ L of critical positive quality control product, PCR reaction solution and the sample after processing, negative quality-control product, positive quality control product
Or the volume ratio of critical positive quality control product is 9：1, cover tube cover, 5,000rpm centrifugation 10s.
Above-mentioned 10 samples are operated according to the step in embodiment 2, amplification provided in an embodiment of the present invention
As shown in figure 3, obtaining specific testing result is shown in Table 6.
Table 6 is the corresponding Ct values of sample that embodiment 4 provides
| Sequence number | Ct values |
| 1 | 24.11 |
| 2 | 30.17 |
| 3 | 22.53 |
| 4 | 31.59 |
| 5 | N/A |
| 6 | N/A |
| 7 | 26.01 |
| 8 | 31.55 |
In table 6, sample 1,3 and 7 is positive in positive scope；Sample 2,4 and 8 is in critical positive scope
Critical positive, positive 6 and are consistent totally with known testing result；Sample 5 and 6 is in negative range, for negative sample
Product, are consistent with known testing result, it is seen that the kit specificity that the embodiment of the present invention 4 provides is 100%, and positive rate is
100%.
A kind of kit for being used to detect enteric adenovirus of embodiment 5.
When the kit provided using the embodiment of the present invention 4 carries out quantitative detection, standard curve need to be drawn, except 8 samples
Outside product reaction tube, it is respectively negative quality-control product, positive quality control product and critical positive quality control product separately to take 3 reaction tubes, also has 4 instead
Ying Guan, the corresponding 5 μ L of working standard for adding various concentrations gradient in kit, PCR reactions are prepared according to the method for embodiment 4
System, 5000rpm centrifugation 10s, is then placed in instrument sample groove and carries out PCR amplification.Working standard selects Standard.For
Standard, it is necessary to input 1.0 × 10 respectively in Quantity columns7Copy/ml, 1.0 × 106Copy/ml, 1.0 × 105Copy
Shellfish/ml, 1.0 × 104Copy/ml and 1.0 × 103Copy/ml.
It is detected using using instrument Bio-RadiQ5TM.
Reference results：
A. if amplification curve is not S-type or Ct values ＞ 32, judgement sample enteric adenovirus DNA content are less than Monitoring lower-cut；
B. if amplification curve S types unobvious or 28≤Ct value≤32, sample enteric adenovirus DNA content is in critical sun
Property scope；
C. if amplification curve is S-type and Ct values ﹤ 28, quantified by the following method：(if " C " represents sample to the C of sample
Product concentration or content) ＜ 5.0000E+01, the then sample 50 gene copies of enteric adenovirus DNA total contents ＜；If sample
5.0000E+01≤C≤5.0000E+07, then the enteric adenovirus DNA total contents of the sample be equal to C gene copies；If the C of sample
The enteric adenovirus DNA total content ＞ 5.0000E+07 gene copies of ＞ 5.0000E+07, the then sample, sample is diluted to linearly
In the range of detect again, specific testing result is shown in Table 7；
Table 7 is Ct values and its corresponding initial concentration
| Working standard | Ct values | C (initial concentration) |
| 1.0e+007 | 18.30 | 1.0e+007 |
| 1.0e+006 | 21.62 | 1.0e+006 |
| 1.0e+005 | 24.94 | 1.0e+005 |
| 1.0e+004 | 28.26 | 1.0e+004 |
| Slope | -3.32 | - |
| Intercept | 41.54 | - |
| R2 | 1 | - |
| Normal equation | Y=-3.32x+41.54 | - |
The amplification curve for the sample that the embodiment of the present invention 5 provides is as shown in figure 5, the work mark that the embodiment of the present invention 5 provides
Quasi- product and 8 samples detect together, according to the Ct values obtained after amplification, look into the standard curve of Fig. 6, then through conversion, final
To the initial concentration such as following table of 8 samples.
| Sequence number | Ct values | C (initial concentration) |
| Positive quality control product | 19.68 | 3.840e+006 |
| Critical positive quality control product | 29.27 | 4.960e+003 |
| Negative quality-control product | N/A | - |
| 1 | 26.01 | 4.761e+004 |
| 2 | 25.43 | 7.118e+004 |
| 3 | 34.24 | 1.580e+002 |
| 4 | 22.42 | 5.742e+005 |
| 5 | N/A | - |
| 6 | N/A | - |
| 7 | N/A | - |
| 8 | 26.03 | 4.696e+004 |
Amplification curve is in smooth " S " type, and standard curve is straight line, and Ct values are between 14-28, each concentration gradient
Ct value differences be about 3.32.Monitoring lower-cut can be accurate to 5.000e+002, it can be seen that, which has high sensitivity.
The present invention relates to a kind of pathogen gene detection technique for causing the diseases such as mankind's progressive multifocal leukoencephalopathy,
Suitable for enteric adenovirus qualitative and quantitative detection.TaqMan quantitative fluorescent PCRs in real time provided in an embodiment of the present invention, its primer and glimmering
Light probe has high specific and high sensitivity, can accurately detect whether sample infects enteric adenovirus, its kit being capable of essence
Determine amount, and can fast and accurately detect enteric adenovirus.Real-time TaqMan quantitative fluorescent PCRs pass through sequence-specific TaqMan
Fluorescence probe detects target gene with stopped pipe pattern while amplification, so as to increase specificity and reduce cross contamination
Possibility.In addition, further downstream analysis is not required in the embodiment of the present invention, the time of gel electrophoresis observation result has been saved,
Whole detection process only need altogether 2~3 it is small when.In real-time TaqMan quantitative fluorescent PCRs, each circulation of PCR product accumulation
It is monitored in real-time and analyzes, the period (Ct values) that analysis reaches fluorescence threshold can be directly reported out DNA starting copy numbers.
The foregoing is merely presently preferred embodiments of the present invention, is not intended to limit the invention, it is all the present invention spirit and
Within principle, any modification, equivalent replacement, improvement and so on, should all be included in the protection scope of the present invention.
Sequence table
<110>Hubei Lang De medical science and technologies Co., Ltd
<120>A kind of primer, probe and kit for being used to detect enteric adenovirus
<160> 3
<170> PatentIn version 3.4
<210> 1
<211> 24
<212> DNA
<213>Artificial sequence
<400> 1
GCCGGGCAGGACGCCTCGGAGTAT
24
<210> 2
<211> 25
<212> DNA
<213>Artificial sequence
<400> 2
GTAGGTGCTGGCCATGTCCAACACC
25
<210> 3
<211> 27
<212> DNA
<213>Artificial sequence
<400> 3
ACTGTGGCTCCGACCCACGATGTAACC
Claims (10)
1. a kind of primer and probe for being used to detect enteric adenovirus, it is characterised in that the primer and probe includes：For detecting
The forward primer of enteric adenovirus, the reverse primer for detecting enteric adenovirus and the probe for detecting enteric adenovirus, wherein,
The forward primer for being used to detect enteric adenovirus is as shown in SEQ ID NO.1 in sequence table；
The reverse primer for being used to detect enteric adenovirus is as shown in SEQ ID NO.2 in sequence table；
The probe for being used to detect enteric adenovirus is as shown in SEQ ID NO.3 in sequence table；
5 ' ends of the probe are connected with fluorophor FAM, HEX, TET, JOE, VIC, ROX, Cy3 or Cy5, and the 3 ' of the probe
End is connected with quenching group TAMRA, Eclipse, BHQ1, BHQ2, BHQ3 or DABCYL.
2. a kind of kit for being used to detect enteric adenovirus, it is characterised in that the kit includes as claimed in claim 1
Primer and probe.
3. kit according to claim 2, it is characterised in that the kit further includes：Nucleic acid releasing agent, PCR are anti-
Answer liquid, critical positive quality control product, positive quality control product, negative quality-control product and working standard.
4. kit according to claim 3, it is characterised in that the working standard includes：Working standard 1, work
Make standard items 2, working standard 3 and working standard 4, wherein,
The working standard 1 is 1 × 107The genetic fragment of the enteric adenovirus of copy/mL；
The working standard 2 is 1 × 106The genetic fragment of the enteric adenovirus of copy/mL；
The working standard 3 is 1 × 105The genetic fragment of the enteric adenovirus of copy/mL；
The working standard 4 is 1 × 104The genetic fragment of the enteric adenovirus of copy/mL.
5. kit according to claim 3, it is characterised in that the positive quality control product is 1.0 × 106The institute of copy/mL
State the T antigen gene fragments of enteric adenovirus.
6. kit according to claim 3, it is characterised in that the final concentration of the forward primer and the reverse primer
It is 0.05-0.9 μM, final concentration of 0.05-0.9 μM of the probe.
7. kit according to claim 3, it is characterised in that the PCR reaction solution each component is in PCR amplified reactions
System includes：The Taq enzyme of final concentration of 0.01U/ μ L~0.05U/ μ L, the dNTPs of final concentration of 0.2~0.6mM, 10 ×
The solution of the ion containing Mg of PCR buffer solutions and final concentration of 1.5~5.0mM.
8. kit according to claim 3, it is characterised in that the nucleic acid releasing agent includes sterile water, final concentration of
The Nonyl pheno of the Triton X-100 of 0.03-0.3%, final concentration of 0.04-0.4%（40）Ether and pH value are
The three of 8.3 final concentration of 0.01-0.1M（Methylol）Aminomethane.
9. kit according to claim 3, it is characterised in that the critical positive quality control product is 1.0 × 104Copy/mL
The enteric adenovirus genetic fragment.
10. kit according to claim 3, it is characterised in that the feminine gender quality-control product is the physiology that concentration is 0.8%
Brine.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2017108858724 | 2017-09-27 | ||
| CN201710885872 | 2017-09-27 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108004348A true CN108004348A (en) | 2018-05-08 |
Family
ID=62054776
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711230467.5A Pending CN108004348A (en) | 2017-09-27 | 2017-11-29 | A kind of primer, probe and kit for being used to detect enteric adenovirus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108004348A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103642936A (en) * | 2013-11-04 | 2014-03-19 | 江苏和创生物科技有限公司 | Primer probe composition and kit for specific detection of 55 type adenovirus nucleic acid |
| CN104745724A (en) * | 2015-01-30 | 2015-07-01 | 湖北永邦医疗科技有限公司 | Primers, probe and kit used for detecting JC viruses (JCVs) |
| CN107058632A (en) * | 2017-05-23 | 2017-08-18 | 安徽安龙基因医学检验所有限公司 | A kind of multiplex PCR detects three kinds of diarrhea virus kits and its detection method |
-
2017
- 2017-11-29 CN CN201711230467.5A patent/CN108004348A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103642936A (en) * | 2013-11-04 | 2014-03-19 | 江苏和创生物科技有限公司 | Primer probe composition and kit for specific detection of 55 type adenovirus nucleic acid |
| CN104745724A (en) * | 2015-01-30 | 2015-07-01 | 湖北永邦医疗科技有限公司 | Primers, probe and kit used for detecting JC viruses (JCVs) |
| CN107058632A (en) * | 2017-05-23 | 2017-08-18 | 安徽安龙基因医学检验所有限公司 | A kind of multiplex PCR detects three kinds of diarrhea virus kits and its detection method |
Non-Patent Citations (2)
| Title |
|---|
| 姚新华等: "实时荧光定量PCR快速检测腺病毒", 《解放军预防医学杂志》 * |
| 曾军荣等: "常见腹泻病毒的多重荧光RT-PCR检测方法的建立及临床应用", 《广东医学》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hirotsu et al. | Double-quencher probes improve detection sensitivity toward Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) in a reverse-transcription polymerase chain reaction (RT-PCR) assay | |
| CN105695631B (en) | Human immunodeficiency virus, hepatitis type B virus, Hepatitis C Virus Quick joint inspection kit and its preparation and application | |
| CN103614494B (en) | Two-color fluorogenic quantitative PCR (Polymerase Chain Reaction) detection kit for CDV (canine distemper viruses) and CPV (canine parvo viruses) | |
| CN101633964B (en) | RNA detection kit for influenza A H1N1 virus | |
| CN111876527A (en) | African swine fever virus wild strain and vaccine strain identification and detection kit | |
| CN103045755A (en) | Fluorescent quantitative PCR (polymerase chain reaction) method, primer and kit for detecting EBOV (Ebola virus) | |
| CN103789451A (en) | Fluorescent quantitative kit for detecting coxsackie viruses A6 and A10 | |
| Wang et al. | An overview of nucleic acid testing for the novel coronavirus SARS-CoV-2 | |
| CN102559930A (en) | Kit of detecting hepahtis C virus by fluorescence quantitative RT-PCR (reverse transcription-polymerase chain reaction) | |
| Hata et al. | Identification of SARS-CoV-2 in wastewater in Japan by multiple molecular assays-implication for wastewater-based epidemiology (WBE) | |
| CN102206713B (en) | Triple fluorescence quantitative reverse transcription-polymerase chain reaction (RT-PCR) detection kit and use thereof | |
| CN102212623A (en) | Two-color fluorescence quantitative polymerase chain reaction (PCR) combined detection method of swine fever virus and blue ear disease virus and kit thereof | |
| CN103966356A (en) | Human immunodeficiency virus type 1 one-step fluorescence quantitative RT-PCR detection kit | |
| CN104745689A (en) | Primers, probe and kit used for detecting bordetella pertussis | |
| CN104911277B (en) | A kind of kit and its detection method for detecting human immunodeficiency virus type 1 in dry blood cake sample | |
| CN101660001A (en) | Reagent kit for detecting rotavirus nucleic acid | |
| CN103045756A (en) | Reagent kit of detecting human immunodeficiency virus type 1 by fluorescence quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) | |
| CN104846116B (en) | Detect PCR primer group, probe and its kit and detection method of human immunodeficiency virus type 1 | |
| CN104593486A (en) | Primer, probe and kit all used for detecting blood fluke | |
| CN107502681A (en) | A kind of quick real-time fluorescence RT PCR detection kits of A group rotavirus | |
| CN104745724A (en) | Primers, probe and kit used for detecting JC viruses (JCVs) | |
| CN104745722A (en) | Primers, probe and kit used for detecting varicella zoster viruses (VZVs) | |
| CN107460249A (en) | A kind of primer, probe and kit for being used to detect methicillin-resistant staphylococcus aureus drug resistant gene | |
| CN104278024B (en) | For identifying Primer composition and their application of human adenovirus 55 type | |
| CN108004348A (en) | A kind of primer, probe and kit for being used to detect enteric adenovirus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180508 |