CN108004224B - Make plant that there is rice ALS mutein and its application of Herbicid resistant - Google Patents

Make plant that there is rice ALS mutein and its application of Herbicid resistant Download PDF

Info

Publication number
CN108004224B
CN108004224B CN201711477560.6A CN201711477560A CN108004224B CN 108004224 B CN108004224 B CN 108004224B CN 201711477560 A CN201711477560 A CN 201711477560A CN 108004224 B CN108004224 B CN 108004224B
Authority
CN
China
Prior art keywords
ala
leu
val
gly
pro
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201711477560.6A
Other languages
Chinese (zh)
Other versions
CN108004224A (en
Inventor
张保龙
王金彦
凌溪铁
陈天子
邓惠清
吴魁
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jiangsu Academy of Agricultural Sciences
Original Assignee
Jiangsu Academy of Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jiangsu Academy of Agricultural Sciences filed Critical Jiangsu Academy of Agricultural Sciences
Priority to PCT/CN2018/082758 priority Critical patent/WO2019024534A1/en
Publication of CN108004224A publication Critical patent/CN108004224A/en
Application granted granted Critical
Publication of CN108004224B publication Critical patent/CN108004224B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
    • A01G13/00—Protecting plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8274—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1022—Transferases (2.) transferring aldehyde or ketonic groups (2.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y202/00—Transferases transferring aldehyde or ketonic groups (2.2)
    • C12Y202/01—Transketolases and transaldolases (2.2.1)
    • C12Y202/01006—Acetolactate synthase (2.2.1.6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/03—Oxo-acid-lyases (4.1.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Plant Pathology (AREA)
  • Immunology (AREA)
  • Toxicology (AREA)
  • Environmental Sciences (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses the rice ALS muteins for making plant have Herbicid resistant.The invention also discloses the nucleic acid for encoding above-mentioned albumen.The albumen source is in the rice mutant plant of anti-ALS inhibitor class herbicide, and compared with the ALS sequence in wild rice genome, protein sequence mutates in the site Pro171 and/or Asp350.The present invention by field spray ALS inhibitor class herbicide " hundred ridges logical " the experimental results showed that, rice 3-4 leaf seedling containing the ALS albumen with Herbicid resistant of the invention application hundred ridge 3.3mL it is logical/L water (10 times are recommended to use concentration) after, plant still normal growth and development and solid, and wild rice 3-4 leaf seedling application hundred ridge 1 mL it is logical/3L water (1 times is recommended to use concentration) 30 days after to show as whole strain dead.

Description

Make plant that there is rice ALS mutein and its application of Herbicid resistant
Technical field
The invention belongs to vegetable protein and plant antiweed field, it is related to the rice for making plant that there is Herbicid resistant ALS mutein, gene and its application；Specifically, the present invention relates to the acetolactate synthestase of rice (ALS) to be mutated egg White, which can assign the characteristic of plant especially Rice Resistance inhibitor of acetolactate synthetase class herbicide.The invention discloses The sequence of the albumen and their applications in plant antiweed field.
Background technique
Weeds are the unfavorable factors for restricting agricultural production high and stable yields.Cultivation step, artificial weeding and machine are relied on tradition The methods of tool weeding is compared, and the use of chemical herbicide is a kind of efficient, easy and economic improvement weeds method.
The biosynthesis of plant and microorganism branched-chain amino acid (valine, leucine and isoleucine) needs 4 kinds of enzymes total Same catalytic action, acetolactate synthestase (acetolactate synthase, ALS), keto-alcohol restore isomerase (ketol- Acidreductoisomerase), dihydroxylated acid dehydratase (dihydroxyavid dehydratase), branched-chain amino acid turn Adnosine deaminase
(branched-chain amino acidtransaminase).Acetolactate synthestase is biosynthetic process The key enzyme of middle first stage is catalyzed 2 molecule pyruvic acid in the synthesis of valine and leucine and generates acetolactic acid and dioxy Change carbon, be catalyzed in the synthesis of isoleucine 1 molecule pyruvic acid and 1 molecule alpha batanone acid generation 2- aldehyde-base -2- hydroxybutyric acid and Carbon dioxide.ALS inhibitor class herbicide is by inhibiting the intracorporal ALS enzymatic activity of plant, to prevent the conjunction of branched-chain amino acid At causing the synthesis of protein to be destroyed, the DNA of block cell division stage synthesis, to make the mitosis of plant cell The M phase for stopping at S phase (DNA synthesizes the phase) and G2 stage in Gl stage, the synthesis of DNA is disturbed, therefore cell cannot have been completed Silk division, and then plant is made to stop growing, eventually lead to plant individual death.
Acetolactate synthestase (ALS) (also referred to as acetohydroxy acid synthetase, AHAS；EC 4.1.3.18) inhibitor class weeding Agent causes weeds dead using ALS as target, mainly includes sulfonylurea (Sulfonylureas, SU), imidazolone type (Imidazolinones, IMI), triazolo pyrimidine class (Triazolopyrimidines, TP), pyrimidine oxygen (sulphur) benzoic acids [Pyrimidinylthio(or oxy)–benzoates,PTB；pyrimidinyl-carboxyherbicides；PCs] and sulphur The 13 class compound such as amide groups carbonyltriazolinone (Sulfonylamino-carbonyltriazolinones, SCT).Second Acyl lactic acid synzyme, is present in growing process, it can be catalyzed pyruvic acid with high specificity and high catalytic efficiency For acetolactic acid, so as to cause the biosynthesis of branched-chain amino acid.
ALS inhibitor class herbicide has the characteristics that strong selectivity, broad weed-killing spectrum, low toxicity are efficient, and large area pushes away at present It is wide to use.But these herbicides also generate phytotoxicity to the general crops for not having anti-(resistance to) herbicidal properties itself, greatly limit It has been made using time and use space, has such as needed just to be avoided that crops using herbicide for the previous period in crop seeding By phytotoxicity.Cultivate the use scope that anti-(resistance to) herbicide crop varieties can reduce chemical injury of crops, widen herbicide.
Currently, anti-ALS inhibitor mutational site known to rice include Gly 95, Ala 96, Ala 122, Trp 548, Ser 627, Ser 653 and Gly 654.ALS mutant antiweed level is related with the position of ALS amino acid mutation, also with The number of amino acid classes and mutating acid after mutation is related.
Currently, the mechanism of action of ALS inhibitor class herbicide not yet determines, it is difficult the other amino of look-ahead ALS albumen Whether the mutation in sour site can generate Herbicid resistant, rely only on the practical exploration that scientific research personnel is long-term, arduous, and rely on Some fortune are likely to the new Herbicid resistant site of discovery ALS albumen.
Summary of the invention
Goal of the invention: first technical problem to be solved by this invention is to provide the egg for making plant have Herbicid resistant It is white.
There is provided the nucleic acid and expression cassette, carrier and cell that encode the albumen for the present invention also technical problems to be solved Deng.
There is provided obtain the methods and applications with the plant of Herbicid resistant for the present invention also technical problems to be solved.
There is provided the identifications for judging whether plant uses the method for the present invention to obtain for the present invention also technical problems to be solved Method.
The present inventor by long-term, arduous research, to wild rice be indica type conventional rice seed Hefei sterile line, Indica type conventional rice seed R89, the EMS mutant plant progress of wild type Jiahua-1 rice is long-term, constantly screens, it was found that A series of ALS mutains, including previously described certain known ALS mutains and new ALS mutain, press down ALS Preparation class herbicide is insensitive, so that plant has ALS inhibitor class Herbicid resistant.The present invention is in plant breeding Using can be used for cultivating the plant with Herbicid resistant, especially crops also developed these albumen and its encoding gene Application in transgenosis or non-transgenic such as rice crop.
Technical solution: in order to solve the above technical problems, The technical solution adopted by the invention is as follows: making plant that there is herbicide The rice ALS mutein of resistance, there are following any one or a few to dash forward for the amino acid sequence of the ALS mutein Become: its 171st amino acids for corresponding to rice ALS mutein and/or 350 amino acids mutate.
Wherein, make plant that there is the rice ALS mutein of Herbicid resistant, comprising:
(a) its amino acid sequence is as shown in SEQ ID NO:2 or shown in SEQ ID NO:8 or SEQ ID NO:12；Or
(b) amino acid sequence in (a) is by replacing and/or being deleted and/or added one or several amino acid and tool There is the protein as derived from (a) of acetolactate synthase activity.
Wherein herbicide is imidazolinone herbicide.
The content of present invention further includes nucleic acid or gene, the coding albumen.
Above-mentioned nucleic acid or gene, comprising:
(a) its coding albumen；Or
(b) under strict conditions with (a) limit nucleotide sequence hybridization and coding have acetolactate synthase activity Protein nucleotide sequence；Or
(c) its nucleotide sequence is as shown in SEQ ID NO:1 or SEQ ID NO:7 or SEQ ID NO:11.
The stringent condition are as follows: 0.1 × SSC, 0.1%SDS solution in, 65 DEG C to wash 15 minutes height of film rigorous Hybridization conditions.
The present invention also provides the ALS albumen for making plant have Herbicid resistant, at the 171st of amino acid sequence Amino acid becomes histidine from proline, and the 350th amino acids are glutamic acid by Aspartic acid mutations.There is presently no report tables It is bright, in the mutant strain of the site the Pro171 and Asp350 simultaneous mutation from rice varieties Hefei sterile line ALS albumen.
It is preferred that the albumen of the first aspect of the present invention has the mutant strain of the site Pro171 and Asp350 simultaneous mutation, in addition to Except the screening of mutant plant described in the embodiment that the present invention has or amplification method, the situation known to protein sequence Under, those skilled in the art have the ability through the coding gene sequence of protein known to change and are conducted into carrier, so that it may The protein for having replaced, added or deleted amino acid residue is prepared, these methods are conventional means.Of the invention specific In embodiment, the amino acid sequence of the ALS albumen with Herbicid resistant of the invention is as shown in SEQ ID NO.2.The egg The white acetolactate synthestase insensitive to imidazolinone herbicide by confirmation.
The contents of the present invention further include providing nucleic acid or gene, encode the protein of first aspect present invention.At this In invention, nucleic acid can be DNA, RNA, wherein preferably DNA.In the premise for knowing coded protein sequence or nucleic acid sequence Under, by conventional codon corresponding relationship and host expresses frequency, with PCR method, DNA recombination method or artificial synthesized side Method, those skilled in the art have the ability to obtain the nucleic acid of the simultaneously protein of Optimized Coding Based first aspect present invention.Once being somebody's turn to do Nucleic acid, so that it may be cloned into carrier, then convert or be transfected into corresponding cell, then carried out by conventional host cell It is proliferated, therefrom isolated a large amount of nucleic acid.It is preferred that the nucleotide sequence of the nucleic acid of second aspect of the present invention such as SEQ ID NO.1 It is shown.Specifically, DNA sequence dna of the invention, is in the ALS base that wild rice is indica type conventional rice seed Hefei sterile line Nucleotide A is become by T because the 512nd nucleotide of sequence becomes nucleotide A, the 1050th nucleotide by C.
In addition, the wild rice before present invention mutation is indica type conventional rice seed Hefei sterile line, the ALS inhibitor The nucleotide sequence of the wild type Hefei sterile line rice ALS of class herbicide sensitive is as shown in SEQ ID NO.3, and amino acid is such as Shown in SEQ ID NO.4.
The contents of the present invention further include include expression cassette, recombinant vector or cell, contain above-mentioned nucleic acid or gene.
The contents of the present invention further include above-mentioned ALS albumen, nucleic acid or the gene with Herbicid resistant, expression cassette, again The application of group carrier or cell in terms of plant antiweed.
Wherein, above-mentioned plant is rice, tobacco, arabidopsis, cotton etc. but is not limited only to the above several plant.
The contents of the present invention further include the method for obtaining the plant with Herbicid resistant, are included the following steps:
1) making plant includes nucleic acid of the present invention or gene；Or
2) albumen for making plant expression described.
Wherein, above-mentioned method, including transgenosis, hybridization, backcrossing or vegetative propagation step.
The contents of the present invention further include the method for plant identification, and wherein plant is the plant comprising the nucleic acid, expression The plant that the plant of the albumen or the method obtain, specifically includes the following steps:
1) measure whether the plant includes the nucleic acid or gene；Or,
2) measure whether the plant expresses the albumen.
The contents of the present invention further include so that plant has the ALS albumen of Herbicid resistant, only in amino acid sequence 350th amino acids are glutamic acid by Aspartic acid mutations.The amino acid sequence of the ALS albumen is as shown in SEQ ID NO.8.Tool Body, DNA sequence dna of the invention is the 1050th of the als gene sequence that wild rice is indica type conventional rice seed R89 Position nucleotide becomes nucleotide A, nucleotide sequence such as SEQ ID NO.7 by T.
The nucleotide sequence of the ALS of the indica type conventional rice seed R89 of wild type of the invention as shown in SEQ ID NO.9, Amino acid sequence is as shown in SEQ ID NO.10；
The contents of the present invention further include so that plant has the ALS albumen of Herbicid resistant, only in amino acid sequence 171st amino acids become leucine from proline.The amino acid sequence of the ALS albumen is as shown in SEQ ID NO.12.Specifically , DNA sequence dna of the invention is the 512nd of the als gene sequence that wild rice is round-grained rice type conventional rice seed Jiahua-1 Position nucleotide becomes T, nucleotide sequence such as SEQ ID NO.11 from C.
The nucleotide sequence of wild type Jiahua-1 rice ALS of the present invention is as shown in SEQ ID NO.13, and amino acid sequence is such as Shown in SEQ ID NO.14.
The content of present invention further includes a kind of method for controlling weeds, comprising: applies effective dose to the crop field of long-term cropping Herbicide, the crop include the nucleic acid or gene or it is described reach box, recombinant vector or cell, the herbicide is Imidazolinone herbicide.
The content of present invention further includes a kind of method for protecting the plants from the damage as caused by herbicide, comprising: right The herbicide of the crop field application effective dose of long-term cropping, the crop include the nucleic acid or gene or it is described up to box, Recombinant vector imports plant, and the plant after importing generates herbicide resistance proteins, and the herbicide is imidazolinone herbicide.
The content of present invention further includes a kind of herbicide protective agent, contains the ALS mutein.
The utility model has the advantages that compared with prior art, the invention has the following advantages that
1) present invention by field spray ALS inhibitor class herbicide " hundred ridges logical " the experimental results showed that, contain this hair The rice 3-4 leaf seedling of the bright ALS albumen with Herbicid resistant application hundred ridge 3.3mL it is logical/(10 times are recommended to use L water Concentration) after, plant still normal growth and development and solid, and wild rice 3-4 leaf seedling application hundred ridge 1mL it is logical/3L water (1 times is recommended to use concentration) shows as whole strain after 30 days dead.
2) the transgenic paddy rice ALS enzymatic activity of the als gene of the invention containing Hefei sterile line antiweed mutant 4.7 times higher than the ALS enzyme activity of wild type, the als gene of the invention containing Hefei sterile line antiweed mutant turns base Because the ALS enzyme activity of ALS activity ratio's wild type of tobacco Progeny plants is 5.2 times high.
3) in Hefei sterile line mutant of the invention and the patent No. 201610226003.6 CGMCC No.12265 it is anti- Herbicide mutant plants carry out ALS enzyme activity and are measured, and find the Hefei sterile line mutant ALS enzyme activity in present patent application Property ratio CGMCC No.12265 high 18%.
4) the transgenic paddy rice ALS enzymatic activity of the als gene of the invention containing antiweed mutant 2 and mutant 3 It is 4.96-5.25 times higher than the ALS enzyme activity of wild type, the als gene of the invention containing antiweed mutant 2 and mutant 3 Transgene tobacco Progeny plants ALS activity ratio's wild type ALS enzyme activity it is 5.84-6.3 times high.
5) the antiweed mutant 2 in the present invention and mutant 3 and CGMCC in the patent No. 201610226003.6 The antiweed mutant plants of No.12265 carry out ALS enzyme activity and are measured, and find 2 and the mutant 3 in present patent application ALS activity ratio CGMCC No.12265 high 15.7%-18.6%.
Detailed description of the invention
Hundred ridge Fig. 1 leads to the resistant rice mutant that herbicide screening obtains；
Fig. 2 PCR amplification als gene result figure.A, the 1st swimming lane are Marker；Marker molecular weight is followed successively by from top to bottom 5kb, 3kb, 2kb, 1kb, 750bp, 500bp, 250bp, 100bp, the 2nd swimming lane be Hefei sterile line wild rice DNA, the 3rd Swimming lane is the DNA, target fragment length 2091bp of antiweed mutant.B, the 1st swimming lane are Marker；Marker molecular weight from Top to bottm is followed successively by 5kb, 3kb, 2kb, 1.5kb, 750bp, 500bp, 250bp, and the 2nd swimming lane is R89 wild rice DNA, and the 3rd Swimming lane is the DNA of R89 antiweed mutant, and the 4th swimming lane is Jiahua-1 wild rice DNA, and the 5th swimming lane is anti-for Jiahua-1 The DNA of herbicide mutant, target fragment length 2091bp；
Hundred ridge Fig. 3 leads to herbicide and measures to the light absorption value of the ALS inhibition of enzyme activity of wild type and antiweed mutant；
The expression vector BamHI/SacI double digestion proof diagram of the als gene of Fig. 4 antiweed mutant；A, the 1st swimming lane For Marker；Marker molecular weight is followed successively by 5kb, 3kb, 2kb, 1kb, 750bp, 500bp, 250bp, 100bp from top to bottom；The 2 swimming lanes are the recombinant vector without digestion, and the 3rd swimming lane is the Hefei infertility that recombinant vector generates after BamHI/SacI double digestion It is mutant als gene segment and plasmid fragments DNA, genetic fragment size meets expection, it was demonstrated that vector construction success；B, the 1st Swimming lane is Marker；Marker molecular weight be followed successively by from top to bottom 15kb, 8kb, 5kb, 3kb, 2kb, 1kb, 750bp, 500bp, 250bp；2nd swimming lane is the recombinant vector without digestion, and the 3rd swimming lane is what recombinant vector generated after BamHI/SacI double digestion R89 mutant als gene segment and plasmid fragments DNA, the 4th swimming lane are what recombinant vector generated after BamHI/SacI double digestion Jiahua-1 mutant als gene segment and plasmid fragments DNA, genetic fragment size meet expection, it was demonstrated that vector construction success；
Fig. 5 saltant type als gene rice PCR detection figure；A, the 1st swimming lane are Marker；Marker molecular weight is from top to bottom It is followed successively by 5kb, 3kb, 2kb, 1kb, 750bp, 500bp, 250bp；2nd swimming lane is non-transgenic wild type DNA, as negative right According to the 3rd swimming lane is that the Plasmid DNA containing Hefei sterile line ALS mutant nucleotide sequence is template, as positive control, the 4th~6 swimming lane For the transgenic plant DNA for converting antiweed mutant als gene；B, the 1st swimming lane are Marker；Marker molecular weight is from upper 3kb, 2kb, 1kb, 750bp, 500bp, 250bp are followed successively by under；2nd swimming lane is non-transgenic wild type DNA, as negative right According to the 3rd swimming lane is that the Plasmid DNA containing R89ALS mutant nucleotide sequence is template, and as positive control, the 4th swimming lane is to contain good flower The Plasmid DNA of No.1 ALS mutant nucleotide sequence is template, and as positive control, the 5th~6 swimming lane is conversion R89 antiweed mutant The transgenic plant DNA of als gene；7th~8 swimming lane is the transgenosis plant for converting Jiahua-1 antiweed mutant als gene Strain DNA；
Hundred ridge Fig. 6 leads to transgenic paddy rice of the herbicide to wild rice and containing antiweed mutant als gene The light absorption value of ALS inhibition of enzyme activity measures；
Hundred ridge Fig. 7 leads to transgene tobacco of the herbicide to wild-type tobacco and containing antiweed mutant als gene The light absorption value of ALS inhibition of enzyme activity measures；
Hundred ridge Fig. 8 leads to herbicide to the extinction of the ALS inhibition of enzyme activity of antiweed mutant and CGMCC No.12265 Value measurement；
Hundred ridge Fig. 9 leads to the Jiahua-1 resistant rice mutant that herbicide screening obtains；
Hundred ridge Figure 10 leads to the R89 resistant rice mutant that herbicide screening obtains；
Hundred ridge Figure 11 leads to herbicide to the ALS enzymatic activity of wild type and antiweed mutant 2, antiweed mutant 3 The light absorption value of inhibition measures；
Hundred ridge Figure 12 lead to herbicide to wild rice, the transgenic paddy rice containing antiweed mutant 2ALS gene and The light absorption value of the ALS inhibition of enzyme activity of transgenic paddy rice containing antiweed mutant 3ALS gene measures；
Figure 13 hundred ridge leads to herbicide to wild-type tobacco and containing antiweed mutant 2, antiweed mutant 3 The light absorption value of the ALS inhibition of enzyme activity of the transgene tobacco of als gene measures；
Hundred ridge Figure 14 leads to herbicide to antiweed mutant 2, antiweed mutant 3 and CGMCC No.12265 The light absorption value of ALS inhibition of enzyme activity measures.
Specific embodiment
Embodiment of the present invention is described in detail below in conjunction with embodiment, but those skilled in the art will Understand, the following example is merely to illustrate the present invention, and should not be taken as limiting the scope of the invention.It is not specified in embodiment specific Condition person carries out according to conventional conditions or manufacturer's recommended conditions.Reagents or instruments used without specified manufacturer is It can be with conventional products that are commercially available.
Embodiment 1: rice Hefei sterile line, Jiahua-1, R89 wild-type sequence obtain
It is expanded according to OryzasativaLcv.Nipponbare als gene (NCBI:XM_015770973) design primer in NCBI, using Takara PrimerSTAR Max DNA Polymerase polymerase (being purchased from Takara company) amplifying rice Hefei sterile line praises and spends 1 Number, the als gene of R89 wild type, reaction system is as follows:
2×PrimerSTAR Max Premix 10.0μl
10 μM of 1.0 μ l of forward primer
10 μM of 1.0 μ l of reverse primer
1.0 μ l of 20-30ng/ μ L oryza sativa genomic dna
Sterile water is added to 20 μ l of total volume
Pcr amplification reaction program uses two-step method, and annealing and extension are combined into together, using 68 degree.
Program is as follows: initial denaturation: 98 DEG C of 3min；35 circulations: 98 DEG C of 10sec of denaturation；Extend 68 DEG C of 2min；Heat preservation: 72 ℃10min。
2 μ l PCR products are taken to detect through 1% agarose gel electrophoresis, after discovery has the segment of expected size, remaining PCR It is (public purchased from Takara to be cloned into pMD19-T carrier after PCR cleaning agents box (being purchased from Axygen company) cleaning recycling for product Department), then convert Escherichia coli.Each random 12 Escherichia coli clones of picking of conversion carry out PCR detection, take PCR result 6 monoclonals being positive send Nanjing one of Biotechnology Co., Ltd's sequencing, obtain mutation als gene sequence, the gene piece Segment length is 2091bp.
The sequencing result of Hefei sterile line wild type ALS sequence gene segment is as follows:
CTGCATCGCGTGTCGCCCTTTCGCCCAAACCCAGAAACCCTCGCCGCCGCCGCCGCCGCCATCACCCAC CATGGCTACGACCGCCGCGGCCGCGGCCGCCACCTTGTCCGCCGCCGCGACGGCCAAGACCGGCCGTAAGAACCACC AGCGACACCACGTCCTTCCCGCTCGAGGCCGGGTGGGGGCGGCGGCGGTCAGGTGCTCGGCGGTGTCCCCGGTCACC CCGCCGTCCCCGGCGCCGCCGGCCACGCCGCTCCGGCCGTGGGGGACGGCCGAGCCCCGCAAGGGCGCGGACATCCT CGTGGAGGCGCTGGAGCGGTGCGGCGTCAGCGACGTGTTCGCCTACCCGGGCGGCGCGTCCATGGAGATCCACCAGG CGCTGACGCGCTCCCCGGTCATCACCAACCACCTCTTCCGCCACGAGCAGGGCGAGGCGTTCGCGGCGTCCGGGTAC GCGCGCGCGTCCGGCCGCGTCGGGGTCTGCGTCGCCACCTCCGGCCCCGGGGCAACCAACCTCGTGTCCGCGCTCGC CGACGCGCTGCTCGACTCCGTCCCGATGGTCGCCATCACGGGCCAGGTCCCCCGCCGCATGATCGGCACCGACGCCT TCCAGGAGACGCCCATAGTCGAGGTCACCCGCTCCATCACCAAGCACAATTACCTTGTCCTTGATGTGGAGGACATC CCCCGCGTCATACAGGAAGCCTTCTTCCTCGCGTCCTCGGGCCGTCCTGGCCCGGTGCTGGTCGACATCCCCAAGGA CATCCAGCAGCAGATGGCTGTGCCAGTCTGGGACACCTCGATGAATCTACCGGGGTACATTGCACGCCTGCCCAAGC CACCCGCGACAGAATTGCTTGAGCAGGTCTTGCGTCTGGTTGGCGAGTCACGGCGCCCGATTCTCTATGTCGGTGGT GGCTGCTCTGCATCTGGTGATGAATTGCGCCGGTTTGTTGAGCTGACCGGCATCCCAGTTACAACCACTCTGATGGG CCTCGGCAATTTCCCCAGTGATGATCCGTTGTCCCTGCGCATGCTTGGGATGCATGGCACGGTGTACGCAAATTATG CGGTGGATAAGGCTGACCTGTTGCTTGCATTTGGCGTGCGGTTTGATGATCGTGTGACAGGGAAAATTGAGGCTTTT GCAAGCAGGGCCAAGATTGTGCACATTGACATTGATCCAGCGGAGATTGGAAAGAACAAGCAACCACATGTGTCAAT TTGCGCAGATGTTAAGCTTGCTTTACAGGGCTTGAATGCTCTGCTAGACCAGAGCACAACAAAGACAAGTTCTGATT TTAGTGCATGGCACAATGAGTTGGACCAGCAGAAGAGGGAGTTTCCTCTGGGGTACAAGACTTTTGGTGAAGAGATC CCACCGCAATATGCTATTCAGGTGCTGGATGAGCTGACGAAAGGGGAGGCAATCATCGCTACTGGTGTTGGACAGCA CCAGATGTGGGCGGCACAATATTACACCTACAAGCGGCCACGGCAGTGGCTGTCTTCGGCTGGTCTGGGCGCAATGG GATTTGGGCTGCCTGCTGCAGCTGGTGCTTCTGTGGCTAACCCAGGTGTCACAGTTGTTGATATTGATGGGGATGGT AGCTTCCTCATGAACATTCAGGAGTTGGCATTGATCCGCATTGAGAACCTCCCGGTGAAGGTGATGGTGTTGAACAA CCAACATTTGGGTATGGTTGTGCAATGGGAGGATAGGTTTTACAAGGCAAATAGGGCGCATACATACTTGGGCAACC CAGAATGTGAGAGCGAGATATATCCAGATTTTGTGACTATTGCTAAAGGGTTCAATATTCCTGCAGTCCGTGTAACA AAGAAGAGTGAAGTCCGTGCCGCCATCAAGAAGATGCTCGAGACCCCAGGGCCATACTTGTTGGATATCATCGTCCC ACACCAGGAGCATGTGCTGCCTATGATCCCAAGTGGGGGCGCATTCAAGGACATGATCCTGGATGGTGATGGCAGGA CTATGTATTAATCTATAATCTGTATGTTGGCAAAGCACCAGCCCGGCCTATGTTTGACCTGAATGACCCATAAAGAG AAGGGCGACACGCGATGCAG
The sequencing result of R89 wild type ALS sequence gene segment is as follows:
CTGCATCGCGTGTCGCCCTTTCGCCCAAACCCAGAAACCCTCGCCGCCGCCGCCGCCGCCATCACCCAC CATGGCTACGACCGCCGCGGCCGCGGCCGCCACCTTGTCCGCCGCCGCGACGGCCAAGACCGGCCGTAAGAACCACC AGCGACACCACGTCCTTCCCGCTCGAGGCCGGGTGGGGGCGGCGGCGGTCAGGTGCTCGGCGGTGTCCCCGGTCACC CCGCCGTCCCCGGCGCCGCCGGCCACGCCGCTCCGGCCGTGGGGGACGGCCGAGCCCCGCAAGGGCGCGGACATCCT CGTGGAGGCGCTGGAGCGGTGCGGCGTCAGCGACGTGTTCGCCTACCCGGGCGGCGCGTCCATGGAGATCCACCAGG CGCTGACGCGCTCCCCGGTCATCACCAACCACCTCTTCCGCCACGAGCAGGGCGAGGCGTTCGCGGCGTCCGGGTAC GCGCGCGCGTCCGGCCGCGTCGGGGTCTGCGTCGCCACCTCCGGCCCCGGGGCAACCAACCTCGTGTCCGCGCTCGC CGACGCGCTGCTCGACTCCGTCCCGATGGTCGCCATCACGGGCCAGGTCCCCCGCCGCATGATCGGCACCGACGCCT TCCAGGAGACGCCCATAGTCGAGGTCACCCGCTCCATCACCAAGCACAATTACCTTGTCCTTGATGTGGAGGACATC CCCCGCGTCATACAGGAAGCCTTCTTCCTCGCGTCCTCGGGCCGTCCTGGCCCGGTGCTGGTCGACATCCCCAAGGA CATCCAGCAGCAGATGGCTGTGCCAGTCTGGGACACCTCGATGAATCTACCGGGGTACATTGCACGCCTGCCCAAGC CACCCGCGACAGAATTGCTTGAGCAGGTCTTGCGTCTGGTTGGCGAGTCACGGCGCCCGATTCTCTATGTCGGTGGT GGCTGCTCTGCATCTGGTGATGAATTGCGCCGGTTTGTTGAGCTGACCGGCATCCCAGTTACAACCACTCTGATGGG CCTCGGCAATTTCCCCAGTGATGATCCGTTGTCCCTGCGCATGCTTGGGATGCATGGCACGGTGTACGCAAATTATG CGGTGGATAAGGCTGACCTGTTGCTTGCATTTGGCGTGCGGTTTGATGATCGTGTGACAGGGAAAATTGAGGCTTTT GCAAGCAGGGCCAAGATTGTGCACATTGACATTGATCCAGCGGAGATTGGAAAGAACAAGCAACCACATGTGTCAAT TTGCGCAGATGTTAAGCTTGCTTTACAGGGCTTGAATGCTCTGCTAGACCAGAGCACAACAAAGACAAGTTCTGATT TTAGTGCATGGCACAATGAGTTGGACCAGCAGAAGAGGGAGTTTCCTCTGGGGTACAAGACTTTTGGTGAAGAGATC CCACCGCAATATGCTATTCAGGTGCTGGATGAGCTGACGAAAGGGGAGGCAATCATCGCTACTGGTGTTGGACAGCA CCAGATGTGGGCGGCACAATATTACACCTACAAGCGGCCACGGCAGTGGCTGTCTTCGGCTGGTCTGGGCGCAATGG GATTTGGGCTGCCTGCTGCAGCTGGTGCTTCTGTGGCTAACCCAGGTGTCACAGTTGTTGATATTGATGGGGATGGT AGCTTCCTCATGAACATTCAGGAGTTGGCATTGATCCGCATTGAGAACCTCCCGGTGAAGGTGATGGTGTTGAACAA CCAACATTTGGGTATGGTTGTGCAATGGGAGGATAGGTTTTACAAGGCAAATAGGGCGCATACATACTTGGGCAACC CAGAATGTGAGAGCGAGATATATCCAGATTTTGTGACTATTGCTAAAGGGTTCAATATTCCTGCAGTCCGTGTAACA AAGAAGAGTGAAGTCCGTGCCGCCATCAAGAAGATGCTCGAGACCCCAGGGCCATACTTGTTGGATATCATCGTCCC ACACCAGGAGCATGTGCTGCCTATGATCCCAAGTGGGGGCGCATTCAAGGACATGATCCTGGATGGTGATGGCAGGA CTATGTATTAATCTATAATCTGTATGTTGGCAAAGCACCAGCCCGGCCTATGTTTGACCTGAATGACCCATAAAGAG AAGGGCGACACGCGATGCAG
The sequencing result of Jiahua-1 wild type ALS sequence gene segment is as follows:
CTGCATCGCGTGTCGCCCTTTCGCCCAAACCCAGAAACCCTCGCCGCCGCCGCCGCCGCCATCACCCAC CATGGCTACGACCGCCGCGGCCGCGGCCGCCGCCCTGTCCGCCGCCGCGACGGCCAAGACCGGCCGTAAGAACCACC AGCGACACCACGTCCTTCCCGCTCGAGGCCGGGTGGGGGCGGCGGCGGTCAGGTGCTCGGCGGTGTCCCCGGTCACC CCGCCGTCCCCGGCGCCGCCGGCCACGCCGCTCCGGCCGTGGGGGCCGGCCGAGCCCCGCAAGGGCGCGGACATCCT CGTGGAGGCGCTGGAGCGGTGCGGCGTCAGCGACGTGTTCGCCTACCCGGGCGGCGCGTCCATGGAGATCCACCAGG CGCTGACGCGCTCCCCGGTCATCACCAACCACCTCTTCCGCCACGAGCAGGGCGAGGCGTTCGCGGCGTCCGGGTAC GCGCGCGCGTCCGGCCGCGTCGGGGTCTGCGTCGCCACCTCCGGCCCCGGGGCAACCAACCTCGTGTCCGCGCTCGC CGACGCGCTGCTCGACTCCGTCCCGATGGTCGCCATCACGGGCCAGGTCCCCCGCCGCATGATCGGCACCGACGCCT TCCAGGAGACGCCCATAGTCGAGGTCACCCGCTCCATCACCAAGCACAATTACCTTGTCCTTGATGTGGAGGACATC CCCCGCGTCATACAGGAAGCCTTCTTCCTCGCGTCCTCGGGCCGTCCTGGCCCGGTGCTGGTCGACATCCCCAAGGA CATCCAGCAGCAGATGGCCGTGCCGGTCTGGGACACCTCGATGAATCTACCAGGGTACATCGCACGCCTGCCCAAGC CACCCGCGACAGAATTGCTTGAGCAGGTCTTGCGTCTGGTTGGCGAGTCACGGCGCCCGATTCTCTATGTCGGTGGT GGCTGCTCTGCATCTGGTGACGAATTGCGCTGGTTTGTTGAGCTGACTGGTATCCCAGTTACAACCACTCTGATGGG CCTCGGCAATTTCCCCAGTGACGACCCGTTGTCCCTGCGCATGCTTGGGATGCATGGCACGGTGTACGCAAATTATG CCGTGGATAAGGCTGACCTGTTGCTTGCGTTTGGTGTGCGGTTTGATGATCGTGTGACAGGGAAAATTGAGGCTTTT GCAAGCAGGGCCAAGATTGTGCACATTGACATTGATCCAGCAGAGATTGGAAAGAACAAGCAACCACATGTGTCAAT TTGCGCAGATGTTAAGCTTGCTTTACAGGGCTTGAATGCTCTGCTACAACAGAGCACAACAAAGACAAGTTCTGATT TTAGTGCATGGCACAATGAGTTGGACCAGCAGAAGAGGGAGTTTCCTCTGGGGTACAAAACTTTTGGTGAAGAGATC CCACCGCAATATGCCATTCAGGTGCTGGATGAGCTGACGAAAGGTGAGGCAATCATCGCTACTGGTGTTGGGCAGCA CCAGATGTGGGCGGCACAATATTACACCTACAAGCGGCCACGGCAGTGGCTGTCTTCGGCTGGTCTGGGCGCAATGG GATTTGGGCTGCCTGCTGCAGCTGGTGCTTCTGTGGCTAACCCAGGTGTCACAGTTGTTGATATTGATGGGGATGGT AGCTTCCTCATGAACATTCAGGAGCTGGCATTGATCCGCATTGAGAACCTCCCTGTGAAGGTGATGGTGTTGAACAA CCAACATTTGGGTATGGTGGTGCAATGGGAGGATAGGTTTTACAAGGCGAATAGGGCGCATACATACTTGGGCAACC CGGAATGTGAGAGCGAGATATATCCAGATTTTGTGACTATTGCTAAGGGGTTCAATATTCCTGCAGTCCGTGTAACA AAGAAGAGTGAAGTCCGTGCCGCCATCAAGAAGATGCTCGAGACTCCAGGGCCATACTTGTTGGATATCATCGTCCC GCACCAGGAGCATGTGCTGCCTATGATCCCAAGTGGGGGCGCATTCAAGGACATGATCCTGGATGGTGATGGCAGGA CTGTGTATTAATCTATAATCTGTATGTTGGCAAAGCACCAGCCCGGCCTATGTTTGACCTGAATGACCCATAAAGAG AAGGGCGACACGCGATGCAG
Embodiment 2: Rice Resistance imidazolinone herbicide mutant acquisition process (hundred ridges are logical)
1, by indica type conventional rice seed Hefei sterile line (magnificent K01S, Anhui Huakai Agricultural Technology Co., Ltd. provide) (this is M0, is impregnated 2 hours with clear water) 150kg divides 6 times impregnates 6- with 0.5-1.0% (w/w) ethyl methane sulfonate (EMS) at room temperature 9 hours, the seed of shake in during which every 1 hour；Discarding EMS solution, tap water stirs immersion seed 5 times, and 5 minutes every time, so It rinses seed with tap water afterwards to stay overnight, next day carries out field sowing, and carries out conventional fertilizer water management (this is M1).Plant is mature Afterwards, seed is mixed receives, dries, preservation of passing the winter.Next year sows field.When rice (this is M2) seedling it is long to the 3-4 leaf phase when, spray for Hundred ridge 3.3mL is logical/and (" hundred ridges are logical " is that BASF Aktiengesellschaft produces a kind of water aqua type imidazolinone herbicide to L water, is recommended most It is low using concentration be hundred ridge 1mL lead to/1.5~3L water), after 30 days also in normal green plant be anti-imidazolinone herbicide Rice mutant (Fig. 1).Total 128 plants of M2 single plant for obtaining antiweed, these resistance single plants carry out conventional fertilizer and water management, There are 101 M2 single plants normal solid, after seed is mature, single plant sowing is dried, preservation of passing the winter.
2, by indica type conventional rice seed R89 (offer of Anhui Lv Yizhongye Co., Ltd) and round-grained rice type conventional rice seed 150kg points 6 of Jiahua-1 (Jiangsu Province's agricultural plasm resource protection and given using platform) (this is M0, is impregnated 2 hours with clear water) It is secondary to be impregnated 6-9 hours at room temperature with 0.5-1.0% (w/w) ethyl methane sulfonate (EMS), the seed of shake in during which every 1 hour；It abandons EMS solution is removed, tap water stirs immersion seed 5 times, 5 minutes every time, then rinses seed with tap water and stay overnight, next day carries out field Between sow, and carry out conventional fertilizer water management (this is M1).After plant is mature, seed is mixed to be received, dries, preservation of passing the winter.Next year sowing Field.When rice (this is M2) seedling it is long to the 3-4 leaf phase when, spray for hundred ridge 3.3mL it is logical/(" hundred ridges are logical " is German Bath to L water Husband company produces a kind of water aqua type imidazolinone herbicide, and recommendation is minimum to lead to/1.5~3L water using concentration for hundred ridge 1mL), It is also the rice mutant 2 and mutant 3 (Fig. 9, Figure 10) of anti-imidazolinone herbicide in normal green plant after 30 days. After antiweed mutant 2 and 3 seed of mutant are mature, single plant sowing is dried, preservation of passing the winter.
Embodiment 3: anti-imidazolinone herbicide rice mutant mutational site analysis
The Herbicide Resistant Rice mutant plant for taking above-described embodiment 2 to obtain chooses mutant plants blade, extracts genome DNA send one of Nanjing Biotechnology Co., Ltd to carry out gene order-checking.Sequencing result and Hefei sterile line wild type ALS base Because comparing, the mutation in 2 sites, the 512nd, 1050 site alkali are had occurred in discovery Herbicide Resistant Rice mutant on als gene Base mutates, and becomes A, T by C respectively and becomes A, leads to that the 171st of the amino acid sequence of its corresponding encoded, 350 sites are by dried meat Propylhomoserin becomes histidine, asparagine becomes glutamic acid, i.e. the nucleotide sequence of the als gene of antiweed mutant such as SEQ Shown in ID NO.1, the amino acid sequence of the ALS albumen of coding is as shown in SEQ ID NO.2.
The antiweed mutant 2 for taking above-described embodiment 2 to obtain chooses mutant plants blade, extracts genomic DNA, send One of Nanjing Biotechnology Co., Ltd carries out gene order-checking.Sequencing result and indica type conventional rice seed R89 wild type ALS The mutation in 1 site, the 1050th site alkali only has occurred in genetic comparison, discovery Herbicide Resistant Rice mutant 2 on als gene Base mutates, and only becomes A by T, the 350th site of the amino acid sequence of its corresponding encoded is caused to become paddy ammonia from asparagine Acid, the i.e. nucleotide sequence of the als gene of antiweed mutant 2 are as shown in the SEQ ID NO.7, the ALS albumen of coding Amino acid sequence is as shown in SEQ ID NO.8.
The antiweed mutant 3 for taking above-described embodiment 2 to obtain chooses mutant plants blade, extracts genomic DNA, send One of Nanjing Biotechnology Co., Ltd carries out gene order-checking.Sequencing result and round-grained rice type conventional rice seed Jiahua-1 are wild Type als gene compares, and the mutation in 1 site, the 512nd site has occurred in discovery Herbicide Resistant Rice mutant 3 on als gene Base mutates, and only becomes T by C, the 171st site of the amino acid sequence of its corresponding encoded is caused to become bright ammonia from proline Acid, the i.e. nucleotide sequence of the als gene of antiweed mutant 3 are as shown in the SEQ ID NO.11, the ALS albumen of coding Amino acid sequence is as shown in SEQ ID NO.12.
Its classification naming of Herbicide Resistant Rice mutant of the invention is rice paddy seed HF-407 (Oryza sativa IndicaGroup HF-407), which is preserved in China typical culture collection center on June 2nd, 2017 (CCTCC), address: Wuhan City, Hubei Province Wuchang District Wuhan University collection (the first affiliated primary school of Wuhan University opposite), postal It compiles: 430072, deposit number is CCTCC No:P201714.
2 its classification naming of R89 Herbicide Resistant Rice mutant of the invention is rice paddy seed R28 (Oryza SativaIndicaGroup R28), which is preserved in China typical culture collection center on July 30th, 2017 (CCTCC), address: Wuhan City, Hubei Province Wuchang District Wuhan University collection (the first affiliated primary school of Wuhan University opposite), postal It compiles: 430072, deposit number is CCTCC No:P201718.
3 its classification naming of Jiahua-1 Herbicide Resistant Rice mutant of the invention is rice paddy seed JH10 (Oryza Sativa Japonica Group JH10), which is preserved in China typical culture collection on July 30th, 2017 The heart (CCTCC), address: Wuhan City, Hubei Province Wuchang District Wuhan University collection (the first affiliated primary school of Wuhan University opposite), Postcode: 430072, deposit number is CCTCC No:P201720.
Embodiment 4: anti-imidazolinone herbicide rice mutant als gene clone
Above-mentioned Herbicide Resistant Rice mutant, Herbicide Resistant Rice mutant 2, Herbicide Resistant Rice mutant 3 is taken to distinguish Extract genomic DNA.According to Hefei sterile line wild type als gene sequence, indica type conventional rice seed R89 wild type ALS base The special primer of cause, round-grained rice type conventional rice seed Jiahua-1 wild type als gene design amplification als gene overall length are as follows: forward direction is drawn Object F5 '-TCGCCCAAACCCAGAAACCC-3 ', reverse primer R 5 '-
CTCTTTATGGGTCATTCAGGTC-3’。
Takara PrimerSTAR Max DNA Polymerase polymerase (purchased from Takara company) is respectively adopted to expand Increase als gene, reaction system is as follows:
Pcr amplification reaction program uses two-step method, and annealing and extension are combined into together, using 68 degree.
Program is as follows: initial denaturation: 98 DEG C of 3min；35 circulations: 98 DEG C of 10sec of denaturation；Extend 68 DEG C of 2min；Heat preservation: 72 ℃10min。
2 μ l PCR products are taken to detect through 1% agarose gel electrophoresis, discovery has (Fig. 2A and figure after the segment of expected size 2B), remaining PCR product is cloned into pMD19-T carrier after PCR cleaning agents box (being purchased from Axygen company) cleaning recycling (being purchased from Takara company), then converts Escherichia coli.Each random 12 Escherichia coli clones of picking of conversion carry out PCR inspection It surveys, 6 monoclonals for taking PCR result to be positive, send Nanjing one of Biotechnology Co., Ltd's sequencing, obtain mutation als gene Sequence, the genetic fragment length are 2091bp, the sequencing knot of Hefei sterile line Herbicide Resistant Rice mutant 1ALS genetic fragment Fruit is as follows:
CTGCATCGCGTGTCGCCCTTTCGCCCAAACCCAGAAACCCTCGCCGCCGCCGCCGCCGCCATCACCCAC CATGGCTACGACCGCCGCGGCCGCGGCCGCCACCTTGTCCGCCGCCGCGACGGCCAAGACCGGCCGTAAGAACCACC AGCGACACCACGTCCTTCCCGCTCGAGGCCGGGTGGGGGCGGCGGCGGTCAGGTGCTCGGCGGTGTCCCCGGTCACC CCGCCGTCCCCGGCGCCGCCGGCCACGCCGCTCCGGCCGTGGGGGACGGCCGAGCCCCGCAAGGGCGCGGACATCCT CGTGGAGGCGCTGGAGCGGTGCGGCGTCAGCGACGTGTTCGCCTACCCGGGCGGCGCGTCCATGGAGATCCACCAGG CGCTGACGCGCTCCCCGGTCATCACCAACCACCTCTTCCGCCACGAGCAGGGCGAGGCGTTCGCGGCGTCCGGGTAC GCGCGCGCGTCCGGCCGCGTCGGGGTCTGCGTCGCCACCTCCGGCCCCGGGGCAACCAACCTCGTGTCCGCGCTCGC CGACGCGCTGCTCGACTCCGTCCCGATGGTCGCCATCACGGGCCAGGTCCACCGCCGCATGATCGGCACCGACGCCT TCCAGGAGACGCCCATAGTCGAGGTCACCCGCTCCATCACCAAGCACAATTACCTTGTCCTTGATGTGGAGGACATC CCCCGCGTCATACAGGAAGCCTTCTTCCTCGCGTCCTCGGGCCGTCCTGGCCCGGTGCTGGTCGACATCCCCAAGGA CATCCAGCAGCAGATGGCTGTGCCAGTCTGGGACACCTCGATGAATCTACCGGGGTACATTGCACGCCTGCCCAAGC CACCCGCGACAGAATTGCTTGAGCAGGTCTTGCGTCTGGTTGGCGAGTCACGGCGCCCGATTCTCTATGTCGGTGGT GGCTGCTCTGCATCTGGTGATGAATTGCGCCGGTTTGTTGAGCTGACCGGCATCCCAGTTACAACCACTCTGATGGG CCTCGGCAATTTCCCCAGTGATGATCCGTTGTCCCTGCGCATGCTTGGGATGCATGGCACGGTGTACGCAAATTATG CGGTGGATAAGGCTGACCTGTTGCTTGCATTTGGCGTGCGGTTTGATGAACGTGTGACAGGGAAAATTGAGGCTTTT GCAAGCAGGGCCAAGATTGTGCACATTGACATTGATCCAGCGGAGATTGGAAAGAACAAGCAACCACATGTGTCAAT TTGCGCAGATGTTAAGCTTGCTTTACAGGGCTTGAATGCTCTGCTAGACCAGAGCACAACAAAGACAAGTTCTGATT TTAGTGCATGGCACAATGAGTTGGACCAGCAGAAGAGGGAGTTTCCTCTGGGGTACAAGACTTTTGGTGAAGAGATC CCACCGCAATATGCTATTCAGGTGCTGGATGAGCTGACGAAAGGGGAGGCAATCATCGCTACTGGTGTTGGACAGCA CCAGATGTGGGCGGCACAATATTACACCTACAAGCGGCCACGGCAGTGGCTGTCTTCGGCTGGTCTGGGCGCAATGG GATTTGGGCTGCCTGCTGCAGCTGGTGCTTCTGTGGCTAACCCAGGTGTCACAGTTGTTGATATTGATGGGGATGGT AGCTTCCTCATGAACATTCAGGAGTTGGCATTGATCCGCATTGAGAACCTCCCGGTGAAGGTGATGGTGTTGAACAA CCAACATTTGGGTATGGTTGTGCAATGGGAGGATAGGTTTTACAAGGCAAATAGGGCGCATACATACTTGGGCAACC CAGAATGTGAGAGCGAGATATATCCAGATTTTGTGACTATTGCTAAAGGGTTCAATATTCCTGCAGTCCGTGTAACA AAGAAGAGTGAAGTCCGTGCCGCCATCAAGAAGATGCTCGAGACCCCAGGGCCATACTTGTTGGATATCATCGTCCC ACACCAGGAGCATGTGCTGCCTATGATCCCAAGTGGGGGCGCATTCAAGGACATGATCCTGGATGGTGATGGCAGGA CTATGTATTAATCTATAATCTGTATGTTGGCAAAGCACCAGCCCGGCCTATGTTTGACCTGAATGACCCATAAAGAG AAGGGCGACACGCGATGCAG
The sequencing result of the als gene segment of R89 Herbicide Resistant Rice mutant 2 is as follows:
CTGCATCGCGTGTCGCCCTTTCGCCCAAACCCAGAAACCCTCGCCGCCGCCGCCGCCGCCATCACCCAC CATGGCTACGACCGCCGCGGCCGCGGCCGCCACCTTGTCCGCCGCCGCGACGGCCAAGACCGGCCGTAAGAACCACC AGCGACACCACGTCCTTCCCGCTCGAGGCCGGGTGGGGGCGGCGGCGGTCAGGTGCTCGGCGGTGTCCCCGGTCACC CCGCCGTCCCCGGCGCCGCCGGCCACGCCGCTCCGGCCGTGGGGGACGGCCGAGCCCCGCAAGGGCGCGGACATCCT CGTGGAGGCGCTGGAGCGGTGCGGCGTCAGCGACGTGTTCGCCTACCCGGGCGGCGCGTCCATGGAGATCCACCAGG CGCTGACGCGCTCCCCGGTCATCACCAACCACCTCTTCCGCCACGAGCAGGGCGAGGCGTTCGCGGCGTCCGGGTAC GCGCGCGCGTCCGGCCGCGTCGGGGTCTGCGTCGCCACCTCCGGCCCCGGGGCAACCAACCTCGTGTCCGCGCTCGC CGACGCGCTGCTCGACTCCGTCCCGATGGTCGCCATCACGGGCCAGGTCCCCCGCCGCATGATCGGCACCGACGCCT TCCAGGAGACGCCCATAGTCGAGGTCACCCGCTCCATCACCAAGCACAATTACCTTGTCCTTGATGTGGAGGACATC CCCCGCGTCATACAGGAAGCCTTCTTCCTCGCGTCCTCGGGCCGTCCTGGCCCGGTGCTGGTCGACATCCCCAAGGA CATCCAGCAGCAGATGGCTGTGCCAGTCTGGGACACCTCGATGAATCTACCGGGGTACATTGCACGCCTGCCCAAGC CACCCGCGACAGAATTGCTTGAGCAGGTCTTGCGTCTGGTTGGCGAGTCACGGCGCCCGATTCTCTATGTCGGTGGT GGCTGCTCTGCATCTGGTGATGAATTGCGCCGGTTTGTTGAGCTGACCGGCATCCCAGTTACAACCACTCTGATGGG CCTCGGCAATTTCCCCAGTGATGATCCGTTGTCCCTGCGCATGCTTGGGATGCATGGCACGGTGTACGCAAATTATG CGGTGGATAAGGCTGACCTGTTGCTTGCATTTGGCGTGCGGTTTGATGAACGTGTGACAGGGAAAATTGAGGCTTTT GCAAGCAGGGCCAAGATTGTGCACATTGACATTGATCCAGCGGAGATTGGAAAGAACAAGCAACCACATGTGTCAAT TTGCGCAGATGTTAAGCTTGCTTTACAGGGCTTGAATGCTCTGCTAGACCAGAGCACAACAAAGACAAGTTCTGATT TTAGTGCATGGCACAATGAGTTGGACCAGCAGAAGAGGGAGTTTCCTCTGGGGTACAAGACTTTTGGTGAAGAGATC CCACCGCAATATGCTATTCAGGTGCTGGATGAGCTGACGAAAGGGGAGGCAATCATCGCTACTGGTGTTGGACAGCA CCAGATGTGGGCGGCACAATATTACACCTACAAGCGGCCACGGCAGTGGCTGTCTTCGGCTGGTCTGGGCGCAATGG GATTTGGGCTGCCTGCTGCAGCTGGTGCTTCTGTGGCTAACCCAGGTGTCACAGTTGTTGATATTGATGGGGATGGT AGCTTCCTCATGAACATTCAGGAGTTGGCATTGATCCGCATTGAGAACCTCCCGGTGAAGGTGATGGTGTTGAACAA CCAACATTTGGGTATGGTTGTGCAATGGGAGGATAGGTTTTACAAGGCAAATAGGGCGCATACATACTTGGGCAACC CAGAATGTGAGAGCGAGATATATCCAGATTTTGTGACTATTGCTAAAGGGTTCAATATTCCTGCAGTCCGTGTAACA AAGAAGAGTGAAGTCCGTGCCGCCATCAAGAAGATGCTCGAGACCCCAGGGCCATACTTGTTGGATATCATCGTCCC ACACCAGGAGCATGTGCTGCCTATGATCCCAAGTGGGGGCGCATTCAAGGACATGATCCTGGATGGTGATGGCAGGA CTATGTATTAATCTATAATCTGTATGTTGGCAAAGCACCAGCCCGGCCTATGTTTGACCTGAATGACCCATAAAGAG AAGGGCGACACGCGATGCAG
The sequencing result of the als gene segment of Jiahua-1 Herbicide Resistant Rice mutant 3 is as follows:
CTGCATCGCGTGTCGCCCTTTCGCCCAAACCCAGAAACCCTCGCCGCCGCCGCCGCCGCCATCACCCAC CATGGCTACGACCGCCGCGGCCGCGGCCGCCGCCCTGTCCGCCGCCGCGACGGCCAAGACCGGCCGTAAGAACCACC AGCGACACCACGTCCTTCCCGCTCGAGGCCGGGTGGGGGCGGCGGCGGTCAGGTGCTCGGCGGTGTCCCCGGTCACC CCGCCGTCCCCGGCGCCGCCGGCCACGCCGCTCCGGCCGTGGGGGCCGGCCGAGCCCCGCAAGGGCGCGGACATCCT CGTGGAGGCGCTGGAGCGGTGCGGCGTCAGCGACGTGTTCGCCTACCCGGGCGGCGCGTCCATGGAGATCCACCAGG CGCTGACGCGCTCCCCGGTCATCACCAACCACCTCTTCCGCCACGAGCAGGGCGAGGCGTTCGCGGCGTCCGGGTAC GCGCGCGCGTCCGGCCGCGTCGGGGTCTGCGTCGCCACCTCCGGCCCCGGGGCAACCAACCTCGTGTCCGCGCTCGC CGACGCGCTGCTCGACTCCGTCCCGATGGTCGCCATCACGGGCCAGGTCCTCCGCCGCATGATCGGCACCGACGCCT TCCAGGAGACGCCCATAGTCGAGGTCACCCGCTCCATCACCAAGCACAATTACCTTGTCCTTGATGTGGAGGACATC CCCCGCGTCATACAGGAAGCCTTCTTCCTCGCGTCCTCGGGCCGTCCTGGCCCGGTGCTGGTCGACATCCCCAAGGA CATCCAGCAGCAGATGGCCGTGCCGGTCTGGGACACCTCGATGAATCTACCAGGGTACATCGCACGCCTGCCCAAGC CACCCGCGACAGAATTGCTTGAGCAGGTCTTGCGTCTGGTTGGCGAGTCACGGCGCCCGATTCTCTATGTCGGTGGT GGCTGCTCTGCATCTGGTGACGAATTGCGCTGGTTTGTTGAGCTGACTGGTATCCCAGTTACAACCACTCTGATGGG CCTCGGCAATTTCCCCAGTGACGACCCGTTGTCCCTGCGCATGCTTGGGATGCATGGCACGGTGTACGCAAATTATG CCGTGGATAAGGCTGACCTGTTGCTTGCGTTTGGTGTGCGGTTTGATGATCGTGTGACAGGGAAAATTGAGGCTTTT GCAAGCAGGGCCAAGATTGTGCACATTGACATTGATCCAGCAGAGATTGGAAAGAACAAGCAACCACATGTGTCAAT TTGCGCAGATGTTAAGCTTGCTTTACAGGGCTTGAATGCTCTGCTACAACAGAGCACAACAAAGACAAGTTCTGATT TTAGTGCATGGCACAATGAGTTGGACCAGCAGAAGAGGGAGTTTCCTCTGGGGTACAAAACTTTTGGTGAAGAGATC CCACCGCAATATGCCATTCAGGTGCTGGATGAGCTGACGAAAGGTGAGGCAATCATCGCTACTGGTGTTGGGCAGCA CCAGATGTGGGCGGCACAATATTACACCTACAAGCGGCCACGGCAGTGGCTGTCTTCGGCTGGTCTGGGCGCAATGG GATTTGGGCTGCCTGCTGCAGCTGGTGCTTCTGTGGCTAACCCAGGTGTCACAGTTGTTGATATTGATGGGGATGGT AGCTTCCTCATGAACATTCAGGAGCTGGCATTGATCCGCATTGAGAACCTCCCTGTGAAGGTGATGGTGTTGAACAA CCAACATTTGGGTATGGTGGTGCAATGGGAGGATAGGTTTTACAAGGCGAATAGGGCGCATACATACTTGGGCAACC CGGAATGTGAGAGCGAGATATATCCAGATTTTGTGACTATTGCTAAGGGGTTCAATATTCCTGCAGTCCGTGTAACA AAGAAGAGTGAAGTCCGTGCCGCCATCAAGAAGATGCTCGAGACTCCAGGGCCATACTTGTTGGATATCATCGTCCC GCACCAGGAGCATGTGCTGCCTATGATCCCAAGTGGGGGCGCATTCAAGGACATGATCCTGGATGGTGATGGCAGGA CTGTGTATTAATCTATAATCTGTATGTTGGCAAAGCACCAGCCCGGCCTATGTTTGACCTGAATGACCCATAAAGAG AAGGGCGACACGCGATGCAG
Embodiment 5: the anti-imidazolinone herbicide of rice M3 mutant (hundred ridges are logical)
The seed insemination and emergence (this is M3) that Hefei sterile line antiweed mutant is harvested, it is long extremely to M3 rice seedling When the 3-4 leaf phase, spray hundred ridge 3.3mL it is logical/L water (recommend it is minimum using concentration be hundred ridge 1mL it is logical/3L water, be equivalent to 10 times it is dense Degree).After herbicide spraying 15 days, resistance seedling M3 is in normal green, can continue long up to 20-30cm, and non-resistance seedling leaf loses Go to green even part withered and yellow, plant does not grow tall, only 5-9cm.After 30 days, M3 resistant strain is in normal green plant, and is sprayed The wild rice for applying same concentration herbicidal agent is all withered, shows that hundred ridges of at least anti-10 times of concentration of rice mutant are logical Herbicide.
By seed insemination and emergence that Herbicide Resistant Rice mutant 2, Herbicide Resistant Rice mutant 3 harvest, (this is respectively M3), when M3 rice seedling it is long to the 3-4 leaf phase when, spray hundred ridge 3.3mL it is logical/L water (recommends minimum the use of concentration to be hundred ridge 1mL Logical/3L water, is equivalent to 10 times of concentration).After herbicide spraying 15 days, resistance seedling M3 is in normal green, can continue long up to 20- 30cm, and non-resistance seedling leaf loses green or even part is withered and yellow, plant does not grow tall, only 5-9cm.After 30 days, M3 resistant strain It is in normal green plant, and the wild rice for spraying same concentration herbicidal agent is all withered, shows antiweed water Rice mutant 2, Herbicide Resistant Rice mutant 3 can at least resist hundred ridges of 10 times of concentration to lead to herbicide.
Embodiment 6: the ALS enzyme activity determination of rice M3 antiweed mutant
In order to verify the Herbicid resistant of rice mutant whether caused by ALS is mutated, present inventor has performed ALS enzyme activity Property measurement.Method (Singh B.K., Stidham M.A., Shaner D.L.Assay of of the measuring method referring to Singh etc. acetohydroxyacid synthase.Analytical Biochemistry,1988,171:173-179.).Specifically, The M3 of wild type, Hefei sterile line antiweed mutant, antiweed mutant 2 and antiweed mutant 3 is taken to plant respectively Strain blade 0.2g, is crushed in mortar with liquid nitrogen grinding, and 2mL extracting solution (100mM K2HPO4, pH 7.5,10mM acetone is added Sour sodium, 5mM EDTA, 1mM valine, 1mM leucine, 10mM cysteine, 0.1mM flavin adenine dinucleotide (FAD), 5mM chlorine Change magnesium, 10% (V/V) glycerol, 1% (w/v) polyvinylpyrrolidone), lyolysis to be extracted continues to grind 1min or so after freezing. 12000rpm, 4 DEG C of centrifugation 30min, Aspirate supernatant are added ammonium sulfate and make up to 50% saturation degree, small in placing half on ice When, 12000rpm, 4 DEG C of centrifugation 30min abandon supernatant, will be precipitated and dissolved in 0.2mL reaction buffer (100mM K2HPO4, pH 7.0,1mM EDTA, 10mM magnesium chloride, 100mM Sodium Pyruvate, 1mM diphosphothiamine, 0.1mM flavin adenine dinucleotide Acid), respectively each plant ALS extracting solution.
It is separately added into 10 μ L herbicides " hundred ridges are logical " (aqua, effective component 240g/L) in obtaining ALS extracting solution, mixes Even, 37 DEG C of incubation 1h add 0.1ml 3M sulfuric acid to terminate reaction, and reaction mixture is incubated for 30 minutes in 60 DEG C of reactions is convenient for decarboxylation. Plus 0.4mL developing solution (0.09g/L 1- naphthols and 0.009g/L creatine, with 2.5M NaOH dissolve) then.Mixed liquor is at 37 DEG C Be incubated for and developed the color for 30 minutes (ALS is catalyzed 2 pyruvic acid and forms acetolactic acids, and acetolactic acid decarboxylation forms 3-Hydroxybutanone, then Pink compound is formed with creatine and 1- naphthols, which has obtained the maximum absorption at 530nm), then measure its 530nm Absorbance, ALS activity indicates with A530 light absorption value, and the height of A530 light absorption value reflects the active height of ALS.It tests with water and is Control, wild type, Hefei sterile line antiweed mutant, antiweed mutant 2 and antiweed mutant 3 mutant Respectively survey 5 single plants.
A530 light absorption value measurement result discovery, when wild type, Hefei sterile line antiweed mutant ALS extracting solution in When not having hundred ridge of ALS inhibitor to lead to, their A530 light absorption value shows the ALS enzyme of wild type and mutant between 1.2-1.4 There was no significant difference (Fig. 3) for activity；And be added hundred ridge of ALS inhibitor it is logical after, the A530 light absorption value of wild type is only 0.25, Hefei The A530 light absorption value of sterile line antiweed mutant is 1.21, i.e., the ALS enzymatic activity of wild type is only 18.9% compareed, and The ALS enzymatic activity of Hefei sterile line antiweed mutant still has 89% or more (Fig. 3), shows that Hefei sterile line antiweed is prominent The ALS of variant hundred ridges are led to it is insensitive, to impart resistance.
A530 light absorption value measurement result discovery, when wild type, the ALS of antiweed mutant 2 and antiweed mutant 3 When not having hundred ridge of ALS inhibitor to lead in extracting solution, their A530 light absorption value shows wild type and mutation between 1.2-1.4 There was no significant difference (Figure 11) for the ALS enzymatic activity of body；And be added hundred ridge of ALS inhibitor it is logical after, the A530 light absorption value of wild type is only It is 0.19~0.23, the A530 light absorption value of antiweed mutant 2 and antiweed mutant 3 is 1.16-1.21, i.e. wild type ALS enzymatic activity be not added only hundred ridges it is logical when 18.9%, and the ALS of antiweed mutant 2 and antiweed mutant 3 High 5.25 times and 4.49 times (Figure 11) of the ALS enzyme activity of enzymatic activity activity ratio's wild type.
Embodiment 7: hundred ridge of transgenosis ALS Rice Resistance is logical
Design special primer 5 '-CGCGGATCCATCCGAGCCACACATCGCCTC-3 ' and 5 '- TCCCCGCGGCCTACGGAAAACAACACAC-3 ', 5 ' are separately added into BamHI and SacI digestion decorating site.Reference implementation The method of example 4 from above-mentioned rice mutant Hefei sterile line antiweed mutant, antiweed mutant 2 and is resisted by PCR Mutation als gene is amplified in the genomic DNA of herbicide mutant 3, after sequencing is correct, with the double enzymes of BamHI and SacI difference Cut mutation als gene segment and plant expression vector pCAMBIA1301 plasmid (purchased from pcambia company), digestion products T4- DNA enzymatic (being purchased from TaKaRa company) connection, connection product convert Escherichia coli.Recombinant plasmid extracts DNA, with BamHI and SacI Double digestion verifying, can produce big plasmid fragments and small genetic fragment, it was demonstrated that respectively by nucleotide sequence such as SEQ ID NO.1 (Fig. 4 A), SEQ ID NO.7 (Fig. 4 B), als gene shown in SEQ ID NO.11 (Fig. 4 B) are cloned into plant expression and carry In body pCAMBIA1301 plasmid (being purchased from pcambia company).The plasmid vector built is converted into Agrobacterium EHA105, culture Thallus.Using conventional Agrobacterium-mediated transformation Japonica rice OryzasativaLcv.Nipponbare (purchased from Jiangsu Province's agricultural plasm resource protection and benefit With platform), after obtaining transgenic plant sowing, Progeny plants it is long to the 3-4 leaf phase when, PCR detects transgenic plant (Fig. 5 A and figure 5B)。
PCR detection primer is 5 '-ATGGTTAGAGAGGCTTACGC-3 ' of forward primer 35SF, reverse primer 5R 5 '- AGCAACAGGTCAGCCTTATCCAC-3 ', amplified fragments include 5 ' terminal sequences of CaMV35S promoter and als gene, size About 2kb.Pcr amplification reaction system reference implementation example 4, pcr amplification reaction program use two-step method, and annealing and extension are combined into one It rises, using 68 degree.Amplification program is as follows: initial denaturation: 98 DEG C of 3min；30 circulations: 98 DEG C of 10sec of denaturation；Extend 68 DEG C of 2min； Heat preservation: 72 DEG C of 10min.After PCR identification is positive, sprays hundred ridge 3.3mL and lead to/L water (10 times are recommended to use concentration), after 7 days, ALS enzymatic activity is measured referring to 6 the method for embodiment, it is found that the ALS enzymatic activity of transgenic paddy rice is significantly higher than non-transgenic water Rice；Find that transgenic paddy rice growth conditions are good after 30 days, and non-transgenic OryzasativaLcv.Nipponbare rice is then all withered.Compare conversion to close The transgenic paddy rice of the als gene of fertile sterile line antiweed mutant, antiweed mutant 2 and antiweed mutant 3 The ALS enzymatic activity of Progeny plants finds the transgenic plant ALS of the als gene containing Hefei sterile line antiweed mutant The ALS enzyme activity of activity ratio's wild type high 4.7 times (Fig. 6), the ALS for finding antiweed mutant 2 and antiweed mutant 3 The ALS enzyme activity of transgenic plant ALS activity ratio's wild type of gene is high 4.96 and 5.04 times (Figure 12).
Embodiment 8: transgenosis ALS tobacco resists hundred ridges logical
Design special primer 5 '-CGCGGATCCATCCGAGCCACACATCGCCTC-3 ' and 5 '- TCCCCGCGGCCTACGGAAAACAACACAC-3 ', 5 ' are separately added into BamHI and SacI digestion decorating site.By PCR from It is amplified in the genomic DNA of Hefei sterile line antiweed mutant, antiweed mutant 2 and antiweed mutant 3 Be mutated als gene, after sequencing is correct, referring to embodiment 7 method by nucleotide sequence such as SEQ ID NO.1, SEQ ID Als gene shown in NO.7, SEQ ID NO.11 is cloned into plant expression vector pCAMBIA2301 plasmid respectively and (is purchased from Pcambia company) in.Positive colony conversion Agrobacterium EHA105 is selected, using conventional Agrobacterium-mediated transformation Ben Shi cigarette Leaf dish, after obtaining transgenic plant sowing, Progeny plants it is long to the 3-4 leaf phase when, after PCR identification is positive, spray 3.3mL hundred Ridge leads to/L water (10 times are recommended to use concentration), after 7 days, measures ALS enzymatic activity referring to 6 the method for embodiment, finds transgenosis The ALS enzymatic activity of tobacco is significantly higher than non-transgenic tobacco；It finds that transgene tobacco growth conditions are good after 30 days, rather than turns base Because tobacco is then all withered.It is prominent to compare conversion Hefei sterile line antiweed mutant, antiweed mutant 2 and antiweed The ALS enzymatic activity of the transgene tobacco Progeny plants of the als gene of variant 3, discovery are mutated containing Hefei sterile line antiweed The ALS enzyme activity of transgenic plant ALS activity ratio's wild type of the als gene of body is high 5.2 times (Fig. 7), and discovery contains anti-weeding The ALS enzyme activity of transgenic plant ALS activity ratio's wild type of the als gene of agent mutant 2 and antiweed mutant 3 is high 5.84 and 6.0 times (Figure 13).
Embodiment 9: the comparison and identification of resistant material
Patent application before resistant plant ratio in order to detect whether to have mention in the application 2 mutational sites (201610226003.6) the weeding tolerance for the resistant plant mentioned in is stronger, we are sterile by the Hefei in embodiment 2 It is the antiweed mutant plants progress ALS enzyme activity of CGMCC No.12265 in mutant and the patent No. 201610226003.6 Measurement finds the Hefei sterile line mutant ALS activity ratio CGMCC No.12265 high 18% (Fig. 8) in the present invention.
In order to detect whether that there is the resistance of the antiweed mutant 2 and antiweed mutant 3 mentioned in the application The weeding tolerance for the resistant plant mentioned in patent application (201610226003.6) before plant ratio is stronger, we will be real The antiweed mutant plants for applying CGMCC No.12265 in mutant and the patent No. 201610226003.6 in example 2 carry out ALS enzyme activity determination finds 8% He of antiweed mutant ALS activity ratio CGMCC No.12265 high in the present invention 10.7% (Figure 14).
Although a specific embodiment of the invention has been described in detail, it will be understood to those of skill in the art that.According to All introductions having disclosed can be carry out various modifications and be replaced to those details, these are in protection scope of the present invention It is interior.Full scope of the invention is given by the appended claims and any equivalents thereof.
Sequence table
<110>Jiangsu Province Agriculture Science Institute
<120>Jiangsu Province Agriculture Science Institute
<150> 201710655418X
<151> 2017-08-03
<160> 14
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1935
<212> DNA
<213>rice paddy seed HF-407 (Oryza sativa Indica Group HF-407)
<400> 1
atggctacga ccgccgcggc cgcggccgcc accttgtccg ccgccgcgac ggccaagacc 60
ggccgtaaga accaccagcg acaccacgtc cttcccgctc gaggccgggt gggggcggcg 120
gcggtcaggt gctcggcggt gtccccggtc accccgccgt ccccggcgcc gccggccacg 180
ccgctccggc cgtgggggac ggccgagccc cgcaagggcg cggacatcct cgtggaggcg 240
ctggagcggt gcggcgtcag cgacgtgttc gcctacccgg gcggcgcgtc catggagatc 300
caccaggcgc tgacgcgctc cccggtcatc accaaccacc tcttccgcca cgagcagggc 360
gaggcgttcg cggcgtccgg gtacgcgcgc gcgtccggcc gcgtcggggt ctgcgtcgcc 420
acctccggcc ccggggcaac caacctcgtg tccgcgctcg ccgacgcgct gctcgactcc 480
gtcccgatgg tcgccatcac gggccaggtc caccgccgca tgatcggcac cgacgccttc 540
caggagacgc ccatagtcga ggtcacccgc tccatcacca agcacaatta ccttgtcctt 600
gatgtggagg acatcccccg cgtcatacag gaagccttct tcctcgcgtc ctcgggccgt 660
cctggcccgg tgctggtcga catccccaag gacatccagc agcagatggc tgtgccagtc 720
tgggacacct cgatgaatct accggggtac attgcacgcc tgcccaagcc acccgcgaca 780
gaattgcttg agcaggtctt gcgtctggtt ggcgagtcac ggcgcccgat tctctatgtc 840
ggtggtggct gctctgcatc tggtgatgaa ttgcgccggt ttgttgagct gaccggcatc 900
ccagttacaa ccactctgat gggcctcggc aatttcccca gtgatgatcc gttgtccctg 960
cgcatgcttg ggatgcatgg cacggtgtac gcaaattatg cggtggataa ggctgacctg 1020
ttgcttgcat ttggcgtgcg gtttgatgaa cgtgtgacag ggaaaattga ggcttttgca 1080
agcagggcca agattgtgca cattgacatt gatccagcgg agattggaaa gaacaagcaa 1140
ccacatgtgt caatttgcgc agatgttaag cttgctttac agggcttgaa tgctctgcta 1200
gaccagagca caacaaagac aagttctgat tttagtgcat ggcacaatga gttggaccag 1260
cagaagaggg agtttcctct ggggtacaag acttttggtg aagagatccc accgcaatat 1320
gctattcagg tgctggatga gctgacgaaa ggggaggcaa tcatcgctac tggtgttgga 1380
cagcaccaga tgtgggcggc acaatattac acctacaagc ggccacggca gtggctgtct 1440
tcggctggtc tgggcgcaat gggatttggg ctgcctgctg cagctggtgc ttctgtggct 1500
aacccaggtg tcacagttgt tgatattgat ggggatggta gcttcctcat gaacattcag 1560
gagttggcat tgatccgcat tgagaacctc ccggtgaagg tgatggtgtt gaacaaccaa 1620
catttgggta tggttgtgca atgggaggat aggttttaca aggcaaatag ggcgcataca 1680
tacttgggca acccagaatg tgagagcgag atatatccag attttgtgac tattgctaaa 1740
gggttcaata ttcctgcagt ccgtgtaaca aagaagagtg aagtccgtgc cgccatcaag 1800
aagatgctcg agaccccagg gccatacttg ttggatatca tcgtcccaca ccaggagcat 1860
gtgctgccta tgatcccaag tgggggcgca ttcaaggaca tgatcctgga tggtgatggc 1920
aggactatgt attaa 1935
<210> 2
<211> 644
<212> PRT
<213>rice paddy seed HF-407 (Oryza sativa Indica Group HF-407)
<400> 2
Met Ala Thr Thr Ala Ala Ala Ala Ala Ala Thr Leu Ser Ala Ala Ala
1 5 10 15
Thr Ala Lys Thr Gly Arg Lys Asn His Gln Arg His His Val Leu Pro
20 25 30
Ala Arg Gly Arg Val Gly Ala Ala Ala Val Arg Cys Ser Ala Val Ser
35 40 45
Pro Val Thr Pro Pro Ser Pro Ala Pro Pro Ala Thr Pro Leu Arg Pro
50 55 60
Trp Gly Thr Ala Glu Pro Arg Lys Gly Ala Asp Ile Leu Val Glu Ala
65 70 75 80
Leu Glu Arg Cys Gly Val Ser Asp Val Phe Ala Tyr Pro Gly Gly Ala
85 90 95
Ser Met Glu Ile His Gln Ala Leu Thr Arg Ser Pro Val Ile Thr Asn
100 105 110
His Leu Phe Arg His Glu Gln Gly Glu Ala Phe Ala Ala Ser Gly Tyr
115 120 125
Ala Arg Ala Ser Gly Arg Val Gly Val Cys Val Ala Thr Ser Gly Pro
130 135 140
Gly Ala Thr Asn Leu Val Ser Ala Leu Ala Asp Ala Leu Leu Asp Ser
145 150 155 160
Val Pro Met Val Ala Ile Thr Gly Gln Val His Arg Arg Met Ile Gly
165 170 175
Thr Asp Ala Phe Gln Glu Thr Pro Ile Val Glu Val Thr Arg Ser Ile
180 185 190
Thr Lys His Asn Tyr Leu Val Leu Asp Val Glu Asp Ile Pro Arg Val
195 200 205
Ile Gln Glu Ala Phe Phe Leu Ala Ser Ser Gly Arg Pro Gly Pro Val
210 215 220
Leu Val Asp Ile Pro Lys Asp Ile Gln Gln Gln Met Ala Val Pro Val
225 230 235 240
Trp Asp Thr Ser Met Asn Leu Pro Gly Tyr Ile Ala Arg Leu Pro Lys
245 250 255
Pro Pro Ala Thr Glu Leu Leu Glu Gln Val Leu Arg Leu Val Gly Glu
260 265 270
Ser Arg Arg Pro Ile Leu Tyr Val Gly Gly Gly Cys Ser Ala Ser Gly
275 280 285
Asp Glu Leu Arg Arg Phe Val Glu Leu Thr Gly Ile Pro Val Thr Thr
290 295 300
Thr Leu Met Gly Leu Gly Asn Phe Pro Ser Asp Asp Pro Leu Ser Leu
305 310 315 320
Arg Met Leu Gly Met His Gly Thr Val Tyr Ala Asn Tyr Ala Val Asp
325 330 335
Lys Ala Asp Leu Leu Leu Ala Phe Gly Val Arg Phe Asp Glu Arg Val
340 345 350
Thr Gly Lys Ile Glu Ala Phe Ala Ser Arg Ala Lys Ile Val His Ile
355 360 365
Asp Ile Asp Pro Ala Glu Ile Gly Lys Asn Lys Gln Pro His Val Ser
370 375 380
Ile Cys Ala Asp Val Lys Leu Ala Leu Gln Gly Leu Asn Ala Leu Leu
385 390 395 400
Asp Gln Ser Thr Thr Lys Thr Ser Ser Asp Phe Ser Ala Trp His Asn
405 410 415
Glu Leu Asp Gln Gln Lys Arg Glu Phe Pro Leu Gly Tyr Lys Thr Phe
420 425 430
Gly Glu Glu Ile Pro Pro Gln Tyr Ala Ile Gln Val Leu Asp Glu Leu
435 440 445
Thr Lys Gly Glu Ala Ile Ile Ala Thr Gly Val Gly Gln His Gln Met
450 455 460
Trp Ala Ala Gln Tyr Tyr Thr Tyr Lys Arg Pro Arg Gln Trp Leu Ser
465 470 475 480
Ser Ala Gly Leu Gly Ala Met Gly Phe Gly Leu Pro Ala Ala Ala Gly
485 490 495
Ala Ser Val Ala Asn Pro Gly Val Thr Val Val Asp Ile Asp Gly Asp
500 505 510
Gly Ser Phe Leu Met Asn Ile Gln Glu Leu Ala Leu Ile Arg Ile Glu
515 520 525
Asn Leu Pro Val Lys Val Met Val Leu Asn Asn Gln His Leu Gly Met
530 535 540
Val Val Gln Trp Glu Asp Arg Phe Tyr Lys Ala Asn Arg Ala His Thr
545 550 555 560
Tyr Leu Gly Asn Pro Glu Cys Glu Ser Glu Ile Tyr Pro Asp Phe Val
565 570 575
Thr Ile Ala Lys Gly Phe Asn Ile Pro Ala Val Arg Val Thr Lys Lys
580 585 590
Ser Glu Val Arg Ala Ala Ile Lys Lys Met Leu Glu Thr Pro Gly Pro
595 600 605
Tyr Leu Leu Asp Ile Ile Val Pro His Gln Glu His Val Leu Pro Met
610 615 620
Ile Pro Ser Gly Gly Ala Phe Lys Asp Met Ile Leu Asp Gly Asp Gly
625 630 635 640
Arg Thr Met Tyr
<210> 3
<211> 1935
<212> DNA
<213>rice paddy seed Hefei sterile line wild type als gene (Oryza sativa Indica)
<400> 3
atggctacga ccgccgcggc cgcggccgcc accttgtccg ccgccgcgac ggccaagacc 60
ggccgtaaga accaccagcg acaccacgtc cttcccgctc gaggccgggt gggggcggcg 120
gcggtcaggt gctcggcggt gtccccggtc accccgccgt ccccggcgcc gccggccacg 180
ccgctccggc cgtgggggac ggccgagccc cgcaagggcg cggacatcct cgtggaggcg 240
ctggagcggt gcggcgtcag cgacgtgttc gcctacccgg gcggcgcgtc catggagatc 300
caccaggcgc tgacgcgctc cccggtcatc accaaccacc tcttccgcca cgagcagggc 360
gaggcgttcg cggcgtccgg gtacgcgcgc gcgtccggcc gcgtcggggt ctgcgtcgcc 420
acctccggcc ccggggcaac caacctcgtg tccgcgctcg ccgacgcgct gctcgactcc 480
gtcccgatgg tcgccatcac gggccaggtc ccccgccgca tgatcggcac cgacgccttc 540
caggagacgc ccatagtcga ggtcacccgc tccatcacca agcacaatta ccttgtcctt 600
gatgtggagg acatcccccg cgtcatacag gaagccttct tcctcgcgtc ctcgggccgt 660
cctggcccgg tgctggtcga catccccaag gacatccagc agcagatggc tgtgccagtc 720
tgggacacct cgatgaatct accggggtac attgcacgcc tgcccaagcc acccgcgaca 780
gaattgcttg agcaggtctt gcgtctggtt ggcgagtcac ggcgcccgat tctctatgtc 840
ggtggtggct gctctgcatc tggtgatgaa ttgcgccggt ttgttgagct gaccggcatc 900
ccagttacaa ccactctgat gggcctcggc aatttcccca gtgatgatcc gttgtccctg 960
cgcatgcttg ggatgcatgg cacggtgtac gcaaattatg cggtggataa ggctgacctg 1020
ttgcttgcat ttggcgtgcg gtttgatgat cgtgtgacag ggaaaattga ggcttttgca 1080
agcagggcca agattgtgca cattgacatt gatccagcgg agattggaaa gaacaagcaa 1140
ccacatgtgt caatttgcgc agatgttaag cttgctttac agggcttgaa tgctctgcta 1200
gaccagagca caacaaagac aagttctgat tttagtgcat ggcacaatga gttggaccag 1260
cagaagaggg agtttcctct ggggtacaag acttttggtg aagagatccc accgcaatat 1320
gctattcagg tgctggatga gctgacgaaa ggggaggcaa tcatcgctac tggtgttgga 1380
cagcaccaga tgtgggcggc acaatattac acctacaagc ggccacggca gtggctgtct 1440
tcggctggtc tgggcgcaat gggatttggg ctgcctgctg cagctggtgc ttctgtggct 1500
aacccaggtg tcacagttgt tgatattgat ggggatggta gcttcctcat gaacattcag 1560
gagttggcat tgatccgcat tgagaacctc ccggtgaagg tgatggtgtt gaacaaccaa 1620
catttgggta tggttgtgca atgggaggat aggttttaca aggcaaatag ggcgcataca 1680
tacttgggca acccagaatg tgagagcgag atatatccag attttgtgac tattgctaaa 1740
gggttcaata ttcctgcagt ccgtgtaaca aagaagagtg aagtccgtgc cgccatcaag 1800
aagatgctcg agaccccagg gccatacttg ttggatatca tcgtcccaca ccaggagcat 1860
gtgctgccta tgatcccaag tgggggcgca ttcaaggaca tgatcctgga tggtgatggc 1920
aggactatgt attaa 1935
<210> 4
<211> 644
<212> PRT
<213>rice paddy seed Hefei sterile line wild type als gene (Oryza sativa Indica)
<400> 4
Met Ala Thr Thr Ala Ala Ala Ala Ala Ala Thr Leu Ser Ala Ala Ala
1 5 10 15
Thr Ala Lys Thr Gly Arg Lys Asn His Gln Arg His His Val Leu Pro
20 25 30
Ala Arg Gly Arg Val Gly Ala Ala Ala Val Arg Cys Ser Ala Val Ser
35 40 45
Pro Val Thr Pro Pro Ser Pro Ala Pro Pro Ala Thr Pro Leu Arg Pro
50 55 60
Trp Gly Thr Ala Glu Pro Arg Lys Gly Ala Asp Ile Leu Val Glu Ala
65 70 75 80
Leu Glu Arg Cys Gly Val Ser Asp Val Phe Ala Tyr Pro Gly Gly Ala
85 90 95
Ser Met Glu Ile His Gln Ala Leu Thr Arg Ser Pro Val Ile Thr Asn
100 105 110
His Leu Phe Arg His Glu Gln Gly Glu Ala Phe Ala Ala Ser Gly Tyr
115 120 125
Ala Arg Ala Ser Gly Arg Val Gly Val Cys Val Ala Thr Ser Gly Pro
130 135 140
Gly Ala Thr Asn Leu Val Ser Ala Leu Ala Asp Ala Leu Leu Asp Ser
145 150 155 160
Val Pro Met Val Ala Ile Thr Gly Gln Val Pro Arg Arg Met Ile Gly
165 170 175
Thr Asp Ala Phe Gln Glu Thr Pro Ile Val Glu Val Thr Arg Ser Ile
180 185 190
Thr Lys His Asn Tyr Leu Val Leu Asp Val Glu Asp Ile Pro Arg Val
195 200 205
Ile Gln Glu Ala Phe Phe Leu Ala Ser Ser Gly Arg Pro Gly Pro Val
210 215 220
Leu Val Asp Ile Pro Lys Asp Ile Gln Gln Gln Met Ala Val Pro Val
225 230 235 240
Trp Asp Thr Ser Met Asn Leu Pro Gly Tyr Ile Ala Arg Leu Pro Lys
245 250 255
Pro Pro Ala Thr Glu Leu Leu Glu Gln Val Leu Arg Leu Val Gly Glu
260 265 270
Ser Arg Arg Pro Ile Leu Tyr Val Gly Gly Gly Cys Ser Ala Ser Gly
275 280 285
Asp Glu Leu Arg Arg Phe Val Glu Leu Thr Gly Ile Pro Val Thr Thr
290 295 300
Thr Leu Met Gly Leu Gly Asn Phe Pro Ser Asp Asp Pro Leu Ser Leu
305 310 315 320
Arg Met Leu Gly Met His Gly Thr Val Tyr Ala Asn Tyr Ala Val Asp
325 330 335
Lys Ala Asp Leu Leu Leu Ala Phe Gly Val Arg Phe Asp Asp Arg Val
340 345 350
Thr Gly Lys Ile Glu Ala Phe Ala Ser Arg Ala Lys Ile Val His Ile
355 360 365
Asp Ile Asp Pro Ala Glu Ile Gly Lys Asn Lys Gln Pro His Val Ser
370 375 380
Ile Cys Ala Asp Val Lys Leu Ala Leu Gln Gly Leu Asn Ala Leu Leu
385 390 395 400
Asp Gln Ser Thr Thr Lys Thr Ser Ser Asp Phe Ser Ala Trp His Asn
405 410 415
Glu Leu Asp Gln Gln Lys Arg Glu Phe Pro Leu Gly Tyr Lys Thr Phe
420 425 430
Gly Glu Glu Ile Pro Pro Gln Tyr Ala Ile Gln Val Leu Asp Glu Leu
435 440 445
Thr Lys Gly Glu Ala Ile Ile Ala Thr Gly Val Gly Gln His Gln Met
450 455 460
Trp Ala Ala Gln Tyr Tyr Thr Tyr Lys Arg Pro Arg Gln Trp Leu Ser
465 470 475 480
Ser Ala Gly Leu Gly Ala Met Gly Phe Gly Leu Pro Ala Ala Ala Gly
485 490 495
Ala Ser Val Ala Asn Pro Gly Val Thr Val Val Asp Ile Asp Gly Asp
500 505 510
Gly Ser Phe Leu Met Asn Ile Gln Glu Leu Ala Leu Ile Arg Ile Glu
515 520 525
Asn Leu Pro Val Lys Val Met Val Leu Asn Asn Gln His Leu Gly Met
530 535 540
Val Val Gln Trp Glu Asp Arg Phe Tyr Lys Ala Asn Arg Ala His Thr
545 550 555 560
Tyr Leu Gly Asn Pro Glu Cys Glu Ser Glu Ile Tyr Pro Asp Phe Val
565 570 575
Thr Ile Ala Lys Gly Phe Asn Ile Pro Ala Val Arg Val Thr Lys Lys
580 585 590
Ser Glu Val Arg Ala Ala Ile Lys Lys Met Leu Glu Thr Pro Gly Pro
595 600 605
Tyr Leu Leu Asp Ile Ile Val Pro His Gln Glu His Val Leu Pro Met
610 615 620
Ile Pro Ser Gly Gly Ala Phe Lys Asp Met Ile Leu Asp Gly Asp Gly
625 630 635 640
Arg Thr Met Tyr
<210> 5
<211> 30
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
cgcggatcca tccgagccac acatcgcctc 30
<210> 6
<211> 28
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
tccccgcggc ctacggaaaa caacacac 28
<210> 7
<211> 1935
<212> DNA
<213>rice paddy seed R28 (Oryza sativa Indica Group R28)
<400> 7
atggctacga ccgccgcggc cgcggccgcc accttgtccg ccgccgcgac ggccaagacc 60
ggccgtaaga accaccagcg acaccacgtc cttcccgctc gaggccgggt gggggcggcg 120
gcggtcaggt gctcggcggt gtccccggtc accccgccgt ccccggcgcc gccggccacg 180
ccgctccggc cgtgggggac ggccgagccc cgcaagggcg cggacatcct cgtggaggcg 240
ctggagcggt gcggcgtcag cgacgtgttc gcctacccgg gcggcgcgtc catggagatc 300
caccaggcgc tgacgcgctc cccggtcatc accaaccacc tcttccgcca cgagcagggc 360
gaggcgttcg cggcgtccgg gtacgcgcgc gcgtccggcc gcgtcggggt ctgcgtcgcc 420
acctccggcc ccggggcaac caacctcgtg tccgcgctcg ccgacgcgct gctcgactcc 480
gtcccgatgg tcgccatcac gggccaggtc ccccgccgca tgatcggcac cgacgccttc 540
caggagacgc ccatagtcga ggtcacccgc tccatcacca agcacaatta ccttgtcctt 600
gatgtggagg acatcccccg cgtcatacag gaagccttct tcctcgcgtc ctcgggccgt 660
cctggcccgg tgctggtcga catccccaag gacatccagc agcagatggc tgtgccagtc 720
tgggacacct cgatgaatct accggggtac attgcacgcc tgcccaagcc acccgcgaca 780
gaattgcttg agcaggtctt gcgtctggtt ggcgagtcac ggcgcccgat tctctatgtc 840
ggtggtggct gctctgcatc tggtgatgaa ttgcgccggt ttgttgagct gaccggcatc 900
ccagttacaa ccactctgat gggcctcggc aatttcccca gtgatgatcc gttgtccctg 960
cgcatgcttg ggatgcatgg cacggtgtac gcaaattatg cggtggataa ggctgacctg 1020
ttgcttgcat ttggcgtgcg gtttgatgaa cgtgtgacag ggaaaattga ggcttttgca 1080
agcagggcca agattgtgca cattgacatt gatccagcgg agattggaaa gaacaagcaa 1140
ccacatgtgt caatttgcgc agatgttaag cttgctttac agggcttgaa tgctctgcta 1200
gaccagagca caacaaagac aagttctgat tttagtgcat ggcacaatga gttggaccag 1260
cagaagaggg agtttcctct ggggtacaag acttttggtg aagagatccc accgcaatat 1320
gctattcagg tgctggatga gctgacgaaa ggggaggcaa tcatcgctac tggtgttgga 1380
cagcaccaga tgtgggcggc acaatattac acctacaagc ggccacggca gtggctgtct 1440
tcggctggtc tgggcgcaat gggatttggg ctgcctgctg cagctggtgc ttctgtggct 1500
aacccaggtg tcacagttgt tgatattgat ggggatggta gcttcctcat gaacattcag 1560
gagttggcat tgatccgcat tgagaacctc ccggtgaagg tgatggtgtt gaacaaccaa 1620
catttgggta tggttgtgca atgggaggat aggttttaca aggcaaatag ggcgcataca 1680
tacttgggca acccagaatg tgagagcgag atatatccag attttgtgac tattgctaaa 1740
gggttcaata ttcctgcagt ccgtgtaaca aagaagagtg aagtccgtgc cgccatcaag 1800
aagatgctcg agaccccagg gccatacttg ttggatatca tcgtcccaca ccaggagcat 1860
gtgctgccta tgatcccaag tgggggcgca ttcaaggaca tgatcctgga tggtgatggc 1920
aggactatgt attaa 1935
<210> 8
<211> 644
<212> PRT
<213>rice paddy seed R28 (Oryza sativa Indica Group R28)
<400> 8
Met Ala Thr Thr Ala Ala Ala Ala Ala Ala Thr Leu Ser Ala Ala Ala
1 5 10 15
Thr Ala Lys Thr Gly Arg Lys Asn His Gln Arg His His Val Leu Pro
20 25 30
Ala Arg Gly Arg Val Gly Ala Ala Ala Val Arg Cys Ser Ala Val Ser
35 40 45
Pro Val Thr Pro Pro Ser Pro Ala Pro Pro Ala Thr Pro Leu Arg Pro
50 55 60
Trp Gly Thr Ala Glu Pro Arg Lys Gly Ala Asp Ile Leu Val Glu Ala
65 70 75 80
Leu Glu Arg Cys Gly Val Ser Asp Val Phe Ala Tyr Pro Gly Gly Ala
85 90 95
Ser Met Glu Ile His Gln Ala Leu Thr Arg Ser Pro Val Ile Thr Asn
100 105 110
His Leu Phe Arg His Glu Gln Gly Glu Ala Phe Ala Ala Ser Gly Tyr
115 120 125
Ala Arg Ala Ser Gly Arg Val Gly Val Cys Val Ala Thr Ser Gly Pro
130 135 140
Gly Ala Thr Asn Leu Val Ser Ala Leu Ala Asp Ala Leu Leu Asp Ser
145 150 155 160
Val Pro Met Val Ala Ile Thr Gly Gln Val Pro Arg Arg Met Ile Gly
165 170 175
Thr Asp Ala Phe Gln Glu Thr Pro Ile Val Glu Val Thr Arg Ser Ile
180 185 190
Thr Lys His Asn Tyr Leu Val Leu Asp Val Glu Asp Ile Pro Arg Val
195 200 205
Ile Gln Glu Ala Phe Phe Leu Ala Ser Ser Gly Arg Pro Gly Pro Val
210 215 220
Leu Val Asp Ile Pro Lys Asp Ile Gln Gln Gln Met Ala Val Pro Val
225 230 235 240
Trp Asp Thr Ser Met Asn Leu Pro Gly Tyr Ile Ala Arg Leu Pro Lys
245 250 255
Pro Pro Ala Thr Glu Leu Leu Glu Gln Val Leu Arg Leu Val Gly Glu
260 265 270
Ser Arg Arg Pro Ile Leu Tyr Val Gly Gly Gly Cys Ser Ala Ser Gly
275 280 285
Asp Glu Leu Arg Arg Phe Val Glu Leu Thr Gly Ile Pro Val Thr Thr
290 295 300
Thr Leu Met Gly Leu Gly Asn Phe Pro Ser Asp Asp Pro Leu Ser Leu
305 310 315 320
Arg Met Leu Gly Met His Gly Thr Val Tyr Ala Asn Tyr Ala Val Asp
325 330 335
Lys Ala Asp Leu Leu Leu Ala Phe Gly Val Arg Phe Asp Glu Arg Val
340 345 350
Thr Gly Lys Ile Glu Ala Phe Ala Ser Arg Ala Lys Ile Val His Ile
355 360 365
Asp Ile Asp Pro Ala Glu Ile Gly Lys Asn Lys Gln Pro His Val Ser
370 375 380
Ile Cys Ala Asp Val Lys Leu Ala Leu Gln Gly Leu Asn Ala Leu Leu
385 390 395 400
Asp Gln Ser Thr Thr Lys Thr Ser Ser Asp Phe Ser Ala Trp His Asn
405 410 415
Glu Leu Asp Gln Gln Lys Arg Glu Phe Pro Leu Gly Tyr Lys Thr Phe
420 425 430
Gly Glu Glu Ile Pro Pro Gln Tyr Ala Ile Gln Val Leu Asp Glu Leu
435 440 445
Thr Lys Gly Glu Ala Ile Ile Ala Thr Gly Val Gly Gln His Gln Met
450 455 460
Trp Ala Ala Gln Tyr Tyr Thr Tyr Lys Arg Pro Arg Gln Trp Leu Ser
465 470 475 480
Ser Ala Gly Leu Gly Ala Met Gly Phe Gly Leu Pro Ala Ala Ala Gly
485 490 495
Ala Ser Val Ala Asn Pro Gly Val Thr Val Val Asp Ile Asp Gly Asp
500 505 510
Gly Ser Phe Leu Met Asn Ile Gln Glu Leu Ala Leu Ile Arg Ile Glu
515 520 525
Asn Leu Pro Val Lys Val Met Val Leu Asn Asn Gln His Leu Gly Met
530 535 540
Val Val Gln Trp Glu Asp Arg Phe Tyr Lys Ala Asn Arg Ala His Thr
545 550 555 560
Tyr Leu Gly Asn Pro Glu Cys Glu Ser Glu Ile Tyr Pro Asp Phe Val
565 570 575
Thr Ile Ala Lys Gly Phe Asn Ile Pro Ala Val Arg Val Thr Lys Lys
580 585 590
Ser Glu Val Arg Ala Ala Ile Lys Lys Met Leu Glu Thr Pro Gly Pro
595 600 605
Tyr Leu Leu Asp Ile Ile Val Pro His Gln Glu His Val Leu Pro Met
610 615 620
Ile Pro Ser Gly Gly Ala Phe Lys Asp Met Ile Leu Asp Gly Asp Gly
625 630 635 640
Arg Thr Met Tyr
<210> 9
<211> 1935
<212> DNA
<213>rice R89 wild type als gene (Oryza sativa Indica)
<400> 9
atggctacga ccgccgcggc cgcggccgcc accttgtccg ccgccgcgac ggccaagacc 60
ggccgtaaga accaccagcg acaccacgtc cttcccgctc gaggccgggt gggggcggcg 120
gcggtcaggt gctcggcggt gtccccggtc accccgccgt ccccggcgcc gccggccacg 180
ccgctccggc cgtgggggac ggccgagccc cgcaagggcg cggacatcct cgtggaggcg 240
ctggagcggt gcggcgtcag cgacgtgttc gcctacccgg gcggcgcgtc catggagatc 300
caccaggcgc tgacgcgctc cccggtcatc accaaccacc tcttccgcca cgagcagggc 360
gaggcgttcg cggcgtccgg gtacgcgcgc gcgtccggcc gcgtcggggt ctgcgtcgcc 420
acctccggcc ccggggcaac caacctcgtg tccgcgctcg ccgacgcgct gctcgactcc 480
gtcccgatgg tcgccatcac gggccaggtc ccccgccgca tgatcggcac cgacgccttc 540
caggagacgc ccatagtcga ggtcacccgc tccatcacca agcacaatta ccttgtcctt 600
gatgtggagg acatcccccg cgtcatacag gaagccttct tcctcgcgtc ctcgggccgt 660
cctggcccgg tgctggtcga catccccaag gacatccagc agcagatggc tgtgccagtc 720
tgggacacct cgatgaatct accggggtac attgcacgcc tgcccaagcc acccgcgaca 780
gaattgcttg agcaggtctt gcgtctggtt ggcgagtcac ggcgcccgat tctctatgtc 840
ggtggtggct gctctgcatc tggtgatgaa ttgcgccggt ttgttgagct gaccggcatc 900
ccagttacaa ccactctgat gggcctcggc aatttcccca gtgatgatcc gttgtccctg 960
cgcatgcttg ggatgcatgg cacggtgtac gcaaattatg cggtggataa ggctgacctg 1020
ttgcttgcat ttggcgtgcg gtttgatgat cgtgtgacag ggaaaattga ggcttttgca 1080
agcagggcca agattgtgca cattgacatt gatccagcgg agattggaaa gaacaagcaa 1140
ccacatgtgt caatttgcgc agatgttaag cttgctttac agggcttgaa tgctctgcta 1200
gaccagagca caacaaagac aagttctgat tttagtgcat ggcacaatga gttggaccag 1260
cagaagaggg agtttcctct ggggtacaag acttttggtg aagagatccc accgcaatat 1320
gctattcagg tgctggatga gctgacgaaa ggggaggcaa tcatcgctac tggtgttgga 1380
cagcaccaga tgtgggcggc acaatattac acctacaagc ggccacggca gtggctgtct 1440
tcggctggtc tgggcgcaat gggatttggg ctgcctgctg cagctggtgc ttctgtggct 1500
aacccaggtg tcacagttgt tgatattgat ggggatggta gcttcctcat gaacattcag 1560
gagttggcat tgatccgcat tgagaacctc ccggtgaagg tgatggtgtt gaacaaccaa 1620
catttgggta tggttgtgca atgggaggat aggttttaca aggcaaatag ggcgcataca 1680
tacttgggca acccagaatg tgagagcgag atatatccag attttgtgac tattgctaaa 1740
gggttcaata ttcctgcagt ccgtgtaaca aagaagagtg aagtccgtgc cgccatcaag 1800
aagatgctcg agaccccagg gccatacttg ttggatatca tcgtcccaca ccaggagcat 1860
gtgctgccta tgatcccaag tgggggcgca ttcaaggaca tgatcctgga tggtgatggc 1920
aggactatgt attaa 1935
<210> 10
<211> 644
<212> PRT
<213>rice R89 wild type als gene (Oryza sativa Indica)
<400> 10
Met Ala Thr Thr Ala Ala Ala Ala Ala Ala Thr Leu Ser Ala Ala Ala
1 5 10 15
Thr Ala Lys Thr Gly Arg Lys Asn His Gln Arg His His Val Leu Pro
20 25 30
Ala Arg Gly Arg Val Gly Ala Ala Ala Val Arg Cys Ser Ala Val Ser
35 40 45
Pro Val Thr Pro Pro Ser Pro Ala Pro Pro Ala Thr Pro Leu Arg Pro
50 55 60
Trp Gly Thr Ala Glu Pro Arg Lys Gly Ala Asp Ile Leu Val Glu Ala
65 70 75 80
Leu Glu Arg Cys Gly Val Ser Asp Val Phe Ala Tyr Pro Gly Gly Ala
85 90 95
Ser Met Glu Ile His Gln Ala Leu Thr Arg Ser Pro Val Ile Thr Asn
100 105 110
His Leu Phe Arg His Glu Gln Gly Glu Ala Phe Ala Ala Ser Gly Tyr
115 120 125
Ala Arg Ala Ser Gly Arg Val Gly Val Cys Val Ala Thr Ser Gly Pro
130 135 140
Gly Ala Thr Asn Leu Val Ser Ala Leu Ala Asp Ala Leu Leu Asp Ser
145 150 155 160
Val Pro Met Val Ala Ile Thr Gly Gln Val Pro Arg Arg Met Ile Gly
165 170 175
Thr Asp Ala Phe Gln Glu Thr Pro Ile Val Glu Val Thr Arg Ser Ile
180 185 190
Thr Lys His Asn Tyr Leu Val Leu Asp Val Glu Asp Ile Pro Arg Val
195 200 205
Ile Gln Glu Ala Phe Phe Leu Ala Ser Ser Gly Arg Pro Gly Pro Val
210 215 220
Leu Val Asp Ile Pro Lys Asp Ile Gln Gln Gln Met Ala Val Pro Val
225 230 235 240
Trp Asp Thr Ser Met Asn Leu Pro Gly Tyr Ile Ala Arg Leu Pro Lys
245 250 255
Pro Pro Ala Thr Glu Leu Leu Glu Gln Val Leu Arg Leu Val Gly Glu
260 265 270
Ser Arg Arg Pro Ile Leu Tyr Val Gly Gly Gly Cys Ser Ala Ser Gly
275 280 285
Asp Glu Leu Arg Arg Phe Val Glu Leu Thr Gly Ile Pro Val Thr Thr
290 295 300
Thr Leu Met Gly Leu Gly Asn Phe Pro Ser Asp Asp Pro Leu Ser Leu
305 310 315 320
Arg Met Leu Gly Met His Gly Thr Val Tyr Ala Asn Tyr Ala Val Asp
325 330 335
Lys Ala Asp Leu Leu Leu Ala Phe Gly Val Arg Phe Asp Asp Arg Val
340 345 350
Thr Gly Lys Ile Glu Ala Phe Ala Ser Arg Ala Lys Ile Val His Ile
355 360 365
Asp Ile Asp Pro Ala Glu Ile Gly Lys Asn Lys Gln Pro His Val Ser
370 375 380
Ile Cys Ala Asp Val Lys Leu Ala Leu Gln Gly Leu Asn Ala Leu Leu
385 390 395 400
Asp Gln Ser Thr Thr Lys Thr Ser Ser Asp Phe Ser Ala Trp His Asn
405 410 415
Glu Leu Asp Gln Gln Lys Arg Glu Phe Pro Leu Gly Tyr Lys Thr Phe
420 425 430
Gly Glu Glu Ile Pro Pro Gln Tyr Ala Ile Gln Val Leu Asp Glu Leu
435 440 445
Thr Lys Gly Glu Ala Ile Ile Ala Thr Gly Val Gly Gln His Gln Met
450 455 460
Trp Ala Ala Gln Tyr Tyr Thr Tyr Lys Arg Pro Arg Gln Trp Leu Ser
465 470 475 480
Ser Ala Gly Leu Gly Ala Met Gly Phe Gly Leu Pro Ala Ala Ala Gly
485 490 495
Ala Ser Val Ala Asn Pro Gly Val Thr Val Val Asp Ile Asp Gly Asp
500 505 510
Gly Ser Phe Leu Met Asn Ile Gln Glu Leu Ala Leu Ile Arg Ile Glu
515 520 525
Asn Leu Pro Val Lys Val Met Val Leu Asn Asn Gln His Leu Gly Met
530 535 540
Val Val Gln Trp Glu Asp Arg Phe Tyr Lys Ala Asn Arg Ala His Thr
545 550 555 560
Tyr Leu Gly Asn Pro Glu Cys Glu Ser Glu Ile Tyr Pro Asp Phe Val
565 570 575
Thr Ile Ala Lys Gly Phe Asn Ile Pro Ala Val Arg Val Thr Lys Lys
580 585 590
Ser Glu Val Arg Ala Ala Ile Lys Lys Met Leu Glu Thr Pro Gly Pro
595 600 605
Tyr Leu Leu Asp Ile Ile Val Pro His Gln Glu His Val Leu Pro Met
610 615 620
Ile Pro Ser Gly Gly Ala Phe Lys Asp Met Ile Leu Asp Gly Asp Gly
625 630 635 640
Arg Thr Met Tyr
<210> 11
<211> 1935
<212> DNA
<213>rice paddy seed JH10 (Oryza sativa Japonica Group JH10)
<400> 11
atggctacga ccgccgcggc cgcggccgcc gccctgtccg ccgccgcgac ggccaagacc 60
ggccgtaaga accaccagcg acaccacgtc cttcccgctc gaggccgggt gggggcggcg 120
gcggtcaggt gctcggcggt gtccccggtc accccgccgt ccccggcgcc gccggccacg 180
ccgctccggc cgtgggggcc ggccgagccc cgcaagggcg cggacatcct cgtggaggcg 240
ctggagcggt gcggcgtcag cgacgtgttc gcctacccgg gcggcgcgtc catggagatc 300
caccaggcgc tgacgcgctc cccggtcatc accaaccacc tcttccgcca cgagcagggc 360
gaggcgttcg cggcgtccgg gtacgcgcgc gcgtccggcc gcgtcggggt ctgcgtcgcc 420
acctccggcc ccggggcaac caacctcgtg tccgcgctcg ccgacgcgct gctcgactcc 480
gtcccgatgg tcgccatcac gggccaggtc ctccgccgca tgatcggcac cgacgccttc 540
caggagacgc ccatagtcga ggtcacccgc tccatcacca agcacaatta ccttgtcctt 600
gatgtggagg acatcccccg cgtcatacag gaagccttct tcctcgcgtc ctcgggccgt 660
cctggcccgg tgctggtcga catccccaag gacatccagc agcagatggc cgtgccggtc 720
tgggacacct cgatgaatct accagggtac atcgcacgcc tgcccaagcc acccgcgaca 780
gaattgcttg agcaggtctt gcgtctggtt ggcgagtcac ggcgcccgat tctctatgtc 840
ggtggtggct gctctgcatc tggtgacgaa ttgcgctggt ttgttgagct gactggtatc 900
ccagttacaa ccactctgat gggcctcggc aatttcccca gtgacgaccc gttgtccctg 960
cgcatgcttg ggatgcatgg cacggtgtac gcaaattatg ccgtggataa ggctgacctg 1020
ttgcttgcgt ttggtgtgcg gtttgatgat cgtgtgacag ggaaaattga ggcttttgca 1080
agcagggcca agattgtgca cattgacatt gatccagcag agattggaaa gaacaagcaa 1140
ccacatgtgt caatttgcgc agatgttaag cttgctttac agggcttgaa tgctctgcta 1200
caacagagca caacaaagac aagttctgat tttagtgcat ggcacaatga gttggaccag 1260
cagaagaggg agtttcctct ggggtacaaa acttttggtg aagagatccc accgcaatat 1320
gccattcagg tgctggatga gctgacgaaa ggtgaggcaa tcatcgctac tggtgttggg 1380
cagcaccaga tgtgggcggc acaatattac acctacaagc ggccacggca gtggctgtct 1440
tcggctggtc tgggcgcaat gggatttggg ctgcctgctg cagctggtgc ttctgtggct 1500
aacccaggtg tcacagttgt tgatattgat ggggatggta gcttcctcat gaacattcag 1560
gagctggcat tgatccgcat tgagaacctc cctgtgaagg tgatggtgtt gaacaaccaa 1620
catttgggta tggtggtgca atgggaggat aggttttaca aggcgaatag ggcgcataca 1680
tacttgggca acccggaatg tgagagcgag atatatccag attttgtgac tattgctaag 1740
gggttcaata ttcctgcagt ccgtgtaaca aagaagagtg aagtccgtgc cgccatcaag 1800
aagatgctcg agactccagg gccatacttg ttggatatca tcgtcccgca ccaggagcat 1860
gtgctgccta tgatcccaag tgggggcgca ttcaaggaca tgatcctgga tggtgatggc 1920
aggactgtgt attaa 1935
<210> 12
<211> 644
<212> PRT
<213>rice paddy seed JH10 (Oryza sativa Japonica Group JH10)
<400> 12
Met Ala Thr Thr Ala Ala Ala Ala Ala Ala Ala Leu Ser Ala Ala Ala
1 5 10 15
Thr Ala Lys Thr Gly Arg Lys Asn His Gln Arg His His Val Leu Pro
20 25 30
Ala Arg Gly Arg Val Gly Ala Ala Ala Val Arg Cys Ser Ala Val Ser
35 40 45
Pro Val Thr Pro Pro Ser Pro Ala Pro Pro Ala Thr Pro Leu Arg Pro
50 55 60
Trp Gly Pro Ala Glu Pro Arg Lys Gly Ala Asp Ile Leu Val Glu Ala
65 70 75 80
Leu Glu Arg Cys Gly Val Ser Asp Val Phe Ala Tyr Pro Gly Gly Ala
85 90 95
Ser Met Glu Ile His Gln Ala Leu Thr Arg Ser Pro Val Ile Thr Asn
100 105 110
His Leu Phe Arg His Glu Gln Gly Glu Ala Phe Ala Ala Ser Gly Tyr
115 120 125
Ala Arg Ala Ser Gly Arg Val Gly Val Cys Val Ala Thr Ser Gly Pro
130 135 140
Gly Ala Thr Asn Leu Val Ser Ala Leu Ala Asp Ala Leu Leu Asp Ser
145 150 155 160
Val Pro Met Val Ala Ile Thr Gly Gln Val Leu Arg Arg Met Ile Gly
165 170 175
Thr Asp Ala Phe Gln Glu Thr Pro Ile Val Glu Val Thr Arg Ser Ile
180 185 190
Thr Lys His Asn Tyr Leu Val Leu Asp Val Glu Asp Ile Pro Arg Val
195 200 205
Ile Gln Glu Ala Phe Phe Leu Ala Ser Ser Gly Arg Pro Gly Pro Val
210 215 220
Leu Val Asp Ile Pro Lys Asp Ile Gln Gln Gln Met Ala Val Pro Val
225 230 235 240
Trp Asp Thr Ser Met Asn Leu Pro Gly Tyr Ile Ala Arg Leu Pro Lys
245 250 255
Pro Pro Ala Thr Glu Leu Leu Glu Gln Val Leu Arg Leu Val Gly Glu
260 265 270
Ser Arg Arg Pro Ile Leu Tyr Val Gly Gly Gly Cys Ser Ala Ser Gly
275 280 285
Asp Glu Leu Arg Trp Phe Val Glu Leu Thr Gly Ile Pro Val Thr Thr
290 295 300
Thr Leu Met Gly Leu Gly Asn Phe Pro Ser Asp Asp Pro Leu Ser Leu
305 310 315 320
Arg Met Leu Gly Met His Gly Thr Val Tyr Ala Asn Tyr Ala Val Asp
325 330 335
Lys Ala Asp Leu Leu Leu Ala Phe Gly Val Arg Phe Asp Asp Arg Val
340 345 350
Thr Gly Lys Ile Glu Ala Phe Ala Ser Arg Ala Lys Ile Val His Ile
355 360 365
Asp Ile Asp Pro Ala Glu Ile Gly Lys Asn Lys Gln Pro His Val Ser
370 375 380
Ile Cys Ala Asp Val Lys Leu Ala Leu Gln Gly Leu Asn Ala Leu Leu
385 390 395 400
Gln Gln Ser Thr Thr Lys Thr Ser Ser Asp Phe Ser Ala Trp His Asn
405 410 415
Glu Leu Asp Gln Gln Lys Arg Glu Phe Pro Leu Gly Tyr Lys Thr Phe
420 425 430
Gly Glu Glu Ile Pro Pro Gln Tyr Ala Ile Gln Val Leu Asp Glu Leu
435 440 445
Thr Lys Gly Glu Ala Ile Ile Ala Thr Gly Val Gly Gln His Gln Met
450 455 460
Trp Ala Ala Gln Tyr Tyr Thr Tyr Lys Arg Pro Arg Gln Trp Leu Ser
465 470 475 480
Ser Ala Gly Leu Gly Ala Met Gly Phe Gly Leu Pro Ala Ala Ala Gly
485 490 495
Ala Ser Val Ala Asn Pro Gly Val Thr Val Val Asp Ile Asp Gly Asp
500 505 510
Gly Ser Phe Leu Met Asn Ile Gln Glu Leu Ala Leu Ile Arg Ile Glu
515 520 525
Asn Leu Pro Val Lys Val Met Val Leu Asn Asn Gln His Leu Gly Met
530 535 540
Val Val Gln Trp Glu Asp Arg Phe Tyr Lys Ala Asn Arg Ala His Thr
545 550 555 560
Tyr Leu Gly Asn Pro Glu Cys Glu Ser Glu Ile Tyr Pro Asp Phe Val
565 570 575
Thr Ile Ala Lys Gly Phe Asn Ile Pro Ala Val Arg Val Thr Lys Lys
580 585 590
Ser Glu Val Arg Ala Ala Ile Lys Lys Met Leu Glu Thr Pro Gly Pro
595 600 605
Tyr Leu Leu Asp Ile Ile Val Pro His Gln Glu His Val Leu Pro Met
610 615 620
Ile Pro Ser Gly Gly Ala Phe Lys Asp Met Ile Leu Asp Gly Asp Gly
625 630 635 640
Arg Thr Val Tyr
<210> 13
<211> 1935
<212> DNA
<213>rice Jiahua-1 wild type als gene (Oryza sativa Japonica Group)
<400> 13
atggctacga ccgccgcggc cgcggccgcc gccctgtccg ccgccgcgac ggccaagacc 60
ggccgtaaga accaccagcg acaccacgtc cttcccgctc gaggccgggt gggggcggcg 120
gcggtcaggt gctcggcggt gtccccggtc accccgccgt ccccggcgcc gccggccacg 180
ccgctccggc cgtgggggcc ggccgagccc cgcaagggcg cggacatcct cgtggaggcg 240
ctggagcggt gcggcgtcag cgacgtgttc gcctacccgg gcggcgcgtc catggagatc 300
caccaggcgc tgacgcgctc cccggtcatc accaaccacc tcttccgcca cgagcagggc 360
gaggcgttcg cggcgtccgg gtacgcgcgc gcgtccggcc gcgtcggggt ctgcgtcgcc 420
acctccggcc ccggggcaac caacctcgtg tccgcgctcg ccgacgcgct gctcgactcc 480
gtcccgatgg tcgccatcac gggccaggtc ccccgccgca tgatcggcac cgacgccttc 540
caggagacgc ccatagtcga ggtcacccgc tccatcacca agcacaatta ccttgtcctt 600
gatgtggagg acatcccccg cgtcatacag gaagccttct tcctcgcgtc ctcgggccgt 660
cctggcccgg tgctggtcga catccccaag gacatccagc agcagatggc cgtgccggtc 720
tgggacacct cgatgaatct accagggtac atcgcacgcc tgcccaagcc acccgcgaca 780
gaattgcttg agcaggtctt gcgtctggtt ggcgagtcac ggcgcccgat tctctatgtc 840
ggtggtggct gctctgcatc tggtgacgaa ttgcgctggt ttgttgagct gactggtatc 900
ccagttacaa ccactctgat gggcctcggc aatttcccca gtgacgaccc gttgtccctg 960
cgcatgcttg ggatgcatgg cacggtgtac gcaaattatg ccgtggataa ggctgacctg 1020
ttgcttgcgt ttggtgtgcg gtttgatgat cgtgtgacag ggaaaattga ggcttttgca 1080
agcagggcca agattgtgca cattgacatt gatccagcag agattggaaa gaacaagcaa 1140
ccacatgtgt caatttgcgc agatgttaag cttgctttac agggcttgaa tgctctgcta 1200
caacagagca caacaaagac aagttctgat tttagtgcat ggcacaatga gttggaccag 1260
cagaagaggg agtttcctct ggggtacaaa acttttggtg aagagatccc accgcaatat 1320
gccattcagg tgctggatga gctgacgaaa ggtgaggcaa tcatcgctac tggtgttggg 1380
cagcaccaga tgtgggcggc acaatattac acctacaagc ggccacggca gtggctgtct 1440
tcggctggtc tgggcgcaat gggatttggg ctgcctgctg cagctggtgc ttctgtggct 1500
aacccaggtg tcacagttgt tgatattgat ggggatggta gcttcctcat gaacattcag 1560
gagctggcat tgatccgcat tgagaacctc cctgtgaagg tgatggtgtt gaacaaccaa 1620
catttgggta tggtggtgca atgggaggat aggttttaca aggcgaatag ggcgcataca 1680
tacttgggca acccggaatg tgagagcgag atatatccag attttgtgac tattgctaag 1740
gggttcaata ttcctgcagt ccgtgtaaca aagaagagtg aagtccgtgc cgccatcaag 1800
aagatgctcg agactccagg gccatacttg ttggatatca tcgtcccgca ccaggagcat 1860
gtgctgccta tgatcccaag tgggggcgca ttcaaggaca tgatcctgga tggtgatggc 1920
aggactgtgt attaa 1935
<210> 14
<211> 644
<212> PRT
<213>rice Jiahua-1 wild type als gene (Oryza sativa Japonica Group)
<400> 14
Met Ala Thr Thr Ala Ala Ala Ala Ala Ala Ala Leu Ser Ala Ala Ala
1 5 10 15
Thr Ala Lys Thr Gly Arg Lys Asn His Gln Arg His His Val Leu Pro
20 25 30
Ala Arg Gly Arg Val Gly Ala Ala Ala Val Arg Cys Ser Ala Val Ser
35 40 45
Pro Val Thr Pro Pro Ser Pro Ala Pro Pro Ala Thr Pro Leu Arg Pro
50 55 60
Trp Gly Pro Ala Glu Pro Arg Lys Gly Ala Asp Ile Leu Val Glu Ala
65 70 75 80
Leu Glu Arg Cys Gly Val Ser Asp Val Phe Ala Tyr Pro Gly Gly Ala
85 90 95
Ser Met Glu Ile His Gln Ala Leu Thr Arg Ser Pro Val Ile Thr Asn
100 105 110
His Leu Phe Arg His Glu Gln Gly Glu Ala Phe Ala Ala Ser Gly Tyr
115 120 125
Ala Arg Ala Ser Gly Arg Val Gly Val Cys Val Ala Thr Ser Gly Pro
130 135 140
Gly Ala Thr Asn Leu Val Ser Ala Leu Ala Asp Ala Leu Leu Asp Ser
145 150 155 160
Val Pro Met Val Ala Ile Thr Gly Gln Val Pro Arg Arg Met Ile Gly
165 170 175
Thr Asp Ala Phe Gln Glu Thr Pro Ile Val Glu Val Thr Arg Ser Ile
180 185 190
Thr Lys His Asn Tyr Leu Val Leu Asp Val Glu Asp Ile Pro Arg Val
195 200 205
Ile Gln Glu Ala Phe Phe Leu Ala Ser Ser Gly Arg Pro Gly Pro Val
210 215 220
Leu Val Asp Ile Pro Lys Asp Ile Gln Gln Gln Met Ala Val Pro Val
225 230 235 240
Trp Asp Thr Ser Met Asn Leu Pro Gly Tyr Ile Ala Arg Leu Pro Lys
245 250 255
Pro Pro Ala Thr Glu Leu Leu Glu Gln Val Leu Arg Leu Val Gly Glu
260 265 270
Ser Arg Arg Pro Ile Leu Tyr Val Gly Gly Gly Cys Ser Ala Ser Gly
275 280 285
Asp Glu Leu Arg Trp Phe Val Glu Leu Thr Gly Ile Pro Val Thr Thr
290 295 300
Thr Leu Met Gly Leu Gly Asn Phe Pro Ser Asp Asp Pro Leu Ser Leu
305 310 315 320
Arg Met Leu Gly Met His Gly Thr Val Tyr Ala Asn Tyr Ala Val Asp
325 330 335
Lys Ala Asp Leu Leu Leu Ala Phe Gly Val Arg Phe Asp Asp Arg Val
340 345 350
Thr Gly Lys Ile Glu Ala Phe Ala Ser Arg Ala Lys Ile Val His Ile
355 360 365
Asp Ile Asp Pro Ala Glu Ile Gly Lys Asn Lys Gln Pro His Val Ser
370 375 380
Ile Cys Ala Asp Val Lys Leu Ala Leu Gln Gly Leu Asn Ala Leu Leu
385 390 395 400
Gln Gln Ser Thr Thr Lys Thr Ser Ser Asp Phe Ser Ala Trp His Asn
405 410 415
Glu Leu Asp Gln Gln Lys Arg Glu Phe Pro Leu Gly Tyr Lys Thr Phe
420 425 430
Gly Glu Glu Ile Pro Pro Gln Tyr Ala Ile Gln Val Leu Asp Glu Leu
435 440 445
Thr Lys Gly Glu Ala Ile Ile Ala Thr Gly Val Gly Gln His Gln Met
450 455 460
Trp Ala Ala Gln Tyr Tyr Thr Tyr Lys Arg Pro Arg Gln Trp Leu Ser
465 470 475 480
Ser Ala Gly Leu Gly Ala Met Gly Phe Gly Leu Pro Ala Ala Ala Gly
485 490 495
Ala Ser Val Ala Asn Pro Gly Val Thr Val Val Asp Ile Asp Gly Asp
500 505 510
Gly Ser Phe Leu Met Asn Ile Gln Glu Leu Ala Leu Ile Arg Ile Glu
515 520 525
Asn Leu Pro Val Lys Val Met Val Leu Asn Asn Gln His Leu Gly Met
530 535 540
Val Val Gln Trp Glu Asp Arg Phe Tyr Lys Ala Asn Arg Ala His Thr
545 550 555 560
Tyr Leu Gly Asn Pro Glu Cys Glu Ser Glu Ile Tyr Pro Asp Phe Val
565 570 575
Thr Ile Ala Lys Gly Phe Asn Ile Pro Ala Val Arg Val Thr Lys Lys
580 585 590
Ser Glu Val Arg Ala Ala Ile Lys Lys Met Leu Glu Thr Pro Gly Pro
595 600 605
Tyr Leu Leu Asp Ile Ile Val Pro His Gln Glu His Val Leu Pro Met
610 615 620
Ile Pro Ser Gly Gly Ala Phe Lys Asp Met Ile Leu Asp Gly Asp Gly
625 630 635 640
Arg Thr Val Tyr

Claims (10)

1. make plant have Herbicid resistant rice ALS mutein, amino acid sequence as shown in SEQ ID NO:2 or Shown in SEQ ID NO:8 or SEQ ID NO:12；The herbicide is imidazolinone herbicide；The plant is rice or cigarette Grass.
2. nucleic acid or gene encode albumen described in claim 1.
3. nucleic acid according to claim 2 or gene, comprising:
(a) it encodes albumen described in claim 1；Or
(c) its nucleotide sequence is as shown in SEQ ID NO:1 or SEQ ID NO:7 or SEQ ID NO:11.
4. expression cassette, recombinant vector or cell contain nucleic acid described in claim 2 or 3 or gene.
5. albumen described in claim 1, nucleic acid or gene described in claim 2 or 3, expression cassette as claimed in claim 4, The application of recombinant vector or cell in terms of rice or the anti-imidazolinone herbicide of tobacco.
6. obtaining the method with the plant of Herbicid resistant, which comprises the steps of:
1) making plant includes nucleic acid described in claim 2 or 3 or gene；Or
2) plant is made to express albumen described in claim 1；The herbicide is imidazolinone herbicide；The plant is water Rice or tobacco.
7. according to the method described in claim 6, it is characterized in that, it includes crispr gene editing, transgenosis, hybridization, returns Friendship or vegetative propagation step.
8. the method for plant identification, wherein plant is the plant comprising nucleic acid described in claim 2 or 3, expression claim The plant that the plant of albumen described in 1 or any method of claim 6~7 obtain, which is characterized in that including following Step:
1) identify whether the plant includes nucleic acid or gene described in claim 2 or 3；Or,
2) identify whether the plant expresses albumen described in claim 1；The herbicide is imidazolinone herbicide； The plant is rice or tobacco.
9. a kind of method for controlling weeds characterized by comprising the weeding to the crop field application effective dose of long-term cropping Agent, the crop include nucleic acid described in claim 2 or 3 or gene or as claimed in claim 4 up to box, recombinant vector or thin Born of the same parents, the herbicide are imidazolinone herbicide, and the crop is rice or tobacco.
10. a kind of method for protecting the plants from the damage as caused by herbicide characterized by comprising make to plantation The herbicide of the crop field application effective dose of object, the crop include that nucleic acid described in claim 2 or 3 or gene or right are wanted Plant is imported up to box, recombinant vector described in asking 4, the plant after importing generates herbicide resistance proteins, and the herbicide is miaow Oxazoline type herbicides, the plant are rice or tobacco.
CN201711477560.6A 2017-08-03 2017-12-29 Make plant that there is rice ALS mutein and its application of Herbicid resistant Active CN108004224B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/CN2018/082758 WO2019024534A1 (en) 2017-08-03 2018-04-12 Rice als mutant protein for conferring herbicide resistance to plants, and use thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN201710655418X 2017-08-03
CN201710655418.XA CN107217044A (en) 2017-08-03 2017-08-03 Make plant that there is paddy rice ALS muteins and its application of Herbicid resistant

Publications (2)

Publication Number Publication Date
CN108004224A CN108004224A (en) 2018-05-08
CN108004224B true CN108004224B (en) 2019-01-18

Family

ID=59954654

Family Applications (2)

Application Number Title Priority Date Filing Date
CN201710655418.XA Pending CN107217044A (en) 2017-08-03 2017-08-03 Make plant that there is paddy rice ALS muteins and its application of Herbicid resistant
CN201711477560.6A Active CN108004224B (en) 2017-08-03 2017-12-29 Make plant that there is rice ALS mutein and its application of Herbicid resistant

Family Applications Before (1)

Application Number Title Priority Date Filing Date
CN201710655418.XA Pending CN107217044A (en) 2017-08-03 2017-08-03 Make plant that there is paddy rice ALS muteins and its application of Herbicid resistant

Country Status (2)

Country Link
CN (2) CN107217044A (en)
WO (1) WO2019024534A1 (en)

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107217044A (en) * 2017-08-03 2017-09-29 江苏省农业科学院 Make plant that there is paddy rice ALS muteins and its application of Herbicid resistant
CN109097346B (en) * 2018-09-06 2021-07-13 江苏省农业科学院 ALS mutant protein based on gene editing technology and application of ALS mutant protein gene in plant breeding
CN111100852B (en) * 2019-12-16 2021-04-13 中国农业科学院植物保护研究所 Directional mutation method of OsALS1 and crop endogenous gene directed evolution method
CN113005105B (en) * 2019-12-21 2022-07-29 科稷达隆(北京)生物技术有限公司 Herbicide-resistant protein and application thereof in plant breeding
CN111593031B (en) * 2020-05-07 2022-04-08 海南波莲水稻基因科技有限公司 Rice ALS mutant gene, plant transgenic screening vector pCALSm3 containing gene and application thereof
CN112029742B (en) * 2020-08-28 2022-03-15 天津市农业科学院 ALS mutant protein of plant and application thereof
CN112410308B (en) * 2020-11-20 2023-11-10 江苏省农业科学院 Rice ACCase mutant gene and application of rice ACCase mutant gene protein in herbicide resistance of plants
CN112813045B (en) * 2021-02-09 2023-02-28 江苏省农业科学院 Cotton GhALS mutant protein, gene, molecular marker and application thereof
CN115873088B (en) * 2022-11-24 2023-06-27 北京大学现代农业研究院 ALS resistant muteins and uses thereof

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101297040A (en) * 2005-08-24 2008-10-29 先锋高级育种国际公司 Compositions providing tolerance to multiple herbicides and methods of use thereof
CN101565708A (en) * 2002-03-29 2009-10-28 组合化学工业株式会社 Genes encoding acetolactate synthase
CN102559646A (en) * 2011-11-24 2012-07-11 未名兴旺系统作物设计前沿实验室（北京）有限公司 Protein for endowing wheat with herbicide resistance and application of protein in plant breeding
CN105695493A (en) * 2016-04-12 2016-06-22 江苏省农业科学院 Application of ALS mutant type genes in aspect of herbicide resistance
CN105779479A (en) * 2016-04-12 2016-07-20 江苏省农业科学院 ALS mutant type gene and application thereof in herbicide resistance
CN106867977A (en) * 2017-01-20 2017-06-20 湖南杂交水稻研究中心 A kind of rice herbicide resistant protein and gene and its application

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001085970A2 (en) * 2000-05-10 2001-11-15 Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College Resistance to acetohydroxyacid synthase-inhibiting herbicides
CN107217044A (en) * 2017-08-03 2017-09-29 江苏省农业科学院 Make plant that there is paddy rice ALS muteins and its application of Herbicid resistant

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101565708A (en) * 2002-03-29 2009-10-28 组合化学工业株式会社 Genes encoding acetolactate synthase
CN101297040A (en) * 2005-08-24 2008-10-29 先锋高级育种国际公司 Compositions providing tolerance to multiple herbicides and methods of use thereof
CN102559646A (en) * 2011-11-24 2012-07-11 未名兴旺系统作物设计前沿实验室（北京）有限公司 Protein for endowing wheat with herbicide resistance and application of protein in plant breeding
CN105695493A (en) * 2016-04-12 2016-06-22 江苏省农业科学院 Application of ALS mutant type genes in aspect of herbicide resistance
CN105779479A (en) * 2016-04-12 2016-07-20 江苏省农业科学院 ALS mutant type gene and application thereof in herbicide resistance
CN106867977A (en) * 2017-01-20 2017-06-20 湖南杂交水稻研究中心 A kind of rice herbicide resistant protein and gene and its application

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
A Sulfonylurea Herbicide Resistance Gene from Arabidopsis thaliana as a New Selectable Marker forProduction of Fertile Transgenic Rice Plants;Zhijian Li et al.;《Plant Physiol.》;19921231;第100卷;第662-668页 *
Development and Genetic Characterization of A Novel Herbicide (Imazethapyr) Tolerant Mutant in Rice (Oryza sativa L.);D. Shoba et al.;《Rice》;20170404;第10卷;第1-12页 *
Oryza sativa Indica Group biotype Lon-2 acetolactate synthase (ALS) gene, complete cds，ACCESSION NO：EU548085.1;Sales,M.A.et al.;《GenBank》;20080701;全文 *
乙酰乳酸合成酶及ALS基因研究概述;任洪雷;《中国农学通报》;20161231;第32卷(第26期);第37-42页 *
油菜乙酰乳酸合成酶抑制剂类除草剂抗性突变体M9的遗传和基因克隆;胡茂龙等;《中国农业科学》;20121231;第45卷(第20期);第4326-4334页 *

Also Published As

Publication number Publication date
WO2019024534A1 (en) 2019-02-07
CN108004224A (en) 2018-05-08
CN107217044A (en) 2017-09-29

Similar Documents

Publication Publication Date Title
CN108004224B (en) Make plant that there is rice ALS mutein and its application of Herbicid resistant
CN105755024B (en) ALS mutated genes and its albumen and application
CN107964543B (en) Rice herbicide resistance ALS mutein, nucleic acid and its application
CN105779479B (en) A kind of ALS mutated genes and its application in terms of antiweed
CN109097346A (en) Application based on the ALS mutein and its gene of gene editing technology in plant breeding
CN107245480B (en) Acetolactate synthase mutant protein with herbicide resistance and application thereof
CN109371000B (en) Rice ACCase mutant type gene and application thereof in herbicide resistance of plants
CN108359646A (en) Make plant that there is ACCase muteins and its application of Herbicid resistant
CN105695493A (en) Application of ALS mutant type genes in aspect of herbicide resistance
CN107090447A (en) Make plant that there is paddy rice ALS muteins, gene and its application of Herbicid resistant
CN105734071A (en) ALS mutant gene and application of protein thereof to herbicide resistance
CN106755019B (en) A kind of application of wheat ALS mutated genes and its albumen in terms of antiweed
CN109082416A (en) ACCase mutated genes and albumen and its application with Herbicid resistant
CN107022540B (en) Wheat ALS mutant protein and gene for endowing plants with herbicide resistance and application thereof
CN113265401B (en) Method for improving resistance of rice to HPPD inhibitor herbicide through gene editing and special sgRNA thereof
CN112410308B (en) Rice ACCase mutant gene and application of rice ACCase mutant gene protein in herbicide resistance of plants
CN106591334B (en) A kind of wheat ALS mutated genes and its application in terms of antiweed
CN106636028A (en) Rice protein with imidazolinone herbicide resistance activity and coding gene and application of rice protein
CN106868027B (en) Japonica rice ALS mutant gene and application of protein thereof in herbicide resistance
CN113755457B (en) Herbicide-resistant acetyl coenzyme A carboxylase mutant and application thereof
CN107354139A (en) Wheat ALS muteins, nucleic acid and its application
CN114032218A (en) Novel herbicide-resistant acetyl coenzyme A carboxylase mutant and application thereof
CN106868028B (en) ALS mutant gene of japonica rice, protein and application thereof
CN106434714B (en) A kind of wheat ALS mutated genes and its albumen and application
US20030115638A1 (en) Plants having increased amino acids content and methods for producing the same

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant