CN101297040A - Compositions providing tolerance to multiple herbicides and methods of use thereof - Google Patents

Abstract

Methods and compositions are provided related to improved plants that are tolerant to more than one herbicide. Particularly, the invention provides plants that are tolerant of glyphosate and are tolerant to at least one ALS inhibitor, and methods of use thereof. The glyphosate/ALS inhibitor-tolerant plants comprise a polynucleotide that encodes a polypeptide that confers tolerance to glyphosate and a polynucleotide that encodes an ALS inhibitor-tolerant polypeptide. In specific embodiments, a plant of the invention expresses a GAT polypeptide and an HRA polypeptide. Methods to control weeds, improve plant yield, and increase transformation efficiencies are provided.

Description

Composition and its using method to the tolerance of multiple weedicide are provided

Invention field

The present invention is a biology field.More specifically, the present invention relates to the sequence by expressing the conferring glyphosate tolerance and express the multiple herbicide tolerant that at least a other herbicide tolerant gene is given.

Background of invention

In the commercial production of crop, people wish to eliminate easily and apace from the crop plants field undesired plant (that is, " weeds ").But it will be can be applied to whole field will only eliminate undesired plant and stay the processing of harmless crop plants that ideal is handled.A kind of this type of treatment system will be referred to use the crop plants of herbicide-tolerant, thereby on the crop plants of herbicide spray in herbicide tolerant the time, crop plants grows vigorously continuing, but not the herbicide tolerant weeds will be killed or be badly damaged.Ideally, this type of treatment system will be utilized different weedicide character, make weeds control that best may the making up of handiness and economy can be provided.For example, various weedicides have the different life-spans in the field, and some weedicides after being applied to the field in the long relatively time lasting exist and effectively, and some other weedicide resolves into other and/or non-active compound fast.The ideal treatment system will allow to use different weedicides, thereby the grower can be at the selection of particular case customization to weedicide.

Can be genetically engineered in crop by herbicide metabolism enzyme and/or the insensitive herbicidal target target that will encode suitable, give crop tolerance at particular herbicide.In some cases, these enzymes and their nucleic acid of coding are from plant.Under some other situation, they are from other biology, as microorganism.For example see Padgette et al. (1996) " New weed controlopportunities:Development of soybeans with a Roundup Ready

Gene " and Vasil (1996) " Phosphinothricin-resistant crops, " is at Herbicide-Resistant Crops, and (CRC Press, Boca Raton is Florida) among pp.54-84 and the pp.85-91 for ed.Duke.In fact, transgenic plant have been carried out through engineering approaches, to express multiple herbicide tolerant gene, comprise the gene (Shiota et al. (1994) Plant Physiol.106:17) of the chimeric protein of coding rat cell cytochrome p 450 7A1 and yeast NADPH-Cytochrome P450 oxydo-reductase from multiple biology.Other gene of conferring herbicide tolerance comprises: acetohydroxy acid synthase (" AHAS "), have been found that the sudden change in this native sequences gives resistance to polytype weedicide to the plant of expressing it, described sudden change be introduced in the various plants (for example see Hattori et al. (1995) Mol.Gen.Genet.246:419), glutathione reductase and superoxide-dismutase (Aono et al. (1995) Plant Cell Physiol.36:1687); Gene (Datta et al. (1992) Plant Mol.Biol.20:619) with multiple phosphotransferase.

A kind of weedicide that has been widely studied is the N-phosphonomethylglycine, and it is commonly referred to as glyphosate.Glyphosate is a broad-spectrum herbicide, it can kill broad leaved plant and grass owing to inhibitory enzyme 5-enol acetonyl shikimic acid-3-phosphate synthase (being also referred to as " EPSP synthase " or " EPSPS "), and 5-enol acetonyl shikimic acid-3-phosphate synthase is a part that produces the biosynthetic pathway of aromatic amino acid, hormone and microorganism.Produced glyphosate resistant transgenic plants, it is owing to introducing the glyphosate resistance level that modified edaphic bacillus (Agrobacterium) CP4 EPSPS demonstrates viable commercial.This modified enzyme is by in the target chloroplast(id), and in chloroplast(id), even there is glyphosate, it also can continue from phosphoenolpyruvic acid (" PEP ") and the synthetic EPSP of shikimic acid-3-phosphoric acid.CP4 glyphosate resistance soybean transgene plant current by commercial applications (for example, by Monsanto with title " Roundup Ready

" sell).

Other comprises careless ammonium phosphine (phosphinothricin) and acetolactate synthase (ALS) chemistry for commercial crops production significant herbicide, as sulfonylurea herbicide.Grass ammonium phosphine is a broad-spectrum herbicide, and it acts on the chloroplast(id) glutamate synthase.Produced the glufosinate tolerant transgenic plant, it carries the bar gene from streptomyces hygroscopicus (Streptomyces hygroscopicus).It is active and careless ammonium phosphine modified and detoxify that the enzyme of Bar genes encoding has the N-acetylize.Grass ammonium phosphine tolerance plant current by commercial applications (for example, by Bayer with title " Liberty Link

" sell).Sulfonylurea herbicide suppresses the higher plant growth by blocking-up acetolactate synthase (ALS).In ALS, contain the plant tolerance ALS weedicide of specific sudden change, comprise sulfonylurea.Thereby, for example, sulfonylurea herbicide such as Synchrony (mixture of chlorimuronethyl and thiameturonmethyl) can with ALS herbicide tolerant plant such as STS

Soybean (Synchrony tolerates soybean) kind is used in combination, and described kind contains the proterties of enhancing soybean to the natural tolerance of soybean sulfonylurea herbicide.

Although currently can obtain multiple herbicide tolerant crop plants by commercial sources, the problem that many commercial herbicides and weedicide/crop combination cause is: typically, each weedicide has incomplete activity profile to common weeds kind.Be used each weedicide of for some time for majority, the colony of herbicide-resistant weeds kind and biotype has become generally and (has for example seen Tranel and Wright (2002) Weed Science 50:700-712; Owen and Zelaya (2005) Pest/Manag.Sci.61:301-311).Described anti-more than one weedicide transgenic plant (see, for example, WO2005/012515).Yet, still continue to select, the improvement of each aspect of the raising of the prolongation of residual weeds control and crop yield in crop production, weeds control.

Particularly, because the part and the regional disparity of main weeds kind and preferred crop species, people need the following custom-built system to Crop protection and weeds processing always, and described system can adapt to the needs of concrete area, geography and/or locality.For example, the following method that people need Crop protection and weeds to handle always, described method can reduce: the essential weedicide number of applications of control weeds in field; The amount of the weedicide that the control weeds in field is essential; Produce essential the cultivating of crop (tilling) amount; And/or postpone or prevent and/or occur the program of herbicide-resistant weeds.The following method that people need Crop protection and weeds to handle always, described method allow the directed particular herbicide combination of using.

Summary of the invention

The invention provides following method and composition, it relates to weedicide or the class of weedicide or the improvement plant of subclass that tolerates more than one.Composition comprises tolerance glyphosate and the class of at least a other weedicide or weedicide or the plant of subclass, with and using method.Extra composition comprises following plant, and described plant comprises the polynucleotide of polypeptide of coding conferring glyphosate tolerance and the polynucleotide of coding ALS inhibitor tolerance polypeptide.In a non-limiting embodiments, composition comprises the polynucleotide of expressing coding GAT (glyphosate-N-acetyl-transferase) polypeptide and tolerates the plant of at least a extra weedicide.In some embodiments, expression of plants GAT polypeptide of the present invention and HRA polypeptide.

The invention provides and use method for weed in the plant control of the present invention cultivation area.Improved method for transformation also is provided.

The accompanying drawing summary

Fig. 1 provides the example of the construct with 35S enhancer element.

Fig. 2 provides and has shown the synoptic diagram of 35S enhanser to the influence of TX efficient.

Fig. 3 provides and has shown the synoptic diagram of 35S enhanser to the influence of T0 efficient.

Fig. 4 provides and has shown the synoptic diagram of 35S enhanser to the influence of incident copy number.

Fig. 5 provides and has shown the form of 35S enhanser to the influence of T2 efficient.

Fig. 6 provides killing gene assess and determine method.

Fig. 7 provides the synoptic diagram of the exploitation that shows the GAT selection scheme.

Fig. 8 shows GAT can be used as selective marker.

Fig. 9 provides the synoptic diagram that shows the GAT transformation efficiency.

Detailed Description Of The Invention

The invention provides for the preparation of with the method and composition that uses plant, described Plant Tolerance more than one herbicide or class or the subclass of herbicide. The plant of tolerance glyphosate and at least a other herbicide (or the class of herbicide or subclass) or other chemicals (the perhaps class of other chemicals or subclass) is provided in some embodiments. This type of plant can be used for: for example, relate in the method for processing with multiple herbicide, make crop plants growth. Thereby, the invention provides improved plant, its herbicide-tolerant or combinations of herbicides (comprise the combinations of herbicides by different mode of action effects, namely, application have 2,3,4 or the mixture of more herbicide action modes) or the combination of at least a herbicide and at least a other chemicals, described chemicals comprises fungicide, insecticide, plant growth regulator etc. By this way, the invention provides and make improving one's methods of plant growth, wherein weeds are selectively controlled. In one embodiment, plant of the present invention comprises the polynucleotides of polypeptide of coding conferring glyphosate tolerance and the polynucleotides of coding ALS inhibitor tolerance polypeptide. As further discussed in detail, this type of plant is known as " glyphosate/ALS inhibitor tolerance plant " in this article.

Plant of the present invention demonstrates the tolerance to the modification of herbicide, therefore and allow to use herbicide with the ratio that will significantly injure plant, and further allow with the concentration that is lower than common application but the concentration that still continues the Selective Control weeds is used Herbicidal mixtures. In addition, glyphosate of the present invention/ALS inhibitor tolerance plant can admix technical combinations with herbicide uses, thereby so that the application of chemical insecticide is more convenient for the producer, economy and effective. Situation for glyphosate/ALS inhibitor tolerance crop; the blending technology will tolerate crop combination with glyphosate of the present invention/ALS inhibitor; this technology for example provides the crop protection products of the ALS herbicide of easy preparation with the form (can send the custom mix thing that design solves particular problem) of dry granula. The effective ALS tolerance that provides by adding plant of the present invention, the effectiveness of ALS herbicide is further brought into play, and replys thereby eliminate the herbicide crop. Can design now and these unique selective herbicides of customization and glyphosate disclosed herein/ALS inhibitor tolerance crop coupling, to satisfy changing weeds control needs. This breakthrough is so that can provide now countless herbicide admixtures, for example comprise, ALS inhibitor admixture, can be customized it, for improvement of weeds process (because ALS inhibitor chemistry has different herbicide attributes), the weeds scope that comprises increase, the ability of specific residual activity is provided, the second mode of action (is supplied glyphosate to resist or to postpone Weed Resistance, grass ammonium phosphine etc.), and new supply, its can be used as before the appearance (pre-emergence) or occur after (post-emergence) or both all design. Fusion also provides the ability of adding or mixing other agricultural chemicals extra herbicide of the third or the 4th kind of mechanism of action (as have) with normal mark utilization rate, with fill the scope breach or even comprise the ability of fungicide, insecticide, plant growth regulator etc., thereby save the expense relevant with additional application. As further discussed in detail, can be customized method of the present invention for particular location or area. Improved method for transformation also is provided.

I. glyphosate/ALS inhibitor tolerates plant

A. glyphosate tolerant

The invention provides plant, it comprises the polynucleotide of polypeptide of coding conferring glyphosate tolerance and the polynucleotide of coding ALS inhibitor tolerance polypeptide.The multiple sequence of conferring glyphosate tolerance can be used for method and composition of the present invention.

In one embodiment, the polynucleotide that have a transferase active by expression provide glyphosate resistance mechanism.As used herein; " transferring enzyme " polypeptide can will be transferred to the N of glyphosate from the acyl group of acetyl-CoA; the propionyl of propionyl coenzyme A is transferred to the N of glyphosate, and perhaps catalysis glyphosate analogue and/or glyphosate metabolite are as the acetylize of aminomethylphosphonic acid.Measure among U. S. application number 10/835,615, WO2005/012515, WO2002/36782 and the WO2003/092360 that this active method is disclosed in U.S.'s publication No. 2003/0083480 for example, application April 29 in 2004/0082770,2004 of U.S.'s publication No..In one embodiment, described transferring enzyme polypeptide comprises glyphosate-N-acetyl-transferase " GAT " polypeptide.

Ground as used herein, GAT polypeptide or enzyme comprise and have glyphosate-polypeptide of N-acetyl-transferase activity (" GAT " activity), i.e. the polypeptide of the acetylizad ability of catalysis glyphosate.In some specific embodiments, has the N that the active polypeptide of glyphosate-N-acetyl-transferase can be transferred to the ethanoyl of acetyl-CoA glyphosate.In addition, some GAT polypeptide are transferred to the propionyl of propionyl coenzyme A the N of glyphosate.Some GAT polypeptide can also catalysis glyphosate analogue and/or the acetylize of glyphosate metabolite (as aminomethylphosphonic acid).The feature of GAT polypeptide is their structural similarities each other, for example, and the sequence similarity when the GAT polypeptide is compared mutually.Exemplary GAT polypeptide and polynucleotides encoding them are known in the art, it especially is disclosed in the U. S. application number 10/004 of application on October 29 calendar year 2001 for example, 357, the Application No. 10/427 of application on April 30th, 2003,692, with the Application No. 10/835,615 of application on October 29th, 2004, with they all complete by reference this paper that incorporates into.In some embodiments, the GAT polypeptide that is used for producing plant of the present invention comprises SEQ ID NO:5,14,11,8,21,27,17,24,30,35,46,47,48,49,50,51,52,53,39,42,45 or 54 aminoacid sequences that provide.Each of these sequences also is disclosed in the U. S. application number 10/835,615 of on April 29th, 2004 application.In some embodiments, use the GAT polynucleotide of the correspondence of these polypeptide of coding; These polynucleotide sequences provide in SEQ ID NO:3,12,9,6,19,15,25,22,28,33,4,7,10,13,16,18,20,23,26,29,32,34,36,38,41,44,43,56,31,37,40,57,58,59,60,61,62,63 or 64.Each of these sequences also is disclosed in the U. S. application number 10/835,615 of on April 29th, 2004 application.Further go through ground as this paper other places, the present invention also comprises fragment or the variant that uses GAT polynucleotide and other known herbicide tolerant polynucleotide and their encoded polypeptides.

In some particular, glyphosate of the present invention/ALS inhibitor tolerance expression of plants GAT polypeptide promptly has the active polypeptide of glyphosate-N-acetyl-transferase, and wherein the ethanoyl of acetyl-CoA is transferred to the N of glyphosate.Thereby the plant of the present invention of handling with glyphosate contains glyphosate metabolite N-ethanoyl glyphosate (" NAG ").Thereby the present invention also provides plant that contains NAG and the method that produces NAG by the plant that contains GAT gene (that is, expressing the GAT polypeptide) with the glyphosate processing.The existence of N-ethanoyl glyphosate can be used as the diagnostic flag of the existence of active GAT gene in the plant, can be assessed it by method as known in the art, for example, carries out by mass spectroscopy or by immunoassay.Usually, the activity of the NAG level in the plant that contains the GAT gene of having handled with glyphosate and GAT gene is relevant with the amount of the glyphosate that is used to handle plant.

Plant of the present invention can comprise many GAT polynucleotide (for example, at least 1,2,3,4,5,6 or more).Recognize if use many GAT polynucleotide, the GAT polynucleotide GAT polypeptide that can encode and have the different dynamic mathematic(al) parameter so, that is, and have low Km the GAT variant can with have higher k _CatVariant combination.In some embodiments, different polynucleotide can be coupled on chloroplast transit sequence or other signal sequence, be provided at the secretion of different cellular compartments, the expression of polypeptides in the organoid or one or more polypeptide thus.

The GAT polypeptide of GAT polynucleotide encoding is compared the enzymatic activity with raising with the enzyme of former evaluation.Can use conventional kinetic parameter k _Cat, K _MAnd k _Cat/ K _MCharacterize enzymatic activity.Can think k _CatBe the tolerance of acetylize speed, especially under high concentration of substrate; K _MBe the tolerance of GAT enzyme to the avidity of its substrate (for example, acetyl-CoA, propionyl coenzyme A and glyphosate); k _Cat/ K _MBe the tolerance of catalytic efficiency, it considers substrate avidity and catalytic rate.Concentration at substrate is to the situation of small part speed limit, k _Cat/ K _mBe even more important.Usually, has higher k _CatOr k _CatThe GAT of/KM is than having low k _CatOr k _Cat/ K _MThe more effective catalyzer of another GAT.Has low K _MGAT be than having higher K _MThe more effective catalyzer of another GAT.Thereby, more effective in order to determine a kind of GAT release to birth ratio another kind, can compare the kinetic parameter of two kinds of enzymes.k _Cat, k _Cat/ K _MAnd K _MRelative importance will (for example, glyphosate be with respect to the K of glyphosate along with expecting the situation of performance function _MExpection effective concentration) and become.Can characterize the GAT activity according to any functional character, described functional character includes but not limited to: stability, the susceptibility to suppressing, perhaps activated by other molecule.

Thereby for example, the GAT polypeptide can have the lower K at glyphosate of enzyme that identified than in the past _M, for example, less than 1mM, 0.9mM, 0.8mM, 0.7mM, 0.6mM, 0.5mM, 0.4mM, 0.3mM, 0.2mM, 0.1mM, 0.05mM, or littler.The GAT polypeptide can have than the enzyme of identifying in the past higher, at the k of glyphosate _Cat, for example, 500min at least ^-1, 1000min ^-1, 1100min ^-1, 1200min ^-1, 1250min ^-1, 1300min ^-1, 1400min ^-1, 1500min ^-1, 1600min ^-1, 1700min ^-1, 1800min ^-1, 1900min ^-1Or 2000min ^-1Or higher k _CatBe used for GAT polypeptide of the present invention and can have the enzyme k higher that identified than in the past glyphosate _Cat/ K _M, for example, 1000mM at least ^-1Min ^-1, 2000mM ^-1Min ^-1, 3000mM ^-1Min ^-1, 4000mM ^-1Min ^-1, 5000mM ^-1Min ^-1, 6000mM ^-1Min ^-1, 7000mM ^-1Min ^-1Or 8000mM ^-1Min ^-1, or higher k _Cat/ K _MThe GAT enzymic activity is subjected to for example influence of pH and salt concn; Suitable measuring method and condition be known in the art (see, for example, WO2005012515).This type of improved enzyme can specifically be used for the method that the field makes plant growth, if the activity of described enzyme (that is k, wherein _Cat, K _MOr k _Cat/ K _M) lower, the use of the combination of particular herbicide or weedicide and/or other agricultural chemicals will cause the injury to plant so.

Also can to increase the ability that produces higher levels of 5-enol acetonyl shikimic acid-3-phosphonic acids synthase (EPSPS), produce the glyphosate tolerance plant, by plant is modified as U.S. Patent number 6,248,876,5,627,061,5,804,425,5,633,435,5,145,783,4,971,908,5,312,910,5,188,642,4,940,835,5,866,775,6,225,114,6,130,366,5,310,667,4,535,060,4,769,061,5,633,448,5,510,471, Re.36,449, RE 37,287 E and 5,491,288 and international publication WO 97/04103, WO 00/66746, among WO01/66704 and the WO 00/66747 more complete as described in, by reference with these documents for the complete this paper that incorporates into of all purposes.Glyphosate resistance can also be given the plant of the gene of expressing the coding glyphosate oxidoreductase, as at U.S. Patent number 5,776,760 and 5,463,175 more complete as described in, by reference with it for the complete this paper that incorporates into of all purposes.In addition, the sudden change of natural generation that also can be by selecting the conferring glyphosate tolerance produces the glyphosate tolerance plant.

Will be appreciated that, the sequence that method and composition of the present invention can use conferring glyphosate tolerance as known in the art (promptly, sequence by identical or different mode effect) any combination has the plant and the plant explants of good glyphosate resistance with generation.

B. acetolactate synthase (ALS) inhibitor tolerance

The invention provides glyphosate/ALS inhibitor tolerance plant, it comprises the polynucleotide of the polypeptide of coding conferring glyphosate tolerance, and comprises the polynucleotide of encoding acetolactate synthase (ALS) inhibitor tolerance polypeptide.Ground as used herein, " ALS inhibitor tolerance polypeptide " is included in any polypeptide of giving when expressing in the plant the tolerance of at least a ALS inhibitor.Multiple ALS inhibitor is known, and it for example comprises, sulfonylurea, imidazolone, triazolo pyrimidine, pyrimidyl (sulfo-) phenylformic acid, and/or sulfonyl amino carbonyl triazolinone herbicide.Extra ALS inhibitor is known, and it is open in this paper other places.Known in the art: ALS sudden change aspect the benzoic tolerance of sulfonylurea, imidazolone, triazolo pyrimidine and pyrimidyl (sulfo-), be divided into three kinds different classes of, comprise the sudden change with following feature: (1) is this wide tolerance of four groups to all; (2) tolerance imidazolone and pyrimidyl (sulfo-) phenylformic acid; (3) tolerance sulfonylurea and triazolo pyrimidine; (4) tolerance sulfonylurea and imidazolone.

Can use multiple ALS inhibitor tolerance polypeptide.In some embodiments, ALS inhibitor tolerance polypeptide contains at least one coding mutation, and it causes an amino acid change in the ALS polypeptide.In specific embodiments, change occur in acetolactate synthase seven basically in the district of conserved regions.For example see, Hattori et al. (1995) Molecular Geneticsand Genomes 246:419-425, Lee et al. (1998) EMBO Journal 7:1241-1248, Mazur et al. (1989) Ann.Rev.Plant Phys.40:441-470 and U.S. Patent number 5,605,011, with they complete by reference this paper that incorporates into.ALS inhibitor tolerance polypeptide can for example be encoded by SuRA or the SuRB locus of ALS.In some particular, ALS inhibitor tolerance polypeptide comprises C3 ALS mutant, HRA ALS mutant, S4 mutant or S4/HRA mutant or its any combination.The tolerance to different weedicides and weedicide group (and/or subgroup) is given in difference sudden change among the known ALS; For example see Tranel and Wright (2002) Weed Science 50:700-712.Also see U.S. Patent number 5,605,011,5,378,824,5,141,870 and 5,013,659, with they all complete by reference this paper that incorporates into.Also see, comprise the SEQ ID NO:65 of soybean HRA sequence; The SEQID NO:66 that comprises corn HRA sequence; The SEQ ID NO:67 that comprises Arabidopis thaliana HRA sequence; With the SEQ ID NO:86 that comprises the HRA that is used for cotton.HRA sudden change among the ALS can specifically be used for one embodiment of the invention.Described sudden change causes producing following acetolactate synthase polypeptide, and it compares anti-at least a ALS inhibitor chemical action with wild-type protein.For example; the plant of expressing ALS inhibitor tolerance polypeptide can tolerate sulfonylurea, imidazolone, triazolo pyrimidine, pyrimidyl (sulfo-) phenylformic acid of doses; and/or the sulfonyl amino carbonyl triazolinone herbicide, described dosage is to cause at least 2,3,4,5,6,7,8,9,10,15,20,25,30,35,40,50,70,80,100,125,150,200,500 or 1000 times high of weedicide dosage of the injury of suitable control plant.In some embodiments, ALS inhibitor tolerance polypeptide comprises many sudden changes.In addition, the sudden change of the natural generation by selecting the conferring glyphosate tolerance can produce the plant with ALS inhibitor polypeptide.

In some embodiments, ALS inhibitor tolerance polypeptide is given the tolerance to sulfonylurea and imidazolidinone weedicide.Sulfonylurea and imidazolidinone weedicide suppress the growth of higher plant by blocking-up acetolactate synthase (ALS) (being also referred to as acetohydroxy acid synthase (AHAS)).For example, the plant that contains specific sudden change (for example, S4 and/or HRA sudden change) in ALS also tolerates sulfonylurea herbicide.To the production of sulfonylurea tolerant plants and imidazolinone-tolerant plant at U.S. Patent number 5,605,011,5,013,659,5,141,870,5,767,361,5,731,180,5,304,732,4,761,373,5,331,107,5,928,937; With 5,378,824 and international publication WO 96/33270 in by more complete description, incorporate these documents into this paper for all purposes by reference.In some particular, ALS inhibitor tolerance polypeptide comprises sulphonamide-tolerance acetolactate synthase (being also referred to as sulphonamide-tolerance acetohydroxy acid synthase) or imidazolinone-tolerant acetolactate synthase (being also referred to as the imidazolinone-tolerant acetohydroxy acid synthase).

At least a sequence that comprises the conferring glyphosate tolerance of the present invention is known as " glyphosate/ALS inhibitor tolerant plants " in this article with the plant of giving at least a sequence of ALS inhibitor tolerance.The plant that contains at least a GAT polypeptide and at least a HRA polypeptide of the present invention is known as " GAT-HRA plant " in this article.

C. extra herbicide tolerant

In some embodiments, the invention provides and have to the enhanced tolerance of glyphosate and at least a ALS inhibitor weedicide with to the plant of the tolerance of at least a extra weedicide.In specific embodiments, be to cause to the tolerance of extra weedicide by at least a polypeptide expression of giving at the resistance of this extra weedicide.In some embodiments, composition of the present invention (for example, plant) can comprise 2,3,4,5,6,7 or more kinds of proterties, described proterties is given the tolerance at least a weedicide, thereby plant of the present invention can tolerate at least 2,3,4,5,6 or 7 kind or how dissimilar weedicides.Thereby the plant of the present invention that tolerates two or more different weedicides can tolerate the weedicide with the different modes of action and/or different action sites.In some embodiments, all these proterties all are the transgenosis proterties, and in other embodiments, at least a of these proterties is not genetically modified.

In some of these embodiments, every kind of herbicide tolerant gene is given at the class of different weedicides or weedicide or the tolerance of subclass.In some of these embodiments, at least two kinds of herbicide tolerant genes are given the tolerance to the weedicide member of identical weedicide or same item or subclass.Therefore, following plant also is provided, described plant has the polynucleotide of the polypeptide that coding can the conferring glyphosate tolerance and the polynucleotide of coding ALS inhibitor tolerance polypeptide, and can comprise at least a extra herbicide tolerant polynucleotide, when expressing, it gives tolerance to extra weedicide.This type of extra weedicide includes but not limited to, acetyl-CoA carboxylase inhibitor, as quizalofop-P-ethyl, the synthetic plant hormone, as quinclorac, proporphyrinogen oxidase (PPO) inhibitor weedicide (as sulfentrazone), pigment synthetic inhibitor weedicide, as the hydroxyphenylpyruvate dioxygenase inhibitor (for example, Mesotrione (mesotrione) or sulphur humulone (sulcotrione)), phosphinothricin acetyl transferase or phytoene desaturase inhibitor are as general grass gram (diflufenican) or pigment synthetic inhibitor.Should be appreciated that the present invention is not subjected to the restriction of herbicide action mechanism, get final product as long as can realize the purpose of the present invention herbicide tolerant of glyphosate and at least a ALS inhibitor (that is, to).Extra purpose weedicide is disclosed in this paper other places.

In some embodiments, composition of the present invention also comprises the polypeptide of giving at the tolerance of the weedicide that suppresses glutamine synthase such as phosphinothricin or careless ammonium phosphine (for example, bar gene or pat gene).Glutamine synthetase (GS) looks like the basic enzyme of most vegetable cells growths and life necessity, and the inhibitor of GS is deleterious to vegetable cell.Developed careless ammonium phosphine weedicide based on the toxic effect that produces owing to the inhibition of GS in plant.These weedicides are nonselective; It is the growth that they suppress current all different types of plants.To the exploitation of the plant that contains the external source phosphinothricin acetyl transferase at U.S. Patent number 5,969,213,5,489,520,5,550,318,5,874,265,5,919,675,5,561,236,5,648,477,5,646,024,6,177,616 and 5, describe to some extent in 879,903, for all purposes by reference with they complete this paper that incorporates into.Phosphinothricin acetyl transferase with this active sudden change is also disclosed.

Go back in some embodiments at other, composition of the present invention also comprises the polypeptide of giving at the tolerance of the weedicide that suppresses protox (proporphyrinogen oxidase).Protox is that generation chlorophyll is essential, and chlorophyll is that all plants survivals are essential.The Protox enzyme is used as the target of multiple herbicidal compounds.These weedicides also suppress the growth of current all different types of plants.The exploitation that resists the active plant of protox that changes containing of these weedicides is at U.S. Patent number 6,288, and 306,6,282,837 and 5,767,373 and international publication WO 01/12825 in describe to some extent, for all purposes by reference with they complete this paper that incorporates into.

In other embodiments, composition of the present invention can comprise the polypeptide of other pattern that relates to Herbicid resistant.For example, hydroxyphenylpyruvate dioxygenase is catalysis, and wherein right-hydroxyphenylpyruvic acid (HPP) is converted into the enzyme of the reaction of homogentisic acid.Suppress this enzyme and be used as weedicide so that suppress HPP to the molecule of the conversion of homogentisic acid in conjunction with this enzyme.The plant that some weedicide is had more resistance is described in U.S. Patent number 6,245, and 968,6,268,549; With 6,069,115 and international publication WO99/23886 in, for all purposes by reference with they complete this paper that incorporates into.The invention also discloses hydroxyphenylpyruvate dioxygenase with this active sudden change.

D. the sequence fragment of conferring herbicide tolerance and variant

Depend on context, " fragment " refers to part or the part of aminoacid sequence and the part of its encoded protein matter of polynucleotide.The fragment of polynucleotide can be encoded and be kept the original proteinic biological activity and the therefore protein fragments of conferring herbicide tolerance.Thereby the fragment of nucleotide sequence can be at least about 20 Nucleotide, about 50 Nucleotide, about 100 Nucleotide, and the total length of the polynucleotide of the herbicide tolerant polypeptide of nearly encoding.

The herbicide tolerant polynucleotide passage of the biologically-active moiety of coding herbicide tolerant polypeptide at least 15,25,30,50,100,150,200 or 250 continuous amino acids of will encode perhaps reach the amino acid whose sum that exists in the total length herbicide tolerant polypeptide.Can be by separating the part of herbicide tolerant polynucleotide, the encoding part of expression herbicide tolerant polypeptide (for example, pass through in-vitro recombination expression), and the activity of the encoding part of assessment herbicide tolerant polypeptide prepares the biologically-active moiety of herbicide tolerant polypeptide.Segmental polynucleotide at the herbicide tolerant polynucleotide comprise at least 16,20,50,75,100,150,200,250,300,350,400,450,500,550,600,650,700,800,900,1,000,1,100,1,200,1,300 or 1,400 continuous nucleotides perhaps reach the Nucleotide sum that exists in the total length herbicide tolerant polynucleotide.

Term " variant " refers to similar basically sequence.For polynucleotide, variant is included in 5 ' and/or 3 ' end and has disappearance (being brachymemma); One or more inner sites disappearance and/or add one or more Nucleotide in natural polynucleotide; And/or substitute the polynucleotide of one or more Nucleotide in one or more sites of natural polynucleotide.Ground as used herein, " natural " polynucleotide or polypeptide comprise naturally occurring nucleotide sequence or aminoacid sequence respectively.For polynucleotide, conservative variant comprises because genetic code degeneracy and those sequences of the herbicide tolerant amino acid sequence of polypeptide of encoding.Can use known Protocols in Molecular Biology, as identifying naturally occurring allele variant with polymerase chain reaction (PCR) and hybridization technique, for example above-mentioned these.The variant polynucleotide also comprise the synthetic polynucleotide that obtain, as for example by using those that site-directed mutagenesis or " reorganization (shuffling) " produces.Usually, the variant of specific polynucleotide and described specific polynucleotide have at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity, and this is to determine by sequence alignment program and the parameter of using this paper other places to describe.

Can also pass through to compare the polypeptide of variant polynucleotide encoding and, assess the variant of specific the more Nucleotide (that is, with reference to polynucleotide) with reference to the per-cent sequence identity between the polypeptide of polynucleotide encoding.Sequence alignment program and the parameter that can use this paper other places to describe are calculated the per-cent sequence identity between any two sequences.When coming more given polynucleotide any a pair of of the present invention by the total per-cent sequence identity of two polypeptide of their codings relatively, the per-cent sequence identity between two polypeptide that are encoded is at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity.

" variant " albumen is intended to refer to by at proteinic N-end and/or the one or more amino acid of C-terminal deletion (brachymemma that is called); In proteinic one or more inner sites disappearance and/or add one or more amino acid, perhaps substitute the protein that one or more amino acid obtain from natural and/or initial protein in proteinic one or more sites.The variant proteins that the present invention comprises is bioactive, and promptly they continue to have the herbicide tolerant activity of hope as described herein.The biological activity variant of herbicide tolerant polypeptide of the present invention will have with the amino acid of natural protein at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity, and this is to determine by sequence alignment program and the parameter of using this paper other places to describe.The biological activity variant of herbicide tolerant polypeptide can differ few to about 1-15 amino-acid residue with this polypeptide, and is few to 1-10, as 6-10, lacks to 5, lacks to 4,3,2 or even 1 amino-acid residue.The polynucleotide of variant herbicide tolerant polypeptide and these variants of encoding are known in the art.

Can change the herbicide tolerant polypeptide with several different methods, described method comprises amino acid replacement, disappearance, brachymemma and insertion.This type of method of operating is known in the art.For example, the amino acid variant and the fragment that prepare the herbicide tolerant polypeptide by the sudden change in the coded polynucleotide.The method that mutagenesis and polynucleotide change is well known in the art.For example see, Kunkel (1985) Proc.Natl.Acad.Sci.USA 82:488-492, Kunkel et al. (1987) Methods inEnzymol.154:367-382, U.S. Patent number 4,873,192, Walker and Gaastra, eds. (1983) Techniques in Molecular Biology (MacMillan Publishing Company, New York) and the reference wherein quoted.Guidance about the amino acid replacement of the amino acid active that do not influence target protein matter can be seen Dayhoff et al. (1978) Atlas of ProteinSequence and Structure (Natl.Biomed.Res.Found., Washington, D.C.) model in is incorporated it into this paper by reference.Can guard and substitute, the amino acid that for example an amino acid and another is had similar quality exchanges.It will be appreciated by one of skill in the art that: can assess the herbicide tolerant polypeptide by conventional screening assay method.Promptly; by determining whether transgenic plant have the enhanced tolerance (as illustrating among the work embodiment 1) to weedicide; perhaps use the external test method; (for example see as producing N-ethanoyl glyphosate from glyphosate by the GAT polypeptide; WO 02/36782), assess the activity of herbicide tolerant polypeptide.

Variant polynucleotide and polypeptide also comprise sequence and the protein from mutagenesis and recombination operation (as DNA reorganization).Use this program, can operate one or more different herbicide tolerant polypeptid coding sequences, have the new herbicide tolerant polypeptide of required character with generation.By this way, can produce the recombination of polynucleotide library from the correlated series polynucleotide colony that comprises following sequence area, described sequence area have height sequence identity and can be in external or body homologous recombination.For example, use this method, can between herbicide tolerant polypeptide and other known, be reorganized, have the proteinic new gene of improved purpose character to obtain encoding the sequence motifs of coding purpose structural domain, described character is for example: for enzyme, and the K of increase _mThe strategy of this type of DNA reorganization is known in the art.See, for example, Stemmer (1994) Proc.Natl.Acad.Sci.USA 91:10747-10751, Stemmer (1994) Nature 370:389-391, Crameri et al. (1997) Nature Biotech.15:436-438, Moore et al. (1997) J.Mol.Biol.272:336-347, Zhang et al. (1997) Proc.Natl.Acad.Sci.USA 94:4504-4509, Crameri et al. (1998) Nature 391:288-291 and U.S. Patent number 5,605,793 and 5,837,458.

Following term is used to describe the sequence relation between two or more polynucleotide and the polypeptide: (a) " reference sequences ", (b) " comparison window ", (c) " sequence identity " and (d) " sequence identity per-cent ".

(a) as used herein, " reference sequences " is the given sequence as sequence basis relatively.Reference sequences can be meant the subclass of sequencing row or all; For example, as the section of full-length cDNA or gene order, perhaps global cDNA or gene order.

(b) as used hereinly, " comparison window " relates to the continuous and particular section of polynucleotide sequence, wherein for two polynucleotide sequences being carried out the best comparison, the polynucleotide sequence in the comparison window is compared to comprise with reference sequences (it does not comprise interpolation or disappearance) and is added or disappearance (being breach).Usually, the length of comparison window is at least 20 continuous nucleotides, and chooses wantonly and can be 30,40,50,100 or longer.It will be appreciated by those skilled in the art that for fear of owing in polynucleotide sequence, comprise breach that cause with high similarity reference sequences, introduce the breach point penalty usually, and from the coupling number deduct the breach point penalty.

The comparison method that is used for the sequence of comparison is well known in the art.Thereby, can use mathematical algorithm to determine per-cent sequence identity between any two sequences.The limiting examples of this type of mathematical algorithm is the mathematical algorithm of Myers and Miller (1988) CABIOS 4:11-17; The local alignment algorithm of Smithet al. (1981) Adv.Appl.Math.2:482; The overall comparison algorithm of Needleman and Wunsch (1970) J.Mol.Biol.48:443-453; The part comparison searching algorithm of Pearson and Lipman (1988) Proc.Natl.Acad.Sci.85:2444-2448; The algorithm of Karlin and Altschul (1990) Proc.Natl.Acad.Sci.USA 87:2264-2268 is as institute among Karlin and Altschul (1993) the Proc.Natl.Acad.Sci.USA 90:5873-5877 is improved.

The computer realization of these mathematical algorithms can be used for sequence is compared, to determine sequence identity.This type of realization comprises, but be not limited to: the CLUSTAL in the PC/Gene program (can be from Intelligenetics, Mountain View, California obtains), ALIGN program (version 2 .0) and GAP, BESTFIT, BLAST, FASTA and GCG Wisconsin Genetics software package, TFASTA in the version 10 (can derive from Accelrys Inc., 9685 Scranton Road, San Diego, California, USA).Use the comparison of these programs to carry out with default parameters.The CLUSTAL program is described in detail by Higgins et al. (1988) Gene 73:237-244 (1988), Higginset al. (1989) CABIOS 5:151-153, Corpet et al. (1988) Nucleic Acids Res.16:10881-90, Huang et al. (1992) CABIOS 8:155-65 and Pearson et al. (1994) Meth.Mol.Biol.24:307-331.The ALIGN program is based on the algorithm of Myers and Miller (1988) (the same).When aminoacid sequence was compared, the ALIGH program can be used PAM120 weight residue table, notch length point penalty 12, breach point penalty 4.The blast program of Altschulet al (1990) J.Mol.Biol.215:403 is based on the algorithm of Karlin and Altschul (1990) (the same).Can use the BLASTN program, score=100, the BLAST nucleotide search is carried out in word length=12, to obtain inventing proteinic nucleotide sequence homologous nucleotide sequence with code book.Can use the BLASTX program, score=50, the BLAST protein search is carried out in word length=3, to obtain the aminoacid sequence with protein of the present invention or homologous peptide.In order to obtain being used for the breach comparison of comparison purpose, can described in Altschul et al. (1997) NucleicAcids Res.25:3389, utilize breach BLAST (among the BLAST 2.0) to carry out.Alternatively, can carry out iterative search with PSI-BLAST (among the BLAST 2.0), the distance relation between its detection molecules.See Altschul et al. (1997) (above).When utilizing BLAST, breach BLAST, PSI-BLAST, can use the default parameters of program (for example, BLASTN is used for nucleotide sequence, and BLASTX is used for protein) separately.BLAST software can open acquisition on the NCBI website.Can also be by checking manual comparing.

Unless otherwise noted, sequence identity/similarity provided herein refers to the value of using the following parameter of GAP version 10 usefulness to obtain: at the % identity and the % similarity of nucleotide sequence, use breach weight 50 and length weight 3 and nwsgapdna.cmp to get sub matrix; At the % identity and the % similarity of aminoacid sequence, use breach weight 8 and length weight 2 and BLOSUM62 to get sub matrix, perhaps its any equivalent procedures." equivalent procedures " means following any sequence comparison program, for any two sequences of being discussed, when comparing with the corresponding comparison that GAP version 10 produces, described program can produce to be had identical Nucleotide or amino-acid residue and mates comparison with identical per-cent sequence identity.

GAP uses the algorithm of Needleman and Wunsch (1970) J.Mol.Biol.48:443-453 to find the comparison of two sufficient sequences, and it makes matching number maximization and breach number minimize.GAP considers all possible comparison and gap position, and generation has the coupling base of maximum number and the comparison of minimum breach.It allows to provide breach to produce point penalty and breach extension point penalty with the unit of coupling base.The breach that GAP is necessary for the coupling of each breach that its produces produces on the point penalty makes a profit.If select the breach greater than 0 to extend point penalty, GAP must be also will multiply by breach at the notch length of the breach of each insertion and extends point penalty and make a profit so.Default gap generation point penalty value and breach extension point penalty value to protein sequence in the version 10 of GCG WisconsinGenetics software package are respectively 8 and 2.For nucleotide sequence, it is 50 that default gap produces point penalty, and default gap extension point penalty is 3.Breach produces and breach extension point penalty can be represented as the integer of the group that is selected from 0 to 200 integer.Thereby for example, breach produces and breach extension point penalty can be 0,1,2,3,4,5,6,7,8,9,10,15,20,25,30,35,40,45,50,55,60,65 or bigger.

GAP is best a member of comparing family.Can there be many members in this family, but does not have other member that better quality is arranged.GAP shows four figures of merit of comparison: quality, ratio, identity and similarity.Quality is the maximized tolerance for sequence is compared.Ratio is that quality is divided by base number in the shortest section.Per-cent identity is the per-cent of the symbol of actual match.The per-cent similarity is the per-cent of similarity sign.Symbol through breach is left in the basket.When pair of symbols during, just write down the similarity score more than or equal to 0.50 (similarity threshold value).What use in the version 10 of GCG WisconsinGenetics software package must sub matrix be BLOSUM62 (seeing Henikoff and Henikoff (1989) Proc.Natl.Acad.Sci.USA 89:10915).

(c) as used hereinly, " the sequence identity " in the background of two polynucleotide or peptide sequence or " identity " refer to when comparing in specific comparison window for maximum correspondence, identical residue in two sequences.When using sequence identity per-cent about protein, will be appreciated that, residue position inequality is normally because conserved amino acid is alternative and different, wherein amino-acid residue (is for example had similar chemical property, electric charge or hydrophobicity) other amino-acid residue substitute, therefore do not change the functional property of this molecule.When sequence substitutes not simultaneously because of conservative, per-cent sequence identity can be adjusted upward, to proofread and correct the conservative character of alternate.Can think because this type of conservative alternative and different sequence has " sequence similarity " or " similarity ".The method of carrying out this adjustment is well known to a person skilled in the art.Usually, this relates to mispairing rather than the mispairing fully that substitutes scoring for part with conservative, thereby increases per-cent sequence identity.Thereby, for example, when identical amino acid is given score 1, and non-conservative substituting when being given score 0, the conservative mark that is given between 0 to 1 that substitutes.For example, (California) middle calculating like that of realizing guarded the alternate score for Intelligenetics, Mountain View as program PC/GENE.

(d) as used herein, " sequence identity per-cent " refers to be compared the value of determining by the sequence to two best comparisons in comparison window, wherein for realizing the best comparison to two sequences, the score of peptide sequence is compared to comprise with reference sequences (it does not comprise interpolation or disappearance) and is added or disappearance (that is breach) in the comparison window.By determining the positional number of identical nucleic acid base or amino-acid residue to take place in two sequences to obtain the matched position number, with the matched position number divided by total number of positions in the comparison window, and the result be multiply by 100 and obtain sequence identity percentage ratio, calculate described percentage ratio.

The use of term " polynucleotide " is not intended to the polynucleotide that are confined to comprise DNA.It should be recognized by those skilled in the art that polynucleotide can comprise the combination of ribonucleotide and ribonucleotide and deoxyribonucleotide.This type of deoxyribonucleotide and ribonucleotide comprise naturally occurring molecule and synthetic analogue.Thereby polynucleotide also comprise the sequence of form of ownership, and it includes but not limited to, single stranded form, double chain form, hair clip, loop-stem structure, or the like.

E. herbicide tolerant

" weedicide " is the chemical that causes the temporary transient or permanent injury of plant.The limiting examples that can be used for the weedicide of several different methods of the present invention and composition has further in this paper other places and goes through.Weedicide can be incorporated in the plant, and perhaps it can act on the plant and not mix in plant or its cell." activeconstituents " is the main chemicals of being responsible for its phytotoxicity and being identified as the activeconstituents on the Product labelling in the herbicide formulations.Product labelling information can obtain from USEPA (U.S.Environmental Protection Agency), and at url oaspub.epa.gov/pestlabl/ppls.own online updating; Product labelling information can also be at url Www.cdms.netOnline acquisition.Term " acid equivalent " is expressed as herbicidal activity parent acid with ratio or amount.For example, 2,4-D acid is configured to activeconstituents in the formulated product by the form with sodium or amine salt or ester usually.The active acid equivalent of the widely used ester formulation of per gallon is 3.8 lb a.e./gallon (about 0.454kga.e./L), and the per gallon activeconstituents is 6.0 lb ai/ gallons (about 0.717kgai/L).As used herein, " agricultural chemicals " is any chemical that is used for agriculture category.

" herbicide tolerant " or " tolerance " or " crop tolerance " in weedicide or other chemical treatment category as used herein refers to: afterwards compare with suitable control plant in this processings with the class of the class of particular herbicide or weedicide or subclass or other chemical or other chemical or plant that subclass is handled or other biology and do not demonstrate remarkable injury or demonstrate less injury.Plant may the natural tolerance particular herbicide or chemical, perhaps can be by manual intervention, and for example, breeding or genetic engineering make plant become herbicide tolerant." herbicide tolerant polypeptide " is to the plant of expressing it or other biological conferring herbicide tolerance (promptly, make that plant or other biology are herbicide tolerant) polypeptide, " herbicide tolerant polynucleotide " are the polynucleotide of coding herbicide tolerant polypeptide.For example, sulfonylurea tolerance polypeptide is to give the polypeptide of sulfonylurea herbicide tolerance to plant or other biology of expressing it, the imidazolinone-tolerant polypeptide is to give the polypeptide of imidazolidinone weedicide tolerance to plant or other biology of expressing it, and the glyphosate tolerant polypeptide is to the plant of expressing it or the polypeptide of other biological conferring glyphosate tolerance.

Thereby, if plant compare with suitable control plant the injury comparison that demonstrates little by at least 5% according to the injury that plant demonstrates, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 400%, 500%, 600%, 700%, 800%, 900% or 1000% or more than, this plant is exactly herbicide-tolerant or other chemical so.By this way, the plant of herbicide-tolerant or other chemical is compared with suitable control plant and demonstrates " tolerance of raising ".Can assess the injury that weedicide or other chemical treatment cause by assessment those skilled in the art any parameter that see fit, plant-growth or healthy state.Can assess injury by visual inspection and/or by statistical analysis to the suitable parameters of bion or one group of plant.Thereby, can be for example by assessment, such as plant height, plant weight, leaf color, leaf length, bloom, productivity, reel off raw silk from cocoons, the parameter of output, seed production or the like, assess injury.Can also assess injury by estimate to arrive time that the specific etap (for example, reel off raw silk from cocoons, bloom or pollen comes off) experienced or recover time of being experienced from the processing of particular chemicals and/or weedicide up to plant.

When making these assessments, can distribute particular value to the injury of specific degrees, thereby can carry out statistical analysis or quantitative comparison.The injury that the scope of use value is described specific degrees is known in the art, can use any suitable scope or yardstick.For example, the yardstick that provides in can use table 7 is as the distribution weedicide damage score of illustrating among the embodiment 1 (being also referred to as the tolerance score).In this yardstick, classification 9 expression herbicide treatment are not promptly observed crop minimizing or infringement to not influence of crop after herbicide treatment.Thereby in this yardstick, classification 9 shows that this crop does not demonstrate the weedicide injury, so this crop is to tolerate this weedicide.Point out as top, herbicide tolerant is also represented by other classification in this yardstick, wherein suitable control plant demonstrates low score in this yardstick, perhaps wherein, than the group of experimenter plant, the group of suitable control plant demonstrates score lower on the statistics for replying of herbicide treatment.

With behind the herbicide treatment plant, can assess the injury that weedicide or other chemical cause at different time.Usually, assess injury in the time that control plant demonstrates maximum injury.Sometimes, assess injury after the time limit at certain hour, the control plant of weedicide wherein of no use or other chemical treatments is compared with the size of using processing or stage has measurable growth and/or growth.Can be at different time, for example, after being tried plant with herbicide treatment 12 hours or 1,2,3,4,5,6,7,8,9,10,11,12,13,14 day or three weeks, reevaluate injury all around or after the longer time.

But have the certain influence plant to recover later on when weedicide does not influence or works as it plant to plant, perhaps work as it and with harmful effect still for example have, when by this particular herbicide the influence of weeds being offset, weedicide " does not significantly injure " plant.Thereby, for example, if crop plants and control plant are (for example, untreated crop plants) compares, when at least a parameter display that shows plant health and/or productivity went out less than 50%, 40%, 30%, 25%, 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1% reduction, this crop plants was not subjected to " the significantly injury " of weedicide or other processing.The suitable parameters that shows health and/or productivity for example comprises, plant height, plant weight, leaf length, arrive specific etap experience time, bloom, output, seed production, or the like.Can evaluate parameter by visual inspection and/or any suitable parameters of statistical analysis.Can compare by visual inspection and/or statistical analysis.Therefore, if crop plants demonstrates the reduction of at least a parameter this to be reduced in be temporary transient and this plant recovers in 1 week, 2 weeks, 3 weeks, 4 weeks or 6 weeks fully in nature, so described crop plants is " the significantly injury " that is not subjected to weedicide or other processing.

On the contrary, if plant and suitable control plant are (for example, undressed weeds mutually of the same race) compare, surpass 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 150%, 170% minimizing showing that plant health or/or productivity demonstrate at least a suitable parameters, so described plant is the remarkable injury that is subjected to weedicide or other processing.Thereby if plant demonstrates reducing of at least a parameter and this plant does not recover in 1 week, 2 weeks, 3 weeks, 4 weeks or 6 weeks fully, so described plant is subjected to significantly injury.

The plant injury that weedicide or other chemical treatment cause can be assessed by visual inspection by those skilled in the art, and can be by the statistical analysis assessment of suitable parameters.Evaluated plant is known as " being tried plant ".Usually, suitable control plant is such plant: the plant (that is, " being tried plant ") of itself and evaluated herbicide tolerant is expressed identical herbicide tolerant polypeptide, but herbicide treatment mistake also of no use.For example, at the assessment conferring glyphosate also in the herbicide tolerant plant of the present invention of ALS inhibitor tolerance, but suitable control plant will be each plant of herbicide treatment of no use of expressing these sequences.In some cases, control plant be subjected to the herbicide treatment identical with evaluated plant (promptly being tried plant) but do not express the expection provide at the plant of being tried the enzyme of the tolerance of purpose weedicide in the plant.Those skilled in the art can design, carry out suitable control experiment and being assessed, and come the herbicide tolerant of purpose of appraisals plant, comprise selecting suitable tried plant, control plant and processing.

Thereby, as used herein, " being tried plant or vegetable cell " is plant or the vegetable cell of wherein having realized the hereditary change of at least a goal gene, or the offspring of plant that changes like this or cell and comprise the plant or the vegetable cell of described change.Can or transform by breeding and in plant, introduce hereditary change." hereditary change " means gene or its sudden change, and its phenotype of giving plant is different from the phenotype of the plant that does not contain this hereditary change.

" contrast " or " control plant " or " control plant cell " provides the reference point that is used to measure the phenotypic alternation that is tried plant or vegetable cell, and they can be any appropriate point plant or vegetable cell.Control plant or vegetable cell for example can comprise: (a) wild-type plant or cell, the plant or the cell that promptly have the homologous genes type with the parent material for the hereditary change that causes experimenter plant or cell; (b) with parent material homologous genes type but with invalid construct transform (that is, and use the purpose proterties is not had known to influencing to construct, as comprise marker gene to construct) plant transformed or vegetable cell; (c) be experimenter plant or vegetable cell plant or vegetable cell to the segregant of non-conversion among the offspring; (d) but identical plant or the vegetable cell that is not exposed to the processing (for example, herbicide treatment) identical with experimenter plant or vegetable cell in the heredity with experimenter plant or vegetable cell; (e) be in experimenter plant or vegetable cell under the condition that goal gene do not express; Or (f) be in experimenter plant or vegetable cell under its condition that also is not exposed to particular procedure (as the combination of weedicide or weedicide or/or other chemical).In some cases, suitable control plant or control plant cell can have and experimenter plant or the different genotype of vegetable cell, but can have the herbicide sensitive feature at the hereditary change that causes experimenter plant or cell (for example seeing Green (1998) WeedTechnology 12:474-477, Green or Ulrich (1993) Weed Science 41:508-516) of parent material.In some cases, suitable contrast maize plant comprises NK603 incident (Nielsonet al. (2004) European Food Research and Technology 219:421-427 andRidley et al. (2002) Journal of Agriculture and Food Chemistry 50:7235-7243), the hard stem inbreeding of original seed plant P3162 plant (Pioneer Hi-BredInternational), 39T66 plant (Pioneer Hi-Bred International) or 34M91 plant (Pioneer Hi-Bred International).In some cases, suitable contrast soybean plants be " Jack " soybean plants (Illinois Foundation Seed, Champaign, Illinois).

The polypeptide of expression of plants conferring glyphosate tolerance of the present invention or give at least a other polypeptide of ALS inhibitor tolerance.Plant of the present invention demonstrates at least a improved character with respect to suitable control plant, as herbicide tolerant, the lodging of reduction, the height of increase, the maturation time of shortening and the output of raising that improves.When plant demonstrates when having on the statistics significant difference (wherein this difference is the improvement direction of representative with respect to control plant) with suitable control plant, this plant just has improved character.For example, when plant demonstrates the statistics of comparing output with control plant and significantly increases, and/or when it demonstrated alleviating of injury that the processing of weedicide causes, plant just had improved character.This type of assessment technology is known in the art.Can use any suitable statistical analysis, as ANOVA (can be, Inc., 100 SAS Campus Drive, Cary, the commercial packages of NC obtains) from SAS Institute.

F. plant

Ground as used herein, term " plant " comprises vegetable cell, plant protoplast, can be from plant cell tissue's culture () of its plant that regenerates, plant callus, plant group, explant, with vegetable cell complete in plant or plant part, as embryo, pollen, ovule, seed, leaf, flower, branch, fruit, nuclear, fringe, cob, shell, stem, root, the tip of a root, flower pesticide, or the like.Particle means the mature seed that commercial production person produces for the purpose that makes outside species growth and the regeneration.The offspring of aftergrowth, variant and mutant also are included in the scope of the present invention, and condition is that these parts comprise the polynucleotide that imported.Thereby, the invention provides the transgenic seed that plant of the present invention produces.

The present invention can be used to transform any plant species, and it includes but not limited to, monocotyledons and dicotyledons.The example of purpose plant species includes but not limited to, corn (Zea mays, be also referred to as " Zea mays " in this article), Btassica (for example, colea, B.rapa, B.juncea), be particularly useful for the kind (being also referred to as " rape ") of the Btassica in seed oil source, flax (Linum spp.), alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secalecereale), Chinese sorghum (Sorghum bicolor, Sorghum vulgare), grain (for example, Egyptain millet (Pennisetum glaucum), glutinous millet (Panicum miliaceum), millet (Setaria italica), finger millet (Eleusine coracana)), Sunflower Receptacle (Helianthus annuus), safflower (Carthamus tinctorius), wheat (Triticum aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanut (Arachishypogaea), cotton (Gossypium barbadense, Gossypium hirsutum), Ipomoea batatas (Ipomoea batatus), cassava (Manihot esculenta), coffee (Coffea spp.), coconut (Cocos nucifera), pineapple (Ananas comosus), citrus trees (Citrus spp.), cocoa (Theobroma cacao), tea (Camellia sinensis), banana (Musa spp.), avocado (Persea americana), Fructus Fici (Ficus casica), piscidia (Psidium guajava), mango (Mangifera indica), olive (Olea europaea), papaya (Carica papaya), cashew nut (Anacardium occidentale), Queensland nut (Macadamia integrifolia), almond (Prunus amygdalus), beet (Beta vulgaris), sugarcane (Saccharum spp.), oat, barley, vegetables, fruit, ornamental plant (flower), sugarcane, softwood tree, Arabidopis thaliana.

Vegetables (for example comprise tomato (Lycopersicon esculentum), lettuce, Lactucasativa), Kidney bean (Phaseolus vulgaris), Sieve Bean (Phaseolus limensis), pea (Lathyrus spp.) and Cucumis member, as cucumber (C.sativus), cantaloupe (C.cantalupensis) and musk melon (C.melo).Ornamental plant comprises rhododendron (Rhododendron spp.), Flower of Largeleaf Hydrangea (Macrophylla hydrangea), lotus (Hibiscusrosasanensis), rose (Rosa spp.), turmeric (Tulipa spp.), flower of Chinese Narcissus (Narcissusspp.), trumpet flower (Petunia hybrida), carnation (Dianthus caryophyllus), poinsettia (Euphorbia pulcherrima) and chrysanthemum.

Can also use any tree.Can be used to implement softwood tree of the present invention for example comprises, pine tree, as torch pine (Pinus taeda), slash pine (Pinus elliotii), North America yellow pine (Pinusponderosa), black pine (Pinus contorta) and pine (Pinus radiata), Pseudotsuga menziesii (Mirbel) Franco (Pseudotsuga menziesii), Canadian hemlock (Tsuga canadensis), Sitka dragon spruce (Piceaglauca), redwood (Sequoia sempervirens), true fir such as silver-colored fir (Abies amabilis) and balsam fir (Abies balsamea) and cdear are as red cdear (Thuja plicata) in west and Chamaecyparis formosensis (Chamaecyparis nootkatensis).Can use deciduous tree, comprise ash, white poplar, beech, lime tree, Piao Shu, morello, black walnut, horse-chestnut, American chestnut, cottonwood, skunk bush, elm, Piao Shu, hickory, Chinese ilex, acacia, lily magnolia, maple, Oak Tree, white poplar, red alder, cercis, imperial paulownia, yellow camphor tree, play both sides of the street, Platanus occidentalis, water tupelo, willow, yellowish-white poplar.

In some particular, plant of the present invention is a crop plants, for example, and corn (being also referred to as " Zea mays "), alfalfa, Sunflower Receptacle, Btassica, soybean, cotton, safflower, peanut, Chinese sorghum, wheat, grain, tobacco, etc.).

Other purpose plant comprises plant, oil seed plant and the leguminous plants that the purpose seed is provided.The purpose seed comprises grain seed, as corn, wheat, barley, rice, Chinese sorghum, rye, or the like.Oil seed plant comprises cotton, soybean, safflower, Sunflower Receptacle, Btassica, corn, alfalfa, palm, coconut, or the like.Leguminous plants comprises beans and pea.Steamed buns stuffed with sweetened bean paste is drawn together coca, acacia, Semen Trigonellae, soybean, string bean, cowpea, mung bean, Sieve Bean, broad bean, root of Szemao crotalaria, garbanzo or the like.

Other purpose plant comprises turfgrass, Tathagata from from Poa, cut strand the turfgrass that grass belongs to (Agrostis), festuca (Festuca), lolium (Lolium) and Zoysia.Extra turfgrass can be from subfamily Panicoideae.Turfgrass can also include but not limited to, gramagrass (Bouteloua gracilis (H.B.K.) Lag.Ex Griffiths), Buffalograss (Buchloedactyloids (Nutt.) Engelm.), red fescue (Festuca rubra ssp.Litoralis), red fescue (Festuca rubra), thin and delicate bent grass (Agrostis tenuis Sibth.), Creepingbentgrass (Agrostis palustris Huds.), wheatgrass (Agropyron cristatum (L.) Gaertn.), Hard fescue (Festuca longifolia Thuill.), English grass (Poapratensis L.), rye grass (Lolium perenne L.), rough stalked blue grass (Poa trivialisL.), tall grama (Bouteloua curtipendula Michx.Torr.), awnless brome (Bromusinermis Leyss.), Tall fescue (Festuca arundinacea Schreb.), annual bluegrass (Poaannua L.), Itanlian rye (Lolium multiflorum Lam.), white bent (Agrostisalba L.), jielu grass (Zoysia japonica), Bermuda grass (Cynodon dactylon, Cynodonspp.L.C.Rich, Cynodon transvaalensis), Seashore paspalum (Paspalumvagmatum Swartz), jielu grass (Zoysia spp.Willd, jielu grass Zoysiajaponica and manilagrass (Z. matrella var.matrella)), Bahiagrass (Paspalum notatumFlugge), nearly edge carpetweed (Axonopus affinis Chase), eremochloa ophiuroides (Eremochloaophiuroides Munro Hack.), kikuyu grass (Pennisetum clandesinum HochstEx Chiov), thin and delicate bent grass (Agrostis tenuis is also referred to as A.capillaris), common bent grass (Agrostis canina), rye grass (Lolium perenne) and St.Augustinegrass (Stenotaphrum secundatum Walt.Kuntze).Extra purpose straw bag is drawn together switchgrass (Panicum virgatum).

G. accumulation of proterties (stacking) and extra purpose proterties

In some embodiments, will be in plant of the present invention the polynucleotide through engineering approaches of conferring glyphosate tolerance and ALS inhibitor tolerance in packing of molecules.In other embodiments, packing of molecules also comprises at least a extra polynucleotide of giving the tolerance of the third weedicide.This type of sequence is open in this paper other places.In one embodiment, this sequence is given the tolerance to glyphosate, and in specific embodiments, sequence comprises pat.

In some other embodiment, glyphosate of the present invention/ALS inhibitor tolerance plant comprises one or more purpose proterties, in some more specific embodiments, described plant is piled up any combination of polynucleotide of interest sequence, so that produce the plant with required proterties combination.Proterties refers to the phenotype from particular sequence or sequence set as used herein.For example, the herbicide tolerant polynucleotide can be piled up the polypeptide that any other coding has desinsection and/or kills insect active, as bacillus thuringiensis (Bacillus thuringiensis) toxic protein (at U.S. Patent number 5,366,892,5,747,450,5,737,514,5,723,756,5,593,881, Geiser et al. (1986) Gene 48:109, Lee et al. (2003) Appl.Environ.Microbiol.69:4648-4657 (Vip3A), Galitzky et al. (2001) Acta Crystallogr.D.Biol.Crystallogr.57:1101-1109 (Cry3Bb1) and Herman et al. (2004) J.Agric.Food Chem.52:2726-2734 (CrylF)), lectin (Van Damme et al. (1994) Plant Mol.Biol.24:825, pentin is (at U.S. Patent number 5, description in 981,722) or the like polynucleotide.The combination that produces can also comprise a plurality of copies of any polynucleotide of interest.

In some embodiments, the herbicide tolerant polynucleotide of glyphosate/ALS inhibitor tolerant plants (plant that promptly comprises GAT and HRA) can be piled up other herbicide tolerant proterties, have the transgenic plant of the present invention of further improvement character with generation.Other herbicide tolerant polynucleotide that can be used for this type of embodiment comprise by other mode of action to be given at glyphosate or to those polynucleotide of the tolerance of ALS inhibitor, as the gene of the glyphosate oxidoreductase of encoding, as at U.S. Patent number 5,776,760 and 5, in 463,175 more complete as described in.Can comprise with other proterties of the herbicide tolerant polynucleotide (as GAT and HRA sequence) of glyphosate/ALS inhibitor tolerant plants combination from giving those proterties that plant produces the ability of high-level 5-enol acetonyl shikimic acid-3-phosphate synthase (EPSPS), as at U.S. Patent number 6,248,876 B1,5,627,061,5,804,425,5,633,435,5,145,783,4,971,908,5,312,910,5,188,642,4,940,835,5,866,775,6,225,114 B1,6,130,366,5,310,667,4,535,060,4,769,061,5,633,448,5,510,471, Re.36,449, RE 37,287 E and 5,491,288 and international publication WO 97/04103, WO00/66746, among WO 01/66704 and the WO 00/66747 more complete as described in.Can comprise those proterties of giving with other proterties of the herbicide tolerant polynucleotide (that is) of glyphosate/ALS inhibitor tolerant plants combination, as at U.S. Patent number 5,605 as GAT and HRA sequence to the tolerance of sulfonylurea and/or imidazolone, 011,5,013,659,5,141,870,5,767,361,5,731,180,5,304,732,4,761,373,5,331,107,5,928,937 and 5,378,824 and international publication WO 96/33270 in more complete as described in.

In some embodiments, the herbicide tolerant polynucleotide of glyphosate/ALS inhibitor tolerant plants (as GAT and HRA sequence) can be piled up for example hydroxyphenylpyruvate dioxygenase, and it is that catalysis changes into the enzyme of the reaction of homogentisic acid with right-hydroxyphenyl pyruvic acid (HPP).Suppress this enzyme and can be used as weedicide to suppress HPP to the molecule that homogentisic acid transforms in conjunction with this enzyme.The proterties of giving this type of herbicide tolerant in the plant is at U.S. Patent number 6,245,968 B1,6,268,549 and 6,069,115 and international publication WO 99/23886 in describe to some extent.The herbicide tolerant polynucleotide that can pile up glyphosate/ALS inhibitor tolerant plants (promptly, this type of GAT and HRA sequence) other example of suitable herbicide tolerant proterties comprise: (report it gives 2 aryloxy paraffinic acid dioxygenase enzyme polynucleotide, 4-D and other phenoxy group growth hormone weedicide are to the tolerance of aryloxy phenoxy propionic acid weedicide, as describing among the WO2005/107437) and dicamba 98 tolerance polynucleotide, those as describing among Herman et al. (2005) J.Biol.Chem.280:24759-24767.

Other example of the herbicide tolerant proterties that can make up with the herbicide tolerant polynucleotide of glyphosate/ALS inhibitor tolerant plants (that is, GAT and HRA plant) comprises those that the encoding exogenous phosphinothricin acetyl transferase is given, as U.S. Patent number 5,969,213,5,489,520,5,550,318,5,874,265,5,919,675,5,561,236,5,648,477,5,646,024,6,177,616 and 5,879, described in 903.The plant that contains the external source phosphinothricin acetyl transferase can demonstrate the tolerance to the raising of careless ammonium phosphine weedicide, careless ammonium phosphine inhibitory enzyme glutamine synthase.Can be with glyphosate/ALS inhibitor tolerant plants (promptly, GAT and HRA plant) other example of herbicide tolerant proterties of herbicide tolerant polynucleotide combinations comprise those proterties that the active polynucleotide of proporphyrinogen oxidase (protox) of giving change are given, as U.S. Patent number 6,288,306 B1,6,282,837 B1; With 5,767,373 and international publication WO01/12825 described in.The plant that contains these type of polynucleotide can demonstrate the tolerance of raising of target being decided any weedicide (being also referred to as " protox inhibitor ") of protox enzyme.

Other example of the herbicide tolerant proterties that can make up with the herbicide tolerant polynucleotide of glyphosate/ALS inhibitor tolerant plants (that is, GAT and HRA plant) comprises: give those proterties to the tolerance of at least a weedicide in plant such as maize plant or Canadian bitter fleabane.The herbicide tolerant weeds are known in the art, as the plant different to the tolerance of particular herbicide.For example see, Green and Williams (2004) " Correlation of Corn (Zeamays) Inbred Response to Nicosulfuron and Mesotrione; " (at WSSAAnnual Meeting in Kansas City, Missouri, 9-12 day in February, 2004, the placard in 2004), Green (1998) Weed Technology 12:474-477, Green and Ulrich (1993) Weed Science 41:508-516.Can be by breeding, or by other method, the proterties that will be responsible for these tolerances makes up with the herbicide tolerant polynucleotide of glyphosate/ALS inhibitor tolerant plants (that is, GAT and HRA plant), with provide plant of the present invention with and using method.

By this way, the invention provides the plant that more tolerates glyphosate and other ALS inhibitor chemistry, the more plant of herbicide-tolerant also is provided, every kind of proterties discussed above is given the tolerance to described weedicide.Therefore, the invention provides make plant growth method (promptly, be used for selective control and cultivate the weeds in zone), it comprises at least a weedicide with plant tolerance of the present invention, come processing intent zone (for example, the field of cultivation or zone) as the mixture of glyphosate, ALS inhibitor chemistry, ALS inhibitor chemistry or the mixture of glyphosate and ALS inhibitor chemistry.In some embodiments, method of the present invention also comprises the extra herbicide treatment with plant tolerance of the present invention.In this type of embodiment, method of the present invention allows the selective control weeds usually and does not significantly injure crop.As used herein, " cultivate the zone " and comprise any area of wishing growing plant.This type of is cultivated zone and includes but not limited to, the field of culturing plants (as the forest of crop field, meadow, the woods, management, the field of cultivating fruits and vegetables, etc.), greenhouse, growth room, or the like.

The herbicide tolerant proterties can make up with at least a other proterties, also comprises the plant of the present invention that multiple required proterties makes up to produce, and described proterties includes but not limited to, the proterties that animal-feed is required, as high oil content (as state's patent No. 6,232,529); The equilibrated aminoacids content is (as hordothionins (U.S. Patent number 5,990,389,5,885,801,5,885,802 and 5,703,409, U.S. Patent number 5,850,016), rice high-lysine (Williamson et al. (1987) Eur.J.Biochem.165:99-106 and WO 98/20122) and homomethionine protein (Pedersenet al. (1986) J.Biol.Chem.261:6279, Kirihara et al. (1988) Gene 71:359 and Musumura et al. (1989) Plant Mol.Biol.12:123)), the digestibility that increases (as, modified storage protein (US application serial No. 10/053,410, submit to November 7 calendar year 2001); And Trx (US application serial No. 10/005,429, submit to December 3 calendar year 2001)); Incorporate above-mentioned document into this paper by reference.Required proterties combination also comprises LLNC (low linolenic content; For example see Dyer et al. (2002) Appl.Microbiol.Biotechnol.59:224-230) and OLCH (high oleic acid content is seen, for example Fernandez-Moya et al. (2005) J.Agric.FoodChem.53:5326-5330).

Purpose herbicide tolerant proterties can also make up with other required proterties, described proterties such as fumonism detoxification gene (U.S. Patent number 5,792,931), nontoxicity and disease resistance gene (Jones et al. (1994) Science 266:789, Martin et al. (1993) Science 262:1432, Mindrinos et al. (1994) Cell 78:1089) and processing or the required proterties of converted products, as the improvement oil (as the saturated enzyme gene (U.S. Patent number 5 of lipid acid, 952,544, WO94/11516)); The starch of improvement (as ADPG pyrophosphorylase (AGPase), starch synthase (SS), Q-enzyme (SBE) and starch-debranching enzyme (SDBE); And polymkeric substance or biological ratio (for example, U.S. Patent number 5,602,321; β-Tong Liuxiemei, polyhydroxybutyrate ester synthase and Acetoacetyl-CoA reductase (Schubert et al. (1988) J.Bacteriol.170:5837-5847) promote the expression of poly (hydroxy alkanoate) (PHA); Incorporate their disclosure into this paper by reference.Can also composite weedicide tolerance polynucleotide with provide agronomy character such as male sterile (for example to see, U.S. Patent number 5,583,210), stem strength, flowering time or transformation technology proterties, as Cycle Regulation or gene targeting (for example, WO 99/61619, WO00/17364 and WO 99/25821) polynucleotide combinations, incorporate their disclosure into this paper by reference.

In another embodiment, purpose herbicide tolerant proterties can also with Rcg1 sequence or its biologic activity variant or fragment combination.The Rcg1 sequence is the anthrax stem rot resistant gene in the corn.For example see that Application No. 11/397,153,11/397,275 and 11/397,247 is all incorporated them into this paper by reference.

Can produce the combination that these pile up by any method, described method include, but not limited to by any routine or TopCross method breeding plant, perhaps genetic transformation.If pile up described sequence by genetic transformation plant, the polynucleotide of interest sequence can make up at any time with any order so.For example, the transgenic plant that comprise the proterties of one or more hope can import other proterties with the conversion by subsequently as target.The polynucleotide of interest that can provide with any combination that transforms box in the cotransformation scheme imports proterties simultaneously.For example, if will import two kinds of sequences, so can these two kinds of sequences can be included in the conversion box separately (trans) or be included on the identical conversion box (cis).The expression of sequence can drive by identical promoters or by different promoters.In some cases, wish to import the conversion box of the expression that will suppress polynucleotide of interest.The combined proterties combination of wishing with generation in plant of any combination that this can suppress box with other or cross expression cassette.It should also be appreciated that and to use the site-specific recombination system, pile up polynucleotide sequence in the genome position of hope.See that for example, WO99/25821, WO99/25854, WO99/25840, WO99/25855 and WO99/25853 incorporate them into this paper by reference.

The multiple change of phenotype is people's a purpose, and described change comprises that lipid acid is formed in the modified plant, changes the aminoacids content of plant, changes the pathogenic agent defense mechanism of plant, or the like.Can express or the expression of the increase of endogenous product by the allos product is provided in plant, realize these results.Alternatively, can be by one or more endogenous products be provided, the especially reduction expressed in plant of enzyme or cofactor realizes described result.These changes cause the change of institute's plant transformed phenotype.

Goal gene has reflected commercial market and the importance that relates to those genes that crop breeds.Purpose crop and market change to some extent, and along with developing country opens world market, also new crop and technology will occur.In addition, along with we to the going deep into of agronomy character and feature such as output and heterotic understanding, the selection of transforming gene will correspondingly change.The general category of goal gene for example comprises, relates to those genes of information, refers to as zinc, relates to those genes of communication, as kinases with relate to those genes of house keeper, as heat shock protein(HSP).Genetically modified classification more specifically for example comprises the gene of the important agronomy character of coding, insect-resistant, disease resistance, Herbicid resistant, sterile, particle characteristic and commerical prod.Goal gene generally includes and relates to metabolic those genes of oil, starch, carbohydrate or nutrition, and those genes of size, sucrose filling or the like are examined in influence.On the agronomy important proterties as oil, starch and protein content except using conventional breeding method, can also be by hereditary change.Modification comprises the content that increases oleic acid, saturated and unsaturated oil, the level that improves Methionin and sulphur, and providing must amino acid and the modification of starch.

Can pass through site-directed mutagenesis, make the derivative of encoding sequence, to improve the amino acid levels of selecting in advance in the encoded polypeptide.For example, the gene of coding barley high-lysine polypeptide (BHL) is from the barley chymotrypsin inhibitor, and US application serial No. 08/740,682 and WO 98/20133 that on November 1st, 1996 submitted to incorporate their disclosure into this paper by reference.Other protein comprises the vegetable-protein that is rich in methionine(Met), as from sunflower seeds (Lilley etal. (1989) Proceedings of the World Congress on Vegetable ProteinUtilization in Human Foods and Animal Feedstuffs, ed.Applewhite (American Oil Chemists Society, Champaign, Illinois), pp.497-502, all incorporate this paper by reference into as a reference); The vegetable-protein that is rich in methionine(Met) of corn (Pedersen et al. (1986) J.Biol.Chem.261:6279, Kirihara et al. (1988) Gene 71:359, all incorporate into by reference this paper) and rice (Musumura et al. (1989) Plant Mol.Biol.12:123 incorporates this paper by reference into).Important other genes encoding milk, Floury 2, somatomedin, the seed storage factor and transcription factor on the agronomy.

The insect-resistant gene can be encoded at the resistance with insect that big output ties down, described insect such as rootworm, cutworm, Pyrausta nubilalis (Hubern). or the like.This genoid comprises: for example, and bacillus thuringiensis toxin protein plasmagene (U.S. Patent number 5,366,892,5,747,450,5,736,514,5,723,756,5,593,881 and Geiser et al. (1986) Gene 48:109); Or the like.

The gene of coding disease resistance proterties comprises detoxification genes, as the gene of anti-fumonosin (U.S. Patent number 5,792,931); Nontoxicity (avr) and disease resistance (R) gene (Jones et al. (1994) Science 266:789, Martin et al. (1993) Science 262:1432 and Mindrinos etal. (1994) Cell 78:1089) or the like.

The sterile gene of can also in expression cassette, encoding, and the alternatives that provides physics to castrate.The example that is used for the gene of these class methods comprises the preferred gene of male tissue and has the gene of male sterile phenotype, as is described in U.S. Patent number 5,583, the QM in 210.Other gene comprises kinases and encodes and male or female gamete body are grown those genes of deleterious compound.

The particulate quality is reflected in the following proterties, quality and the quantity and the cellulosic level of the level of for example saturated and unsaturated oil of described proterties and type, indispensable amino acid.In corn,, modified hordothionin albumen has been described in 049,5,885,801,5,885,802 and 5,990,389 at U.S. Patent number 5,703.

The following commercial proterties of can also encoding on one or more genes, described proterties for example can increase the starch that is used for alcohol production, and protein expression perhaps is provided.The another kind of important commercial purposes that transforms plant is to produce polymkeric substance and biological plastics, as U.S. Patent number 5,602, describes in 321.Gene such as β-Tong Liuxiemei, PHB enzyme (polyhydroxybutyrate synthase) and Acetoacetyl-CoA reductase (seeing Schubert et al. (1988) J.Bacteriol.170:5837-5847) can promote the expression of poly (hydroxy alkanoate) acid esters (PHA).

The external source product comprises the enzyme of plant and product and from other source those products of (comprising prokaryotic organism and other eukaryote).This type of product comprises enzyme, cofactor, hormone, or the like.The modified protein level that protein, the amino acid that especially has a raising distribute with the nutritive value that improves plant can be enhanced.This realizes by expressing this type of protein with aminoacids content of increase.

II. polynucleotide constructs

In some particular, can in expression cassette, be provided for one or more herbicide tolerant polynucleotide in the method and composition, in purpose plant or other biology, to express.Expression cassette will comprise 5 ' and 3 ' adjusting sequence of the herbicide tolerant polynucleotide that are operably connected.The function that means between two or more elements that " is operably connected " connects.For example, the exercisable connection between polynucleotide of interest and the adjusting sequence (for example promotor) is that the function that allows polynucleotide of interest to express connects.The element that can be operatively connected can be continuous or discontinuous.When being used in reference to two protein coding regions of connection, " can be operatively connected " refers to that the coding region is in identical open reading-frame (ORF).When being used in reference to the effect of enhanser, " being operably connected " refers to that enhanser increases the expression of one or more concrete polynucleotide of interest.Wherein said one or more polynucleotide of interest coded polypeptide produces the polypeptide that is encoded with higher level.

Expression cassette can additionally contain by cotransformation at least one extra gene in the biology.Alternatively, can on a plurality of expression cassettes, provide described extra gene.For this type of expression cassette provides a plurality of restriction sites and/or recombination site, so that the insertion of herbicide tolerant polynucleotide is under the transcriptional regulatory of regulatory region.Expression cassette can additionally contain other gene, comprises other selectable marker gene.When expression cassette contained above polynucleotide, the polynucleotide in the box can be transcribed (being also referred to as " Divergence (divergent) " transcribes) with equidirectional or different directions.

The expression cassette that comprises the herbicide tolerant polynucleotide will on 5 '-3 ' transcriptional orientation, comprise transcribe with the translation initiation district (promptly, promotor), the herbicide tolerant polynucleotide (for example, GAT polynucleotide, ALS inhibitor tolerance polynucleotide, the HRA polynucleotide, perhaps its any combination, or the like) and the transcribing with the translation termination district (that is terminator) of function arranged in purpose plant or other biology.Therefore, also provide plant with this type of expression cassette.Regulatory region (that is, promotor, transcriptional regulatory district and translation termination district) and/or herbicide tolerant polynucleotide can be natural (promptly similar) or to being natural (similarly) mutually to host cell.Alternatively, regulatory region of the present invention and/or herbicide tolerant polynucleotide can be to host cells or are allogenic mutually.Ground as used herein, said when mentioning sequence " allogenic " is meant the sequence from alien species, if perhaps from same species, so described sequence by the human intervention of having a mind to form and/or locus on compare with its natural form substantive modification taken place.For example, the promotor of the heterologous polynucleotide that is operably connected from these polynucleotide from the different species of species, if perhaps from identical (promptly similar) species, compare one or both and all be subjected to essence and modify with their original form and/or locus so, perhaps this promotor is not the natural promoter of the polynucleotide that are operably connected.

Although it may be best using allogeneic promoter to express polynucleotide, can also use natural promoter.This type of construct can change expression level and/or the expression pattern of encoded polypeptide in plant or vegetable cell.Because as the additional adjustment element such as the enhanser of the part of construct, the expression level of encoded polypeptide and/or expression pattern also can be changed.Thereby,, also can change the phenotype of plant or cell although use natural promoter.

The terminator can be natural for transcription initiation region, for the purpose herbicide tolerant polynucleotide that are operably connected, be natural perhaps, can be natural with plant host, perhaps can make up from another source (that is external source or allogenic) with respect to this promotor, purpose herbicide tolerant polynucleotide, plant host or its.Conventional terminator can as octopine synthase and nopaline synthase terminator, perhaps can obtain from plant gene such as potato proteinase inhibitor II gene from the Ti-plasmids of Agrobacterium tumefaciems.Also see Guerineau et al. (1991) Mol.Gen.Genet.262:141-144, Proudfoot (1991) Cell 64:671-674, Sanfacon et al. (1991) Genes Dev.5:141-149, Mogen etal. (1990) Plant Cell 2:1261-1272, Munroe et al. (1990) Gene 91:151-158, Ballas et al. (1989) Nucleic Acids Res.17:7891-7903 and Joshi etal. (1987) Nucleic Acids Res.15:9627-9639.

Multiple promotor can be used to implement the present invention, comprises the natural promoter of polynucleotide of interest sequence.The result that can wish selects promotor.Polynucleotide of interest can be with composing type, tissue is preferred or other promotor combination, to express in plant.

This type of constitutive promoter for example comprises, the core promoter of Rsyn7 promotor and WO99/43 838 and U.S. Patent number 6,072, disclosed other constitutive promoter in 050, core CaMV 35S promoter (Odell et al. (1985) Nature 313:810-812), rice Actin muscle (McElroy et al. (1990) Plant Cell 2:163-171); The maize actin promotor; The ubiquitin promotor (is seen, for example Christensen et al. (1989) Plant Mol.Biol.12:619-632, Christensen et al. (1992) Plant Mol.Biol.18:675-689, Callis et al. (1995) Genetics 139:921-39), pEMU (Last et al. (1991) Theor.Appl.Genet.81:581-588), MAS (Velten et al. (1984) EMBOJ.3:2723-2730), ALS promotor (U.S. Patent number 5,659,026), or the like.Other constitutive promoter for example comprises, U.S. Patent number 5,608,149,5,608,144,5,604,121,5,569,597,5,466,785,5,399,680,5,268,463,5,608,142; With 6,177, those that describe in 611.Some promotors can demonstrate the expression of raising when being used in combination with natural 5 ' non-translational region and/or other element such as intron.For example, usually corn ubiquitin promotor is placed the upstream of at least a portion (first intron that comprises corn ubiquitin gene) of 5 ' non-translational region of polynucleotide of interest and ubiquitin gene.

The promotor of Chemical Regulation can be used for regulating the plant expression of gene by using the external source chemical regulator.Depend on purpose, promotor can be the chemical reagent inducible promoter, and it is used for the application of chemical reagent inducible gene expression, and perhaps promotor can be the quenchable promotor of chemical reagent, and it is used for the application of chemical reagent inhibition of gene expression.The chemical reagent inducible promoter is known in the art, it includes but not limited to: corn In2-2 promotor, it is activated by the benzenesulfonamide herbicide safener, corn GST promotor, it is used as the hydrophobic electrophilic compound activation of sprouting preceding weedicide, with tobacco PR-1a promotor, it is activated by Whitfield's ointment.Other promotor that the purpose chemical reagent is regulated comprises that steroid replys promotor and (for example see, Schena et al. (1991) Proc.Natl.Acad.Sci.USA 88:10421-10425 and McNellis et al. (1998) PlantJ.14 (2): the glucocorticosteroid inducible promoter among the 247-257) and the derivable and quenchable promotor of tsiklomitsin of tsiklomitsin (see, for example, Gatz et al. (1991) Mol.Gen.Genet.227:229-237 and U.S. Patent number 5,814,618 and 5,789,156), incorporate it into this paper by reference.

Organize preferred promotor can be used for target and decide enhanced herbicide tolerant expression of polypeptides in the specified plant tissue.Organize preferred promotor to comprise J.12 (2): 255-265 of Yamamoto et al. (1997) Plant, Kawamata et al. (1997) Plant Cell Physiol.38 (7): 792-803, Hansen et al. (1997) Mol.Gen Genet.254 (3): 337-343, Russell et al. (1997) Transgenic Res.6 (2): 157-168, Rinehart et al. (1996) Plant Physiol.112 (3): 1331-1341, Van Camp et al. (1996) Plant Physiol.112 (2): 525-535, Canevascini et al. (1996) Plant Physiol.112 (2): 513-524, Yamamoto et al. (1994) Plant Cell Physiol.35 (5): 773-778, Lam (1994) Results Probl.Cell Differ.20:181-196, Orozco et al. (1993) Plant MolBiol.23 (6): 1129-1138, Matsuoka et al. (1993) Proc Natl.Acad.Sci.USA90 (20): 9586-9590 and Guevara-Garcia et al. (1993) Plant be (3): 495-505 J.4.If necessary, can be modified this type of promotor, to be used for weak expression.

The preferred promotor of leaf is known in the art.For example see, Yamamoto et al. (1997) Plant J.12 (2): 255-265, Kwon et al. (1994) Plant Physiol.105:357-67, Yamamoto et al. (1994) Plant Cell Physiol.35 (5): 773-778, Gotor et al. (1993) Plant J.3:509-18, Orozco et al. (1993) Plant Mol.Biol.23 (6): 1129-1138 and Matsuoka et al. (1993) Proc.Natl.Acad.Sci.USA 90 (20): 9586-9590.

The preferred promotor of root is known, and it can be selected from the document available many promotors or from the beginning separate from multiple compatible species.For example see Hire et al. (1992) Plant Mol.Biol.20 (2): 207-218 (the NADPH-linked glutamate synthase gene that the soybean Gent is different), Keller and Baumgartner (1991) Plant Cell 3 (10): 1051-1061 (the root-specific controlling elementss in GRP 1.8 genes of Kidney bean), Sanger et al. (1990) Plant Mol.Biol.14 (3): 433-443 (root-specific promoter of the mannopine synthase (MAS) of Agrobacterium tumefaciems); With Miao et al. (1991) Plant Cell3 (1): 11-22 (full-length cDNA of cytosol glutamine synthetase (GS), it is expressed in the root of soybean and root nodule).Also see Bogusz et al. (1990) Plant Cell2 (7): 633-641, wherein described two kinds of root-specific promoters, it separates from the oxyphorase from fixed nitrogen non-leguminous plant Parasponia andersonii and relevant non-fixed nitrogen non-leguminous plant Trema tomentosa.

The promotor of these genes is connected on β-glucuronidase reporter gene, and is imported among non-leguminous plant tobacco and the leguminous plants Lotus corniculatus, and they all keep the different promoter activity of Gent in both cases.Leach and Aoyagi (1991) have described the analysis of the promotor of the rolC of the high level expression of rhizobiaceae (Agrobacterium rhizogenes) and rolD root induction gene (have been seen Plant Science (Limerick) 79 (1): 69-76).They infer, enhanser and organize preferred terminator dna to dissociate in those promotors.Teeri et al. (1989) uses and the gene fusion of lacZ shows, the edaphic bacillus T-DNA gene of coding octopine synthase has activity especially in tip of a root epidermis, TR2 ' gene is a root-specific in complete plant, and be subjected to the stimulation of wound in the leaf texture, this is to use desinsection or kills the characteristics combination of the special hope of larva gene and (see EMBOJ.8 (2): 343-350).TR1 ' the gene that merges to nptII (neomycin phosphotransferase II) demonstrates similar feature.The preferred promotor of extra root comprises VfENOD-GRP3 gene promoter (Kuster et al. (1995) Plant Mol.Biol.29 (4): 759-772) with rolB promotor (Capana et al. (1994) Plant Mol.Biol.25 (4): 681-691.Also see U.S. Patent number 5,837,876,5,750,386,5,633,363,5,459,252,5,401,836,5,110,732; With 5,023,179.

" seed is preferred " promotor comprises " seed-specific " promotor (promoters active in seed development is as the seed storage protein promotor) and " seed germination " promotor (activated those promotors in seed germination).See Thompson et al. (1989) BioEssays10:108, incorporate it into this paper by reference.The preferred promotor of this type of seed comprises, but be not limited to, Cim1 (phytokinin inductive information), cZ19B1 (corn 19 kDa zein), milps (myo-Inositol-1-phosphate synthase) (see WO 00/11177 and U.S. Patent number 6,225,529, be introduced into this paper as a reference).γ-zein is an endosperm specificity promoter.Sphaeroprotein 1 (Glb-1) is representative embryo-specific promoter.For dicotyledons, seed specific promoters includes, but not limited to beans β-Kidney bean albumen, rapeseed protein, beta-conglycinin, soybean agglutinin, cruciferin, or the like.For monocotyledons, seed specific promoters comprises, but be not limited to, corn 15kDa zein, 22kDa zein, 27kDa zein, γ-zein, waxy, shrunken1, shrunken 2, sphaeroprotein 1, or the like.Also see WO 00/12733, wherein disclose seed specific promoters from end1 and end2 gene; Incorporate it into this paper by reference.

Extra purpose promotor comprises SCP1 promotor (US 6,072,050), HB2 promotor (US 6,177,611) and SAMS promotor (US20030226166 and SEQ ID NO:87 and its biological activity variant and fragment); All incorporate them into this paper as a reference by reference.In addition, as this paper other places publicly, multiple enhanser can use with these promotors, described enhanser for example comprises that the ubiquitin intron (that is, (for example see by corn ubiquitin introne 1, NCBI sequence S94464), ω enhanser or ω ' enhanser (Gallie et al. (1989) Molecular Biologyof RNA ed.Cech (Liss, New York) 237-256 and Gallie et al.Gene (1987) 60:217-25), perhaps 35S enhanser; All incorporate them into this paper by reference.

Expression cassette can also comprise the selected marker who is used to be selected from through transformant.The selected marker can be used for selecting by cell transformed or tissue.Marker gene comprises the gene of the antibiotics resistance of encoding, as the gene of encode neomycin phosphotransferase II (NEO) and hygromix phosphotransferase (HPT), and give herbicidal compounds (as glyphosate, bromoxynil, imidazolone and 2, the gene of the resistance of 4-dichlorophenoxyacetic acid (2,4-D)).Extra selective marker comprises phenotypic markers, as beta-galactosidase enzymes and fluorescin, as green fluorescent protein (GFP) (Suet al. (2004) Biotechnol Bioeng 85:610-9 and Fetter et al. (2004) Plant Cell16:215-28), cyan fluorescent protein (CYP) (Bolte et al. (2004) J.Cell Science117:943-54 and Kato et al. (2002) Plant Physiol 129:913-42) and yellow fluorescence protein (, seeing Bolte et al. (2004) J.Cell Science 117:943-54) from the PhiYFP of Evrogen.Extra selective marker is generally seen, Yarranton (1992) Curr.Opin.Biotech.3:506-511; Christopherson et al. (1992) Proc.Natl.Acad.Sci.USA 89:6314-6318; Yao et al. (1992) Cell 71:63-72; Reznikoff (1992) Mol.Microbiol.6:2419-2422; Barkley et al. (1980), The Operon, pp.177-220; Hu et al. (1987) Cell 48:555-566; Brown et al. (1987) Cell 49:603-612; Figge et al. (1988) Cell 52:713-722; Deuschle et al. (1989) Proc.Natl.Acad.Aci.USA 86:5400-5404; Fuerst et al. (1989) Proc.Natl.Acad.Sci.USA 86:2549-2553; Deuschle et al. (1990) Science 248:480-483; Gossen (1993) Ph D dissertation, University of Heidelberg; Reines et al. (1 993) Proc.Natl.Acad.Sci.USA 90:1917-1921; Labow et al. (1990) Mol.Cell.Biol.10:3343-3356; Zambretti et al. (1992) Proc.Natl.Acad.Sci.USA 89:3952-3956; Baim et al. (1991) Proc.Natl.Acad.Sci.USA 88:5072-5076; Wyborski et al. (1991) Nucleic Acids Res.19:4647-4653; Hillenand-Wissman (1989) Topics Mol.Struc.Biol.10:143-162; Degenkolb et al. (1991) Antimicrob.Agents Chemother.35:1591-1595; Kleinschnidt et al. (1988) Biochemistry 27:1094-1104; Bonin (1993) Ph.D.Thesis, University of Heidelberg; Gossen et al. (1992) Proc.Natl.Acad.Sci.USA 89:5547-5551; Oliva et al. (1992) Antimicrob.Agents Chemother.36:913-919; Hlavka et al. (1985) Handbook of Experimental Pharmacology, and Vol.78 (Springer-Verlag, Berlin); Gill et al. (1988) Nature 334:721-724.Incorporate these disclosures into this paper by reference.Top selected marker's tabulation is not intended to restriction.Any selected marker all can be used for the present invention, comprises GAT gene and/or HRA gene.

The method of polypeptide expression level of the present invention in increase plant known in the art or the vegetable cell, for example, be rich in the codon (as GCG or GCT) of G/C by insert one or two in polypeptid coding sequence, described password is from being close to initial methionine ATG codon and just inserting in the downstream of this codon.When suitable, can optimize polynucleotide, to increase the expression in the plant transformed.Promptly, can synthetic polyribonucleotides, substitute the less one or more codons that are used for plant in the polypeptid coding sequence with the codon that more is usually used in the coding same amino acid in the plant, and this modified encoding sequence is imported in plant or the vegetable cell encoding sequence of expressing this modification.See, for example, the discussion that Campbell and Gowri (1990) Plant Physiol.92:1-11 selects about the preferred codon of host.This area can utilize the method for the preferred gene of synthetic gene.See, for example, U.S. Patent number 5,380,831 and 5,436,391 and Murray et al. (1989) Nucleic Acids Res.17:477-498, incorporate it into this paper by reference.The embodiment that comprises this type of modification also is a feature of the present invention.

Known extra sequence modification can strengthen the genetic expression in the cell host.These comprise: remove the pseudo-polyadenylation signal of coding sequence, exon-intron splice site signal, swivel base increment tumor-necrosis factor glycoproteins and may to genetic expression deleterious other this type of by the sequence of fine sign.The G-C content of sequence can be adjusted to the mean level (ML) of given cell host, as calculating by the known of expressing in the reference host cell.When possible, but the hair clip secondary mRNA structure of modification sequence to avoid predicting.Also can use " enhanser " as CaMV 35S enhanser (seeing that for example, Benfey et al. (1990) EMBO J.9:1685-96), perhaps can use other enhanser.For example, can use sequence or its biological activity variant or the fragment that provides among the SEQ ID NO:1,72,79,84,85,88 or 89.See that also submission and the complete title that is incorporated herein by reference are the novel application number of U.S. utility of " Methods and Compositions for the Expression of aPolynucleotide of Interest " simultaneously.Term " promotor " means the DNA that comprises transcription initiation region and regulates sequence, and in some embodiments, it comprises the TATA box, and described TATA box can guide rna plymerase ii synthetic at the suitable transcription initiation site startup RNA of specific coding sequence.Promotor can also be operably connected to be influenced on the additional adjustment element of transcribing, and described element includes, but not limited to 5 ' non-translational region, and enhancer element.Ground as used herein, " enhancer sequence ", " enhanser structural domain ", " enhancer element or " enhanser " are when being operably connected to promotor, and it will regulate the transcriptional level of the polynucleotide of interest that can be operatively connected.The biological activity that can keep adjusting (increase or reduce) transcriptional level when the bioactive fragment of enhanser structural domain and variant are operably connected to suitable promotor.

The polynucleotide passage of enhanser structural domain or promotor can be at least about the full length nucleotide sequence of the present invention that 50 Nucleotide, about 100 Nucleotide, about 150 Nucleotide, about 200 Nucleotide, about 250 Nucleotide, about 300 Nucleotide, about 350 Nucleotide, about 400 Nucleotide, about 450 Nucleotide, about 500 Nucleotide and as many as are used for enhanser structural domain of the present invention.In other embodiments, the fragment of enhanser structural domain comprises about 50 to about 100,100 to about 150,150 to about 200,200 to about 250, about 250 to about 300, about 300 to about 350, about 350 to about 400, about 400 to about 450, about 450 to about 500, about 500 length to about 535 Nucleotide.Usually, the variant of specific polynucleotide of the present invention will have at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity with these specific polynucleotide, determine as the sequence alignment program described by this paper other places and parameter.The biological activity variant of enhanser or promotor can with this sequence have few to 1-15 nucleotide residue, few to 1-10, as 6-10, less to 10,9,8,7,6,5,4,3,2 or even 1 nucleotide residue difference.This type of active variant and fragment will continue to regulate transcribes.

Enhanser structural domain or its active variant and segmental a plurality of copy can be operatively attached on the promotor.In specific embodiments, chimeric transcriptional regulatory control region can comprise at least 1,2,3,4,5,6,7 or multiple copied more of enhanser structural domain.In other embodiments, the enhanser structural domain of use does not comprise the sequence that provides among the SEQ ID NO:5.In addition, enhanser can be any orientation (that is, justice or antisense being arranged).

Distance between promotor and the enhanser structural domain can change, as long as the chimeric transcription regulatory region continues to instruct the polynucleotide of interest that is operably connected to transcribe in desirable mode.For example, the enhanser structural domain can arrive the next-door neighbour at least about 10000 to about 15000, about 10000 to about a9000, about 9000 to about 8000, about 8000 to about 7000, about 7000 to about 6000, about 6000 to about 5000, about 5000 to about 4000, about 4000 to about 3000, about 3000 to about 2000, about 2000 to about 1000, about 1000 to about 500, about 500 to about 250, about 250 with the promotor distance.It should also be appreciated that and one or more copies of enhanser can be placed promotor upstream (5 '), perhaps alternatively, one or more copies of enhanser can be placed 3 ' of promotor.In some particular, when be positioned at promotor 3 ' time, enhanser is positioned at the downstream that stops the subarea.In some other embodiment, one or more enhansers can be arranged with 5 ' or 3 ' direction (as shown in SEQ ID NO:1 or 72) or 3 ' to 5 ' direction.

If use a plurality of enhansers, the enhanser promotor can be placed construct, its relation with respect to promotor be make to realize desirable to the influence expressed.For example, enhanser can be close to or mutually at a distance of at least 1 to 100,100 to 300,300 to 500,500 to 1000 Nucleotide.

It should also be appreciated that be used for enhanser of the present invention can be between DNA construct first and second promotor, and be operably connected first and second promotor.In this type of embodiment, enhanser allows to regulate first and the expression of second promotor from the Divergence direction.But the exemplary limiting examples of this type of DNA construct comprises: (with 5 ' to 3 ' or 3 ' to 5 ' direction,) be operably connected to first purpose nucleic acid of first promotor, described purpose nucleic acid is operably connected at least one copy of enhanser of the present invention, described copy is operably connected to second promotor, and described second promotor is operably connected to second polynucleotide of interest.In specific embodiments, enhancer sequence and first and second enhancer sequence are allogenic.In some other embodiment, first promotor is operably connected to the polynucleotide of coding ALS inhibitor, and second promotor is operably connected to the polynucleotide of the polypeptide of coding conferring glyphosate tolerance.These type of polynucleotide are described to some extent in this paper other places.

Expression cassette can additionally contain 5 ' leader sequence.This type of leader sequence can play a role to strengthen translation.The translation leader sequence is known in the art; it comprises: the picornavirus leader sequence; for example; EMCV leader sequence (encephalomyocarditis 5 ' non-coding region) (Elroy-Stein et al. (1989) Proc.Natl.Acad.Sci.USA 86:6126-6130); marmor upsilon group leader sequence; as TEV leader sequence (marmor erodens) (Gallie et al. (1995) Gene 165 (2): 233-238); MDMV leader sequence (maize dwarf mosaic virus) (Virology 154:9-20) and human immunoglobulin heavy chain conjugated protein (BiP) (Macejak et al. (1991) Nature 353:90-94); untranslated leader (AMVRNA 4) (Jobling et al. (1987) Nature 325:622-625) from the coat protein mRNA of alfalfa mosaic virus; tobacco mosaic virus (TMV) leader sequence (TMV) (Gallie et al. (1 989); Molecular Biology of RNA; ed.Cech (Liss; New York), pp.237-256) and corn yellows mottle virus leader sequence (MCMV) (Lommel et al. (1991) Virology 81:382-385).Also see Della-Cioppa et al. (1987) Plant Physiol.84:965-968.

When the preparation expression cassette, can be operated multiple polynucleotide passage, as long as if can in correct frame, provide sequence to get final product with correct direction and suitable.For reaching this purpose, can fragment be coupled together with adapter or joint, perhaps can operate the restriction site of providing convenience with other, remove unnecessary material, as remove restriction site, or the like.For this reason, can relate to vitro mutagenesis, primer reparation, restriction enzyme digestion, annealing, substitute again, for example, conversion and transversion.Standard recombinant dna used herein and molecule clone technology are well known in the art, those that in Sambrook et al. (1989) Molecular Cloning:A LaboratoryManual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor) (being also referred to as " Maniatis "), describe more fully for example.

In some embodiments, polynucleotide of interest is used for expressing by the target chloroplast(id).By this way, when polynucleotide of interest is not inserted directly into chloroplast(id), expression cassette will additionally contain the nucleic acid of the transit peptides of encoding, with chloroplast(id) that the goal gene product is led.This type of transit peptides is known in the art.For example see Von Heijne et al. (1991) Plant Mol.Biol.Rep.9:104-126; Clark et al. (1989) J.Biol.Chem.264:17544-17550; Della-Cioppa et al. (1987) Plant Physiol.84:965-968; Romer et al. (1993) Biochem.Biophys.Res.Commun.196:1414-1421 and Shah et al. (1986) Science 233:478-481.

Chloroplast targeted sequence is known in the art, it comprises ribulose-1,5-bisphosphate, the chloroplast(id) small subunit of 5-bisphosphate carboxylase (Rubisco) (de Castro Silva Filho et al. (1996) Plant Mol.Biol.30:769-780, Schnell et al. (1991) J.Biol.Chem.266 (5): 3335-3342); 5-(enol acetonyl) shikimic acid-3-phosphate synthase (EPSPS) (Archer et al. (1990) J.Bioenerg.Biomemb.22 (6): 789-810), tryptophan synthetase (Zhao et al. (1995) J.Biol.Chem.270 (11): 6081-6087), plastocyanin (Lawrence et al. (1997) J.Biol.Chem.272 (33): 20357-20363), chorismate synthase (Schmidt et al. (1993) J.Biol.Chem.268 (36): 27447-27457); With light harvesting chloroplast(id) a/b conjugated protein (LHBP) (Lamppa et al. (1988) J.Biol.Chem.263:14996-14999).Also see Von Heijneet al. (1991) Plant Mol.Biol.Rep.9:104-126, Clark et al. (1989) J.Biol.Chem.264:17544-17550, Della-Cioppa et al. (1987) Plant Physiol.84:965-968, Romer et al. (1993) Biochem.Biophys.Res.Commun.196:1414-1421; With Shah et al. (1986) Science 233:478-481.

The method that is used to transform chloroplast(id) is known in the art.For example see that Svab et al. (1990) Proc.Natl.Acad.Sci.USA 87:8526-8530, Svab and Maliga (1993) Proc.Natl.Acad.Sci.USA 90:913-917, Svab and Maliga (1993) EMBO are J.12:601-606.Described method depend on by particle gun send the DNA that contains selective marker and by homologous recombination with DNA target plastom.In addition, can preferably express by examining tissue coding and the RNA polymerase plastid orientation, the plastid transgenosis of trans-activation silence is finished plastid and is transformed.This system reported in McBride et al. (1994) Proc.Natl.Acad.Sci.USA 91:7301-7305.

Can consider the difference that the codon between plant nucleolus and this organoid is selected, the polynucleotide of interest with the target chloroplast(id) is optimized, in chloroplast(id), expressing.By this way, can use the preferred codon of chloroplast(id) to synthesize polynucleotide of interest.For example see that U.S. Patent number 5,380,831 is incorporated it into this paper by reference.

" gene " refers to express the polynucleotide of specified protein, and it generally includes encoding sequence (that is the sequence part of encode specific protein matter) (5 ' non-coding sequence) and the adjusting sequence of (3 ' non-coding sequence) before afterwards." natural gene " refer to as the gene of finding in nature, has its oneself adjusting sequence usually." transgenosis " is by the gene in the transgeneic procedure quiding gene group.Therefore, " transgenic plant " are to contain genetically modified plant, and no matter this gene is imported in the specified plant by breeding by transforming still; Therefore, this definition comprises the offspring of initial plant transformed.

III. introduction method

By producing plant of the present invention in polypeptide or the polynucleotide importing plant." importing " means: give plant polynucleotide or polypeptide in the following manner, described mode makes calling sequence enter the inside of vegetable cell.Method of the present invention does not rely on the concrete grammar that sequence is imported plant, as long as described polynucleotide or polypeptide enter the inside of at least one cell of plant.The method that imports polynucleotide or polypeptide to plant is known in the art, and it includes but not limited to, stable conversion method, instantaneous conversion method, virus-mediated method and breeding.

" stable conversion " mean the constructs that is imported into plant be integrated into plant genome and can be by its offspring's heredity." instantaneous conversion " means polynucleotide and is imported in the plant but is not integrated in the genome of plant, and perhaps polypeptide is imported in the plant.

Conversion scheme and being used for imports polypeptide or scheme from polynucleotide to plant can depend on the type that is used for plant transformed or vegetable cell (that is, monocotyledons or dicotyledons) by target surely.The appropriate method that imports polypeptide or polynucleotide in vegetable cell comprises: microinjection (Crossway et al. (1986) Biotechniques 4:320-334), electroporation (Riggs et al. (1986) Proc.Natl.Acad.Sci.USA 83:5602-5606, agrobacterium-mediated conversion (U.S. Patent number 5,563,055 and U.S. Patent number 5,981,840), direct gene shifts (Paszkowski et al. (1984) EMBOJ.3:2717-2722) and biological projectile particle quickens (to see, for example U.S. Patent number 4,945,050, U.S. Patent number 5,879,918, U.S. Patent number 5,886,244; With 5,932,782, Tomes et al. (1995), Plant Cell, Tissue, andOrgan Culture:Fundamental Methods, ed. Gamborg and Phillips (Springer-Verlag, Berlin), McCabe et al. (1988) Biotechnology 6:923-926) and Lec1 transform (WO 00/28058).Also see Weissinger et al. (1988) Ann.Rev.Genet.22:421-477, Sanford et al. (1987) Particalate Scienceand Technology 5:27-37 (onion), Christou et al. (1988) Plant Physiol.87:671-674 (soybean), McCabe et al. (1988) Bio/Technology 6:923-926 (soybean), Finer and McMullen (1991) In Vitro Cell Dev.Biol.27P:175-182 (soybean), Singh etal. (1998) Theor.Appl.Genet.96:319-324 (soybean), Datta et al. (1990) Biotechnology 8:736-740 (rice), Klein et al. (1988) Proc.Natl.Acad.Sci.USA 85:4305-4309 (Zea mays), Klein et al. (1988) Biotechnology 6:559-563 (Zea mays), U.S. Patent number 5,240,855,5,322,783 and 5,324,646, Klein et al. (1988) Plant Physiol.91:440-444 (Zea mays), Fromm et al. (1990) Biotechnology 8:833-839 (Zea mays), " IP.com " is with permanent announcement identifier IPCOM000033402D, their schemes (cotton) that can obtain of IPCOM000033402D and IPCOM000033402D electronic publication in " IP.com " website, Hooykaas-Van Slogteren et al. (1984) Nature (London) 311:763-764, U.S. Patent number 5,736,369 (cereal), Bytebier etal. (1987) Proc.Natl.Acad. Sci.USA 84:5345-5349 (Liliaceae), De Wet etal. (1985), The Experimental Manipulation of Ovule Tissues, ed.Chapmanet al. (Longman, New York), pp.197-209 (pollen), Kaeppler et al. (1990) Plant Cell Reports 9:415-418 and Kaeppler et al. (1992) Theor.Appl.Genet.84:560-566 (conversion of whisker mediation), D ' Halluin et al. (1992) Plant Cell 4:1495-1505 (electroporation), Li et al. (1993) Plant Cell Reports 12:250-255 and Christou and Ford (1995) Annals of Botany 75:407-413 (rice), Osjoda et al. (1996) Nature Biotechnology 14:745-750 (transforming Zea mays) by Agrobacterium tumefaciems, all documents are all incorporated this paper by reference into.

In some particular, can use multiple instantaneous conversion method that the sequence of herbicide tolerant or other hope is provided as plant.This type of instantaneous conversion method includes, but not limited to polypeptide or its variant or fragment directly imported in the plant or with transcript and imports in the plant.These class methods comprise, for example, and microinjection or microparticle bombardment.For example see, Crossway et al. (1986) MolGen.Genet.202:179-185, Nomura et al. (1986) Plant Sci.44:53-58, Hepler et al. (1994) Proc.Natl.Acad.Sci.91:2176-2180 and Hush et al. (1994) The Journal of Cell Science 107:775-784 incorporate them into this paper by reference.Alternatively, can use skill known in the art, art is advanced the instantaneous conversion of herbicide tolerant polynucleotide in the plant.This type of technology comprises that virus carrier system and the mode that discharges with the order that stops DNA precipitate polynucleotide.Thereby, can take place from the transcribing of particle bonded DNA, but it is released to become the frequency that is integrated into genomic state and is reduced greatly.These class methods comprise the particle that uses polymine (PEI, Sigma#P3143) bag quilt.

In some other embodiment, can be by plant be contacted with virus or viral nucleic acid, in plant, to import polynucleotide.Usually, these class methods relate in viral DNA or RNA molecule and mix constructs.Will be appreciated that desired polypeptides can be at first be synthesized as the part of viral polyprotein, more in vivo or externally it is processed by proteolysis, to produce desirable recombinant protein.In addition, will be appreciated that useful promotor can comprise and is used for the promotor of transcribing by viral rna polymerase.The method (relating to viral DNA or RNA molecule) that imports polynucleotide and express its encoded polypeptides in plant is known in the art.For example see U.S. Patent number 5,889,191,5,889,190,5,866,785,5,589,367,5,316,931 and Porta et al. (1996) Molecular Biotechnology 5:209-221; Incorporate them into this paper by reference.

The polynucleotide that are used for known in the art are in the directed method of inserting of Plant Genome specific position.In one embodiment, use the locus specificity recombination system to realize the insertion of polynucleotide in desirable genome position.For example see that WO99/25821, WO99/25854, WO99/25840, WO99/25855, and WO99/25853 incorporate them into this paper by reference.In brief, polynucleotide can be included in the transfer box, and this box flank is two non-recombination recombination sites.Transfer box is imported in the plant, this plant in its genome stable integration target site, this target site flank is two non-recombination recombination sites corresponding to the transfer box site.Suitable recombinase is provided, and transfer box is integrated at target site.Thereby polynucleotide of interest is integrated in the Plant Genome on the specific chromosome position.

Can make to be grown into plant according to conventional methods by cell transformed.See, for example, McCormick et al. (1986) Plant Cell Reports 5:81-84.Make these plant-growths then,, and identify resulting offspring with constitutive expression of desirable phenotypic characteristic with the strain system of same conversion or not homophyletic system pollination.Can grow two generations or many generations, be stabilized maintenance and heredity, gather in the crops seed then to guarantee to have realized the expression of desirable phenotypic characteristic with the expression of guaranteeing desirable phenotypic characteristic.By this way, the invention provides the seed (being also referred to as " transgenic seed ") of conversion, it has stable integration and advances polynucleotide of the present invention in their genome, for example, and expression cassette of the present invention.

In some particular, desired polypeptides or polynucleotide are imported in the vegetable cell.Subsequently, use method known to those skilled in the art to select to have the vegetable cell of quiding gene of the present invention, described method as but be not limited to southern blotting technique analysis, dna sequencing, pcr analysis or phenotype analytical.Change or the plant of modifying or plant part are grown under the plant formation condition and be enough to regulate the concentration of polypeptide in the plant and/or active time by the front embodiment.The plant formation condition is well known in the art, to some extent briefly discusses in this paper other places.

It should also be appreciated that can be by utilizing the polynucleotide that can not instruct protein or rna expression in plant transformed, the level and/or the activity of regulating desired polypeptides.For example, polynucleotide of the present invention can be used to design polynucleotide constructs, this construct can be used for changing or the method for the genome nucleotide sequence of mutation biology in.This type of polynucleotide constructs includes but not limited to, RNA:DNA carrier, RNA:DNA mutational vector, RNA:DNA repair vector, blended duplex oligonucleotide, self complementary RNA:DNA oligonucleotide and the few nuclear of reorganization base.This type of constructs and using method are known in the art.See U.S. Patent number 5,565,350,5,731,181,5,756,325,5,760,012,5,795,972; With 5,871,984; All incorporate them into this paper by reference.Also see WO 98/49350, WO 99/07865, WO99/25821 and Beetham et al. (1999) Proc.Natl.Acad.Sci.USA 96:8774-8778; Incorporate them into this paper by reference.

Therefore will be appreciated that method of the present invention does not rely on complete polynucleotide and mixes to genomic, as long as because cytotropic the mixing of polynucleotide can cause plant or its cell change.In one embodiment of the invention, import polynucleotide in cell after, genome may change.For example, polynucleotide or its part can be incorporated in the genome of plant.The genomic change of the present invention can include but not limited to, the interpolation of Nucleotide in the genome, disappearance and alternative.Although method of the present invention does not rely on interpolation, the disappearance of given number Nucleotide or substitutes, will be appreciated that this type of interpolation, disappearance or alternative at least one Nucleotide that comprises.

Can produce plant of the present invention by any suitable method (comprising breeding).Plant breeding can be used for introducing the feature (flowing into stable purpose transgenosis or hereditary variant or hereditary change of mixing) of wishing to the specific purpose plant lines, and can carry out with any method of several different methods.Pedigree breeding is since two kinds of genotypic hybridization, as a kind of purpose excellent strain with have one kind of multiple additional purpose foundation seed strains hope feature a kind of other original seed inbred strain (for example, the stable polynucleotide of interest that mixes, activity that is conditioned and/or level with desired polypeptides, or the like) hybridization.If two kinds of initial parents do not provide the feature that is hopeful, can in breeding population, comprise other source so.In the pedigree method, make good plant selfing, and in the continuous hybrid offspring, select.In the continuous hybrid offspring, because self-pollination and selection, the heterozygosis condition is given way in the homogeneity strain.Usually, in the pedigree method of breeding, implement five or more continuous hybrid offsprings of selfing and selection: F1 → F2, F2 → F3, F3 → F4, F4 → F ₅, or the like.After the inbreeding of q.s, will increase the seed of the inbred lines that is taken place with the continuous hybrid offspring.In specific embodiments, inbred lines is about 95% or more comprise the allelotrope that isozygotys on its locus.Known in this area have multiple technologies can be used for promoting and quicken breeding (for example, backcrossing) process, for example comprises, uses the greenhouse of the daily cycle with acceleration or growth room, analyzing molecules mark identifying desirable offspring, or the like.

Except be used for producing backcross transform, backcross and can also make up, with the hybrid of modifying the purpose excellent strain and using the excellent strain of this modification to obtain with pedigree breeding.As discussed earlier, backcross and can be used for from a strain---donor parents shifts the proterties that one or more are wished especially to the inbred lines that is known as recurrent parent, described recurrent parent has good generally agronomy feature, but lacks one or more proterties of this hope.Yet, the genotype that identical step can be used to make the offspring shift to recurrent parent but simultaneously by stopping in early days backcrossing and proceeding to keep many components of nonrecurrent parent with selfing and selection.For example, produce F1, as commercial hybrid.This commerce hybrid can be backcrossed with one of its parent system, to produce BC1 or BC2.Make the filial generation selfing, and selected, make inbred lines newly developed have the attribute of several hope of many attributes of recurrent parent and nonrecurrent parent.This method plays leverage for the value and the intensity of the recurrent parent that is used for new hybrid and breeding.

Therefore, one embodiment of the invention are the methods of backcrossing and changing that produce the purpose inbred lines, it comprises step: will at least aly (for example give required proterties with comprising from the plant of purpose inbred lines, herbicide tolerant) mutator gene or genetically modified donor plant hybridization, select and comprise the mutator gene or the genetically modified F1 progeny plants of giving required proterties, and required F1 progeny plants and purpose inbred lines plant are backcrossed.This method also comprises the steps: to obtain the molecule marker spectrum of purpose inbred lines, and uses the selection of molecule marker spectrum to have the offspring of the molecule marker spectrum of required proterties and purpose inbred lines.In an identical manner, this method can be used to produce the F1 hybrid seed, this finishes by adding final step: the required proterties of purpose inbred lines is changed and different plant hybridizations, to obtain comprising mutator gene or the genetically modified F1 hybrid seed of giving required proterties.

Returning selection is to be used for the method that the plant breeding program is improved plant population.This method needs the mutual crossing pollination of bion to form the offspring.The offspring is grown, and select superior progeny by the multiple choices method, it comprises the offspring and the topcross of bion, half sibs offspring, full sibs offspring, selfing.Selected offspring is carried out mutual cross-pollination, to form the offspring of another colony.Plant this colony, and select good plant to be used for mutual cross-pollination once more.The recurrence selection is the one-period process and therefore can repeats repeatedly as needs.Returning the purpose of selecting is to improve the proterties of colony.Then improved colony is used as the source of breeding material, to obtain inbred lines, the parent that it will be used for hybrid or be used as the artificial culture kind.The artificial culture kind is the offspring by the hybridization formation of the inbred lines of several selections.

When selecting to be used in combination with the molecule marker enhanced, mixing selection (mass selection) is useful technology.In mix selecting, select seed from individuality based on phenotype and/or genotype.Then the seed of selecting is mixed, and it is of future generation to be used for growth.Plant population's growth is selected to make by group (bulk) in group's study plot, allow the plant self-pollination, gathers in the crops seed in a large number, uses the seed sample plantation of a large amount of results of future generation then.The part that the orientation pollination can be used as the procedure of breeding replaces self-pollination.

Mutation breeding is to be used for one of many methods of introducing to excellent strain new proterties.Spontaneous generation or artificial induction's sudden change can be as plant breeder's source of variation.The target of induced mutations is the mutation rate that increases desirable proterties.Can increase mutation rate by many different means, described means comprise temperature, long-term seed stores, conditions of tissue culture, radiation, as X ray, gamma-rays (for example, cobalt 60 or caesium 137), neutron, (in atomic reactor, producing the nuclear fission of uranium 235), β-radiation (from radio isotope such as phosphorus 32 or carbon 14 emissions), perhaps uv-radiation (preferably from 2500 to 2900nm), perhaps chemical mutagen is (as base analogue (5-bromo-uridylic), related compound (8-Ethoxycaffeine), microbiotic (Streptonigrin), alkylating agent (sulphur mustard, mustargen, epoxide, ethamine, vitriol, sulfonate, the sulfone class, lactone), trinitride, azanol, nitrous acid or acridine.In case observe the proterties of produce wishing, just can pass through traditional breeding method, as backcross this proterties is incorporated in the existing germplasm by mutagenesis.The details of mutation breeding can be seen " Principals of CultivarDevelopment " Fehr, and 1993 Macmillan Publishing Company incorporate its disclosure into this paper by reference.In addition, the sudden change that produces in other strain can be used to produce the transformation of backcrossing of the excellent strain that comprises this type of sudden change.

IV. regulate the method for expressing

In some embodiments, regulate the activity and/or the level of (that is, increase or reduce) polypeptide.Can realize described polypeptide level and/or active increase by described polypeptide is provided to plant.As this paper other places ground is discussed, known in the art have several different methods can be used to plant that polypeptide is provided, described method includes but not limited to, directly imports polypeptide in plant, and (temporary transient or stable) imports the polynucleotide constructs that coding has desirable active polypeptide in plant.It should also be appreciated that method of the present invention can use the polynucleotide that can not instruct protein or rna expression in plant transformed.Thereby, can be by changing gene or its promotor of coded polypeptide, the level and/or the activity of regulating polypeptide.For example see Kmiec, United States Patent (USP) 5,565,350, Zarling etal., PCT/US93/03868.Therefore, provide the plant through mutagenesis of carrying sudden change in gene, wherein said sudden change increases expression of gene or increases the activity of encoded polypeptide.

In some other embodiment, can reduce or eliminate the activity and/or the level of described polypeptide by in plant, importing the level or the active polynucleotide of known peptide.Described polynucleotide can directly suppress described polypeptide expression by the translation that stops corresponding messenger RNA(mRNA), perhaps suppress described polypeptide expression indirectly by encoding a peptide species, described encoded polypeptides suppresses the gene transcription or the translation of code for said proteins.It is well known in the art being used for suppressing or eliminate the method that gene expresses plant, and any these class methods may be used among the present invention, to suppress expression of gene in the plant.In other embodiments of the present invention, can reduce or suppress the activity of last peptide species by suppress the sequence transformed plant cells of the polypeptide of described polypeptide active with coding.In some other embodiment, can reduce or eliminate the activity of this polypeptide by the gene that destroys coded polypeptide.The present invention includes the plant through mutagenesis, it carries the sudden change in the goal gene, and wherein said sudden change reduces described expression of gene or suppresses the activity of encoded polypeptides.

The activity (being also referred to as gene silencing or gene inhibition) that reduces specific gene is desirable aspect genetically engineered plant several.The several genes silent technology is well known to a person skilled in the art, its include, but not limited to antisense technology (see, for example, Sheehy et al. (1988) Proc.Natl.Acad.Sci.USA 85:8805-8809; With U.S. Patent number 5,107,065,5,453,566 and 5,759,829), (for example suppress altogether, Taylor (1997) Plant Cell 9:1245, Jorgensen (1990) Trends Biotech.8 (12): 340-344, Flavell (1994) Proc.Natl.Acad.Sci.USA 91:3490-3496, Finnegan et al. (1994) Bio/Technology 12:883-888 and Neuhuber et al. (1994) Mol.Gen.Genet.244:230-241), RNA disturbs (Napoliet al. (1990) Plant Cell 2:279-289, U.S. Patent number 5,034,323, Sharp (1999) Genes Dev.13:139-141, Zamore et al. (2000) Cell 101:25-33 and Montgomery et al. (1998) Proc.Natl.Acad.Sci.USA 95:15502-15507), the gene silencing of virus induction (Burton et al. (2000) Plant Cell 12:691-705 and Baulcombe (1999) Curr.Op.Plant Bio.2:109-113), target-RNA-specific ribozyme (Haseloff et al. (1988) Nature 334:585-591), hairpin structure (Smith et al. (2000) Nature 407:319-320, WO 99/53050, WO 02/00904, WO 98/53083, Chuang and Meyerowitz (2000) Proc.Natl.Acad.Sci.USA 97:4985-4990, Stoutjesdijk et al. (2002) Plant Physiol.129:1723-1731, Waterhouse and Helliwell (2003) Nat.Rev.Genet.4:29-38, Pandolfini et al.BMCBiotechnology3:7, U.S. Patent Publication numbers 20030175965, Panstruga et al. (2003) Mol.Biol.Rep.30:135-140, Wesley et al. (2001) Plant J.27:581-590, Wang and Waterhouse (2001) Curr.Opin.Plant Biol.5:146-150; U.S. Patent Publication numbers 20030180945 and WO 02/00904, all incorporate them into this paper by reference), ribozyme (Steinecke et al. (1992) EMBO J.11:1525 with Perriman et al. (1993) Antisense Res.Dev. 3:253), oligonucleotide mediated directed modification (for example, WO03/076574 and WO 99/25853); Zinc to molecule (is for example specified, WO 01/52620, WO03/048345 and WO 00/42219), transposon tagging (Maes et al. (1999) Trends PlantSci.4:90-96, Dharmapuri and Sonti (1999) FEMS Microbiol.Lett.179:53-59, Meissner et al. (2000) Plant J.22:265-274, Phogat et al. (2000) J.Biosci.25:57-63, Walbot (2000) Curr.Opin.Plant Biol.2:103-107, Gai etal. (2000) Nucleic Acids Res.28:94-96, Fitzmaurice et al. (1999) Genetics153:1919-1928, Bensen et al. (1995) Plant Cell7:75-84, Mena et al. (1996) Science 274:1537-1540 and U.S. Patent number 5,962,764); All incorporate them into this paper by reference; Combination with other method well known by persons skilled in the art or aforesaid method.

Will be appreciated that, can make up at least a portion complementary antisense constructs with the messenger RNA(mRNA) (mRNA) of polynucleotide of interest.Make up antisense nucleotide, to hybridize with corresponding mRNA.Can be modified antisense sequences, as long as this sequence can be hybridized with corresponding mRNA and be disturbed it to express.By this way, can use with corresponding sequence by antisense have at least 70%, the antisense constructs of best 80%, better 85% sequence identity.In addition, can use the partial destruction target gene expression of antisense nucleotide.Usually, can use at least 50 Nucleotide, 100 Nucleotide, 200 Nucleotide, 300,400,450,500,550 or the sequence of polynucleotide more.

Polynucleotide can also use with just direction, to suppress the expression of native gene in the plant.It is known in the art using the method for the polynucleotide inhibition of gene expression of just direction.Described method is usually directed to transform plant with DNA construct, and described DNA construct comprises and drives expression promoter in the plant, and this promotor is operably connected at least a portion corresponding to the polynucleotide of native gene transcript.Usually, the sequence of this nucleotide sequence and native gene transcript has height sequence identity, usually greater than about 65%, 85% or 95% sequence identity.See U.S. Patent number 5,283,184 and 5,034,323; Incorporate it into this paper by reference.Thereby, can reduce or eliminate the activity of polypeptide with several different methods.Can reduce or eliminate the activity of polypeptide with more than one method.

In one embodiment; can directly measure the polypeptide expression level; as the level by measuring polynucleotide described in the plant or polypeptide or known metabolite (for example; the level that contains N-ethanoyl glyphosate (" NAG ") in the plant of GAT gene by mensuration) carries out; perhaps measure the polypeptide expression level indirectly; as by in the plant that contains this polypeptide will by as described in the polypeptide proterties of giving, carry out as Herbicid resistant.

V. control method for weed

The invention provides the hybrid that is used for controlling cultural area, the method that prevents to take place in the cultivation area or occur herbicide-resistant weeds, generation crop and increase crop safety.Term " control " and its vocabulary of deriving refer to suppress weed growth, sprouting, breeding and/or propagation as " control weeds "; And/or kill, remove, destroy or reduce the generation of weeds and/or one of active.

Glyphosate of the present invention/ALS inhibitor plant demonstrates the tolerance to the modification of weedicide, therefore allow to use one or more weedicides, also further allow to use combinations of herbicides and still continue the selective control weeds with the concentration that is lower than normal use with the ratio that will significantly injure control plant.In addition, glyphosate of the present invention/ALS inhibitor tolerance plant can admix technical combinations with weedicide, and therefore make the application of chemical insecticide more convenient for the producer, economical and effectively.

Method of the present invention is included in the cultivation area and plants glyphosate of the present invention/ALS inhibitor tolerance plant seed or plant, and in specific embodiments, any crop, crop part, weeds or its cultivation area is used the purpose weedicide of significant quantity.Will be appreciated that, can before or after the kind plant of cultivation area, use weedicide.This type of weedicide is used and can be comprised application glyphosate, ALS inhibitor chemical, perhaps its any combination.In specific embodiments, ALS inhibitor chemicals and glyphosate applied in any combination are tolerated plant in glyphosate/ALS inhibitor, wherein at least two of effective concentration kinds of ALS inhibitor chemical will significantly injure suitable control plant.In a non-limiting embodiments, weedicide comprises the sulfonyl amino carbonyl Triazolinones; Triazolo pyrimidine; Pyrimidyl (sulfo-) benzoic ether; Imidazolone; Triazine; And/or phospho acid (phosphinic acid) is at least a.

In another non-limiting embodiments, the combination of weedicide comprises glyphosate, weed eradication cigarette, chlorimuronethyl, quizalofop and removes the beans green bristlegrass, and wherein said significant quantity is described crop and the tolerance of contrast weeds.As this paper other places ground is discussed, can be used any significant quantity of these weedicides.In specific embodiments, the combination of this weedicide comprises and comprises the about 1110 significant quantity glyphosates to about 1130gai/ hectare; Comprise about 7.5 significant quantity weed eradication cigarettes to about 27.5gai/ hectare; Comprise about 7.5 significant quantity chlorimuronethyls to about 27.5gai/ hectare; Comprise about 50 significant quantity quizalofops to about 70gai/ hectare; Remove the beans green bristlegrass with about 240 to the significant quantity of about 260gai/ hectare.

In other embodiments, use the combination of two kinds of weedicides at least, wherein said combination does not comprise glyphosate.In other embodiments, plant is used at least a ALS inhibitor and glyphosate.The more details that can be used for the multiple combinations of herbicides of the inventive method are discussed to some extent in this paper other places.

In one embodiment, the control method for weed comprises: tolerate crop seed or plant at described ecological region planting with glyphosate/ALS inhibitor, and to the seed of described crop, crop part, described crop or the weedicide of cultural area application significant quantity, wherein said significant quantity comprises

I) when being applied to first kind of contrast crop, crop part, seed or cultural area, this the first kind amount that the contrast crop does not tolerate, wherein said first kind of contrast crop are expressed first kind of polynucleotide of conferring glyphosate tolerance and are not expressed second kind of polynucleotide of coding ALS inhibitor tolerance polypeptide;

Ii) when being applied to second kind of crop, crop part, seed or cultural area, this second kind amount that the contrast crop does not tolerate, wherein said second kind of contrast crop expressed described second kind of polynucleotide and do not expressed described second kind of polynucleotide; With

Iii) when being applied to glyphosate/ALS inhibitor tolerance crop, crop part, seed or cultural area, the amount of tolerance.Weedicide can comprise combinations of herbicides, and described combination can comprise or not comprise glyphosate.In specific embodiments, the combination of weedicide comprises ALS inhibitor chemical as further discussed in detail.

In another embodiment, the control method for weed comprises with glyphosate/ALS inhibitor tolerance crop seed or the described zone of plant growing, and to the seed of described crop, crop part, described crop or the weedicide of cultural area application significant quantity, wherein said significant quantity comprises the level of the recommendation label usage rate that is higher than this crop, and wherein said significant quantity is tolerated when being applied to glyphosate/ALS inhibitor tolerance crop, crop part, seed or cultural area.The weedicide of using can comprise combinations of herbicides, and described combination can comprise or not comprise glyphosate.In specific embodiments, the combination of weedicide comprises at least a ALS inhibitor chemical as further discussed in detail.Other weedicide that can be used for several different methods of the present invention is combined in hereinafter with it and further goes through.

In another non-limiting embodiments, the weedicide of using in any method disclosed herein does not comprise glyphosate, chlorimuronethyl-methyl (chlorimuron-methyl), rimsulfuron 25 (Rimsulfuron), tribenuron-methyl or thiameturonmethyl (thifensufuron-methyl).

A. weedicide type

Any kind of weedicide can be applied to glyphosate/ALS inhibitor tolerance crop, crop part or contain the cultivation area of described crop plants.The classification of weedicide (promptly, weedicide is grouped into classification and subclass) be well known in the art, it comprises the classification (also referring to Retzinger and Mallory-Smith (1997) Weed Technology 11:384-393) of HRAC (Herbicide Resistance ActionCommittee) and WSSA (the Weed Science Society of America).Provided the simple version (note) of HRAC classification in the following Table 1 with corresponding WSSA group.

Can classify to weedicide by their mode of action and/or avtive spot, also the time that can use by their (for example, before sprouting or sprout the back), by the method used (for example, leaf is used or soil is used), perhaps classified by plant absorbing or the mode that influences plant by them.For example, thiameturonmethyl and tribenuron-methyl are applied to crop (for example, corn) leaf and they are usually there by metabolism, and rimsulfuron 25 and chlorimuronethyl then are absorbed by root and the leaf of plant usually." mode of action " refers generally to metabolism metabolism or the physiological process of weedicide so as to suppressing or damaging in the plant, and wherein " avtive spot " is often referred to endophytic physical location or chemical position, at described site herbicide action or direct interaction.Can classify to weedicide in many ways, comprise the mode of action and/or action site (see, for example, table 1).

Usually, the plant of the herbicide tolerant gene of expressing it given the described gene of the tolerance of particular herbicide or other chemical is also given identical class or subclass, as the class in the table 1 or other weedicide in the subclass or the tolerance of chemical.Thereby, in some embodiments of the present invention, class that transgenic plant of the present invention tolerance is identical or more than one weedicide or the chemical in the subclass, for example, PPO inhibitor, sulfonylurea or synthetic plant hormone.

Usually, plant of the present invention can tolerate the dissimilar weedicide weedicide of the different modes of action and/or different action sites (as have) and than the more processing of a large amount weedicide of previously known plant, thereby allow to realize mutually improved weeds control strategy, described strategy is recommended, with incidence and the advantage that reduces the herbicide tolerant weeds.Can effectively control weeds with the particular herbicide combination.

Thereby the invention provides the genetically modified crops plant, it can be based on the advantage of herbicide tolerant weeds kind in the zone of growth transgenosis crop and be selected for crop production.The method that is used to assess the herbicide tolerant of multiple weeds kind is known in the art.The weeds control techniques also is known in the art, carries out shift of crops as the crop of using herbicide-tolerant, and wherein local weeds kind does not tolerate described weedicide.Incidence and the feature of many entity monitorings and open report herbicide tolerant weeds, comprise that the Herbicid resistant effect council (HRAC), U.S. weeds scientific institution and a plurality of state department (for example see, from 2004 Illinois agricultural pest management handbook (Illinois Agricultural Pest Management Handbook) the herbicide tolerant score of multiple broadleaf weeds), and those skilled in the art can use described information to determine should use which crop and combinations of herbicides for the specific region.

These entities have also been announced and have been prevented the generation of herbicide tolerant weeds and/or the hints and tips of appearance and its diffusion of control (for example to see, Owen and Hartzler (2004), 2005 HerbicideManual for Agricultural Professionals, Pub.WC 92 Revised (Iowa StateUniversity Extension, Iowa State University of Science and Technology, Ames, Iowa), Weed Control for Corn, Soybeans, and Sorghum, " Illinois agricultural pest management handbook in 2004 " chapter 2 (University of Illinois Extension, University of Illinois at Urbana-Champaign, Illinois)), Weed Control Guidefor Field Crops, MSU Extension Bulletin E434 (Michigan State University, East Lansing, Michigan)).

The simple version of table 1:HRAC weedicide classification

I.ALS inhibitor (WSSA group 2)

A. sulfonylurea

1. azimsulfuron (Azimsulfuron)

2. chlorimuronethyl (Chlorimuron-ethyl)

3. metsulfuronmethyl (Metsulfuron-methyl)

4. nicosulfuron (Nicosulfuron)

5. rimsulfuron 25 (Rimsulfuron)

6. ethyl methyl (Sulfometuron-methyl)

7. thiameturonmethyl (Thifensulfuron-methyl)

8. tribenuron-methyl (Tribenuron-methyl)

9. amidosulfuron (Amidosulfuron)

10. benbbensulfuronmethyl (Bensulfuron-methyl)

11. chlorine sulphur swells (Chlorsulfuron)

12. cinosulfuron (Cinosulfuron)

13. cyclammonium sulphur swells (Cyclosulfamuron)

14. ethametsulfuron (Ethametsulfuron-methyl)

15. ethoxy sulphur swells (Ethoxysulfuron)

16. flazasulfuron (Flazasulfuron)

17. fluorine pyrrole yellow grand (Flupyrsulfuron-methyl)

18. foramsulfuron (Foramsulfuron)

19. imidazoles sulphur swells (Imazosulfuron)

20. iodine metsulfuronmethyl (Iodosulfuron-methyl)

21. two sulphurs swell (Mesosulfuron-methyl)

22. oxasulfuron (Oxasulfuron)

23. Fluoropyrimidinesulfuron (Primisulfuron-methyl)

24. prosulfuron (Prosulfuron)

25. pyrazosulfuronmethyl (Pyrazosulfuron-ethyl)

26. sulfosulfuron (Sulfosulfuron)

27. triasulfuron (Triasulfuron)

28. trifloxysulfuron (Trifloxysulfuron)

29. sulfonium triflate methyl (Triflusulfuron-methyl)

30. tritosulfuron (Tritosulfuron)

31. frighten careless sulphur first (Halosulfuron-methyl)

32. fluorine pyrrole sulphur swells (Flucetosulfuron)

B. sulfonyl amino carbonyl Triazolinones

1. flucarbazonesodium (Flucarbazone)

2. procarbazone (Procarbazone)

C. triazolo pyrimidine

1. cloransulammethyl (Cloransulam-methyl)

2. flumetsulam (Flumetsulam)

3. diclosulam (Diclosulam)

4. florasulam (Florasulam)

5. metosulam (Metosulam)

6. triazole species sulfanilamide (SN) (Penoxsulam)

7.Pyroxsulam

D. 2-pyrimidinyl oxy (sulfo-) benzoic acids

1. two careless ethers (Bispyribac)

2. pyriftalid (Pyriftalid)

3. pyribenzoxim (Pyribenzoxim)

4. pyrithiobacsodium (Pyrithiobac)

5. KIH 6127 (Pyriminobac-methyl)

E. imidazolone type

1. weed eradication cigarette (Imazapyr)

2. Imazethapyr (Imazethapyr)

3. weed eradication quinoline (Imazaquin)

4. imazapic (Imazapic)

5. methyl miaow oxalic acid (Imazamethabenz-methyl)

6. imazamox (Imazamox)

II. other herbicidal activity composition/extra mode of action

A. acetyl-CoA carboxylase (ACCase) inhibitor (WSSA group 1)

1. aryloxy phenoxy propionic acid class (' FOPs ')

A. quizalofop-P-ethyl

B. dichlorophenoxy propionic acid-methyl

C. alkynes oxalic acid

D. smart azoles diclofop-methyl (Fenoxaprop-P-ethyl)

E. fluazifop-P-butyl

F. propaquizafop

G. haloxyfop-P-methyl (Haloxyfop-P-methyl)

H. cyhalofop-butyl

I. quizalofop-P-ethyl

2. cyclohexane diketone (' DIMs ')

A. alloxydim

B. butroxydim (Butroxydim)

C. clethodim

D. cycloxydim

E. sethoxydim

F. tepraloxydim (Tepraloxydim)

G. tralkoxydim

B. photosystem II inhibitor-HRAC group C1/WSSA organizes 5

1. triazines

A. ametryn (Ametryne)

B. Aunar draws piperazine

C. cyanazine

D. desmetryn (Desmetryne)

E. diformazan third second clean (Dimethametryne)

F. prometon

G. prometryn

H. propazine

I. Simazin

J. simetryn (Simetryne)

K. terbumeton

L. terbuthylazine

M. special fourth grass is clean

N. trietazine

2. Triazinone

A. Hexazinone

B. piperazine humulone

C. metamitron

3. triazolineone

A. amicarbazone (Amicarbazone)

4. uracil

A. methoxyphenone

B. lenacil

C. terbacil (Terbacil)

5. pyridazinone

A. Phenylbutazone

6. phenyl carbamate class

A. desmedipham

B. phenmedipham

C. the inhibitor of photosystem II-HRAC group C2/WSSA organizes 7

1. urea

A. fluometuron

B. methoxydiuron

c.Chlorobromuron

D. chlorotoluron (Chlorotoluron)

E. chlorxuron

F. dimefuron

G. Diuron Tech

H. ethidimuron

I. fenuron

J. isoproturon

K. isouron

L. methabenzthiazuron (Methabenzthiazuron)

M. metobromuron

N. metoxuron

O. monolinuron

P. neburon

Q. Tupersan

R. Metribuzin

2. amides

A. Stam F-34

B. pentanochlor

D. the inhibitor of photosystem II-HRAC group C3/WSSA organizes 6

1. nitrile

A. kill careless oxime

B. bromoxynil

C. ioxynil

(2.Benzothiadiazinone bentazone)

A. bentazone

3.Phenylpyridazines

A. pytidate

b.Pyridafol

E. photosystem-I-transfer transport (Bipyridyliums) (WSSA group 22)

1. diquat

2. paraquat

F.PPO (protoporphyrinogen oxidase) inhibitor (WSSA group 4)

1. phenyl ether

A. acifluorfen-Na

B. bifenox

C. chlomethoxyfen

D. fluoroglycofenethyl (Fluoroglycofen-ethyl)

E. remove the beans green bristlegrass

f.Halosafen

G. the spirit of newborn fluorine grass

H. oxyfluorfen

2. phenyl pyrazoles

A. fluazolate (Fluazolate)

B. pyrrole grass ether (Pyraflufen-ethyl)

3.N-phenyl phthalimide (N-phenylphthalimides)

A. cinidon-ethyl (Cinidon-ethyl)

B. flumioxazin

C. methylarsonic acid (Flumiclorac-pentyl)

4. thiadiazole

A. the careless fluorine (Fluthiacet-methyl) of rattling away

B. thiadiazoles grass amine (Thidiazimin)

5. furodiazole

A. oxadiazon

B. oxadiargyl (Oxadiargyl)

6. triazolineone

A. azoles humulone (Carfentrazone-ethyl)

B. sulfentrazone

7. oxazolidinedione class

A. amyl group oxazolone

8. pyrimidine dione class

A. benzfendizone (Benzfendizone)

b.Butafenicil

Other

a.Pyrazogyl

B. profluazol (Profluazol)

G. bleaching: suppress the carotenoid biosynthesizing (WSSA group 12) of phytoene desaturase step (PDS)

1. pyridazinone

A. monometflurazone

2. pyridine carboxamides class

A. general grass gram

B. fluorine pyrrole acyl grass amine (Picolinafen)

Other

A. beflubutamid (Beflubutamid)

B. fluridone

C. fluorochloridone (Flurochloridone)

D. flurtamone

H. bleaching: suppress 4-hydroxy phenyl-pyruvic acid-dioxygenase enzyme (4-HPPD) (WSSA group 28)

1. triketone

A. Mesotrione (Mesotrione)

B. sulphur humulone (Sulcotrione)

2. isoxazole class

A. isoxachlorotole (Isoxachlortole)

B. isoxaflutole (Isoxaflutole)

3. pyrazoles

A. benzofenap

b.Pyrazoxyfen

C. pyrazoxyfen (Pyrazolynate)

Other

A. benzo dicyclo ketone (Benzobicyclon)

I. bleaching: suppress carotenoid biosynthesizing (unknown target) (WSSA group 11 and 13)

1. triazole species (WSSA group 11)

A. ammonia azoles

2. isothiazole two ketones (WSSA group 13)

A. clomazone

3. ureas

A. fluometuron

3. phenyl ether

A. aclonifen

J. suppress the EPSP synthase

1. glycine class (WSSA group 9)

A. glyphosate

B. sulphosate

K. suppress glutamine synthetase

1. phospho acid class

A. Glufosinate ammonium

B. two third ammonia phosphorus (Bialaphos)

L. suppress DHP (dihydropteroate) synthetic (WSSA group 18)

1 carbamates

A. sulphur grass spirit

M. the microtubule assembling suppresses (WSSA group 3)

1. dinitraniline

A. benfluralin

B. standing grain is pacified

C. dinitramine

D. fourth fluchloralin

E. oryzalin

F. pendimethalin

G. trifluralin

2. phosphoamide class

A. amiprophosmethl (Amiprophos-methyl)

B. butamifos (Butamiphos)

3. pyridines

A. dithiopyr

B. the thiophene grass is decided (Thiazopyr)

4. benzamides

A. pronamide (Pronamide)

B. special propylamine

5. benzene dicarboxylic acid class

A. chlorthal dimethyl

N. suppress mitotic division/microtubule and organize WSSA group 23)

1. carbamates

A. Chlorpropham

B. propham

C. carbetamide

O. suppress cell fission and (as the mechanism that proposes, suppress very-long-chain fatty acid; WSSA group 15)

1. chloroacetyl amine

A. acetochlor

B. alachlor

C. Butachlor technical 92

D. dimethachlor

e.Dimethanamid

F. metazachlor

G. the third careless amine

H. pethoxamid (Pethoxamid)

I. the third careless amine

J. propachlor

K. propisochlor

L. P DimethenamidP

2. ethanamide

A. dianiline

B. R-7465

C. naproanilide

3. oxo ethanamide

A. flufenacet (Flufenacet)

B. mefenacet

4. tetrazolinone

A. four cafenstroles (Fentrazamide)

Other

A. anilofos

B. cafenstrole (Cafenstrole)

C. indanofan (Indanofan)

D. piperophos

P. it is synthetic to suppress cell walls (Mierocrystalline cellulose)

1. nitrile (WSSA group 20)

A. Niagara 5006

B. chlorthiamide (Chlorthiamid)

2. benzamides (isoxaben (WSSA group 21))

A. isoxaben

3. triazolo carboxyl acylamide (flupoxam)

A. flupoxam

Q. uncoupling (cytolemma destruction): (WSSA group 24)

1. dinitrophenols

a.DNOC

B. dinoseb

C. dinoseb acetate phenol

R. it is synthetic to suppress lipid by the inhibition outside the AAC

1. thiocarbamates (WSSA group 8)

A. butylate

B. cycloate

C. dimepiperate

d.EPTC

E. esprocarb

F. molinate

G. orbencarb

H. pebulate

I. prosulfocarb

J. thiobencarb

K. tiocarbazil

L. tri_allate

M. vernolate

2. phosphorodithioate

A. bensulide

3. benzene furans

A. benfuresate

B. ethofumesate

4. halogenated-chain acid (WSSA group 26)

a.TCA

B. dalapon

C. fluorine propionic acid (Flupropanate)

S. synthetic auxin (IAA-sample) (WSSA group 4)

1. phenoxy carboxylic acid

A. clomeprop

b.2，4-D

C.2-first-4 chloropropionic acid

2. benzoic acids

A. dicamba 98

B. Amiben

c.TBA

3. pyridine carboxylic acid

A. clopyralid

B. fluroxypyr

C. picloram

d.Tricyclopyr

4. quinoline carboxylic acid

A. quinclorac

B. quinmerac

5. other (ethyl benazolin)

A. ethyl benazolin

T. suppress the plant hormone transhipment

1.Phthalamates; Semicarbazone class (WSSA group 19)

A. naptalam

B. diflufenzopyr-Na (Diflufenzopyr-Na)

U. other mechanism of action

1. arylamino propionic acid

A. cyclodextrin-M-methyl/-sec.-propyl

2.Pyrazolium

A. difenzoquat

3. organic arsenical

a.DSMA

b.MSMA

Other

A. bromobutide

B. cinmethylin

C. cumyluron (Cumyluron)

D. Dazomet

E. methyldymron

F. daimuron

G. ethobenzanid (Etobenzanid)

H. ioxynil

I. metamsodium (Metam)

J. go barnyard grass peace (Oxaziclomefone)

K. oleic acid

L. n-nonanoic acid

M. pyributicarb

In one embodiment, a kind of ALS inhibitor or at least two kinds of ALS inhibitor are applied to glyphosate/ALS inhibitor tolerance crop or cultivation area.In a non-limiting embodiments, the combination of ALS weedicide does not comprise glyphosate.Can use the ALS inhibitor with any effective ratio that can effectively control weeds and significantly not injure crop.In specific embodiments, with at least a ALS inhibitor of the horizontal application that will significantly injure suitable control plant.In other embodiments, use at least a ALS inhibitor with the recommendation label rate of utilization that is higher than crop.In other embodiments, use the mixture of ALS inhibitor with the rate of utilization that is lower than recommendation, and weeds are controlled by selectivity still.The weedicide that suppresses acetolactate synthase (being also referred to as the acetohydroxy acid synthase) and therefore can be used for the inventive method comprises the sulfonylurea of listing as table 1, comprises that its agricultural goes up suitable salt (for example, sodium salt); As the sulfuryl amino carboxyl Triazolinones of listing in the table 1, comprise that its agricultural goes up suitable salt (for example, sodium salt); As the triazolo pyrimidine of listing in the table 1, comprise that its agricultural goes up suitable salt (for example, sodium salt); As 2-pyrimidinyl oxy (sulfo-) phenylformic acid of listing in the table 1, comprise that its agricultural goes up suitable salt (for example, sodium salt); With imidazolone, comprise that its agricultural goes up suitable salt (for example, sodium salt) as listing in the table 1.In some embodiments, method of the present invention comprises the use sulfonylurea, and it is not that chlorimuronethyl, chlorine sulphur are grand, rimsulfuron 25, thiameturonmethyl or tribenuron-methyl.

Also have in the certain methods at other, can be applied to glyphosate/ALS inhibitor tolerant plants or their cultivation area with the glyphosate of other purpose combinations of herbicides.The limiting examples of glyphosate formulation provides in table 2.In specific embodiments, glyphosate is the form of salt, as ammonium salt, sec.-propyl ammonium salt, sylvite, sodium salt (comprising the sesquialter sodium salt) or trimesium (perhaps being called sulphosate).Also have in some embodiments at other, the glyphosate of synergy amount and the mixture of ALS inhibitor (as sulfonylurea) combination are applied to glyphosate/ALS inhibitor tolerant plants or their cultivation area.

Table 2. glyphosate formulation relatively

Thereby, in some embodiments, in the method for growth glyphosate/ALS inhibitor tolerance crop, use transgenic plant of the present invention by the weedicide of appliable plant tolerance. is by this way; Combined treatment with one or more herbicides; Described herbicide includes but not limited to: Acetochlor; Acifluorfen and its sodium salt; Aclonifen; Methacrylaldehyde (2-methacrylaldehyde); Alachlor; Alloxydimsodium; Ametryn; Amicarbazone; Amidosulfuron; Chlorine Fampridine acid (aminopyralid); The ammonia azoles; Amcide Ammate; Anilofos; The spirit of sulphur grass; Aunar draws piperazine; Azimsulfuron; Beflubutamid; Benazolin; The ethyl benazolin; Bencarbazone; Benfluralin; Benfuresate; Bensulfuron-methyl; Bensulide; Bentazon; Benzo dicyclo ketone; Benzofenap; Bifenox; Bilanafos (bilanafos); Two careless ethers and its sodium salt; Methoxyphenone; Bromobutide; The herbicide oxime; Brominal; The Brominal caprylate; Butachlor; Butafenacil (butafenacil); Butylamine phosphorus; Ground standing grain peace; Butroxydim; Butylate; Cafenstrole; Carbetamide; The azoles humulone; Catechol; Chlomethoxyfen; Amiben; Bromax; Methyl-chlorflurenol; Chloridazon; Chlorimuronethyl; Chlortoluron; Chlorpropham; Chlorine sulphur is grand; Chlorthal dimethyl; Chlorthiamide; Cinidon-ethyl; Cinmethylin; Cinosulfuron; Clethodim; Alkynes oxalic acid; Clomazone; Clomeprop; Clopyralid; Clopyralid-olamine; Cloransulammethyl; CUH-35 (2-methoxy ethyl 2-[[[4-chloro-2-fluoro-5-[(1-methyl-2-propynyl) oxygen base] phenyl] (3-fluorobenzene formoxyl) amino] carbonyl]-1-cyclohexene-1-formic acid); Cumyluron; Cyanazine; Cycloate; Cyclammonium sulphur is grand; Cycloxydim; Cyhalofop-butyl; 2; 4-D and its butotyl; Butyl; Iso-octyl and isopropyl esters and its dimethyl ammonium; Diethanol amine and triethanolamine salt; Daimuron; Dalapon; Dalapon-sodium; Dazomet; 2; 4-DB and its dimethyl ammonium; Potassium and sodium salt; Desmedipham; Desmetryn; Mediben and its diethylene glycol (DEG) ammonium; Dimethyl Ammonium; Potassium and sodium salt; Dichlobenil; 2; 4-drips propionic acid; Dichlorophenoxy propionic acid-methyl; Diclosulam; The difenzoquat metilsulfate; General grass gram; Diflufenzopyr; Dimefuron; Dimepiperate; Dimethachlor; Dimethametryn; Dimethenamid; Dimethenamid-P; Dimethipin; Dimethyl arsinic acid and its sodium salt; Dinitramine; Dinoseb acetate phenol; Dianil; The diquat dibromide dibromide; Dithiopyr; Diuron; DNOC; Endothall; EPTC; Esprocarb; The fourth fluchloralin; Ethametsulfuron; Ethofumesate; Ethoxyfenethyl (ethoxyfen); Ethoxysulfuron; Ethobenzanid; Fenoxaprop-P-ethyl; Fenoxaprop-P-ethyl; Fentrazamide; Fenuron; Fenuron-TCA; Cyclodextrin-methyl; Cyclodextrin-M-isopropyl; Cyclodextrin-M-methyl; Flazasulfuron; Florasulam; Fluazifop-butyl; Fluazifop-P-butyl; Flucarbazonesodium; Flucetosulfuron; Fluchloralin; Flufenacet; Flufenpyrethyl (flufenpyr); Flufenpyrethyl-ethyl; Flumetsulam; Flumiclorac pentyl; Flumioxazin; Fluometuron; Fluoroglycofen-ethyl; Yellow grand and its sodium salt of fluorine pyrrole; Florencol; Florencol-butyl; Fluridone; Fluorochloridone; Fluroxypyr; Flurtamone; The careless fluorine of rattling away; Except the beans green bristlegrass; Foramsulfuron; Ioxynil-ammonium; Grass ammonium phosphine; Grass ammonium phosphine; Glyphosate and its salt; Such as ammonium salt; The isopropyl ammonium; Sylvite; Sodium salt (comprising sesquialter sodium) and trimesium (or being called sulphosate); Frighten careless sulphur first; Fluazifop-butyl (haloxyfop-etotyl); Haloxyfop-P-methyl; Hexazinone; HOK-201 (N-(2; The 4-difluorophenyl)-1; 5-dihydro-N-(1-Methylethyl)-and 5-oxygen-1-[(tetrahydrochysene-2H-pyrans-2-yl) methyl]-4H-1; 2; 4-triazole-4-formamide); Methyl miaow oxalic acid; Imazamox; AC 263222 (imazapic); Arsenal; Scepter; Scepter-ammonium; Imazethapyr; Imazethapyr-ammonium; Imidazoles sulphur is grand; Indanofan; The iodine metsulfuron-methyl; Ioxynil; The ioxynil caprylate; Ioxynil-sodium; Isoproturon; Isouron; Isoxaben; Isoxaflutole; Isoxachlorotole; The spirit of breast fluorine grass; Lenacil; Linuron; The maleic acid hydrazides; MCPA and its salt are (for example; The MCPA-Dimethyl Ammonium; MCPA-potassium and MCPA-sodium; Ester (for example; The MCPA-2-ethylhexyl; MCPA-butotyl) and thioesters (for example; MCPA-second thioesters); MCPB and its salt are (for example; MCPB-sodium) and ester (for example; The MCPB-ethyl); 2-first-4 chloropropionic acid; 2-first-4 chloropropionic acids-P; Mefenacet; Fluorine grass sulphur; Two sulphurs are grand; Mesotrione; Metham-sodium-sodium; Metamifop (metamfop); Metamitron; Metazachlor; Fluorine grass sulphur; Methanearsonic acid and its calcium; Single ammonium; Single sodium and disodium salt; Methyldymron; Metobenzuron; Metobromuron; The third careless amine; S-isopropyl methoxalamine (metholachlor); Metosulam; Metoxuron; The piperazine humulone; Metsulfuron-methyl; Molinate; Afesin; Naproanilide; Proproanmide; Alanap; Neburea; Nicosulfuron; Monometflurazone; Orbencarb; Oryzalin; Oxadiargyl; Oxadiazon; Oxasulfuron; Go the barnyard grass peace; Oxyfluorfen; The Aerial gramoxone dichloride; Pebulate; N-nonanoic acid; Pendimethalin; Triazole type sulfanilamide (SN); Pentanochlor; The amyl group oxazolone; Yellow grass volt (perfluidone); Pethoxyamid; Phenmedipham; Picloram; Picloram-potassium; Fluorine pyrrole acyl grass amine; Pinoxaden; Piperofos; The third careless amine; Fluoropyrimidinesulfuron; Prodiamine; Clefoxidim (profoxydim); Prometon; Prometryn; Propachlor; Stam F-34; Propaquizafop; Propazine; Chem hoe; Propisochlor; Procarbazone (propoxycarbazone); Propyzamide; Prosulfocarb; Prosulfuron; Pyraclonil (pyraclonil); Pyrrole grass ether; Pyrasulfotole; Pyrazogyl; Pyrazoxyfen (pyrazolynate); Pyrazoxyfen; Pyrazosulfuron; Pyribenzoxim; Pyributicarb; Pytidate; Pyriftalid; KIH 6127; Pyrimisulfan; Pyrithiobac-sodium; Pyrithiobac-sodium sodium; Pyroxsulam; Dichloro quinolinic acid; Quinmerac; Quinoclamine; Quizalofop-ethyl-ethyl; Quizalofop-ethyl-P-ethyl; Quizalofop-ethyl-P-tefuryl; Rimsulfuron 25; Sethoxydim; Tupersan; Simazin; Symetryne; The sulphur humulone; Sulfentrazone; Ethyl methyl; Sulfosulfuron; 2; 3,6-TBA; TCA; TCA-sodium; Special propylamine; Metribuzin; Tefuryltrione; Tembotrione; Tepraloxydim; Terbacil; Terbumeton; Garagard; Terbutryn; P DimethenamidP; The thiophene grass is fixed; Thiencarbazone; Thiameturonmethyl; Benthiocarb; Tiocarbazil; Topramezone; Tralkoxydim; Tri-allate; Triasulfuron; Pyrazosulfuron (triaziflam); Tribenuron-methyl; Triclopyr; Triclopyr-butotyl; Triclopyr-three second ammonium; Tridiphane; Trietazine; Trifloxysulfuron; Trefanocide; The sulfonium triflate methyl; Tritosulfuron and vernolate.

Weedicide that other is suitable and agrochemicals are known in the art, those as describing among the WO2005/041654.Other weedicide also comprises campelyco, as Alternariadestruens Simmons, and Colletotrichum gloeosporiodes (Penz.) Penz. ﹠amp; Sacc., Drechsiera monoceras (MTB-951), myrothecium verrucaria (Myrothecium verrucaria) (Albertini ﹠amp; Schweinitz) Ditmar:Fries, Phytophthora palmivora (Butl.) Butl. and Puccinia thlaspeos Schub.The combination of multiple weedicide can cause at weeds greater than the effect of add up (that is, collaborative) and/or to crop or at the plant of other hope less than the effect that adds up (that is safe).In some cases, glyphosate with have similar control spectrum but the combination of other weedicide of the different modes of action will be especially favourable for the generation that prevents resistant weed.Those skilled in the art can easily determine the weedicide significant quantity of any concrete weedicide by simple experimental technique.

Can weedicide be divided in groups and/or subgroup about their mode of action as above-mentioned, perhaps can they be divided in groups and/or subgroup according to their chemical structure.

The sulfoamide weedicide has the sulphonamide part (S (O) as the basic molecular structure feature ₂NH-).Point out ground as this paper, sulphonamide herbicides especially comprises sulfonylurea herbicide, sulfonyl amino carbonyl triazolinone herbicide and triazolo pyrimidine weedicide.In sulfonylurea herbicide, sulphonamide partly is sulfonylurea bridge (S (O) ₂NHC (O) NH (R)-) in component.In sulfonylurea herbicide, the alkylsulfonyl of sulfonylurea bridge is terminal directly or by Sauerstoffatom or optionally be connected on the ring-type or non-annularity group that is replaced by the typical case by amino or the methylene radical that replaces.In the opposite ends of sulfonylurea bridge, amino (it can have substituting group such as methyl, and (R is CH ₃) the replacement halogen) be connected on the heterocyclic group, typically, described group is asymmetric pyrimidine or triazine ring, has one or more substituting groups, as methyl, ethyl, trifluoromethyl, methoxyl group, oxyethyl group, methylamino, dimethylamino, ethylamino and halogen.In the sulfonyl amino carbonyl triazolinone herbicide, sulphonamide partly is sulfonyl amino carbonyl bridge (S (O) ₂NHC (O)-), in sulfuryl amino-carbonyl triazole quinoline herbicides, the substituted benzyl ring of the terminal connection usually of the alkylsulfonyl of sulfonyl amino carbonyl bridge.In the opposite ends of sulfonyl amino carbonyl bridge, carbonyl is connected to 1 of triazol inone ring, and typically, it is replaced by the group such as alkyl and alkoxyl group.In the triazolo pyrimidine weedicide; the alkylsulfonyl of sulphonamide part partly is connected to the 2-position of substituted [1,2,4] triazolo pyrimidine member ring systems and the N-terminal of sulphonamide part is connected to substituted aryl; typically; phenyl, perhaps alternatively, the N-terminal of alkylsulfonyl part is connected to substituted [1; 2; 4] the alkylsulfonyl end of the 2-position of triazolo pyrimidine member ring systems and sulphonamide part is connected to substituted aryl, typically, and pyridyl.

The representative that is used for sulfonylurea herbicide of the present invention is those of following formula:

Wherein:

J is selected from

J is R ¹³SO ₂N (CH ₃)-;

R is H or CH ₃

R ¹Be F, Cl, Br, NO ₂, C ₁-C ₄Alkyl, C ₁-C ₄Haloalkyl, C ₃-C ₄Cycloalkyl, C ₂-C ₄Haloalkenyl group, C ₁-C ₄Alkoxyl group, C ₁-C ₄Halogenated alkoxy, C ₂-C ₄Alkoxyl group alkoxyl group, CO ₂R ¹⁴, C (O) NR ¹⁵R ¹⁶, SO ₂NR ¹⁷R ¹⁸, S (O) _nR ¹⁹, C (O) R ²⁰, CH ₂CN or L;

R ²Be H, F, Cl, Br, I, CN, CH ₃, OCH ₃, SCH ₃, CF ₃Or OCF ₂H;

R ³Be Cl, NO ₂, CO ₂CH ₃, CO ₂CH ₂CH ₃, C (O) CH ₃, C (O) CH ₂CH ₃, C (O)-cyclopropyl, SO ₂N (CH ₃) ₂, SO ₂CH ₃, SO ₂CH ₂CH ₃, OCH ₃Or OCH ₂CH ₃

R ⁴Be C ₁-C ₃Alkyl, C ₁-C ₂Haloalkyl, C ₁-C ₂Alkoxyl group, C ₂-C ₄Haloalkenyl group, F, Cl, Br, NO ₂, CO ₂R ¹⁴, C (O) NR ¹⁵R ¹⁶, SO ₂NR ¹⁷R ¹⁸, S (O) _nR ¹⁹, C (O) R ²⁰Or L;

R ⁵Be H, F, Cl, Br or CH ₃

R ⁶Be C ₁-C ₃Alkyl, optional with 0-3 F, a 0-1 Cl and 0-1 C ₃-C ₄The alkoxyl group acetoxyl group replaces, or R ⁶Be C ₁-C ₂Alkoxyl group, C ₂-C ₄Haloalkenyl group, F, Cl, Br, CO ₂R ¹⁴, C (O) NR ¹⁵R ¹⁶, SO ₂NR ¹⁷R ¹⁸, S (O) _nR ¹⁹, C (O) R ²⁰Or L;

R ⁷Be H, F, Cl, CH ₃Or CF ₃

R ⁸Be H, C ₁-C ₃Alkyl or pyridyl;

R ⁹Be C ₁-C ₃Alkyl, C ₁-C ₂Alkoxyl group, F, Cl, Br, NO ₂, CO ₂R ¹⁴, SO ₂NR ¹⁷R ¹⁸, S (O) _nR ¹⁹, OCF ₂H, C (O) R ²⁰, C ₂-C ₄Haloalkenyl group or L;

R ¹⁰Be H, Cl, F, Br, C ₁-C ₃Alkyl or C ₁-C ₂Alkoxyl group;

R ¹¹Be H, C ₁-C ₃Alkyl, C ₁-C ₂Alkoxyl group, C ₂-C ₄Haloalkenyl group, F, Cl, Br, CO ₂R ¹⁴, C (O) NR ¹⁵R ¹⁶, SO ₂NR ¹⁷R ¹⁸, S (O) _nR ¹⁹, C (O) R ²⁰Or L;

R ¹²Be halogen, C ₁-C ₄Alkyl or C ₁-C ₃Alkyl sulphonyl;

R ¹³Be C ₁-C ₄Alkyl

R ¹⁴It is allyl group, propargyl or trimethylene oxide-3-base; Or R ¹⁴Be C ₁-C ₃Alkyl, optional halogen, the C of being independently selected from ₁-C ₂At least one member of alkoxyl group and CN replaces;

R ¹⁵Be H, C ₁-C ₃Alkyl or C ₁-C ₂Alkoxyl group;

R ¹⁶Be C ₁-C ₂Alkyl;

R ¹⁷Be H, C ₁-C ₃Alkyl, C ₁-C ₂Alkoxyl group, allyl group or cyclopropyl;

R ¹⁸Be H or C ₁-C ₃Alkyl;

R ¹⁹Be C ₁-C ₃Alkyl, C ₁-C ₃Haloalkyl, allyl group or propargyl;

R ²⁰Be the optional C that is replaced by halogen ₁-C ₄Alkyl, C ₁-C ₄Haloalkyl or C ₃-C ₅Cycloalkyl;

N is 0,1 or 2;

L is

L ¹Be CH ₂, NH or O;

R ²¹Be H or C ₁-C ₃Alkyl;

X is H, C ₁-C ₄Alkyl, C ₁-C ₄Alkoxyl group, C ₁-C ₄Halogenated alkoxy, C ₁-C ₄Haloalkyl, C ₁-C ₄Halogenated alkylthio, C ₁-C ₄Alkylthio, halogen, C ₂-C ₅Alkoxyalkyl, C ₂-C ₅Alkoxyl group alkoxyl group, amino, C ₁-C ₃Alkylamino or two (C ₁-C ₃Alkyl) amino;

Y is H, C ₁-C ₄Alkyl, C ₁-C ₄Alkoxyl group, C ₁-C ₄Halogenated alkoxy, C ₁-C ₄Alkylthio, C ₁-C ₄Halogenated alkylthio, C ₂-C ₅Alkoxyalkyl, C ₂-C ₅Alkoxyl group alkoxyl group, amino, C ₁-C ₃Alkylamino, two (C ₁-C ₃Alkyl) amino, C ₃-C ₄Alkene oxygen base, C ₃-C ₄Alkynyloxy group, C ₂-C ₅Alkylthio alkyl, C ₂-C ₅Alkyl sulfinyl alkyl, C ₂-C ₅Alkyl sulphonyl alkyl, C ₁-C ₄Haloalkyl, C ₂-C ₄Alkynyl, C ₃-C ₅Cycloalkyl, azido-or cyano group; With

Z is CH or N;

And satisfy following condition: (i) when one or two of X and Y be C ₁During halogenated alkoxy, Z is CH; (ii) when X was halogen, Z was CH, and Y is OCH ₃, OCH ₂CH ₃, N (OCH ₃) CH ₃, NHCH ₃, N (CH ₃) ₂Or OCF ₂H.It should be noted that single liquid herbicide composition of planting of the present invention, it comprises the sulfonylurea of one or more formulas I, wherein works as R ⁶When being alkyl, described alkyl is not substituted.

Expection to be used for representative triazolo pyrimidine weedicide of the present invention be following formula those:

Wherein:

R ²²And R ²³Be selected from halogen, nitro, C independently of one another ₁-C ₄Alkyl, C ₁-C ₄Haloalkyl, C ₁-C ₄Alkoxyl group, C ₁-C ₄Halogenated alkoxy or C ₂-C ₃Alkoxy carbonyl;

R ²⁴Be H, halogen, C ₁-C ₂Alkyl or C ₁-C ₂Alkoxyl group;

W is-NHS (O) ₂-or-S (O) ₂NH-;

Y ¹Be H, C ₁-C ₂Alkyl or C ₁-C ₂Alkoxyl group;

Y ²Be H, F, C1, Br, C ₁-C ₂Alkyl or C ₁-C ₂Alkoxyl group;

Y ³Be H, F or methoxyl group;

Z ¹Be CH or N;

Z ²Be CH or N;

And satisfy following condition: Y ¹And Y ²In at least one is not H.

In above the Ma Kushi of representational triazolo pyrimidine weedicide being described, when W be-during NHS (O) 2-, the alkylsulfonyl end of sulphonamide part is connected to [1,2,4] triazolo pyrimidine loop systems, and as W be-S (O) ₂During NH-, the N-terminal of sulphonamide part is connected to [1,2,4] triazolo pyrimidine loop systems.

In content mentioned above, use separately or when being used for compound, word comprises the straight or branched alkyl as the term " alkyl " in " alkylthio " or " haloalkyl ", as methyl, ethyl, n-propyl, sec.-propyl or different butyl isomer." cycloalkyl " for example comprises, cyclopropyl, cyclobutyl and cyclopentyl." thiazolinyl " comprises straight or branched alkene, as vinyl, 1-propenyl, 2-propenyl and different thiazolinyl isomer." thiazolinyl " also comprises polyenoid, as 1, and 2-propadiene base and 2,4-butadienyl, " alkynyl " comprise straight or branched alkynes, as ethynyl, 1-proyl, 2-propynyl and different butynyl isomer.Alkynyl can also comprise and comprise a plurality of triple-linked parts, as 2, and 5-hexadiyne base." alkoxyl group " for example comprises, methoxyl group, oxyethyl group, positive propoxy, isopropoxy and different butoxy isomer." alkoxyalkyl " refers to that the alkoxyl group on the alkyl replaces.The example of " alkoxyalkyl " comprises CH ₃OCH ₂, CH ₃OCH ₂CH ₂, CH ₃CH ₂OCH ₂, CH ₃CH ₂CH ₂CH ₂OCH ₂And CH ₃CH ₂OCH ₂CH ₂" alkoxyl group alkoxyl group " refers to that the alkoxyl group on the alkoxyl group replaces." alkene oxygen base " comprises straight or branched alkene oxygen base section.The example of " alkene oxygen base " comprises H ₂C=CHCH ₂O, (CH ₃) CH=CHCH ₂O and CH ₂=CHCH ₂CH ₂O." alkynyloxy group " comprises the alkynyloxy group part of straight or branched.The example of " alkynyloxy group " comprises HC ≡ CCH ₂O and CH ₃C ≡ CCH ₂O." alkylthio " comprises side chain or straight chain alkylthio part, as methylthio group, ethylmercapto group and different rosickyite base isomer." alkylthio alkyl " refers to that the alkylthio on the alkyl replaces.The example of " alkylthio alkyl " comprises CH ₃SCH ₂, CH ₃SCH ₂CH ₂, CH ₃CH ₂SCH ₂, CH ₃CH ₂CH ₂CH ₂SCH ₂And CH ₃CH ₂SCH ₂CH ₂" alkyl sulfinyl alkyl " and " alkyl sulphonyl alkyl " comprise corresponding sulfoxide and sulfone respectively.Define other substituting group similarly, for example " alkylamino ", " dialkyl amido ".

The total number of carbon atoms is by " C in the substituting group _i-C _i" prefix points out that wherein i and j are 1 to 5 number.For example, C ₁-C ₄Alkyl is represented methyl to butyl, comprises various isomer.As further example, C ₂Alkoxyalkyl is represented CH ₃OCH ₂C ₃Alkoxyalkyl is represented for example CH ₃CH (OCH ₃), CH ₃OCH ₂CH ₂Or CH ₃CH ₂OCH ₂C ₄Alkoxyalkyl represents that example comprises CH with containing the multiple isomer of the alkyl of the alkoxyl group replacement of 4 carbon atoms altogether ₃CH ₂CH ₂OCH ₂And CH ₃CH ₂OCH ₂CH ₂

Comprise fluorine, chlorine, bromine or iodine as the term in " haloalkyl " " halogen " separately or at the compound word.In addition, when being used for the compound word as " haloalkyl ", described alkyl can partially or completely be replaced by halogen atom, and described halogen atom can be identical or different.The example of " haloalkyl " comprises F ₃C, ClCH ₂, CF ₃CH ₂And CF ₃CCl ₂Term " halogenated alkoxy ", " halogenated alkylthio " or the like are similar to term " haloalkyl " definition.The example of " halogenated alkoxy " comprises CF ₃O, CCl ₃CH ₂O, HCF ₂CH ₂CH ₂O and CF ₃CH ₂O.The example of " halogenated alkylthio " comprises CCl ₃S, CF ₃S, CCl ₃CH ₂S and ClCH ₂CH ₂CH ₂S.

Following sulfonylurea herbicide has been illustrated and can be used for sulfonylurea of the present invention: amidosulfuron (N-[[[[(4; 6-dimethoxy-2-pyrimidyl) amino] carbonyl] amino] alkylsulfonyl]-N-methyl Toluidrin); azimsulfuron (N[[(4; 6-dimethoxy-2-pyrimidyl) amino] carbonyl]-1-methyl-4-(2-methyl-2H-tetrazolium-5-yl)-1H-pyrazoles-5-sulphonamide); benbbensulfuronmethyl (2-[[[[[(4; 6-dimethoxy-2-pyrimidyl) amino] carbonyl] amino] alkylsulfonyl] methyl] methyl benzoate); chlorimuronethyl (2-[[[[(4-chloro-6-methoxyl group-2-pyrimidyl) amino] carbonyl] amino] alkylsulfonyl] ethyl benzoate); chlorine sulphur swells (2-chloro-N-[[(4-methoxyl group-6-methyl isophthalic acid; 3; 5-triazine-2-yl) amino] carbonyl] benzsulfamide); cinosulfuron (N-[[(4; 6-dimethoxy-1; 3,5-triazine-2-yl) amino] carbonyl]-2-(2-methoxy ethoxy) benzsulfamide); cyclammonium sulphur grand (N-[[[2-(cyclopropyl carbonyl) phenyl] amino] alkylsulfonyl]-N ¹-(4; 6-dimethoxypyridin-2-yl) urea); ethametsulfuron (2-[[[[[4-oxyethyl group-6-(methylamino)-1; 3; 5-triazine-2-yl] amino] carbonyl] amino] alkylsulfonyl] methyl benzoate); ethoxysulfuron ([[(4; 6-dimethoxy-2-pyrimidyl) amino] carbonyl] thionamic acid 2-oxyethyl group phenyl ester); flazasulfuron (N-[[(4; 6-dimethoxy-2-pyrimidyl) amino] carbonyl]-3-(trifluoromethyl)-2-pyridine sulfonamide); fluorine pyrrole sulphur swells (1-[3-[[[[(4; 6-dimethoxy-2-pyrimidyl) amino] carbonyl] amino] alkylsulfonyl]-the 2-pyridyl]-2-fluoro propyl group methoxyacetic acid ester); yellow grand (the 2-[[[[(4 of fluorine pyrrole; 6-dimethoxy-2-pyrimidyl) amino] carbonyl] amino] alkylsulfonyl]-6-(trifluoromethyl)-3-pyridine carboxylic acid methyl esters); foramsulfuron (2-[[[[(4; 6-dimethoxy-2-pyrimidyl) amino] carbonyl] amino] alkylsulfonyl]-4-(formyl radical amino)-N; the N-dimethyl benzamide); frighten careless sulphur first (3-chloro-5-[[[[(4; 6-dimethoxy-2-pyrimidyl) amino] carbonyl] amino] alkylsulfonyl]-1-methyl isophthalic acid H-pyrazoles-4-methyl-formiate); imidazoles sulphur swells (2-chloro-N-[[(4; 6-dimethoxy-2-pyrimidyl) amino] carbonyl] imidazo [1; 2-a] pyridine-3-sulphonamide); iodine metsulfuronmethyl (4-iodo-2-[[[[(4-methoxyl group-6-methyl isophthalic acid; 3; 5-triazine-2-yl) amino] carbonyl] amino] alkylsulfonyl] methyl benzoate); two sulphurs swell (2-[[[[(4; 6-dimethoxy-2-pyrimidyl) amino]-carbonyl] amino] alkylsulfonyl]-the 4-[[(methyl sulphonyl) amino] methyl] methyl benzoate); metsulfuronmethyl (2-[[[[(4-methoxyl group-6-methyl isophthalic acid; 3; 5-triazine-2-yl) amino] carbonyl] amino] alkylsulfonyl] methyl benzoate); nicosulfuron (2-[[[[(4; 6-dimethoxy-2-pyrimidyl) amino] carbonyl] amino] alkylsulfonyl]-N; N-dimethyl-3-pyridine carboxamide); oxasulfuron (2-[[[[(4; 6-dimethyl-2-pyrimidyl) amino] carbonyl] amino] alkylsulfonyl] phenmethyl 3-azetidine ester); Fluoropyrimidinesulfuron (2-[[[[[4; 6-two (trifluoromethoxy)-2-pyrimidyl] amino] carbonyl] amino] alkylsulfonyl]-methyl benzoate); prosulfuron (N-[[(4-methoxyl group-6-methyl isophthalic acid; 3; 5-triazine-2-yl) amino] carbonyl]-2-(3; 3; the 3-trifluoro propyl) benzsulfamide); pyrazosulfuronmethyl (5-[[[[(4; 6-dimethoxy-2-pyrimidyl) amino] carbonyl] amino] alkylsulfonyl]-1-methyl isophthalic acid H-pyrazoles-4-ethyl formate); rimsulfuron 25 (N-[[(4; 6-dimethoxy-2-pyrimidyl) amino] carbonyl]-3-(ethylsulfonyl)-2-pyridine sulfonamide); ethyl methyl (2-[[[[(4; 6-dimethyl-2-pyrimidyl) amino] carbonyl] amino] alkylsulfonyl] methyl benzoate); sulfosulfuron (N-[[(4; 6-dimethoxy-2-pyrimidyl) amino] carbonyl]-2-(ethylsulfonyl) imidazo [1; 2-a] pyridine-3-sulphonamide); thiameturonmethyl (3-[[[[(4-methoxyl group-6-methyl isophthalic acid; 3; 5-triazine-2-yl) amino] carbonyl] amino] alkylsulfonyl]-2-thiobenzoic acid methyl esters); triasulfuron (2-(2-chloro oxyethyl group)-N-[[(4-methoxyl group-6-methyl isophthalic acid; 3; 5-triazine-2-yl) amino] carbonyl] benzsulfamide); tribenuron-methyl (2-[[[[N-(4-methoxyl group-6-methyl isophthalic acid; 3; 5-triazine-2-yl)-the N-methylamino]-carbonyl] amino] alkylsulfonyl] methyl benzoate); trifloxysulfuron (N-[[(4; 6-dimethoxy-2-pyrimidyl) amino] carbonyl]-3-(2; 2; the 2-trifluoro ethoxy)-the 2-pyridine sulfonamide); sulfonium triflate methyl (2-[[[[[4-dimethylamino)-6-(2; 2; the 2-trifluoro ethoxy)-1; 3; 5-triazine-2-yl] amino] carbonyl]-amino] alkylsulfonyl]-the 3-methyl-toluate) and tritosulfuron (N-[[[4-methoxyl group-6-(trifluoromethyl)-1; 3,5-triazine-2-yl] amino] carbonyl]-2-(trifluoromethyl) benzsulfamide).

Following triazolo pyrimidine weedicide illustrates and can be used for triazolo pyrimidine of the present invention: cloransulammethyl (3-chloro-2-[[(5-oxyethyl group-7-fluorine [1; 2; 4] triazolo [1; 5-c] pyrimidine-2-base) alkylsulfonyl] amino] methyl benzoate; (N-(2 for diclosulam; the 6-dichlorophenyl)-5-oxyethyl group-7-fluorine [1; 2; 4] triazolo [1; 5-c] pyrimidine-2-sulphonamide; (N-(2 for florasulam; the 6-difluorophenyl)-8-fluoro-5-methoxyl group [1; 2; 4] triazolo [1; 5-c] pyrimidine-2-sulphonamide); flumetsulam (N-(2, the 6-difluorophenyl)-5-methyl [1,2; 4] triazolo [1; 5-a] pyrimidine-2-sulphonamide); metosulam (N-(2,6-two chloro-3-aminomethyl phenyls)-5,7-dimethoxy [1; 2; 4] triazolo [1,5-a] pyrimidine-2-sulphonamide); triazole species sulfanilamide (SN) (2-(2, the 2-difluoroethoxy)-N-(5; 8-dimethoxy [1; 2,4] triazolo [1,5-c] pyrimidine-2-base)-6-(trifluoromethyl) benzsulfamide) and pyroxsulam (N-(5; 7-dimethoxy [1; 2,4] triazolo [1,5-a] pyrimidine-2-base)-2-methoxyl group-4-(trifluoromethyl)-3-pyridine sulfonamide).

Below the sulfonyl amino carbonyl triazolinone herbicide for example understand and can be used for sulfonyl amino carbonyl Triazolinones of the present invention: flucarbazonesodium (4; 5-dihydro-3-methoxyl group-4-methyl-5-oxo-N-[[2-(trifluoromethoxy) phenyl] alkylsulfonyl]-1H-1; 2; 4-triazole-1-carboxylic acid amides) and procarbazone (2-[[[(4; 5-dihydro-4-methyl-5-oxo-3-propoxy--1H-1; 2, the 4-triazol-1-yl) carbonyl] amino] alkylsulfonyl] methyl benzoate).

Extra weedicide comprises disclosed weedicide among phenmedipham, Triazolinones and the WO2006/012981, by reference with its complete this paper that incorporates into.

Method of the present invention also comprises uses the described crop seed of capacity or at least a weedicide of plant tolerance to the crop in field and weeds; as glyphosate; medical midbodies of para (ortho)-hydroxybenzoic acetone acid dioxygenase enzyme inhibitors (for example; Mesotrione or sulphur humulone); the phytoene desaturase inhibitor (for example; general grass gram); the pigment synthetic inhibitor; sulphonamide; imidazolone; two third ammonia phosphorus; phosphinothricin; two third ammonia phosphorus; glufosinates; azafenidin (azafenidin); butafenacil (butafenacil); sulphosate; grass ammonium phosphine; triazolo pyrimidine; 2-pyrimidinyl oxy (sulfo-) benzoic ether; or sulfonyl amino carbonyl Triazolinones; and acetyl-CoA carboxylase inhibitor; as quizalofop-P-ethyl; the synthetic plant hormone is as quinclorac; or the protox inhibitor does not significantly injure crop plants with the control weeds.

B. the significant quantity of weedicide

Usually, the significant quantity that is applied to the weedicide in field is enough selective control weeds and the amount of not remarkably influenced crop." weeds " used herein refer to concrete regional undesired plant.On the contrary, " crop plants " used herein refers to the plant at concrete zone needs, as soybean plants.Thereby, in some embodiments, weeds are non-crop plants or non-crop species, and in some embodiments, weeds are the crop species that are eliminated from concrete zone, for example, semiprecious and/or non-transgenic maize plant, the perhaps soybean plants in the field of maize planting in the field of plantation transgenic corns.Weeds can be categorized into two organizes greatly: monocotyledons and dicotyledons.

Can control (that is, kill or injure) many plant species by weedicide described herein.Therefore, method of the present invention can be used to control these plant species (when not needing them (, when they are weeds)).These plant species comprise crop plants, and the species that are considered to weeds usually, include but not limited to that species are as blackgrass (Alopecurusmyosuroides), paddy green bristlegrass (giant foxtail) (Setaria faberi), lady's-grass (large crabgrass) (Digitaria sanguinalis), Suriname's grass (Surinam grass) (Brachiaria decumbens), havergrass (wild oat) (Avena fatua), Siberian cocklebur (common cocklebur) (Xanthiumpensylvanicum), purslane (common lambsquarters) (Chenopodium album), mater convolvulus (morning glory) (Ipomoea coccinea), ash dish (pigweed) (Amaranthusspp.), velvetleaf (Abutilion theophrasti), barnyard grass grass (common barnyardgrass) (Echinochloa crus-galli), Bermuda grass (bermudagrass) (Cynodon dactylon), cheatgrass brome (downy brome) (Bromus tectorum), Herba Eleusines Indicae (goosegrass) (Eleusineindica), Herba Setariae Viridis (green foxtail) (Setaria viridis), Italian ryegrass (Italianryegrass) (Lolium multiflorum), Johnson grass (Johnsongrass) (Sorghumhalepense), lesser canarygrass (Phalaris minor), windgrass (Aperaspica-venti), crow sharp thousand grass (wooly cupgrass) (Erichloa villosa), nutgrass flatsedge (yellownutsedge) (Cyperus esculentus), cyclophanes thread (common chickweed) (Stellariamedia), artemisiifolia (common ragweed) (Ambrosia artemisiifolia), summer cypress (Kochiascoparia), horseweed (horseweed) (Conyza canadensis), rigid ryegrass (Lolium rigidum), Herba Eleusines Indicae (Eleucine indica), America vacation fluffy (hairyfleabane) (Conyza bonariensis), buckhorn plantain (buckhorn plantain) (Plantagolanceolata), torrid zone spiderwort (Commelina benghalensis), Herba seu Flos Convolvuli arvensis (fieldbindweed) (Convolvulus arvensls), Rhizoma Cyperi (purple nutsedge) (Cyperusrotundus), redvine (Brunnichia ovata), big fruit sesbania (hemp sesbania) (Sesbania exaltata), reaping hook beans (sicklepod) (Senna obtusifolia), blue stem Sunflower Receptacle (Texas blueweed) (Helianthus ciliaris) and unicorn (Devil ' s claws) (Proboscidea louisianica).In other embodiments, weeds comprise Herbicid resistant naked barley grass, for example, and glyphosate resistance naked barley grass, paraquat resistance naked barley grass, ACC enzyme inhibitors resistance naked barley grass and nonselective herbicide resistance naked barley grass.In some embodiments, the contiguous crop plants in undesired plant position.

Ground as used herein, " selective control " mean that most weeds are significantly injured or kill in the cultivation area, and if crop plants also is present in the field, so most crop plants are not significantly injured.Thereby, when at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more weeds significantly injured or killed, if and crop plants also is present in the field, when the crop plants less than 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5% or 1% was significantly injured or kills, the method for thinking was significantly controlled weeds.

In some embodiments, glyphosate of the present invention/ALS inhibitor tolerance plant is not handled in the particular herbicide of plant with following dose application causes remarkable damage, described dosage is equal to every acre or per hectare at least 0.5,1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,20,25,30,35,40,45,50,55,60,65,70,75,80,85,90,95,100,110,120,150,170,200,300,400,500,600,700,800,800,1000,2000,3000,4000,5000 or more grams or ounce (1 ounce=activeconstituents 29.57ml) or the ratio of commerical prod or herbicide formulations, and significantly damage suitable control plant by identical processing.

In some particular, the significant quantity of ALS inhibitor weedicide comprises per hectare at least about 0.1,1,5,10,25,50,75,100,150,200,250,300,350,400,450,500,600,700,750,800,850,900,950,1000,2000,3000,4000,5000 or (1 ounce=29.57ml) activeconstituents of more grams or ounce.In other embodiments, the significant quantity of ALS inhibitor weedicide comprises per hectare at least about (1 ounce=29.57ml) activeconstituents of 0.1-50, about 25-75, about 50-100, about 100-110, about 110-120, about 120-130, about 130-140, about 140-150, about 150-200, about 200-500, about 500-600, about 600-800, about 800-1000 or more grams or ounce.Any ALS inhibitor, for example listed those can be with these horizontal applications in the table 1.

In some other embodiment, the significant quantity of sulfonylurea comprises per hectare at least 0.1,1,5,10,25,50,75,100,150,200,250,300,350,400,450,500,600,700,800,900,1000,5000 or (1 ounce=29.57ml) activeconstituents of more grams or ounce.In other embodiments, the significant quantity of sulfonylurea comprises per hectare at least about 0.1-50; about 25-75; about 50-100; about 100-110; about 110-120; about 120-130; about 130-140; about 140-150; about 150-160; about 160-170; about 170-180; about 190-200; about 200-250; about 250-300; about 300-350; about 350-400; about 400-450; about 450-500; about 500-550; about 550-600; about 600-650; about 650-700; about 700-800; about 800-900; about 900-1000; (1 ounce=29.57ml) activeconstituents of about 1000-2000 or more grams or ounce.Can in table 1, provide with the representative sulfonylurea of this horizontal application.

In some other embodiment, the sulfonyl amino carbonyl Triazolinones; triazolo pyrimidine; the significant quantity of 2-pyrimidinyl oxy (sulfo-) benzoic ether and imidazolone (imidazolinone) can comprise per hectare at least about 0.1; 1; 5; 10; 25; 50; 75; 100; 150; 200; 250; 300; 350; 400; 450; 500; 550; 600; 650; 700; 750; 800; 850; 900; 950; 1000; 1050; 1100; 1150; 1200; 1250; 1300; 1350; 1400; 1500; 1550; 1600; 1650; 1700; 1800; 1850; 1900; 1950; 2000; 2500; 3500; 4000; 4500; 5000 or (1 ounce=29.57ml) activeconstituents of more grams or ounce.In other embodiments, sulfonyl amino carbonyl Triazolinones; triazolo pyrimidine; the significant quantity of 2-pyrimidinyl oxy (sulfo-) benzoic ether or imidazolone comprises per hectare at least about 0.1-50; about 25-75; about 50-100; about 100-110; about 110-120; about 120-130; about 130-140; about 140-150; about 150-160; about 160-170; about 170-180; about 190-200; about 200-250; about 250-300; about 300-350; about 350-400; about 400-450; about 450-500; about 500-550; about 550-600; about 600-650; about 650-700; about 700-800; about 800-900; about 900-1000; (1 ounce=29.57ml) activeconstituents of about 1000-2000 or more grams or ounce.

The additional range of the significant quantity of weedicide for example can be seen, in the multiple publication of University Extension department.See, for example, Bernards et al. (2006) Guide for WeedManagement in Nebraska ( Www.ianrpubs.url.edu/sendlt/ec130); Regher etal. (2005) Chemical Weed Control for Fields Crops, Pastures, Rangeland, and Noncropland, Kansas State University Agricultural Extension Stationand Corporate Extension Service; Zollinger et al. (2006) North DakotaWeed Control Guide, North Dakota Extension Service and Www.weeds.iastate.eduIowa State University Extension, all incorporate them into this paper by reference.

In some embodiments of the present invention, glyphosate is applied at least one strain plant of cultivation area and/or cultivation area, the ratio of using is every acre of 8 to 32 ounces of acid equivalents, perhaps the following acid equivalent that is limited between 10,12,14,16,18,20,22,24,26,28 and 30 ounces every acre of range of application is limited to the acid equivalent between 12,14,16,18,20,22,24,26,28,30 and 32 ounces every acre on the range of application.In other embodiments, with per hectare at least 1,5,10,20,30,40,50,60,70,80,90 or higher ounce use glyphosate (1 ounce=29.57ml).In some embodiments of the present invention; the sulfonylurea weedicide is applied at least one strain plant in field and/or field; the ratio of using is every acre of 0.04 to 1.0 ounce of activeconstituents; or range of application following is limited to every acre 0.1,0.2,0.4,0.6 to 0.8 ounce of activeconstituents, is limited to every acre 0.2,0.4,0.6 on the range of application, 0.8 to 1.0 ounce of activeconstituents (1 ounce=29.57ml).

As known in the art, contain identical activeconstituents as the glyphosate herbicidal of a class, but activeconstituents is as a kind of existence in multiple different salt and/or the preparation.Yet, the weedicide of known inhibition ALS its activeconstituents with and chemical formulation aspect different.Determining of the activeconstituents that exists in the familiar herbicide formulations of those skilled in the art and/or the amount of acid equivalent for designated volume and/or weight.

In some embodiments, use ALS inhibitor weedicide.The ratio that ALS inhibitor weedicide is applied to crop, crop part, seed or cultivation area can be any ratio disclosed herein.In specific embodiments, the ratio of ALS inhibitor weedicide is about 0.1 to about 5000gai/ hectare, and about 0.5 arrives about 150gai/ hectare to about 300gai/ hectare or about 1.

Usually, particular herbicide being no more than every year 1,2,3,4,5,6,7 or 8 time, or being no more than and being applied to specific field (with any plant of growth wherein) for 1,2,3,4 or 5 time each vegetative period.

" with the combined treatment of weedicide " or " with the applied in any combination of weedicide in " crop, cultivation area or field mean: every kind of weedicide and/or chemical with a part that is considered to described combination are handled, make and realize required effect, that is, make the selective control weeds and crop is not subjected to remarkable infringement.In some embodiments, the weeds of every kind of herbicide sensitive are demonstrated the infringement that every kind of herbicide treatment causes, described infringement is that add up or collaborative.The application of every kind of weedicide and/or chemical can be simultaneously or can use at different time, as long as realize required effect.In addition, can before kind of plant, use.

Be used for the ratio that other herbicidal activity components in proportions in the weedicide of the inventive method and the herbicidal composition is generally by weight 5000: 1 to 1: 5000,1000: 1 to 1: 1000,100: 1 to 1: 100,10: 1 to 1: 10 or 5: 1 to 1: 5.Those skilled in the art can easily determine optimum proportion based on desirable weeds control spectrum.In addition, any combination of the scope of disclosed multiple weedicide in the method for the invention also can application table 3.

Thereby, in some embodiments, the invention provides and be used for improving one's methods of selective control weeds in field, wherein total weedicide is used can be below 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5% or 1% of amount that uses in other method.Similarly, in some embodiments, the amount that is used for the particular herbicide of selective control weeds in field can be for being used for other method, promptly not utilize below 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5% or 1% of amount of this particular herbicide in the method for plant of the present invention.

In some embodiments, glyphosate of the present invention/ALS inhibitor tolerance plant is benefited from synergistic effect, and wherein the polypeptide of conferring glyphosate (being GAT) resistance and at least a ALS inhibitor tolerance polypeptide herbicide tolerant of giving is greater than every kind of gene being given the desired herbicide tolerant of herbicide tolerant simple combination that contains their transgenic plant separately separately.See, for example, McCutchen et al. (1997) J.Econ.Entomol.90:1170-1180; Priesler etal. (1999) J.Econ.Entomol.92:598-603.As used herein, as the situation the term " synergetic property " in " synergistic effect " or " Synergistic herbicidal combination " or " Synergistic herbicidal compositions ", " working in coordination with ", " synergistically " or its term of deriving refer to, under described situation, weedicide, as the biological activity of the combination of at least the first kind of weedicide and second kind of weedicide greater than weedicide biological activity sum separately.Usually pass through F.C.Kull, et al., Applied Microbiology9,538 (1961) described methods are determined the synergetic property that adopts " index of cooperation (SI) " to represent.Also see Colby, S.R., " Calculating Synergistic and Antagonistic Responses ofHerbicide Combinations, " Weeds 15,20-22 (1967).

Under some other situation, the herbicide tolerant of giving glyphosate of the present invention/ALS inhibitor tolerance plant adds up; That is, the herbicide tolerant gene herbicide tolerant spectrum of giving is can give the herbicide tolerant that contains their transgenic plant separately respectively from every kind of gene of simple combination to expect.Two or more weedicides at crucial weed species add up and/or synergistic activity will increase overall validity and/or reduce to control the actual amount of the required activeconstituents of described weeds.When observing synergetic property, plant of the present invention can demonstrate and can demonstrate the tolerance to extra weedicide or other chemical outside those tolerances that expection demonstrated tolerance to the tolerance of the more high dosage of weedicide or ratio and/or plant.For example, the plant that contains GAT gene and HRA gene can demonstrate the tolerance to organo phosphorous compounds such as sterilant and/or 4-medical midbodies of para (ortho)-hydroxybenzoic acetone acid dioxygenase enzyme inhibitors.

Thereby, for example, glyphosate of the present invention/ALS inhibitor tolerant plants can demonstrate greater than the expection, to the tolerance of multiple weedicide, described weedicide comprises glyphosate, ALS inhibitor chemistry and sulfonylurea weedicide.Glyphosate of the present invention/ALS inhibitor tolerant plants can demonstrate the tolerance to particular herbicide or combinations of herbicides, its for contain only single herbicide tolerant gene (it gives the tolerance to identical weedicide or combinations of herbicides) suitable control plant tolerance at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 12%, 15%, 17%, 20%, 22%, 25%, 27%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 100%, 125%, 150%, 175%, 200%, 300%, 400%, 500% or higher.Thereby, glyphosate of the present invention/ALS inhibitor tolerant plants is compared the damage that reduces that can demonstrate for the same dose weedicide with suitable control plant, perhaps they can be compared according to plant and reply the weedicide of high dosage more and demonstrate the damage of same degree.Therefore, in specific embodiments, be used for particular herbicide ratio that the field selectivity contains weeds will be used for the amount of this particular herbicide of other method (promptly not utilizing the method for plant of the present invention) big by 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90%, 100% or bigger.

In an identical manner, in some embodiments, glyphosate of the present invention/ALS inhibitor tolerance plant is compared the tolerance that demonstrates the raising of the particular formulations of herbicidal activity composition with suitable control plant.Weedicide is sold as preparation commercial, and it also comprises other composition usually except described herbicidal activity composition; These compositions are intended to strengthen the effect of described activeconstituents usually.This type of other composition for example can comprise, safener (safener) and adjuvant (are seen, for example, Green and Foy (2003) " Adjuvants:Tools for Enhancing HerbicidePerformance; " Weed Biology and Management, ed.Inderjit (KluwerAcademic Publishers, Holland)).Thereby, glyphosate of the present invention/ALS inhibitor tolerance plant to the particular herbicide preparation (for example can demonstrate, specific for the obtainable weedicide product of commercial sources) tolerance, its be contain give to the tolerance of identical herbicide formulations only single plant the herbicide tolerant gene suitable control plant tolerance at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 12%, 15%, 17%, 20%, 22%, 25%, 27%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 100%, 125%, 150%, 175%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000%, 1100%, 1200%, 1300%, 1400%, 1500%, 1600%, 1700%, 1800%, 1900% or 2000% or higher.

In some embodiments, glyphosate of the present invention/ALS inhibitor tolerant plants demonstrates the tolerance of the raising of the class of weedicide or weedicide (at least a other herbicide tolerant is given the tolerance to the class of described weedicide or weedicide), and demonstrates the tolerance (at least a other weedicide or chemical have with glyphosate or corresponding to the weedicide of described at least a other herbicide tolerant gene different mechanism of action or basis) to the raising of at least a other weedicide or chemical.This wonderful benefit of the present invention can be used for growing method of crop, described method comprises: the multiple combination with chemical is handled, and described chemical for example comprises, other chemical of the crop that is used to grow.Thereby, for example, glyphosate of the present invention/ALS inhibitor tolerance maize plant (that is GAT/HRA plant) also can demonstrate the Chlorpyrifos 94 tolerance, Chlorpyrifos 94 is a kind of organic phosphoric acid sterilant of general, and it disturbs the ability of corn metabolism weedicide by interference cell cytochrome p 450 gene.Thereby; the present invention also provides transgenic plant and its using method; described plant comprises the sequence (being the GAT gene) and the sulfonylurea herbicide tolerant gene of conferring glyphosate tolerance, and it demonstrates the tolerance to the raising of the chemical that influences cytochrome P450 gene.In some embodiments, glyphosate of the present invention/ALS inhibitor tolerance gene also demonstrates the tolerance to the raising of dicamba 98.In these embodiments, when glyphosate and sulfonylurea weedicide exist, may be tangible to the tolerance of the raising of dicamba 98.

In some other method, combinations of herbicides is applied to glyphosate of the present invention/ALS inhibitor tolerant plants, wherein said combinations of herbicides adds up in generation aspect the control weeds or synergistic effect.This type of combinations of herbicides can be so that application rate be reduced, and the more undesired plant of wide region is able to Be Controlled, improves control to undesired plant with still less application, the faster outbreak of herbicidal activity, and perhaps weeding activity is prolonged.

" herbicidal composition that adds up " has and approximates the viewed active weeding activity of component separately." collaborative combinations of herbicides " has weeding activity, and it is higher than the desired activity of observed activity when component is used separately separately.Therefore, theme disclosed by the invention provides the Synergistic herbicidal combination, and wherein the weeds control degree of this mixture surpasses the summation of weedicide control separately.In some embodiments, the weeds control degree of mixture surpasses weedicide control summation separately with any statistics significant quantity, for example comprise about 1% to 5%, about 5% to about 10%, about 10% to about 20%, about 20% to about 30%, about 30% to 40%, about 40% to about 50%, about 50% to about 60%, about 60% to about 70%, about 70% to about 80%, about 80% to about 90%, about 90% to about 100%, about 100% to 120% or bigger.In addition, " cooperative effective quantity " of weedicide refers to that a kind of weedicide causes the essential amount of synergistic effect in the another kind of weedicide that exists in the herbicidal composition.Thereby term " synergistic agent " and its term of deriving refer to the active material of enhanced activity composition, and activeconstituents is the material that is used for obtaining from it biological effect that exists in the preparation, for example, and weedicide.

Therefore, in some embodiments, theme disclosed by the invention provides method for weed in the control cultivation area.In some embodiments, this method comprises: (a) at this ecological region planting crop seed or crop plants, wherein crop seed or crop plants comprise: (i) first kind of polynucleotide of the polypeptide of coding conferring glyphosate tolerance, and it is operably connected in this crop seed or crop plants on the promoters active; Second kind of polynucleotide of the ALS inhibitor tolerance of (ii) encoding polypeptide, it is operably connected in this crop seed or crop plants on the promoters active; (b) to the herbicidal composition of weeds, crop plants, crop part, cultivation area or its applied in any combination significant quantity, the ALS inhibitor that said composition comprises the glyphosate of at least a cooperative effective quantity and cooperative effective quantity (for example, but be not limited to the sulfonylurea weedicide) or its agronomy on suitable salt, wherein at least a: (i) cooperative effective quantity of glyphosate is lower than when not having the sulfonylurea weedicide amount of the required glyphosate of control weeds; (ii) the cooperative effective quantity of ALS inhibitor weedicide is lower than the amount of controlling the required ALS inhibitor of weeds when not having glyphosate; (iii) its combination; And wherein the significant quantity of this herbicidal composition is by the described weeds in crop seed or crop plants tolerance and the control cultivation area.

As on the ground of more detailed description above, in some embodiments, first kind of polynucleotide encoding glyphosate-N-acetyl-transferase.More specifically, in some embodiments, first kind of polynucleotide encoding glyphosate tolerant 5-enol acetonyl shikimic acid-3-phosphate synthase or glyphosate tolerant glyphosate oxidoreductase.In addition, more detailed description ground as mentioned, ALS inhibitor tolerance polypeptide comprises the acetolactate synthase polypeptide of sudden change.In some embodiments, the acetolactate synthase polypeptide of sudden change comprises HRA.

In some embodiments, the herbicidal composition that is used for control method for weed disclosed by the invention comprises the glyphosate and the sulfonylurea weedicide of cooperative effective quantity.In further embodiment, Synergistic herbicidal compositions disclosed by the invention comprise glyphosate and be selected from metsulfuronmethyl, chlorine sulphur is grand and the sulfonylurea weedicide of triasulfuron.

In specific embodiments, the Synergistic herbicidal combination also comprises adjuvant, as the adjuvant based on ammonium sulfate, as ADD-UP

(Wenkem S.A., Halfway House, Midrand, South Africa).In extra embodiment, Synergistic herbicidal compositions disclosed by the invention comprises extra weedicide, for example, and the 2-pyrimidinyl oxy of significant quantity (sulfo-) benzoic acid herbicides.In some embodiments, 2-pyrimidinyl oxy (sulfo-) benzoic acid herbicides comprises two careless ether, for example (VELOCITY , ValentU.S.A.Corp., Walnut Creek, California, the U.S.) or its agronomy on suitable salt.

In some embodiments of the method for the undesired plant of control disclosed by the invention, with glyphosate occur (emergence) preceding, the back appears or occur before and be applied to unwanted plant or plant crop after the appearance; And with ALS inhibitor weedicide (that is sulfonylurea weedicide) before appearance, the back appears or occur before and occur after be applied to unwanted plant or plant crop.In other embodiments, glyphosate and ALS inhibitor weedicide (that is sulfonylurea weedicide) are used together or are used separately.In other embodiments, plantation purpose plant, for example Shang Mian step (a) is used Synergistic herbicidal compositions before at least one time, for example, and top step (b).

Although glyphosate of the present invention/ALS inhibitor tolerant plants tolerates many weedicides, they do not tolerate some weedicides, for example, and dinitraniline, ACCase and chloracetamide herbicide.Thereby the method that comprises weeds control of the present invention also can be utilized these to handle and control glyphosate/ALS inhibitor tolerant plants, as planting or " spontaneous " glyphosate/ALS inhibitor tolerant plants of occurring of the field of growing different crops once more.

Make crop (for example, soybean crops) Sheng Chang field only includes but not limited to following with the unmanageable weeds of glyphosate: erigeron (for example, Conyza canadensis), the rigid rye grass (for example, Lolium rigidum), Herba Eleusines Indicae (for example, Eleusine indica), Italian ryegrass (for example, Lolium multiflorum), America vacation fluffy (hairy fleabane) (for example, Conyzabonariensis), buckhorn plantain (for example, Plantago lanceolata), the common rye grass (for example, Ambrosia artemisifolia), mater convolvulus (morning glory) (for example, Ipomoea spp.), waterhemp (for example, Amaranthus spp.), Herba seu Flos Convolvuli arvensis (for example, Convolvulus arvensis), nutgrass flatsedge (for example, Cyperus esculentus), commonlambsquarters (for example, Chenopodium album), Wild Buckwheat Rhizome (wild buckwheat) (for example, Polygonium convolvulus), suede leaf grass (velvetleaf) (for example, Abutilontheophrasti), summer cypress (kochia) (for example, Kochia scoparia) and Asia Herba Commelinae (Asiatic dayflower) (for example, Commelina spp.).In the peptide zone of finding these type of weeds, glyphosate of the present invention/ALS inhibitor tolerant plants (GAT-HRA plant) can be particularly useful for handling field (with any crop that therefore grows Tanaka) with the combinations of herbicides that will cause unacceptable infringement to the crop plants that does not contain these two kinds of polynucleotide.Tolerance glyphosate and other weedicide; as sulfonylurea; the plant of the present invention that imidazolone, triazolo pyrimidine, pyrimidyl (sulfo-) phenylformic acid and/or sulfonyl amino carbonyl triazolinone herbicide and tolerance have at least a other weedicide of different binding modes or action site can be particularly useful for such situation, and wherein weeds tolerate at least two kinds of identical weedicides in the weedicide that tolerates with plant.By this way, may make plant of the present invention improve control to the weeds that tolerate more than one weedicides.

For example, be used to make some processing commonly used of the weeds in field control of commercial crops of the present invention (for example comprising soybean) growth to comprise glyphosate and randomly, 2,4-D; Yet this combination has some shortcomings.Particularly, some weeds kinds can not be made up good control and this combination by this and can not play a role well for the control of the weeds in the cold snap.Another processing commonly used of soybean Tanaka weeds control is a sulfonylurea weedicide chlorimuronethyl; it has remarkable residual activity in soil; thereby the weed species that occurs after all is kept selective pressure, for the growth and the diffusion generation advantageous environment of sulfonylurea resistant weed.Yet, can be (for example with following weedicide, chlorimuronethyl) and combinations of herbicides handle that glyphosate/ALS inhibitor tolerant plants (promptly, GAT-HRA plant of the present invention), comprise that glyphosate/ALS inhibitor tolerance soybean plants (promptly, GAT-HRA soybean of the present invention), described weedicide or combinations of herbicides will cause unacceptable injury to the standard plant variety.Thereby; for example; can handle the field of containing glyphosate/ALS inhibitor tolerance soybean plants (that is GAT-HRA soybean plants) separately or with other combinations of herbicides with sulfonylurea, imidazolone, triazolo pyrimidine, pyrimidyl (sulfo-) phenylformic acid and/or sulfonyl amino carbonyl Triazolinones such as sulfonylurea chlorimuronethyl.For example, can be with the combination of glyphosate and tribenuron-methyl (by commercial sources with Express

Obtain) handle the field of containing soybean plants of the present invention.This combination has several advantages for the weeds under certain situation control, comprising: use the weedicide with different modes of action and use the weedicide that has the relative residual activity phase of lacking in soil.Having short relatively residual activity phase weedicide is desirable under for example such situation: the selective pressure that reduces to help the growth of herbicide tolerant weeds is important.Certainly, under any particular case that needs weeds control, other consideration can be prior, as before kind of plant, prevents the field generation and/or weeds occur by the weedicide with long relatively residual activity phase.Can also handle glyphosate/ALS inhibitor tolerance soybean plants with combinations of herbicides, described combination comprises at least a of nicosulfuron, metsulfuronmethyl, tribenuron-methyl, thiameturonmethyl and/or rimsulfuron 25.The processing that comprises tribenuron-methyl and thiameturonmethyl can be particularly useful.

Other processing commonly used in the Tanaka weeds control that makes commercial variety crop of the present invention (for example comprising soybean) growth comprises that sulfonylurea weedicide thiameturonmethyl (can be by commercial sources with Harmony GT

Obtain).Yet a shortcoming of thiameturonmethyl is that the required higher utility ratio of successive weeds control causes the injury to identical Tanaka's growing crop usually.Can comprise soybean plants with the combined treatment glyphosate of the present invention/ALS inhibitor tolerant plants of glyphosate and thiameturonmethyl, it has the advantage of using the weedicide with different modes of action.Thereby the weeds of anti-only any weedicide can be by the Combination Control of two kinds of weedicides, and this processing does not significantly injure glyphosate of the present invention/ALS inhibitor tolerant plants.

Other weedicide in the Tanaka weeds control that makes commercial variety crop of the present invention (for example comprising soybean) growth is that triazolo pyrimidine weedicide cloransulammethyl (can be by commercial sources with FirstRate Obtain) and imidazolidinone weedicide weed eradication quinoline (can be by commercial sources with Sceptor

Obtain).When these weedicides of independent use, they can provide the only edge control of weeds.Yet, can for example use glyphosate (for example, Roundup

(glyphosate isopropyl amine salt)), the weed eradication cigarette (current can be by commercial sources with Arsenal

Obtain), chlorimuronethyl (current can be by commercial sources with Classic Obtain), quizalofop-P-ethyl (current can be by commercial sources with Assure II

Obtain) and remove the beans green bristlegrass (current can be by commercial sources with Flexstar

Obtain) combination, handle and contain glyphosate of the present invention/ALS inhibitor tolerant plants, comprise the field of soybean plants.This combination has the advantage of the herbicide treatment of using the different modes of action.Thereby the Combination Control by this species weedicide only tolerates one or more weeds of these weedicides, and glyphosate of the present invention/ALS inhibitor tolerant plants is not handled significantly injury of institute by described combinations of herbicides.Described combination provides the protection domain to the non-constant width that is expected at the herbicide tolerant weeds that occur in the weeds control practice of the present invention and spread.

Also can handle and contain glyphosate of the present invention/ALS inhibitor tolerant plants (that is, the GAT/HRA plant), comprise the field of soybean plants with the combinations of herbicides that for example comprises glyphosate, rimsulfuron 25 and dicamba 98 or Mesotrione.Said composition especially can be used for controlling the weeds of having developed certain tolerance of the weedicide that suppresses ALS.Especially another combination that can be used for the weedicide of weeds control comprise glyphosate and at least a below: metsulfuronmethyl (can be by commercial sources with Ally

), the weed eradication cigarette (can be by commercial sources with Arsenal

Obtain), Imazethapyr, weed eradication quinoline and sulfentrazone at least a.Should be appreciated that above with this paper other places appointing of discussing and set up jointly also and can close other weedicide or the agricultural chemicals combination is used for treatment zone with appointing.

Make commonly used processing of some of weeds control in the field of commercial crops of the present invention (for example comprising corn) growth comprise that glyphosate (current can be by commercial sources with Roundup Obtain), rimsulfuron 25 (current can be by commercial sources with Resolve

Or Matrix

Obtain), dicamba 98 is (by commercial sources with Clarity

Obtain), Aunar draws piperazine and Mesotrione (by commercial sources with Callisto Obtain).Because to the weak tolerance of multiple weedicide, these weedicides are used alone sometimes.Unfortunately, when independent use, these weedicides all have significant disadvantage for every kind.Particularly, tolerate separately that the weeds incidence of weedicide constantly increases, make low than expection of the significant quantity of glyphosate in some cases.Rimsulfuron 25 provides weeds control preferably under the high dosage that causes the crop damage, alternatively, more expensive than other weedicide commonly used usually as dicamba 98.Yet, can be with causing that the weedicide of unacceptable injury or combinations of herbicides handle glyphosate of the present invention/ALS inhibitor tolerant plants (being the GAT-HRA plant) to the standard plant variety, comprise glyphosate/ALS inhibitor tolerance maize plant, described combination comprises the combinations of herbicides that comprises rimsulfuron 25 and/or dicamba 98.Other the suitable combinations of herbicides that is used for glyphosate of the present invention/ALS inhibitor tolerant plants comprises glyphosate, sulfonylurea, imidazolone, triazolo pyrimidine, 2-pyrimidinyl oxy (sulfo-) phenylformic acid; and/or sulfonyl amino carbonyl triazolinone herbicide; for example comprise that following is at least a: metsulfuronmethyl, tribenuron-methyl, chlorimuronethyl, Imazethapyr, weed eradication cigarette and weed eradication quinoline.

For example, can use glyphosate and rimsulfuron 25, perhaps glyphosate/ALS inhibitor tolerance maize plant (that is GAT/HRA plant) is handled in the combination of rimsulfuron 25 and at least a other weedicide.Can also use the combination of glyphosate, rimsulfuron 25 and dicamba 98, perhaps the combined treatment of glyphosate, rimsulfuron 25 and at least a other weedicide glyphosate/ALS inhibitor plant (that is GAT/HRA plant).In some embodiments, at least a other weedicide has the mode of action different with glyphosate and rimsulfuron 25.The combination of glyphosate, rimsulfuron 25 and dicamba 98 has following advantage: these weedicides have the different modes of action and short residual activity, and this has reduced the generation of herbicide tolerant weeds and the risk of diffusion.

Make commonly used processing of some of weeds control in the field of commercial crops of the present invention (for example comprising cotton) growth comprise that glyphosate (current can be by commercial sources with Roundup

Obtain), chlorimuronethyl, tribenuron-methyl, rimsulfuron 25 (current can be by commercial sources with Resolve

Or Matrix

Obtain), Imazethapyr, weed eradication cigarette and weed eradication quinoline.Unfortunately, when independent use, every kind of these weedicides has remarkable shortcoming.Particularly, tolerate separately that the weeds incidence of weedicide constantly increases, make low than expection of the significant quantity of glyphosate in some cases.Yet glyphosate of the present invention/ALS inhibitor tolerant plants comprises that vegetable lamb can comprise the combination of at least a weedicide that comprises above-mentioned these weedicides with causing that the combinations of herbicides of unacceptable injury handles to the standard plant variety.

C. weedicide application method

In the method for the invention, can prepare weedicide by any way and be applied to the purpose zone, as cultivation land for growing field crops or zone.Can be in any form, as using weedicide to the field with liquid spray or as solid powder or granula.In some particular, the weedicide or the combinations of herbicides that are used for method comprise jar mixture or premixture.Also weedicide can be formulated as " the single-size adulterant " that for example use the blending technology to produce (see, for example, U.S. Patent number 6,022,552, title " Uniform Mixtures of Pesticide Granules ").U.S. Patent number 6; 022; 552 blending technology has produced the non-separation adulterant (that is, " single-size adulterant ") of Crop protection chemical through preparation with dry granula form, and it makes can send the custom mix thing that is designed to solve particular problem.Can transport in the mode identical with conventional pre-mixing product, processing, double sampling and application single-size adulterant, in conventional pre-mixing product, activeconstituents is formulated in the identical particle.

In brief, by at least two kinds of particulate product through preparation of extruding are mixed, prepare " single-size adulterant ".In some embodiments, every kind of particulate product all comprises chartered preparation, and it contains a kind of activeconstituents, and this activeconstituents can be for example weedicide, mycocide and/or insecticide.Can be used for adulterant particulate relative size and size distribution by control, optimize the homogeneity (homogeneity) of " single-size adulterant ".The particulate diameter of can the size control by the hole in the extrusion machine mould extruding is used the centrifugal screen separating method, obtain having desirable length distribution, extrude particulate colony (see, for example, U.S. Patent number 6,270,025).

When the homogeneous granules adulterant can be become the composition of suitable big or small aliquots containig and each aliquots containig will satisfy required assay method standard by double sampling, described homogeneous granules adulterant was considered to " uniformly ".In order to confirm homogeneity, the large sample of preparation single-size becomes its double sampling the aliquots containig (seeing embodiment 4) greater than the statistics sample size of minimum then.

In some non-limiting embodiments, can be (for example with weedicide, the combination of chlorimuronethyl and other weedicide, in the absence of glyphosate/ALS inhibitor tolerance crop, described weedicide will cause replys the unacceptable crop that does not have glyphosate/genetic plant variety of ALS inhibitor) handle glyphosate/ALS inhibitor tolerant plants (that is, the GAT-HRA plant), comprise soybean plants.Thereby; can use sulfonylurea, imidazolone, triazolo pyrimidine, pyrimidyl (sulfo-) phenylformic acid; and/or the sulfonyl amino carbonyl triazolinone herbicide separately or with other combinations of herbicides; for example handle; plant and contain the field of glyphosate/ALS inhibitor tolerance soybean, corn or cotton variety (that is GAT/HRA plant).Because ALS inhibitor chemical has different weedicide attributes, the admixture of all ALS and other chemical will provide good weeds management strategy, comprise the weeds scope that changes and increase, specific residual activity can be provided, and (the SU/ALS inhibitor chemistry with residual activity causes the leaf activity that improves, it causes wideer window between the glyphosate application, if and weather condition stops when in time using its feasible control phase increase).

Adulterant also provides with rate of utilization normal, mark and has added the ability of other agricultural chemicals, as extra weedicide (the 3rd/four kind of mechanism of action), mycocide, insecticide, plant-growth regulator or the like, thereby save the cost relevant with additional application.

Any herbicide formulations that glyphosate/ALS inhibitor tolerant plants is used can be prepared as " jar mixing " composition.In this type of embodiment, the combination of every kind of composition or composition can be preserved separately mutually.Can before application, composition be mixed mutually then.Usually, this type of is blended in application and not long ago mixed.In the jar blending means, every kind of composition is present in water or the appropriate organic solvent before mixing usually, additional teachings for compounding process, see, T.S.Woods, " The Formulator ' s Toolbox--Product Forms for Modern Agriculture " Pesticide Chemistry and Bioscience, The Food-Environment Challenge, T.Brooks and T.R.Roberts write, Proceedings of the 9th InternationalCongress on Pesticide Chemistry, The Royal Society of Chemistry, Cambridge, 1999, pp.120-133.Also see U.S. Patent number 3,235,361 the 6th hurdles, 6 row are to the 7th hurdle the 19th row and embodiment 10-41, U.S. Patent number 3,309,192 the 5th hurdles the 43rd row is to the 7th hurdle the 62nd row, with embodiment 8,12,15,39,41,52,53,58,132,138-140,162-164,166,167 and 169-182, U.S. Patent number 2,891,855 the 3rd hurdles the 66th row is to the 5th hurdle the 17th row and embodiment 1-4, Klingman, Weed Control as a Science, JohnWiley and Sons, Inc., New York, 1961, pp 81-96 and Hance et al., WeedControl Handbook, the 8th edition, Blackwell Scientific Publications, Oxford, 1989, by reference with they all complete this paper that incorporates into.

Method of the present invention also allows exploitation to be used for the combinations of herbicides of glyphosate/ALS inhibitor tolerant plants.In these class methods, the envrionment conditions in the cultivation area is assessed.The envrionment conditions that can assess comprises, but be not limited to, the weeds that exist in the desired use of underground and surface water pollution problem, crop, crop tolerance, pedo relict, the cultivation area, the amount of organic substance, application apparatus and the practice of ploughing in the soil texture, soil pH, the soil.When the Evaluation Environment condition, the combinations of herbicides of significant quantity can be applied to crop, crop part, crop seed or cultivation area.

D. the choose opportunities of weedicide application

In some embodiments, the weedicide that is applied to glyphosate of the present invention/ALS inhibitor tolerant plants is used to prevent that susceptible weeds from beginning to grow and/or be used to cause the injury of the weeds of purpose region growing.In some embodiments, weedicide or Herbicidal mixtures have influence on the weeds of planting the crop in purpose zone (that is, cultivation field or zone) subsequently to meeting and bring into play these effects.In the method for the invention, the application of combinations of herbicides does not need to carry out simultaneously., just think and used Herbicidal mixtures according to the present invention to handle described crop as long as but the field of kind of plant is contained first kind of weedicide of monitoring variable and used second kind of weedicide in crop certain time during the cultivation area.Thereby method of the present invention comprises the application weedicide, and described application is " before the appearance ", " back occurring " " mixing before the plantation " and/or relates to the preceding seed treatment of plantation.

In one embodiment, provide method at the coating seed.Described method comprises with the combination of the weedicide or the weedicide of significant quantity (open as this paper other places) coating seed.Seed can be planted in the cultivation area then.Seed with coating also is provided, and described coating comprises the combination (open as this paper other places) of the weedicide or the weedicide of significant quantity.

" occur before " refers to plant from being applied to the weedicide in purpose district (for example, cultivation field or zone) before soil occurs visibly." occur back " refers to plant from being applied to the weedicide in purpose district after soil occurs visibly.In some cases, term " before occurring " and " back occurring " are used for the weeds in purpose district, and in some cases, these terms are used for the crop plants of cultivation area.When being used for weeds, these terms can only be used for the weeds or the existence of a kind of particular type only or think the weeds kind that is present in the purpose district.Although can and/or occur using in the aftertreatment any weedicide before appearance, more known weedicides are more effective in one or more weeds of control when using before appearance or after occurring.For example, rimsulfuron 25 have occur before and the back to occur active, and other weedicide mainly have occur before (the third careless amine) or back (glyphosate) activity occurs.These character of concrete weedicide are known in the art, and are determined by those skilled in the art easily.In addition, those skilled in the art can easily select suitable weedicide and be used for transgenic plant of the present invention and/or will plant application time in the zone of transgenic plant of the present invention." mix before the plantation " to relate in plantation forward direction soil and mix compound.

Thereby, the invention provides and make plant growth and/or control weeds, as improving one's methods of " weakening before the plantation ", wherein regional with herbicide treatment before plantation purpose crop so that control weeds better.The present invention also provides and has made plant growth and/or control method for weed, and described weeds are " not having-cultivate " or " low-as to cultivate " (being also referred to as " cultivating of minimizing ").In these class methods, to compare with ordinary method, the frequency that soil is not cultivated or cultivated during growth cycle is lower; These methods can be saved the cost that causes owing to extra cultivation, as labour and fuel cost.

Method of the present invention comprises the weedicide that uses simultaneously and/or use a plurality of classifications in proper order.In some embodiments, method of the present invention relates to uses only a kind of weedicide or other chemical, as sulfonylurea herbicide treatment plant of the present invention and/or purpose district (for example, cultivation field or zone) and/or weeds.

The time that weedicide is applied to purpose district (with any plant wherein) may be important in the optimization to weeds control.Can as growing crop plant or weeds in the zone, determine to use the time of weedicide at the growth of plant in plant size and/or growth phase and/or the purpose district.Growth phase and/or development of plants are known in the art.For example, soybean plants is grown usually through being called V _E(emergence), V _C(cotyledon), V ₁(single leaf) and V ₂To V _NVegetative growth phase.Soybean is replied the photoperiod signal then and turns to reproductive stage; Reproductive phase comprises R ₁(beginning to bloom), R ₂(blooming fully), R ₃(beginning pod), R ₄(pod fully), R ₅(beginning seed), R ₆(whole seed), R ₇(beginning is ripe) and R ₈(fully matured).Maize plant is usually through following vegetative phase VE (emergence), V1 (first leaf), V2 (second leaf), V3 (the 3rd leaf), V (n) (Nth/ leaf) and VT (male flower fringe).Corn is as follows by the progress in generative phase: R1 (reeling off raw silk from cocoons), R2 (sending out blister), R3 (galactopoiesis), R4 (wax ripeness), R5 (dent); And R6 (physiological maturity).Vegetable lamb passes through V usually _E(emergence), V _C(cotyledon), V ₁(first true leaf) and V ₂To V _NThen, at about V ₁₄The reproductive phase of beginning comprises R ₁(beginning to bloom), R ₂(perfect flower), R ₃(beginning cotton boll), R ₄(cutout, cotton boll is grown), R ₅(beginning is ripe, the cotton boll that first is opened), R ₆(maturation, 50% cotton boll of opening) and R ₇(fully matured, the cotton boll that 80-90% opens).Thereby, for example, weedicide or other chemical application can be that some or all plants have reached specific at least size and/or the time of growth and/or etap in the specific region in the time in the purpose district of growing plant, and perhaps some or all plants also do not reach time of specific size and/or growth and/or etap in the specific region.

In some embodiments, glyphosate of the present invention/ALS inhibitor tolerant plants demonstrates the tolerance to the raising that the back herbicide treatment occurs.For example, plant of the present invention is compared with suitable control plant, can tolerate the more weedicide of high dosage, and the weedicide that tolerates wide region more (promptly, tolerate more ALS inhibitor chemical), and/or can tolerate more early or the weedicide dosage used of more late development time.For example, in some embodiments, glyphosate of the present invention/ALS inhibitor tolerant plants demonstrate increase, to the resistance of following anomalad, known described anomalad is that the processing by the specific etap causes.Thereby, for example, when being later than V5, V6, V7, V8, V9, V10, V11, V12, V13 or more late stage during with the herbicide treatment maize plant, usually cause the phenomenon that is called " atrophy of ear fringe (ear pinch) ", and glyphosate of the present invention/ALS inhibitor tolerant plants demonstrates the incidence of the reduction of " atrophy of ear fringe " when same phase is processed.Thereby the stage that glyphosate of the present invention/ALS inhibitor tolerant plants can be used for relating to more late than the feasible in the past etap carries out in the method for herbicide treatment.Thereby, can handle plant of the present invention with particular herbicide, described weedicide causes anomalad in the control plant of identical etap, but glyphosate of the present invention/ALS inhibitor tolerant plants will not be subjected to the remarkable injury of this same treatment.

Different chemical such as weedicide have different " residual " effects, promptly growing plants in the processed zone are continued to have the different time amount of influence with described chemical or herbicide treatment.This type of influence can be that wish or undesirable, and this depends on the purpose in future of the needs in processed zone (for example, cultivation field or zone).Thereby, can select the shift of crops scheme based on the residual effect of the processing that will be used for every kind of plant and they to will be subsequently in the influence of same area growing crop.Those skilled in the art are familiar with being used to assessing the technology of the residual action of weedicide; For example, usually, glyphosate has very little or does not have residual activity, and the residual activity level of weedicide that suppresses ALS is then different.The residual activity of multiple weedicide is known in the art, and also knownly becomes along with multiple environmental factors, and described factor for example comprises, soil humidity level, temperature, pH and soil constitution (quality and organic substance).Glyphosate of the present invention/ALS inhibitor tolerant plants can be used for making the method for plant growth, and the tolerance to the residual activity of weedicide that wherein improves is useful.

For example; in one embodiment; glyphosate of the present invention/ALS inhibitor tolerant plants has the tolerance (when the independent application) of raising to glyphosate and to ALS inhibitor chemical (as the sulfonylurea weedicide), and the tolerance to the raising of the combination of weedicide such as glyphosate and/or ALS inhibitor chemical further is provided.In addition, transgenic plant of the present invention provide to the tolerance of the raising of the extra chemical that is usually used in crop of herbicide treatment coupling, described extra chemical is such as safener, adjuvant, as ammonium sulphonate and crop soil enriched material, or the like.

E. safener and adjuvant

Term " safener " refers to eliminate or reduce the material of weedicide to the phytotoxicity effect of some crop when adding herbicide formulations.It will be apparent to one skilled in the art that the selection to safener partly depends on the combinations of herbicides that comprises in purpose crop plants and the Synergistic herbicidal compositions.The exemplary safener that is applicable to herbicidal composition disclosed by the invention comprises, but be not limited to, U.S. Patent number 4,808,208,5,502,025,6,124,240 and U.S. Patent Application Publication No. 2006/0148647,2006/0030485,2005/0233904,2005/0049145,2004/0224849,2004/0224848,2004/0224844,2004/0157737,2004/0018940,2003/0171220,2003/0130120,2003/0078167 in those disclosed, by reference with their complete this paper that incorporates into of disclosure.Method of the present invention can relate to the combination of use weedicide and herbicide-safener to increase crop safety; described safener is such as benoxacor; BCS (1-bromo-4-[(chloro methyl) alkylsulfonyl] benzene); cloquintocet-mexyl; cyometrinil; dichlormid; 2-(dichloromethyl)-2-methyl isophthalic acid; 3-dioxolane (MG 191); fenchlorazole-ethyl; fenclorim; separate careless amine; fluxofenim; furilazole; the isoxadifen-ethyl; the mefenpyr-diethyl; methoxyphenone ((4-methoxyl group-3-aminomethyl phenyl) (3-aminomethyl phenyl)-ketone); naphthalene acid anhydride (1, the 8-naphthalene acid anhydride) and oxabetrinil.The detoxifcation significant quantity of herbicide-safener can be used simultaneously with compound of the present invention, perhaps uses as seed treatment.Therefore, an aspect of of the present present invention relates to the purposes of the mixture of the herbicide-safener that comprises glyphosate, at least a other weedicide and detoxifcation significant quantity.

Seed treatment especially can be used for optionally weeds control, because it limits the detoxifcation at crop plants on physiology.Therefore, the embodiment that is particularly useful of the present invention is the method for selective control Tanaka weed growth, and it comprises: the safener with the detoxifcation significant quantity is handled the seed of the crop that is used to grow, and handles the land for growing field crops with the weedicide of the contrast weeds of significant quantity.Those skilled in the art can easily determine the detoxifcation significant quantity of safener by simple experiment.The detoxifcation significant quantity that has safener, wherein the plant of handle wishing with safener makes the effect of the plant that weedicide is handled this safener not the effect of plant and described weedicide compare attenuating; Usually, the detoxifcation significant quantity of safener prevents infringement or the grievous injury to the plant of handling with this safener.Whether the use that those skilled in the art can determine safener suitable and definite safener dosage that should be applied to crop.

In some particular, be applied to the weedicide of plant of the present invention or combinations of herbicides as safener.In this embodiment, plant is used first kind of weedicide or Herbicidal mixtures with the detoxifcation significant quantity.Therefore, provide and be used for controlling the cultivation region method for weed.This method is included in this ecological region planting crop seed or plant, described crop seed or plant comprise be operably connected in the plant on the promoters active, coding can the conferring glyphosate tolerance first kind of polynucleotide of polypeptide; Be operably connected in the plant second kind of polynucleotide on the promoters active, coding ALS inhibitor tolerance polypeptide.The combinations of herbicides that will comprise first kind and second kind weedicide of at least a significant quantity is applied to crop, crop part, weeds or its cultivation area.The significant quantity of combinations of herbicides can be controlled weeds; And, when the significant quantity of first kind of weedicide of independent application, to compare with the contrast crop that is not exposed to first kind of weedicide, described crop does not tolerate the significant quantity of described first kind of weedicide; And the significant quantity of second kind of weedicide is enough to produce safe effect, and wherein the crop tolerance when only using first kind of weedicide is compared, and when using first kind and second kind of weedicide, this safe effect provides the increase of crop tolerance.

In some particular, the combination of safe weedicide comprises first kind of ALS inhibitor and second kind of ALS inhibitor.In other embodiments, realize safe effect by the glyphosate of application significant quantity and the combination of at least a ALS inhibitor chemical.In some other embodiment; when using from least a weedicide of sulfonylurea family chemical when handling glyphosate/ALS inhibitor tolerance crop, crop part, crop seed, weeds or cultivation area from least a weedicide (as the imidazolone) combination of ALS family chemical the realization safe effect.

This type of mixture provides the crop tolerance that increases (that is, the weeding damage alleviates).This method allows after processing or increases the utility ratio of chemical before handling.These class methods can be used for increasing the undesired or unwanted plant of control.In other embodiments; when using from least a weedicide of sulfonylurea family chemical with the time realization safe effect from the combined processing glyphosate of at least a weedicide of imidazolone family/ALS inhibitor tolerance crop, crop part, crop seed, weeds or cultivation area.This method provides the crop tolerance that increases (that is, the weeding damage alleviates).In specific embodiments, sulfonylurea comprises rimsulfuron 25 and imidazolone comprises Imazethapyr.In other embodiments, glyphosate is applied to crop, crop part or cultivation area.

Ground as used herein, " adjuvant " are to add spray solution or preparation with the agrochemistry of modifying spray solution or any material of physical properties.For example see Green and Foy (2003) " Adjuvants:Tools for Enhancing Herbicide Performance, ", WeedBiology and Management, ed.Inderjit (Kluwer Academic Publishers, Holland).Can or be categorized as activator again with the adjuvant classification; souring agent; buffer reagent; additive; tackiness agent; deflocculation agent; kilfoam; defoaming agents; antifreezing agent; attractant; basic adulterant; sequestrant; sanitising agent; pigment or dyestuff; compatilizer; cosolvent; coupler; the crop oil enriched material; deposition agent; stain remover; dispersion agent; floating control agent; emulsifying agent; evaporation moderator; expand agent; fertilizer; foam marker; preparaton (formulant); inert substance; thinner; seed oil methylates; high loading COCs; polymkeric substance; the vegetables oil of improvement; permeate agent; repellents; the oil enriching agent; sanitas; antirain agent; keep auxiliary agent; solubilizing agent; tensio-active agent; the coating agent; tackiness agent; the coating tackiness agent; synergistic agent; thickening material; migration aids; ultraviolet protective agent; vegetables oil; water modifier; and moistening agent.

F. extra agricultural chemicals

In addition; method of the present invention can comprise uses weedicide and Herbicidal mixtures; and one or more other insecticides, mycocide, nematocides, bactericide, miticide, growth regulator, chemistry go out living agent, semiochemicals, protective agent, attractive substance, pheromone, feed stimulant or other bioactive compounds or entomopathogenic bacterium, virus or fungi to form multicomponent mixture, and it gives the more agricultural protection of wide region.：；；；；amidoflumet （S-1955）；；； （azinphos）-；； （bifenazate）；；；；；；；-； （chromafenozide）； （clothianidin）； （cyflumetofen）；；β-；；λ-；；；；；；；； （dimefluthrin）；； （dinotefuran）； （diofenolan）；；；；ethiprole；；；；；； （flonicamid）； （flubendiamide）；；τ-；flufenerim （UR-50701）；；fonophos； （halofenozide）；；；；；；；； （metaflumizone）；；；；；；； （metofluthrin）；； （methoxyfenozide）；；nithiazine； （novaluron）； （noviflumuron） （XDE-007）；；；-；；；；；；；；profluthrin；；pyrafluprole；； （pyridalyl）；pyriprole；；；； （spinosad）； （spirodiclofen）； （spiromesfen） （BSN 2060）； （spirotetramat）；；；；；；； （thiacloprid）；；；thiosultap-；；；；； （acibenzolar）；aldimorph； （amisulbrom）；；；；； （benthiavalicarb）；-；binomial；；；-S； （）； （boscalid）／nicobifen；；；；； （carpropamid）；；；；；；；；；；； （cyazofamid）；cyflunamid；；； （cyprodinil）；； （diclocymet）；；；；；； （dimoxystrobin）；；-M；；discostrobin；；；；；；； （epoxiconazole）； （ethaboxam）；；ethridiazole； （famoxadone）； （fenamidone）；；；fencaramid；；fenhexamide； （fenoxanil）；；；；；；；ferfurazoate；；；；flumetover； （fluopicolide）； （fluoxastrobin）；；；；；；；； （fosetyl-）；；；furametapyr；； （hymexazole）；；；；；iodicarb；；；； （iprovalicarb）；；；； （kresoxim）-；； （mandipropamid）；；mapanipyrin； （mefenoxam）；；；；；； （metominostrobin）／fenominostrobin；； （metrafenone）；；； （neo-asozin） （）；；；； （orysastrobin）；，； （oxpoconazole）；；；；； （penthiopyrad）；perfurazoate；；；picobenzamid； （picoxystrobin）；；；；；；-；；； （proquinazid）； （prothioconazole）； （pyraclostrobin）；pryazophos；；；；pyrolnitrine；；quinconazole； （quinoxyfen）；； （silthiofam）； （simeconazole）； （spiroxamine）；；；；techrazene；；；；；；；-；； （tiadinil）； （tolclofos-methyl）；；；；；；；trimoprhamide；；；；；；；； （zoxamide）；。 Nematocides is as aldicarb, oxamyl and fenamiphos; Bactericide is as Streptomycin sulphate; Miticide is as amitraz, chinomethionate, G-23922, cyhexatin, Mitigan, Hooker HRS 16 (dienochlor), oxyethane (etoxazole), fenazaquin, fenbutatin oxide, Fenvalerate, the spirit of despot mite, hexythiazox, propargite, pyridaben and tebufenpyrad; And biological agent, comprise the entomopathogenic bacterium, as the δNei Dusu of the packing of bacillus thuringiensis Aizawai subspecies (Bacillusthuringiensis subsp.Aizawai) and bacillus thuringiensis (for example, Cellcap, MPV, MPVII); The entomopathogenic fungi is as blue or green mycosis fungoid; With entomopathogenic virus, comprise baculovirus, NPV (NPV), as HzNPV, AfNPV; And granulosis virus (GV), as CpGV.The part by weight that is used for these multiple mixture mating partners of the present invention and other component (as weedicide) is generally 100: 1 to 1: 100, or 30: 1 to 1: 30,10: 1 to 1: 10 or 4: 1 to 1: 4.

The invention still further relates to following composition, it comprises the purpose weedicide of biology significant quantity or at least a extra bioactive compounds or the reagent of Herbicidal mixtures and significant quantity, and can also comprise at least a tensio-active agent, solid diluent or liquid diluent.The example of this type of bioactive compounds or reagent is:sterilant, as abamectin, Ortho 12420, acetamiprid, amidoflumet (S-1955), avermectin, nimbin, the R-1582 methyl, bifenthrin, Bifenazate, Buprofezin, the worm mite becomes, Chlorfenapyr, UC 62644, Chlorpyrifos 94, Chlorpyrifos 94-methyl, ring worm hydrazides, thiophene worm amine, cyfloxylate, β-cyfloxylate, cyhalothrin, λ-cyhalothrin, Cypermethrin, cyromazine, Deltamethrin, the butyl ether urea, Dimpylate, two fluorobenzene are grand, Rogor, two propyl phenyl ethers, emamectin, 5a, 6,9,9a-hexahydro-6,9-methano-2,4, kill the A Ju ester, ethiprole, fenothiocarb, Fenoxycarb 25WG, Fenvalerate, fenvalerate, fluorine worm nitrile, flonicamid, fluoro-Cyano chrysanthemate, τ-taufluvalinate, flufenerim (UR-50701), flufenoxuron, fonophos, chlorine worm hydrazides, fluorine bell urea, lid reaches upright, homerun, isofenphos, lufenuron, the Malathion, the snail spirit of going out, acephatemet, methidathion, methomyl, methoprene, methoxy-DDT, monocrotophos, methoxyfenozide, nithiazin, Rimon, noviflumuron (XDE-007), oxamyl, thiophos, thiophos-methyl, permethrin, phorate, zolone, R-1504, phosphamidon, Aphox, Profenofos, pymetrozine, pyridalyl, pyriproxyfen, tubatoxin, many sterilizations, first mite ester (BSN 2060), sulprofos, the worm hydrazides, the fluorobenzene urea, tefluthrin, Terbufos, Tetrachlorvinphos, thiophene worm quinoline, the fast victory, the two prestige of sulphur, thiosultap-sodium, tralomethrin, trichlorfon 98 and kill the bell urea; Fungicide; Such as diazosulfide; The nitrile Fluoxastrobin; Benomyl; Blasticidin S-S; Bordeaux mixture (tribasic copper sulfate); Bromuconazole; Ring propionyl imines; Difoltan; Captan; Carbendazim; Chloroanisole; Bravo; Copper oxychloride; Mantoquita; Cyflufenamid; Frost urea cyanogen; Cyproconazole; Cyprodinil; (S)-3; 5-two chloro-N-(3-chloro-1-ethyl-1-methyl-2-oxopropyls)-4-methyl benzamide (RH 7281); Two chlorine zarilamids (S-2900); Diclomezine; Botran; Difenoconazole; (S)-3,5-dihydro-5-methyl-2-(methyl thio)-5-phenyl-3-(phenyl-amino)-4H-imidazo 1-4-ketone (RP 407213); Dimethomorph; Dimoxystrobin; Alkene azoles alcohol; Alkene azoles alcohol-M; Dodine; Ediphenphos; Epoxiconazole; The oxazolone bacterium; Fenamidone; Pleasure must be ploughed; Divide bacterium cyanogen azoles; Fencaramid (SZX0722); Fenpiclonil; Fenpropidin; Butadiene morpholine; TPTA; Fentin hydroxide; Fluazinam; Fludioxynil; Flumetover (RPA 403397); Flumorf/flumorlin (SYP-L190); Fluoxastrobin (HEC 5725); Fluquinconazole; Flusilazole; Flutolanil; Flutriafol; Folpet; Fosetyl-aluminium; Furalaxyl; Furametapyr (S-82658); Own azoles alcohol; Plant the bacterium azoles; IBP; Iprodione; Isoprothiolane; Kasugarnycin; The kresoxim-methyl; Mancozeb; Maneb; Metalaxyl-M; Mebenil; Metalaxyl; Metconazole; SSF 126/fenominostrobin (SSF-126); Metrafenone (AC375839); The gram that goes out falls; Neo-Asozin (ferric methylarsonate); Nicobifen (BAS 510); Dimoxystrobin; Wakil; Join that azoles; The withered urea of line; Probenazole; Prochloraz; Propamocarb; Propiconazole; The third oxygen quinoline (DPX-KQ926); Prothioconazoles (JAU 6476); The ecchymose removing oxime; Pyraclostrobin; Pyrimethanil; Pyroquilon; Quinoxyfen; Volution bacterium amine; Sulphur; Tebuconazole; Fluorine ether azoles; Thiabendazole; Thiophene fluorine bacterium amine; Fragrant ester-the methyl of sulphur; Sai Lanmu; Tiadinil; Triazolone; Triadimenol; Tricyclazole; Brufen; Triticonazole; Valida and cut down the spirit of bacterium azoles; Nematocides is as aldicarb, oxamyl and fenamiphos; Bactericide is as Streptomycin sulphate; Miticide is as amitraz, chinomethionate, G-23922, cyhexatin, Mitigan, Hooker HRS 16, oxyethane, fenazaquin, fenbutatin oxide, Fenvalerate, the spirit of despot mite, hexythiazox, propargite, pyridaben and tebufenpyrad; And biological agent, comprise the entomopathogenic bacterium, as the δ Nei Dusu (for example, Cellcap, MPV, MPVII) of the packing of bacillus thuringiensis Aizawai subspecies (Bacillus thuringiensis subsp.Aizawai) and bacillus thuringiensis; The entomopathogenic fungi is as blue or green mycosis fungoid; With entomopathogenic virus, comprise baculovirus, NPV (NPV), as HzNPV, AfNPV; And granulosis virus ( GV ) ； as CpGV.Method of the present invention can also comprise that use expresses the deleterious protein of invertebrates insect ( as the bacillus thuringiensis δNei Dusu ) through the plant of genetic transformation.In this type of embodiment, the effect of the invertebrates insect of exogenous application control compound can be worked in coordination with expressed toxin protein.

General reference about these agricultural protection agent comprises The Pesticide Manual, the 13rd edition, and C.D.S.Tomlin; Ed., British Crop Protection Council, Farnham; Surrey, U.K., 2003 and The BioPesticide Manual; second edition, L.G.Copping, Ed.; British Crop Protection Council, Farnham, Surrey; U.K., 2001.

In some cases, still other invertebrates insect control compound or the combination of agents of the different modes of action will be especially favourable for the resistance management with having similar span of control.Thereby but composition of the present invention can also comprise at least a extra of biology significant quantity and have similar span of control the invertebrates insect of different modes of action control compound or reagent.Contacting of the The compounds of this invention of genetically modified location with the plant of expressing plant control compound (as protein) or plant and biology significant quantity also provides the more plant protection of wide region, and it is managed for resistance is favourable.

Thereby method of the present invention is used weedicide or combinations of herbicides can further include and is used insecticide and/or mycocide and/or other agricultural chemicals (for example fertilizer).The purposes of this type of combined therapy of the present invention can be expanded the activity profile at extra weeds kind, and suppresses the propagation of any resistance biotype.

Method of the present invention can also comprise the use plant-growth regulator, as viglycine, N-(phenyl methyl)-1H-purine-6-amine, ethrel, epocholeone, gibberic acid, Gibberellin A4 and A7, harpin albumen, mepiquat chloride, Prohexadione calcium salt, protect that the people live in plenty (prohydrojasmon), nitro phenolic acid sodium and anti-ester-methyl and the plant-growth modified biological of falling, as bacillus cereus (Bacillus cereus) strain BP 01.

VI. as the purposes and the method for transformation of selective marker

In some embodiments of the present invention, the construct of the GAT of comprising polynucleotide of the present invention or ALS inhibitor tolerance polypeptide for example plays a role as selective marker in plant, bacterium, actinomycetes, yeast, algae or other fungi.For example, the ability that can grow in the presence of glyphosate based on them is selected the biology that has transformed with the carrier that comprises the GAT polynucleotide.Alternatively, the ability that can grow in the presence of the ALS inhibitor based on them is selected the biology that has transformed with the carrier that comprises ALS inhibitor tolerance polynucleotide.In some embodiments of the present invention, the construct of the present invention that comprises GAT polynucleotide and another kind of herbicide tolerant polynucleotide (that is, the polynucleotide of coding ALS inhibitor tolerance polypeptide, the polynucleotide of HRA polypeptide etc. of encoding) is used as selective marker in plant, bacterium, actinomycetes, yeast, algae or other fungi.For example, can select with the biology that comprises that GAT polynucleotide and another kind of herbicide tolerant polynucleotide transform based on the ability of its growth in the presence of glyphosate and suitable other weedicide.As illustrating ground among embodiment 10 and Fig. 7, this type of system of selection allows any polynucleotide of interest of assessment for example transforming early stage expression, so that identify the potential expression problem.Although can use any polynucleotide of interest, in some particular, use killing gene.

The construct of the present invention that comprises the polynucleotide of GAT polynucleotide and/or coding ALS inhibitor tolerance polypeptide can demonstrate very high transformation efficiency, as at least 20%, 30%, 40%, 50% or 60% or higher efficient.By this way, provide improved method for transformation.In addition, when construct of the present invention comprises GAT polynucleotide and/or ALS inhibitor tolerance polynucleotide, resulting transformant can demonstrate the glyphosate or the ALS inhibitor tolerance frequency of high frequency, as long as for example, at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% transformant tolerance glyphosate and/or ALS inhibitor." conversion effect " is defined as resisting as used herein: the per-cent of the T0 incident of the selective reagents of specific concentrations (as glyphosate and/or ALS inhibitor chemical).When construct of the present invention comprises when being operably connected to as GAT polynucleotide on the 35S enhanser and/or ALS inhibitor tolerance polynucleotide, the transformant that obtains can demonstrate the glyphosate or the ALS inhibitor tolerance frequency of high frequency, as long as for example, at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% transformant tolerance glyphosate or ALS inhibitor.In addition, when construct of the present invention comprised GAT polynucleotide and/or ALS inhibitor tolerance polynucleotide, only the construct of a copy was inserted into genomic transformation event frequency and can be as high as at least 35%, 40%, 50%, 60%, 70%, 80%, 90% or higher.When construct of the present invention comprises when being operably connected to as GAT polynucleotide on the 35S enhanser and/or ALS inhibitor tolerance polynucleotide, only the construct of a copy is inserted into genomic transformation event frequency and can be as high as at least 35%, 40%, 50%, 60%, 70%, 80%, 90%, or higher.By this way, the present invention also provides improved method for transformation.Recognize that working as enhanser is used for construct (as S ³⁵Enhanser) time, can use a plurality of copies, comprise 1,2,3,4,5,6 or more a plurality of copy.In these class methods, can use glyphosate and/or ALS inhibitor to select transformant, perhaps can use another kind of compound, select them as another kind of weedicide, the construct that is transformed contains the tolerance proterties at described compound.

VII. test kit

The present invention also provides test kit, it comprises at least a nucleic acid construct, this construct comprises the polynucleotide of the polypeptide that coding can the conferring glyphosate tolerance and/or the polynucleotide of coding ALS inhibitor tolerance polypeptide, and described construct is used to produce glyphosate of the present invention/ALS inhibitor plant.In specific embodiments, this test kit can comprise the polynucleotide of the GAT that encodes, and perhaps this test kit can comprise polynucleotide and coding ALS inhibitor tolerance polynucleotide (that is polynucleotide HRA), of the GAT that encodes.In some respects, construct of the present invention will comprise the T-DNA sequence.This construct can randomly comprise the adjusting sequence (as promotor) on the polynucleotide that are operably connected to conferring glyphosate resistance, wherein this promotor and described polynucleotide are allogenic, and can effectively cause the effective expression of encoded polypeptide, to strengthen glyphosate tolerant with nucleic acid construct plant transformed cell.

Article " one (a and an) " is used in reference to one or more than the grammer target of (that is, at least one) this article in this article.For example, " element " refers to one or more elements.

All publications mentioned in specification sheets and patent application all are the indications of those skilled in the art's level that the present invention relates to.All incorporate all publications and patent application into this paper by reference, this is with all to incorporate each publication or patent application into this paper especially and separately by reference the same.

Although, described aforementioned invention in detail, obviously can implement some change and modification within the scope of the appended claims by explanation and example for the clear purpose of understanding.

Experiment

Embodiment 1-GAT-HRA maize plant tolerates multiple weedicide and agricultural chemicals

For carrying out agriculture bacillus mediated corn, the expression cassette with GAT polynucleotide (SEQ IDNO:4) that contain the constitutive promoter that is operably connected and HRA polynucleotide (SEQ ID NO:66) transforms, use the method (U.S. Patent number 5 of Zhao, 981,840, announce WO98/32326 with the PCT patent, incorporate its content into this paper by reference).Preparation contains the expression cassette of GAT polynucleotide and HRA polynucleotide.In some expression cassettes, GAT and HRA polynucleotide are operably connected at least one copy of 35S enhanser [SEQ ID NO:72].In some expression cassettes, GAT and HRA polynucleotide be operably connected to SEQ ID NO:1 the 35S enhanser two or three the copy on.In some expression cassettes, the GAT polynucleotide are operably connected on the ubiquitin promotor, and the HRA polynucleotide are operably connected on natural corn acetolactate synthase (ALS) promotor.

In brief,, and this embryo contacted with agrobacterium suspension from immature embryos from corn dividing, wherein this bacterium can be transferred to GAT and HRA sequence at least one cell of at least one immature embryos (step 1: infect step).In this step, described immature embryos is immersed in the agrobacterium suspension, be used for starting inoculation.Embryo and Agrobacterium are cultivated for some time altogether (step 2: be total to culturing step).After infecting step, on solid medium, cultivate immature embryos.Behind the incubation period, be contemplated to optional " static " step altogether.In this static step, exist and do not add under the situation of selective reagents of vegetable transformant and cultivate embryo (step 3: static step) at the microbiotic of at least a known inhibition Agrobacterium growth.Cultivate immature embryos on the solid medium of selective reagents having microbiotic but do not have, be used to eliminate Agrobacterium and make infected cell be in stationary phase.Then, contain the embryo of cultivating inoculation on the substratum of selective reagents, and reclaiming the callus (step 4: select step) that growth transforms.Cultivate immature embryos having on the solid medium of selective reagents, make institute's transformant selective growth.Then callus regeneration is become plant (step 5: regeneration step), and selecting callus on the substratum with aftergrowth in incubation growth on the solid medium.

Assessment to herbicide tolerant

Assessment GAT-HRA maize plant is to the tolerance of glyphosate and other weedicide.A kind of scheme that is used for this assessment is as described below.(Ritchie and Hanway (1982), " How acorn plant develops " Spec.Rep.48. (Coop.Ext.Ser., Iowa State Univ., Ames, Iowa)) measures plant height, and uses weedicide by the spray applications method in the V2 phase.After the spray applications 10 to 14 days, the damage symptom of assessment transgenic plant was measured plant height once more, so that measure plant growth rate.In a series of tests, handle (back occurring) GAT-HRA corn and control plant with one of following weedicide: tribenuron-methyl is (as Express

, with the utility ratio (gai/ha) of per hectare 0 to 200 gram activeconstituents), chlorimuronethyl is (as Classic

, 0 to 200gai/ha), the weed eradication cigarette is (as Arsenal

, 0 to 200gai/ha), metsulfuronmethyl is (as Ally

, 0.5ozai/ac (36.9mlai/ha) or 35gai/ha).For each processing, the GAT-HRA corn does not demonstrate handles the remarkable damage cause, and the contrast corn is by major injury or kill.

Also with the combination of multiple other weedicide and weedicide and other agricultural chemicals the GAT-HRA maize plant is handled, comprising: glyphosate is (as WeatherMax

, with the utility ratio of 64.4oz ai/ac (4.7Lai/ha)), rimsulfuron 25 is (as Matrix

, with the utility ratio of 1.9ozai/ac (140mlai/ha)), ethyl methyl is (as Oust

, with the utility ratio of 4.5ozai/ac (332mlai/ha)), Basis

(combination of rimsulfuron 25 and thiameturonmethyl is with the utility ratio of 1.4ozai/ac (103mlai/ha)) and Chlorpyrifos 94 are (as Lorsban

, with the utility ratio of 14.4ozai/ac (1.06Lai/ha)).Different time after processing then, as handle the back and plant was assessed in 10 or 14 days.Tolerant plants is to demonstrate very little damage or undamaged those plants after handling with weedicide or combinations of herbicides.This assessment has identified the GAT-HRA plant that tolerates multiple sulfonylurea and glyphosate chemical.The GAT-HRA plant is compared any significant difference that does not demonstrate in growth or the product seed (being output) with control plant.Get the leaf sample from the GAT-HRA plant, be used for quantitative PCR analysis and other analysis, with definite number and arrangement that has been incorporated into the GAT and the HRA polynucleotide copies of Plant Genome.

Other evaluation scheme comprises uses imidazolidinone weedicide, as commercial herbicides Lightning

(combination of weed eradication cigarette and Imazethapyr) handled, and it is applied to the GAT-HRA corn with four times of field mark rate (250gai/ha) at the V3 leaf during stage.14 days assessment plants behind the weedicide have 4 not demonstrate weedicide damage symptom in 6 transgenic events of test.Another evaluation scheme comprises with imidazolidinone weedicide and sulfonylurea and glyphosate herbicidal to be handled.In these tests, use Lightning

(weed eradication cigarette and Imazethapyr), Basis

(rimsulfuron 25 and thiameturonmethyl) and WeatherMAX

The multiple combined treatment GAT-HRA corn of (glyphosate potassium).These weedicides are in V2 following application during the stage: twice field mark rate is used Lightning

(1.8ozai/ac (133mlai/ha)), twice field mark rate are used Basis

(0.5ozai/ac (36.9mlai/ha)) and four times of field mark rates are used WeatherMax

(43ozai/ac).Handle and use back 14 days, plant is assessed.11 the plant that contains 12 transgenic events does not demonstrate weedicide damage symptom." field mark rate " refers to specified utility ratio on Product labelling.Wherein the utility ratio of particular case is the scope of ratio as used herein, and the upper limit of this scope pointed out in term " field mark rate ".The Product labelling information of sterilant can obtain from USEPA (U.S.Environmental Protection Agency), and at the urloaspub.epa.gov/pestlabl/ppls.own online updating; Product labelling information also can be at url Www.cdms.netOnline obtaining.

Other testing authentication many herbicide tolerant property of these GAT-HRA maize plants be stabilized heredity.The greenhouse assessment, demonstrate good herbicide tolerant from the T1 seed of 20 transgenosis T0 plant results.As known in the art, plant can be along with environment change to the tolerance of weedicide, and the herbicide treatment in greenhouse can have bigger influence to handled plant than the herbicide treatment in field.Therefore, also assessed the T1 seed at field condition.Make up spraying T1 plants in the V4 leaf stage with four kinds that comprise sulfonylurea and glyphosate herbicidal different herbicide treatment.In some tests, use the transgenosis check clone, known its tolerance glyphosate is still to other herbicide sensitive.The T1 plant of test also demonstrates outstanding herbicide tolerant under field condition, verified the genetic stability of herbicide tolerant.

Assessment is to the tolerance of a series of weedicides

Assess the GAT-HRA maize plant then, whether also tolerate other weedicide to determine them.The test that before occurring and appearance back weedicide is used.Particularly, seven corn seeds of to be assessed every kind of strain system are planted in 1cm depths in the Tama silt of 5.5 inches square plastic containers.The processing described in the application table 3 and 4 before any watering.One week of back occurs, thinning (thin) makes every kind of container have two kinds of uniform plants.Corn seedling is watered and applies fertilizer, so that grow fast and use the 16h photoperiod to grow.When dropping to, natural optical density(OD) is lower than 500 μ E/m ²During/s,, use 160 μ E/m to its additional metal halide light ²/ s photosynthetically active radiation.Temperature remains on 28 ± 2 ℃ of daytimes, 22 ± 2 ℃ of nights.Relative humidity is generally 50 to 90%.

The commercial herbicides preparation is used in the research that weedicide is used before occurring.Use deionized water also to stir at least 15 minutes at room temperature preparation spray mixing thing.Preparation aftertreatment spraying 1 to 2 hour.All are handled all and use with the sprayed volume of 374L/ha, use the flat fan-shaped nozzle of 51cm, use the spray pressure that is set to 138kPa, guarantee dissolving with the alkalescence blending adjuvant of high pH.By the visual assessment plant injury and after processing the fresh branch of 4 all weighings (result displayed in the table 1).Also estimate the crop damage by vision on 0% to 100% scale, wherein 0% represents not damaged, 100% expression plant death.The result is displayed in Table 3 and is expressed as multiple mean value four times.

Influence before the appearance of table 3.34 kind of ALS weedicide to the fresh weight of GAT-HRA and parent's inbreeding corn

Influence before the appearance of table 4.34 kind of ALS weedicide to the visual damage of GAT-HRA and parent's inbreeding corn

The commercial herbicides preparation is also used in the research that back weedicide application occurs.Especially, four corn seeds of to be assessed every kind of strain system are planted in 1cm depths in the synthetically grown substratum of 5.5 inches square plastic containers.With the transgenosis seedling at glyphosate pre-treatment initial stage, to remove segregant to the glyphosate sensitivity.Remove the plant of being handled injury by glyphosate, and two uniform plants of each container are arrived in the container thinning.Plant extra container, use in the feasible experiment only to have two all containers of even int plant.Corn seedling is watered and applies fertilizer, so that growth and with the growth of photoperiod of 16 hours fast.When natural light intensity is lower than 500 μ E/m ²During/s, use metal halide illumination with 160 μ E/m ²The photosynthetically active radiation of/s replenishes irradiation.Temperature remains on 28 ± 2 ℃ of daytimes, 22 ± 2 ℃ of nights.Relative humidity is generally 50 to 90%.

Back research occurs and use the commercial herbicides preparation, two weeks were used after plantation.The spray mixing thing that uses deionized water at room temperature to prepare weedicide also stirred 15 minutes at least.After preparation, handled thing was sprayed in 1 to 2 hour.All ALS herbicide treatment are all used with the sprayed volume of 374L/ha, use the flat fan nozzle of 51cm and are arranged on the spray pressure of 138kPa, and comprise the basic blending adjuvant of high pH, to guarantee stable and the leaf infiltration.Glyphosate and careless ammonium phosphine herbicide formulations comprise that in their commercial formulation adjuvant system is to guarantee high leaf activity.Fresh branches of 2 all weighings (data are displayed in Table 5) after processing, and on 0% to 100% yardstick, assess damage by vision, 0% expression not damaged wherein, 100% expression plant death (data are displayed in Table 6).The result is expressed as multiple mean value four times in table 5 and 6.

Influence after the appearance of table 5.34 kind of ALS weedicide to GAT-HRA and parent's inbreeding corn fresh weight

Influence after the appearance of table 6.34 kind of ALS weedicide to GAT-HRA and parent's inbreeding corn

Comprise the extra test of other agricultural chemicals

Assess with other scheme: whether other GAT-HRA plant more tolerates other agricultural chemicals than other control plant except comparison more tolerates the multiple weedicide according to plant.For example, a kind of scheme comprises: except using organic phosphoric acid weedicide Chlorpyrifos 94 (Lorsban

) outside the processing, also handle the GAT-HRA corn with sulfonylurea weedicide rimsulfuron 25 and thiameturonmethyl.In this test, handle back 14 days assessment plants, all 20 strain GAT-HRA transgenic plant all demonstrate and well extremely tolerate these chemical goodly, and control plant has demonstrated the remarkable injury that this processing causes (seeing Table 8).Distribute weedicides damage scores (be also referred to as tolerance score) with 1 to 9 yardstick with 9 grades based on study plot.Grade is 5 to show the damage of medium leaf.The further yardstick that herein interpreted is used in the table 7 below.

The weedicide damage yardstick (1 to 9 yardstick gets sub-system) of table 7. corn

Grade	Primary categories	Describe in detail
			9	There is not influence	No crop reduces or damage
8 7 6	Minimal effect	Slight crop is faded or some crops of growth retardation are faded, and growth retardation or the damage of dysplasia crop are more serious, but not lasting
			5 4 3	Medium influence	It is more lasting that middle equivalent damage, crop recover the crop damage usually, recovers to be difficult to determine lasting crop damage, do not recover
2 1	Have a strong impact on	Serious crop damage and laid crop are near the plant of destroyed-some survivals

Table 8.GAT HRA rotaring gene corn plant demonstrates the outstanding tolerance (measuring by the tolerance score) to weedicide

After the spray applications 14 days, also measure the plant height of 20 strain transgenic plant based on study plot.Collect the GAT HRA incident that four identical strains tolerate most and the plant height of non-GAT HRA contrast.Four transgenic events all demonstrate plant-growth uniformly after all herbicide treatment.Non-GAT HRA contrast demonstrates the minimizing that sulfonylurea is handled the back plant-growth.Be displayed in Table 9 average ground level from these measurements.

Table 9.GAT HRA rotaring gene corn plant demonstrates the outstanding tolerance (measuring by the average plant height) to weedicide

The GAT-HRA plant is to the comparison of replying of a series of weedicide dosage

Use multiple expression cassette to produce the GAT-HRA maize plant, and, measure (seeing Table 10) as mentioned at described to the tolerance of multiple sulfonylurea chemical and glyphosate combination.

The GAT HRA corn that table 10. uses multiple expression cassette to produce tolerates multiple sulfonylurea chemical

Embodiment 2-GAT-HRA soybean plants tolerates multiple weedicide and agricultural chemicals Conversion of transgenic plant and regeneration

With expression cassette bombardment soybean embryo, this expression cassette contains GAT (SEQ ID NO:68) and the HRA polynucleotide (SEQ ID NO:65) that are operably connected on the constitutive promoter, and is as mentioned below.The promotor that is used for the GAT sequence is the SCP1 promotor, and the promotor that is used for the HRA sequence is the SAMS promotor.These two promotor/assortments of genes are arranged with the direction of connecting with the HRA promotor/gene in GAT promotor/gene downstream.For the inductor somatic embryo, will light or dark, at suitable nutrient agar cultivate 6 to 10 weeks under 26 ℃ less than the long cotyledon of 4mm from what the immature seed of the surface sterilization of soybean varieties Jack was dissected.The somatic embryo that will produce secondary embryo then cuts off, and places suitable liquid nutrient medium.Select breeding for behind the somatic embryo of early stage globular embryo bunch repeatedly, as mentioned below, keep this suspension.Here, should be used as selective marker by the herbicide tolerant proterties that the conversion plant has.

With soybean embryo generation suspension culture 150rpm on rotary shaker, remain in the 35ml liquid nutrient medium under 26 ℃, use fluorescence and 16:8 hour day/night scheme.Be organized in the 35ml liquid nutrient medium by inoculating about 35mg, culture is carried out biweekly going down to posterity.

Come soybean transformation embryo generation suspension culture by particle gun bombardment method (Klein et al. (1987) Nature (London) 327:70-73, U.S. Patent number 4,945,050) then.

Add (in order) to the 60mg/ml of 50 μ l, 1 μ m gold grain suspension: 5 μ l DNA (1 μ g/ μ l), 20 μ l spermidines (0.1M) and 50 μ l CaCl ₂(2.5M).Then the granules preparation thing is stirred 3 times in Eppendorf centrifuge centrifugal 10 seconds and remove supernatant liquor.The particle that then DNA is wrapped quilt with 400 μ l, 70% washing with alcohol once and be resuspended in the 40 μ l dehydrated alcohols.To three supersound process of DNA/ particle suspension liquid, each 1 second.Gold grain with 5 microlitre DNA bag quilt is loaded on each larger vector dish then.

The suspension culture in two ages in week of about 150-200mg is positioned in the empty 60x15mm culture dish, and removes residual liquid from tissue with pipettor.For each transformation experiment, bombard the tissue of about 5-10 dish usually.Film rupture pressure is set to 1100psi (77.356kg/cm), and the chamber is evacuated down to 28 inches of mercury.To organize from keeping the about 8.89cm of screen and place, and bombard 3 times.After the bombardment, will organize in two and be put back in the liquid and as above-mentioned cultivation.

Bombardment back 5 to 7 days, with fresh culture exchanging liquid substratum, and after bombardment 11 to 12 days, contain the grand fresh culture of 30-50mg/L Totomycin and 100ng/ml chlorine sulphur as selective agent.This selection substratum upgrades weekly.In 7 to 8 weeks of bombardment back, observing clusters from the embryogeny of unconverted necrosis grows green transforming tissue.Remove isolating chlorenchyma, and inoculation advances in each culture plate, new to produce, vegetative, the embryo generation suspension culture that transformed.Being used as independently transformation event from each new culture of the separated region of transforming tissue treats; Individual culture and initial (T0) plant and its offspring representative single " incident " usually from the single district of transforming tissue.Then these suspension are gone down to posterity cultivate and remain immature embryos bunch, perhaps maturation and the complete plant of sprouting regeneration by individual somatic embryo.

Herbicide treatment

With 1x glyphosate (1X glyphosate ratio is the 1120g/ha glyphosate isopropyl amine) young regeneration of transgenic plant is sprayed, to eliminate segregant.The each processing carried out four repetitions.Use multiple weedicide then, comprise glyphosate and ALS inhibitor herbicide treatment plant.When handling with the tribenuron-methyl weeding agent, with 0 and the genetically engineered soybean that contains GAT-and HRA-handled of 35g/ha do not demonstrate remarkable damage, and the non-transgenic of herbicide treatment contrast soybean is killed by this processing.With 8x glyphosate and 35g/ha tribenuron-methyl and 35g/ha rimsulfuron 25 processing plant, and obtain similar result.

To be planted in 1cm depths in the synthetically grown substratum of square plastic container of 5.5 (13.97cm) foot from 6 soybean seeds of each kind to be determined.With the extremely young transgenosis seedling of glyphosate pre-treatment, to eliminate the segregant that does not tolerate glyphosate; Remove the plant of this processing damage.When possible, be two uniform plants with the container thinning.Strain is that thinning becomes two even plants of each container to non-transgenic.Soybean seedling is watered and applies fertilizer with quick growth.Plant grew with 16 hour photoperiod, when natural light intensity is lower than 500 μ E/m ²During/s, use metal halide illumination with 160 μ E/m ²The photosynthetically active radiation of/s replenishes irradiation.Temperature remains on 28 ± 2 ℃ of daytimes, 22 ± 2 ℃ of nights.Relative humidity is generally 50 to 90%.

These occur, and the commercial herbicides preparation is used in back research and two all application after plantation.Use deionized water at room temperature to prepare the spray mixing thing, and stirred at least 15 minutes.Handled thing was sprayed after preparation in 1 to 2 hour.35g/ha rimsulfuron 25 and tribenuron-methyl weeding agent are handled with the sprayed volume of 374L/ha and are used, and use the flat fan nozzle of 51cm and are arranged on the spray pressure of 138kPa, and comprise the basic blending adjuvant of high pH, to guarantee stable and the leaf infiltration.The commercial formulation that glyphosate is handled is used with the sprayed volume of 374L/ha, uses the flat fan nozzle and the spray pressure that is arranged on 138kPa of 51cm.By the scale assessment plant of vision with 0% (not damaged) and 100% (plant death).The result is expressed as multiple mean value in the following Table 11 four times.

Influence after table 11. glyphosate and two kinds of sulfonylurea weedicide appearance the GAT-HRA soybean

Some kinds of weedicides of embodiment 3-transgenosis GAT-HRA cotton tolerance

With GAT polynucleotide (gat 4621) and Hra polynucleotide (SEQ ID NO:86) converting cottons (Gossypium hirsutum) Coker 312, described polynucleotide all are operably connected on the strong constitutive plant viral promotors.The promotor that is connected to gat4621 contains strawberry vein banding virus (Strawberry Vein Banding Virus) transcript promotor (Wang et al.VirusGenes 20:11-17,2000; Genbank X97304) repeating part.The Hra gene is by the chimeric cauliflower mosaic virus of Mirabilis jalapa (Mirabilis Mosaic Caulimovirus) total length transcript promotor (United States Patent (USP) 6,420,547; Dey and Maiti, Transgenics 3:61-70,1999) repeating part drive.The dubbing method use contains the agrobacterium tumefaciens (Agrobacterium tumefaciens) of expression of gene box to be transferred and the callus in cotyledon explant source, and this callus has the ability that certain experience embryo takes place.Callus is exposed to Agrobacterium 48-72 hour.Then callus is exposed in solid medium on the grand and/or 50-450 μ M glyphosate of 50-200 μ g/l chlorine sulphur, to select transformant.Also can use about 5 glyphosates to about 450 μ M concentration.Application choice is up to the organizer somatic embryo, and in the embryo germination step with choose during plantlet is taken root application choice once more wantonly.Use chlorine sulphur to swell and select to have produced the GAT-HRA transformation event more than 450 with glyphosate.

The vegetable lamb that order transforms takes root, and it is transferred to further growth in the soil.Then plant being carried out herbicide sprays in the greenhouse handles.In a processing, in the 4-6 leaf stage, at the top of plant with the utility ratio spraying glyphosate of every acre of 1.5lb acid equivalent (per hectare 2.58Kg acid equivalent).It is dead that unconverted Coker 312 control plants are used 2 weeks of back at glyphosate.Compare, about 50% GAT-HRA transgenic plant (every kind corresponding to independent transformation event) did not demonstrate harmful symptom that glyphosate is handled in back 14 days in application.GAT and HRA plant transformed are further used sulfonylurea weedicide rimsulfuron 25 with the ratio " at the top " of 16g activeconstituents/hectare.Once more, about 35% transgenic plant are used back 14 days and glyphosate at rimsulfuron 25 and use back 28 days and do not demonstrate dual weedicide and use the harmful symptom that causes.Even do not use glyphosate, unconverted Coker 312 plants also demonstrate rimsulfuron 25 and use the grievous injury that causes.In further embodiment, cotton is used the rimsulfuron 25 of 32gai/ha.

Use polymerase chain reaction (" PCR ") assay method, further verify the existence of every kind of GAT and HRA polynucleotide in the Herbicid resistant transgenic plant, and use western blot analysis to detect expressed GAT and HRA polypeptide.

The preparation of embodiment 4-single-size adulterant

Can prepare in any suitable manner and be used for herbicidal composition of the present invention, as " single-size adulterant " (for example seeing U.S. Patent number 6,022,552, title " UniformMixtures of Pesticide Granules ").By shaking or alternate manner mixes usually by extruding or two or more sets columned basically particles of granulation preparation; can prepare and be formulated as according to U.S. Patent number 6; 022; the herbicidal composition of 552 single-size adulterant; wherein one group has the active component content that comprises at least a weedicide; and one or more other groups have different active component contents or inert substance content; particle in every group has basically about 1 to 8 times longitudinal length of diameter and diameter uniformly; the particulate mean length is 1.5 to 4 times of diameter, and every group mean diameter and another group differ and be no more than 30%.In some embodiments, each groups of grains comprises and contains single registration formulation products of planting activeconstituents, and described activeconstituents is for example weedicide, mycocide and/or insecticide." cylindric basically " is bar-shaped or piped, and wherein cross-sectional shape can be circle, octagon, rectangle, perhaps any shape that other can be expected, and wherein vertical surface is spiral, curve or straight.By deducting and have than particulate mean diameter in the group of minor diameter from having larger-diameter group the particulate mean diameter, then with the difference calculated divided by having than particulate mean diameter in the group of minor diameter, at last the merchant who is calculated be multiply by 100% difference of coming arithmetic average diameter.

Can optimize the uniformity coefficient of " single-size adulterant " by particulate relative size and the size distribution used in the control adulterant.That how many density variations is is unessential (see, for example, Rhodes (1990) Principles of Powder Technology, pp.71-76 (John Wiley ﹠amp; Sons)).Extrude the particulate diameter by the size control of extruding the mould mesopore, and can obtain having that desired length distributes extrudes particle colony (see, for example, U.S. Patent number 6,270,025) with the centrifugal screen separating method.Preferably, the mean diameter of each groups of grains and another group differ and are no more than 20%, more preferably no more than 10%.Also preferably, every group longitudinal length is 1.5 to 4 times of particle diameter.

Based on the instruction of United Nations's food and agricultural organization (FAQ), the activeconstituents in every kind of preparation has relevant otherness tolerance, as showing in the table 12.

Table 12:FAO is for the nominal concentration guide of activeconstituents in the preparation

Nominal concentration (=N)	FAO scope (for the % of nominal)
		N≤2.5％	±25％
2.5％≤N≤10％	±10％
		10％≤N≤25％	±6％
25％≤N≤50％	±5％
		N＞50％	±25g/kg

Based on the active component content and the mixed ratio of component particles of component particles, determine the active component content in the single-size adulterant.Produce the single-size adulterant, the nominal value of supposing the activeconstituents of compound ingredients is correct.Because the otherness in the real difference relevant with the determination of bioactive constituent method and mixing and the sampling has been developed following method, calculate the scope of active component content in the single-size adulterant, as described below.

1. at every kind of compound ingredients, define chartered FAQ standard (" %AI in the component ").

2. use the FAQ tolerance, with the production limit (" % component in the adulterant ") of the amount of setting up every kind of component in the adulterant.

3. multiply by the greatest limit of " % component in the adulterant " by greatest limit, calculate the greatest limit (" %AI in the adulterant ") of activeconstituents in the adulterant " %AI in the component ".Carrying out minimum value and nominal simply calculates.

Calculated examples at some kinds of single-size adulterant products is as follows.Rank rear in each example table has shown standard FAO assay method scope, its will be applied to contain with example in the conventional pre-mixing product of the identical active component content of single-size adulterant.The otherness that the relative broad range of single-size adulterant product (" %AI in the adulterant ") allow to use Registering product to introduce, with the relevant range of active component content as the component in the product.

*=adulterant of 65.2%Ally 20PX and 34.8%Quantum 75PX.This adulterant is sold with BiPlay and DP911 commercial.

The adulterant of *=42.8%Ally 20PX and 57.2%Harmony 75PX.This adulterant is sold with Finish and DP928 commercial.

The adulterant of * *=60%Lexus 50PX and 40%Quantum 75PX.This adulterant is sold with DP953 commercial.

Also developed following method, whether fallen into the scope of hope to determine concrete single-size adulterant.The single-size adulterant is the particulate random mixture; Therefore, in order accurately to represent said composition, must assess the particle of certain number.Can use statistics equation sample estimates particulate minimum (to see Rhodes (1990), Principles of Powder Technology (John Wiley ﹠amp; Sons), pp.71-76),

s ²＝P(100-P)/n

The standard deviation of composition ratio in the s=adulterant wherein, the weight percent of P=component, granule number in the n=sample (～4001-mm diameter particle=1 gram).By solving n and n being changed into the gram number by the particle mean number of extruding divided by 1-mm paste in the 1g sample with ' n ' (for example, 400).

If standard deviation is based on the FAQ tolerance of the amount of component in the concrete particulate admix in this calculating, can calculate the minimal sample size of this particulate admix so.In order to obtain 95% degree of confidence, " % component in the adulterant " tolerance on every side is set to 2 standard deviations.Be appreciated that this is that theoretic statistics is estimated.

For particulate admix is feasible commerical prod, the statistics sample size must be equal to or less than the minimum that the peasant maybe should choose and will measure, and is generally one hectare of dosage.The sample size calculated examples that has shown particulate admix discussed above below.

Detailed calculated to the minimal sample size of DPX-CDQ73 39.1WG adulterant:

For less important compound ingredients (Quantum 75PX), the FAQ tolerance of ± 5% relative value obtains scope: 5% * 34.8=1.7

For 95% degree of confidence, 2 standard deviations are set to=and 1.7, obtain standard deviation s=0.85 and be used for calculating:

s ²＝P(1-P)/n＝(0.85)2＝(65.2×34.8)/n

N=3140 particle=7.8 grams (based on 400 particle/grams)

The minimum statistics of calculating of about 8 grams this product rate of utilization that imitates less than 38g/ha.

When the single-size adulterant can be become the composition of suitable big or small aliquots containig and each aliquots containig will satisfy required assay method standard by double sampling, described homogeneous granules adulterant just was considered to " uniformly ".In order to illustrate homogeneity, the large sample of preparation single-size adulterant becomes its double sampling the aliquots containig greater than the statistics sample size of minimum then.Prepare second part of adulterant sample, and carry out mimic transport test (ASTM D 4728-87, the random vibration test standard method of transport container (Standard Method for Random VibrationTesting of Shipping Containers)), double sampling becomes aliquots containig then.Use liquid chromatography (LC) to analyze the activeconstituents of aliquots containig.The simulate test is shaken the time quantum of bottle standard with CF, gives the chance that particle moves around.When the particulate admix component is not suitable size, take place to separate and the unacceptably change of aliquots containig composition.

Aliquots containig analytical data from the uniformity test of DPX-CDQ73 39.1WG adulterant is shown in the table 17 hereinafter.All data points of testing in the particulate admix aliquots containig all fall in their theoretical specification limits separately, show that adulterant is uniform.

Used the cylinder type mixing tank to produce the single-size mixture with batch processes.After the mixing, be about to particulate admix and be assigned in the commercial-scale suitable vessel (bottle, bag or the like).All data of the different batches of the test shows adulterant of the single-size adulterant DPX-CDQ73 WG that produces are all in the measurement range of planning separately of activeconstituents.

Embodiment 5. assesses glyphosate and ALS in the soybean plants that carries different GAT and HRA sequence Inhibitor weedicide efficacy levels

Three the GAT7 incidents in the soybean and the GAT11 soybean event of four selections are compared, to determine whether to detect the tolerance difference of glyphosate+sulfonylurea processing height ratio.In treatment combination, GAT7 construct and 7,14 is compared the sprays that has significantly still less and is answered with the GAT11 construct of 28 DAS.At 8X Touchdown + 1X Resolve

+ 2X Express

Handle and 8X Touchdown

+ 2X Resolve + 4X Express

In the processing, GAT7 incident EAFS 3560.4.3 and 7,14 compares with all other incidents of 28 DAS to have minimum spraying and replys score.

Material and method

For each processing, in Hawaiian two places,, make three selected GAT7 incidents and four selected GAT11 incident growths with RCB design (carrying out piecemeal) by processing, this carries out three times at two 12 feet study plots and repeats.Each strain system, incident and the construct of test in table 18, have been listed.

Table 18

Numbering GAT incident construct construct is described

JH12862353 GAT11 EAFS3861.2.3 PHP22021A H2B:GAT4618::3(35Senh)+:SCP:HRA(DV)

JH12862357 GAT11 EAFS3862.2.5 PHP22021A H2B:GAT4618::3(35Senh)+:SCP:HRA(DV)

JH12862359 GAT11 EAFS3862.2.5 PHP22021A H2B:GAT4618::3(35Senh)+:SCP:HRA(DV)

JH12862360 GAT11 EAFS3862.2.5 PHP22021A H2B:GAT4618::3(35Senh)+:SCP:HRA(DV)

JH12862361 GAT11 EAFS3862.2.5 PHP22021A H2B:GAT4618::3(35Senh)+:SCP:HRA(DV)

JH12862364 GAT11 EAFS3862.4.2 PHP22021A H2B:GAT4618::3(35Senh)+:SCP:HRA(DV)

JH12862365 GAT11 EAFS3862.4.2 PHP22021A H2B:GAT461 8::3(35Senh)+:SCP:HRA(DV)

JH12862405 GAT11 EAFS3876.8.15 PHP22117A H2B:GAT4621::3(35Senh)+:SCP:HRA(DV)

JH12862406 GAT11 EAFS3876.8.15 PHP22117A H2B:GAT4621::3(35Senh)+:SCP:HRA(DV)

JH12862528 GAT7 EAFS3560.4.3 PHP20163A SCP:GAT4601::SAMS:HRA

JH12862529 GAT7 EAFS3559.2.1 PHP20163A SCP:GAT4601::SAMS:HRA

JH12862531 GAT7 FAFS3561.1.1 PHP20163A SCP:GAT4601::SAMS:HRA

Three kinds of different being treated to of using vegetative period at V3: 1.8X Touchdown Hi-Tech (8630.55g/ha a.i. glyphosate)+1X Resolve (35.0g/ha a.i. rimsulfuron 25)+2XExpress

(17.5g/ha tribenuron), 2.8X Touchdown Hi-Tech (8630.55g/ha a.i. glyphosate)+2X Resolve

(70.0g/ha a.i. rimsulfuron 25)+4XExpress

The contrast that (35.0g/ha tribenuron) and 3. do not spray.All sprayings are handled and are also contained 1X nonionogenic tenside and ammonium sulfate.After spraying 7,14 and 28 days, study plot is estimated spraying damage grading (0%=does not observe and has influence on the death of the whole study plot plant of 100%=) based on observed chlorosis, necrosis and/or plant-growth are slow.Use SAS to the range estimation ratings data carry out ANOVA and average mark from.

Result and discussion

In three processing, GAT (7vs.11) wheel, DNA construct, incident, processing, GAT ^*Processing, construct ^*Handle and incident ^*Processing is at 7DAS during with 14DAS significantly different (data not shown).At 28 DAS, GAT wheel, construct, incident, processing, GAT ^*Handle and incident ^*Handle significantly different (data not shown).Observing GAT7 strain cording between three processing of 7,14 and 28 DAS has remarkable lower reply data not show).

At 8X Touchdown

+ 1X Resolve

+ 2X Express In the processing, GAT7 construct PHP20163A compares with GAT11 construct PHP22021A to have significantly lower spraying and replys grading (data not shown) when 7,14 and 28 DAS.PHP20163A compares with PHP22117A and only obviously more tolerate this processing (data not shown) when 28 DAS.In the incident that is compared, GAT7 incident EAFS 3560.4.3 has the most preliminary tolerance when 7 and 14 DAS, and has best recovery score (data not shown) when 28 DAS.When the difference of checking between the lowest mean square (LSMeans), compare with GAT11 EAFS 3862.2.5 with GAT11 EAFS 3861.2.3, each of three GAT7 incidents all has significantly littler spraying when 7 DAS replys, and statistically with GAT 11 EAFS 3862.2.5 and GAT11 EAFS 3876.8.1 similarly grade (data not shown).At 14 DAS, the GAT7 incident is compared the score of replying that has significantly still less with GAT11 EAFS 3862.4.2, but only has only GAT7 EAFS 3560.4.3 to have significantly littler replying (data not shown) when comparing with EAFS 3862.2.5 with EAFS 3861.2.3.At 28 DAS, all three GAT7 incidents are compared with EAFS 3876.8.1 all to have with GAT11 incident EAFS 3861.2.3, EAFS 3862.4.2 and are significantly better recovered (data not shown).In addition, GAT7 incident EAFS 3560.4.3 compares with GAT11 incident EAFS 3862.2.5 and has significantly littler spraying reply (data not shown) when 28 DAS.

Checking 8X Touchdown

+ 2X Resolve

+ 4X Express

During processing, GAT7 PHP20163A compares with GAT11 PHP22021 to compare with 28 DAS 7,14 has significantly littler replying, and PHP20163A compares with GAT11 PHP22117A has significantly littler replying (data not shown) when 28 DAS.In these incidents, other incident of GAT7 EAFS3560.4.3 and all is compared has significantly better tolerance when 7 and 14 DAS, GAT7 EAFS 3559.2.1 compares with other incident of EAFS 3560.4.3 and all to compare at 28 DAS to have significantly lower spraying and reply (data not shown).The difference that compares LSMeans, when 7 DAS and 14 DAS, GAT7 incident EAFS 3559.2.1 compares with all GAT11 incidents to have with EAFS 3560.4.3 and significantly better recovers (data not shown).GAT7 incident EAFS 356 1.1.1 only significantly are better than GAT11 incident EAFS 3 862.4.2 (data not shown).

Robustness test data analyzer in embodiment 6. soybean

Under the field test condition, studied the interaction of sulfonylurea and imidazolone.In the past at commercial STS

Observed the antagonistic action between sulfonylurea and the imidazolone chemical on the soybean varieties.To STS

The SU sample thiameturonmethyl of soybean normally safety.Add IMI sample Imazethapyr (Pursuit) and mixture become more dangerous (antagonism crop safety).For the situation of GAT Rd7, rimsulfuron 25 causes crop phenotype (phyto).Add IMI sample Pursuit and mixture become safer (damage of antagonism crop).The test of the filing that describes below shows the crop safety increase when mixing as rimsulfuron 25 and for example Imazethapyr (imidazolidinone weedicide of common " safety ") when normal amount of damage.Embodiment 6A comprises field test, and it has illustrated this effect.Embodiment 6B provides the greenhouse data, and it confirms the field test data.

Embodiment 6A

Also the T6 to the guide GAT7 incident (SEQ ID NO:68) that also has HRA (SEQ ID NO:65) [SCP:GAT7::SAMS:ALS] compares for soybean and 92B25, the robustness level when determining with the various combination of sulfonylurea, Chlorpyrifos 94 and/or Imazethapyr chemical and ratio spraying.Except 16X Harmony

In all treatment combinations of (not detecting significance), GAT7 and STS

Comparing after spraying 7,14 and 28 days (DAS) has significantly lower spraying and replys.Use 1X Resolve

With with not with Lorsban

Produced from GAT7 and STS at 7 DAS Reply in a large number.GAT7 can and handle obviously from these during 28DAS and recover 14, and STS

It is seriously injured that strain keeps.GAT7 strain and STS

Strain is compared at 7 DAS 4X Pursuit

Have significantly lower spraying and reply, and two kinds of product tie up to 14 all not have during with 28 DAS remarkable different.When using 1X Resolve + 4X Pursuit

The time, GAT7 strain and STS

Strain is compared has significantly higher tolerance when 7,14 and 28 DAS.At 7,14 and 28 DAS16X Harmony

, do not observe from GAT7 or STS Big the replying of strain system.From combination 16X Harmony

With 4X Pursuit

Or 16X Harmony

With 4XExnress

Processing data show: GAT7 and STS Product tie up to 7,14 and compare during with 28 DAS and have significantly lower spraying and reply.In addition, with STS

Compare, from 0.25X Resolve

+ 1.5X Express

7, the 14 and 28 DAS data of handling have significantly higher tolerance.Usually, the data from this research show GAT7 and STS

Compare obviously higher tolerance is provided between multiple weedicide and desinsection chemical.

Material and method

For every kind is handled, make the growth of guide GAT7 incident with RCB design (carrying out piecemeal) by processing in Hawaiian two places.(EAFS 3560.4.3; GEID=JH12862528) and 92B25 (STS

) carry out three repetitions at two 12 feet study plots.9 kinds of different being treated in the application of V3 growth phase: 1.1X Resolve

(2oz) (35.0g/ha a.i. rimsulfuron 25), 2.1X Resolve

(35.0g/ha a.i. rimsulfuron 25)+1X Lorsban 4E (560.0g/haa.i. Chlorpyrifos 94), 3.4X Pursuit

(211.8g/ha a.i. Imazethapyr), 4.1X Resolve

(35.0g/ha a.i. rimsulfuron 25)+4X Pursuit

(211.8g/ha a.i. Imazethapyr), 5.16XHarmony GT (70.0gms/ha a.i. thiameturonmethyl), 6.16X Harmony

(70.0gms/haa.i. thiameturonmethyl)+4X Pursuit

(211.8g/ha a.i. Imazethapyr), 7.16X Harmony (70.0gms/ha a.i. thiameturonmethyl)+4X Express

(35.0g/ha a.i.tribenuron), 8.0.25X Resolve (2,157g/ha a.i. glyphosate)+1.5X Express

(13.1g/ha a.i.tribenuron), the 9. not contrast of spraying.All sprayings are handled and are also contained 1X nonionogenic tenside and ammonium sulfide.After spraying 7,14 and 28 days, study plot is estimated spraying damage grading (0%=does not observe and has influence on the death of the whole study plot plant of 100%=) based on observed chlorosis, necrosis and/or plant-growth are slow.Use SAS to the range estimation ratings data carry out ANOVA and average mark from.

Result and discussion

7 with during during 14DAS all handle, place, GEID, processing and GEID ^*Obvious processing effect difference (data not shown).7 with during during 14DAS all handle, the GAT7 strain is that score is starkly lower than STS Strain system (data not shown) is at 28 DAS, GEID, loc ^*GEID handles, and GEID ^*Obviously different (data not shown).In all are handled, when 28 DAS, GAT7 strain system and STS

Strain system compares to such an extent that be divided into significantly lower spraying damage (data not shown).

1X Resolve

(rimsulfuron 25) handled and produced when 7 DAS from GAT7 (70%) and STS

(83%) big the replying (data not shown goes out) of strain system.At 14DAS, GAT7 strain system (74%) and STS

Strain system (93%) compares has significantly lower replying (data not shown goes out).During to 28 DAS, GAT7 can recover and and STS Strain system compares to such an extent that be divided into significantly less injury (32% and 93%) (data not shown).

When checking from Lorsban

(Chlorpyrifos 94)+1X Resolve

During the data handled, GAT7 strain system and STS

The replying to compare of strain system all not have remarkable lower replying (data not shown) before 14 and 28 DAS.At 28 DAS, use Lorsban

And Resolve (56%) recovery of the GAT7 strain of spraying system does not only have the 1X Resolve of GAT7 strain system

(32%) recovery of Chu Liing so fast (data not shown).

Use 4X Pursuit

(Imazethapyr) provides at 7 DAS from STS

Big the replying (72%) of strain system, and GAT7 strain system (29%) has significantly lower replying (data not shown).At 14 DAS and 28 DAS, GAT7 and STS Between difference be not significant (data not shown).

1X Resolve

+ 4X Pursuit Jar mixture and STS

Strain ties up to 7,14 and compares with 28DAS and to cause the obvious littler spraying of GAT7 strain system to reply (data not shown).1X Resolve to GAT7 + 4X Pursuit

Handle and 1X Resolve only And 1XResolve

+ Lorsban Compare when 7,14 and 28 DAS and must be divided into lower overall impairment (data not shown).Use these handle to GAT7 strain system only by to relatively, when 14 and 28 DAS, 1X Resolve

+ 4X Pursuit

Handle score significantly less than 1XResolve

+ Lorsban

Handle.In addition, to the 1X Resolve of GAT7

+ 4XPursuit Handle and 1X Resolve

Handle by to being significant when 14 DAS more only.

Use 16X Harmony

Daily do not produce three gradings from GAT7 or STS

The replying greatly of strain system (data not shown).For all 16X Harmony

Score, GAT7 and STS

There is not significant difference (data not shown).Use and 16X Harmony Blended 4X Pursuit

Processing is for GAT7 strain system and STS

Strain system Comparatively speaking 7,14 and 28DAS do not produce the significantly lower score (data not shown) of replying.4X Express With 16XHarmony Mixture for GAT7 strain system and STS

Strain system compares in 7,14 and 28 DAS scores significantly lower (data not shown).Usually, the GAT7 strain ties up to provides the Harmony for 16X all marking days

, 16X Harmony

+ 4X Pursuit

With 16X Harmony

+ 4XExpress

The outstanding overall tolerance of handling.

0.25X Resolve

+ 1.5X Express

The strain that produces of the mixture crop that ties up to 7 DAS (53%) and 14 DAS (47%) from GAT7 reply obvious (data not shown) that does not have 28 DAS (12%).STS

Strain system compares with GAT7 at 7 DAS (79%) and 14 DAS (90%) has obviously higher replying (data not shown).STS

It is to compare to have obviously more to reply (data not shown) less than recovery (87%) and with the GAT7 strain that strain ties up to 28 DAS.Only check GAT7 strain system, 0.25X Resolve

+ 1.5X Express

That handles pursues comparing and 1X Resolve Compare at 7,14 and 28 DAS and observe significantly less replying.

Table 19 processing scheme is summed up

＞=additional chemical

Grade unit:

LMA=pound material/acre

NA=is inapplicable

OMA=OZ (doing) material/acre

PMA=pint material/acre

PMV=% material (volume/volume)

Design: the complete piecemeal of randomization

Do not have and repeat: 3

Study plot size: 5X10 foot

Sample area: 50 square feet

Observation/grading:

Crop replys 7,14﹠amp; 28+ DAT

Embodiment 6B

Embodiment 6B provides the greenhouse data, and field experiment data that provide among top embodiment 6A have been provided for it.Use the soybean that comprises guide GAT7 incident and also have HRA under study for action.

Table 20. treatment condition are summed up

Table 21. greenhouse result sums up

Embodiment 7. uses the method for transformation of GAT sequence in corn

I. prepare Agrobacterium master flat board

1. obtain having the GAT component through engineering approaches agrobacterium tumefaciens bacterial strain of (SEQ ID NO:70 or SEQ ID NO:55), it is preserved as 50% glycerine original seed in-80 ℃ of refrigerators.The check plot of transcribing of using is the 3X35S ENH (-) of ZmUbi PRO-5UTR-ZmUbi introne 1 promotor (SEQ ID NO:78) of being operably connected.This is transcribed check plot (SEQ ID NO:78) and provides hereinafter, has wherein pointed out the position in the multiple zone of regulatory region: a) reverse 35S enhanser (3X) has single underscore; B) the UBI promotor has double underline; C) the UBI intron is an italic.

By the streak inoculation bacterium on the #800 substratum, to produce single bacterium colony, main dull and stereotyped from the preparation of glycerine original seed, and in the dark bacterium is carried out cultivating in 3-4 days.

3. by dull and stereotyped through 1 bacterium colony preparation work flat board of #810 substratum line from the master.Bacterium 1-2 days are cultivated under 28 ℃ in the dark.

II. preparation is used for the bacterium that embryo infects

1. the liquid culture that separates preceding 1 day preparation Agrobacterium at embryo.With 30ml 557A substratum, 30 μ l, 2% Syringylethanone and 30 μ l, the 5% spectinomycin culturing bottle of packing into.

2. use Agrobacterium inoculation, and place shaking table (200rpm) upward to spend the night under 28 ℃ in the darkroom from 1 loopful of 810 substratum.

3. in the morning of infecting, get the liquid culture matter sample of Agrobacterium, and carry out 1/4 dilution with 557A.Use the liquid culture of dilution, under 550nm, carry out the OD reading with visible light.

4. dilute the Agrobacterium culture suitably according to the OD reading, being between the 0.2-0.8 keeping the OD reading between the embryo separation period.

5. when preparing the Agrobacterium that is used to infect, repeat the OD reading of liquid culture.Use the OD reading, use formula EXPONENT (1.755* (lnOD)+21.77) to calculate the required ml number of 5 E10 cfu/ml (cfu=colony-forming unit) from typical curve.The Agrobacterium liquid culture that pipettes calculated amount in the 14ml pipe, and 4-20 ℃ with 4500rpm centrifugal 10 minutes.Remove supernatant liquor, and the appropriate amount of Agrobacterium with 100uM Syringylethanone solution is resuspended among the 561Q.

II. immature embryos separates

1. the 9-11 days results in pollination back have the long GS3 fringe of 1-2mm embryo size that is.

2. fringe is carried out 20-30 minute sterilization with 50% SYNTHETIC OPTICAL WHITNER and 1 Tween.With aseptic water washing 3-5 minute.

3. separate embryo and place the microminiature tube that contains 2ml 561Q from nuclear.

VI. the agroinfection of embryo

1. remove 561Q with pipettor from microminiature tube, add the agrobacterium suspension of the above-mentioned OD of 1ml with isolating embryo.

2. vortex mixed in about 30 seconds.

3. make it infect 5 minutes in room temperature.

V cultivates altogether

1. after removing liquid nutrient medium, shift embryo and directed embryo, make plumular axis be on the surface of the common culture medium of 562P downwards.

2. embryo was placed 20 ℃ of incubators 3 days.Transferring to 28 ℃ placed extra 3 days.

VI. the selection of the callus incident that transgenosis is inferred

1. after cultivating altogether, embryo is transferred to the 563I that contains the 1mM glyphosate select substratum.Culturing embryo in 28 ℃ of following dark.

2. embryo transferred to fresh 563I substratum in every 14-21 days.Sustainable about 2 months of chosen process is up to the callus incident of inferring that can identify active growth.On the 563I substratum, keep the callus incident infer, and get the callus sample and be used for PCR.

The regeneration of VII.T0 plant

1. the callus incident is transferred in the 287I substratum that contains the 0.1mM glyphosate up to the somatic embryo maturation.Cultured calli in 28 ℃ of following dark.

2. mature embryo is transferred in the 273I embryo germination substratum that contains the 0.1mM glyphosate in the flat board.Culture plate under 28 ℃ of illumination.

3. when branch and Gen Shi occurring, each plant is transferred to the 273I that contains the 0.1mM glyphosate in the test tube.Culture test tube under 28 ℃ of illumination.

4. have the branch of foundation and the plantlet of root and will be transferred to further growth and generation T1 seed in the greenhouse.

Embodiment 8.35S enhanser is to the transformation efficiency of GAT and ALS corn and the influence of effect

Material and method

With 35S enhanser construct (PHP20118, PHP20120, PHP20122, PHP20124) and non-35S construct (PHP19288) generation incident, assess the 35S enhanser to the transformation efficiency of GAT (SEQID NO:70) and the influence (Fig. 1) of effect.Difference between four kinds of 35S enhanser constructs is the direction of 35S enhanser in the copy number of 35S enhanser and the construct.The general introduction of every kind of 35S enhanser construct is provided below.

PHP20118 comprises 35S ENH (+): ZmUBI PRO-5UTR-UBI INTRON1 (forward of+expression 35S enhanser).This transcripting controling area (SEQ ID NO:80) provides below, and wherein pointed out the position in a plurality of zones of regulatory region: a) enhanced 35S enhanser has single underscore; B) the UBI promotor has double underline, and c) the UBI intron is an italic.

ctccgcttcaaggtacgccgctcgtcctcccccccccccctctctaccttctctagatcggcgttccggtccatggttagggcccggtagttctacttctgttcatgtttgtgttagatccgtgtttgtgttagatccgtgctgctagcgttcgtacacggatgcgacctgtacgtcagacacgttctgattgctaacttgccagtgtttctctttggggaatcctgggatggctctagccgttccgcagacgggatcgatttcatgattttttttgtttcgttgcatagggtttggtttgcccttttcctttatttcaatatatgccgtgcacttgtttgtcgggtcatcttttcatgcttttttttgtcttggttgtgatgatgtggtctggttgggcggtcgttctagatcggagtagaattctgtttcaaactacctggtggatttattaattttggatctgtatgtgtgtgccatacatattcatagttacgaattgaagatgatggatggaaatatcgatctaggataggtatacatgttgatgcgggttttactgatgcatatacagagatgctttttgttcgcttggttgtgatgatgtggtgtggttgggcggtcgttcattcgttctagatcggagtagaatactgtttcaaactacctggtgtatttattaattttggaactgtatgtgtgtgtcatacatcttcatagttacgagtttaagatggatggaaatatcgatctaggataggtatacatgttgatgtgggttttactgatgcatatacatgatggcatatgcagcatctattcatatgctctaaccttgagtacctatctattataataaacaagtatgttttataattattttgatcttgatatacttggatgatggcatatgcagcagctatatgtggatttttttagccctgccttcatacgctatttatttgcttggtactgtttcttttgtcgatgctcaccctgttgtttggtgttacttctgca (SEQ ID NO：80)

PHP20122 comprises 3X35S ENH (+): ZmUBI PRO-5UTR-UBI INTRON1 (forward of+expression 35S enhanser).This transcripting controling area (SEQ ID NO:81) provides below, and wherein pointed out the position in a plurality of zones of regulatory region: a) the 35S enhanser of forward has single underscore; B) the UBI promotor has double underline, and c) the UBI intron is an italic.

atgatggatggaaatatcgatctaggataggtatacatgttgatgcgggttttactgatgcatatacagagatgctttttgttcgcttggttgtgatgatgtggtgtggttgggcggtcgttcattcgttctagatcggagtagaatactgtttcaaactacctggtgtatttattaattttggaactgtatgtgtgtgtcatacatcttcatagttacgagtttaagatggatggaaatatcgatctaggataggtatacatgttgatgtgggttttactgatgcatatacatgatggcatatgcagcatctattcatatgctctaaccttgagtacctatctattataataaacaagtatgttttataattattttgatcttgatatacttggatgatggcatatgcagcagctatatgtggatttttttagccctgccttcatacgctatttatttgcttggtactgtttcttttgtcgatgctcaccctgttgtttggtgttacttctgca (SEQ ID NO：81)

PHP20120 comprises ENH (-): ZmUBI PRO-5UTR-UBI INTRON 1 (representing the reverse of 35S enhanser).This transcripting controling area (SEQ ID NO:82) provides below, and wherein pointed out the position in a plurality of zones of regulatory region: a) reverse 35S enhanser has single underscore; B) the UBI promotor has double underline, and c) the UBI intron is an italic.

PHP20124 comprises 3X35S ENH (-): ZmUBI PRO-5UTR-UBI INTRON1 (representing the reverse of 35S enhanser).(SEQ ID NO:83 provides below, has wherein pointed out the position in a plurality of zones of regulatory region: a) reverse 35S enhanser has single underscore to this transcripting controling area; B) the UBI promotor has double underline, and c) the UBI intron is an italic.

ttccccaacctcgtgttgttcggagcgcacacacacacaaccagatctcccccaaatccacccgtcggcacctccgcttcaaggtacgccgctcgtcctcccccccccccctctctaccttctctagatcggcgttccggtccatggttagggcccggtagttctacttctgttcatgtttgtgttagatccgtgtttgtgttagatccgtgctgctagcgttcgtacacggatgcgacctgtacgtcagacacgttctgattgctaacttgccagtgtttctctttggggaatcctgggatggctctagccgttccgcagacgggatcgatttcatgattttttttgtttcgttgcatagggtttggtttgcccttttcctttatttcaatatatgccgtgcacttgtttgtcgggtcatcttttcatgcttttttttgtcttggttgtgatgatgtggtctggttgggcggtcgttctagatcggagtagaattctgtttcaaactacctggtggatttattaattttggatctgtatgtgtgtgccatacatattcatagttacgaattgaagatgatggatggaaatatcgatctaggataggtatacatgttgatgcgggttttactgatgcatatacagagatgctttttgttcgcttggttgtgatgatgtggtgtggttgggcggtcgttcattcgttctagatcggagtagaatactgtttcaaactacctggtgtatttattaattttggaactgtatgtgtgtgtcatacatcttcatagttacgagtttaagatggatggaaatatcgatctaggataggtatacatgttgatgtgggttttactgatgcatatacatgatggcatatgcagcatctattcatatgctctaaccttgagtacctatctattataataaacaagtatgttttataattattttgatcttgatatacttggatgatggcatatgcagcagctatatgtggatttttttagccctgccttcatacgctatttatttgcttggtactgtttcttttgtcgatgctcaccctgttgtttggtgttacttctgca(SEQ ID NO：83)

Use is carried out transformation experiment together from the phase homeomorphism of identical fringe.Sterilely remove the immature embryos of GS3 strain system from each fringe, and be divided into five parts.With agrobacterium tumefaciens bacterial strain LBA4404 each part of embryo is infected then, this bacterial strain contains respectively the expression cassette from each of five kinds of constructs.After cultivating altogether in 6 days, embryo is transferred in the fresh selection substratum that contains glyphosate.Select the transformant propagation that survives and produce the callus that somatic embryo takes place from glyphosate.Went down to posterity in about 2 months cultivate after, embryo is operated, with the complete transgenic plant that under glyphosate, regenerate, and it is transferred to the greenhouse.Then T0 plant V3 or V4 in the greenhouse are carried out the glyphosate spraying of 6X (156 oz/ac) Roundup Ready UltraMax during the phase.Gathering the sun plant sample is used for determining copy number and the definite expression of western blotting by quantitative PCR.Then T0 plant and inbred line cross are obtained seed and be used for further assessment.

The result

Measure transformation efficiency and produce the infected embryo of resistant calli for selecting the back.The average transformation efficiency of PHP19288, PHP20118, PHP20120, PHP20122 and PHP20124 is respectively 58%, 63%, 59%, 57% and 51%.All constructs of data surface have suitable height and similar transformation efficiency, although PHP20118 demonstrates slight increase (Fig. 3).

T0 plant effect is defined as the T0 incident of anti-fully 6x glyphosate spraying.The effect of non-35S construct (PHP19288) is 48.1%.By contrast, the effect of 35S enhanser construct (PHP20118, PHP20120, PHP20122 and PHP20124) is respectively 96.6%, 93.5%, 89.1% and 91.1% (Fig. 4).All 35S enhanser constructs of data surface have significantly increased the effect of plant resistance glyphosate.

It is genetically modified integration mode that another of use 35S enhanser significantly improves.At single per-cent that copies the test event of non-35S enhanser construct only is 38%, but for four kinds of 35S enhanser constructs (PHP20118, PHP20120, PHP20122 and PHP20124), single copy incident is represented 65%, 63%, 71% and 88% incident (Fig. 4) respectively.

By western blot analysis the incident subclass from all five kinds of constructs is sampled, with the comparing difference of checking that GAT expresses between non-35S and the 35S incident.This analysis revealed: the incident from non-35S enhanser construct has extremely low-level GAT expression, and demonstrates the GAT expression (Fig. 5) of high level from most incidents of 35S enhanser construct.

Embodiment 9. uses in the new gene based on the callus/construct evaluating system of exploitation 35S enhanser GAT

Material and method

Develop this assay method and be used to improve assessment, so that identify the potential expression problem in the expression of the extremely early stage killing gene of conversion process.The basis of this assay method is to use glyphosate acetyl based transferase (GAT) gene (SEQ ID NO:55) as selective marker.GAT and desinsection test cdna all will be driven by strong constitutive promoter, and be connected in the identical construct.The promotor of using comprises ZmUBI PRO-5UTR-UBI INTRON1, and it has the 3X35S enhanser of describing as among the embodiment 7.As a result, the selection that is expected on the high-level glyphosate will be identified high desinsection test cdna expressor.Then, will be used in the insect bioassay method, whether function be arranged to measure gene product from the callus of these high expression level of inferring.Those constructs that demonstrate effect can be further used for transforming.If construct does not demonstrate effect, can follow the tracks of biological chemistry and analysis of molecules so, to identify described problem, will redesign gene and test (Fig. 6) once more in this system.

The result

This assay method is current to be in the exploitation.Preliminary data has shown the activity that can detect effect insect controlling gene in the callus stage.The current dependency of assessing between callus activity and the plant effect.

Embodiment 10. is as the GAT of selective marker

Material and method

In the corn gene group, introduce GAT (SEQ ID NO:55) expression cassette with agriculture bacillus mediated conversion.The GAT expression cassette comprises promotor, and this promotor comprises the ZmUBIPRO-5UTR-UBI INTRON1 that has on the 3X35S enhanser (described in top embodiment 1) that is operably connected to the gat gene, and this expression cassette also comprises the pinII terminator.By removing the natural T-DNA of agrobacterium tumefaciens bacterial strain LBA4404, it is eliminated in virulence.As an alternative, the GAT expression cassette is contained in the T-DNA site on Ti-plasmids.

Sterilely remove the immature embryos of corn from the caryopsis of just growing, and it is handled with the agrobacterium tumefaciens bacterial strain LBA4404 that contains the GAT expression cassette.After on the solid medium that does not have in the presence of the glyphosate embryo and Agrobacterium being carried out the common cultivation of certain hour, embryo is transferred in the fresh selection substratum that contains microbiotic and glyphosate.Any remaining Agrobacterium of antibiotic kills.Select substratum to stimulate generation of corn somatic embryo and selection to contain those cells of the gat gene of integration.Therefore, selecting to survive and breed and produce the callus of embryogeny tissue from glyphosate may be by genetic transformation.Get the callus sample and be used for analysis of molecules, to verify genetically modified the existence by PCR.Operate embryo then and tissue takes place, transfer to the greenhouse then with regeneration of transgenic gene in the presence of glyphosate.Glyphosate spraying T0 plant with different concns.Gathering the sun plant sample is used for analyzing molecules transgenosis copy number and obtains seed from initial plant transformed with inbred line cross.

Reply with the embryo of non-conversion on the different levels glyphosate test media by test, set up glyphosate and kill curve.Separate the GS3 embryo from immature fringe, place then contain 0.0,0.5,1.0 and the substratum of 2.0mM glyphosate on.After cultivating in about 40 days, observe and write down replying of embryo.Similarly, will place with the GS3 embryo that the GAT construct infects contain 0.0,0.5,1.0 and the substratum of 2.0mM glyphosate on.After cultivating in about 40 days, observe and write down reply (Fig. 7) of infected embryo.

Walk abreast experiment to compare the transformation efficiency of GAT, bar and mopat.Sterilely remove the immature embryos of GS3 strain system and be divided into three parts from each fringe.Use the agrobacterium tumefaciens bacterial strain LBA4404 of the expression cassette that contains GAT, bar or mopat respectively to infect each part of embryo then.After cultivating altogether, at the embryo of selecting with the embryo of GAT construct infection on the glyphosate substratum of routine and on the careless ammonium phosphine of routine substratum, selecting to infect with bar or mopat.The cultivation of going down to posterity in per 2 weeks.When selecting in about 50 days, observe and write down replying of embryo.

The result

Kill the curve experiment according to glyphosate, all embryos on the substratum with 0.0mM glyphosate have all started healthy callus and have formed, and the about half embryo on the substratum with 0.5mM glyphosate demonstrates the callus startup.Contain 1.0 and the substratum of 2.0mm glyphosate on embryo have minimum callus growth.This shows that 0.5mM is not enough to suppress all embryonic developments, kills the embryo of non-conversion but 1mM or 2mM are enough strong.In the embryo experiment of infecting, have 0.0 and the substratum of 0.5mM glyphosate on most embryos grown, but some embryos start resistant calli on the substratum with 1.0mM or 2.0mM glyphosate.Verified these resistant callis of western blotting or pcr analysis are transformed.Current, GAT as one man shows as the effective choice mark, all has good transformation efficiency (Figure 10 and table 45) in GS3 and introEF09B genotype.

GAT transformation efficiency among the table 22introEF09B

The embryo that genotype construct selective marker # infects to the thing of GH based on thing to GH

The txn% of part # spare #

EFWWBTX GATHRA GAT 1332 354 27％

EFWWCTX GATHRA GAT 136 47 35％

EFWWETX GATHRA GAT 1109 158 14％

EFWWZTX GATHRA GAT 1790 502 28％

4367 1061 24％

In the parallel experiment of relatively GAT, bar and mopat, 34%, mopat obtains best transformation efficiency 30% to GAT at about 64%, bar.The callus that uses GAT to select seems than those growths faster (Fig. 8) of selecting on the careless ammonium phosphine.

Embodiment 11-glyphosate, metsulfuronmethyl and two kinds of additives are to the interaction between the rye grass control

On non-glyphosate resistance rye grass, carry out this embodiment.As providing in the table 23, comprise glyphosate [180ga.i.L ha ^-1(0.5L glyphosate (SCAT ))] add metsulfuronmethyl (BRUSH-OF

) (5 and 10gha ^-1) all processing can both 100% ground the control rye grass.Metsulfuronmethyl (BRUSH-OFF

) self except the growth that hinders the rye grass plant a little, do not produce any influence.Although 0.5L is ha ^-1Glyphosate (SCAT

) 15 strains (12) in the processing in the 16 strain plants are final dead, but their deadly need longer time.These results show at glyphosate (SCAT

) and metsulfuronmethyl (BRUSH-OFF ) between may have synergy.Two kinds of additives, the control degree with any processing the time does not have difference as ADD-UP and VELOCITY.

Biotype: non--glyphosate resistance rye grass (70-04)

Population distribution: Rup 0.25 contrast (%) 6.25

Rup 0.5 contrast (%) 81.25

Rup 1.0 contrast (%) 93.75

Growth phase: 5-6 leaf stage

Condition: hot and sunny

Volume fraction: 200 L ha ^-1

Embodiment 12-glyphosate, metsulfuronmethyl and two kinds of additives are to the fluffy (Conyza of America vacation Bonariensis) interaction between the control

This embodiment comprise with embodiment 11 in the same treatment used, just handle with glyphosate susceptibility biotype Kleinskraalhans (Conyza bonariensis).Glyphosate self control is very weak, only kills 1 strain (12) in the 16 strain plants.Yet, in this embodiment, based on the adjuvant (ADD-UP of ammonium sulfate

) than two careless ether-sodium (VELOCITY ) play a role better with this mixture.

Biotype: non--glyphosate resistance Conyza (Welgevallen-paraquat resistance)

Vegetative period: 10-15 leaf stage

Condition: nice and cool and sunny

Volume fraction: 200L ha ^-1

Glyphosate (ROUNDUP): 360g a.i.L ^-1

Embodiment 13-glyphosate, metsulfuronmethyl and two kinds of additives are to glyphosate, paraquat and ACCase Inhibitor resistance rye grass between the control to interacting

This embodiment carries out with one of rye grass type of tool resistance in the world, and it is the rye grass of anti-nonselective herbicide such as Fairview (Tulbagh), its resistance glyphosate, paraquat and ACCase inhibitor.In this embodiment, adding 5 and 10g ha in 0.5L Roundup ^-1Metsulfuronmethyl (BRUSH-OFF

) and the 1% adjuvant (ADD-UP based on ammonium sulfate

), make control improve 44% (for example, 50% to 94%).In addition, based on the adjuvant (ADD-UP of ammonium sulfate

) be better than bispyribac-sodium (VELOCITY as additive ).

Biotype: the Fairview (Tulbagh) of resistance glyphosate, paraquat and ACCase inhibitor

Growth phase: 10-15 leaf stage

Condition: nice and cool and sunny

Volume fraction: 200L ha ^-1

Glyphosate (ROUNDUP): 360g ai L ^-1

Embodiment 14-glyphosate and representative SU ' s suppress glyphosate, paraquat and ACCase- Agent resistance rye grass is to the interaction between the control

In this embodiment, with four kinds of differences to SU ' s and glyphosate (SCAT

) be applied to the resistance rye grass together.Is not conclusive to best SU companion to the result about glyphosate, but is 39% (for example, only to use glyphosate (SCAT to the average benefit that the Herbicid resistant rye grass is used SU and glyphosate

) obtain 34% control, with glyphosate (SCAT

) add metsulfuronmethyl (BRUSH-OFF

), the grand (GLEAN of chlorine sulphur

) or triasulfuron (LOGRAN ) obtain 57-83% control).

Biotype: the Fairview (Tulbagh) of resistance glyphosate, paraquat and ACCase inhibitor

Growth phase: 4 leaf stages

Condition: nice and cool and sunny

Volume fraction: 200L ha ^-1

All processing are sprayed with 1%ADD-UP

Embodiment 15.GAT does not have yield effect for homophyletics such as soybean system (isoline)

Summary

3 Iowa environment in 2004 and 6 Midwest environmental testings in 2005 from 12 selected SCP:GAT7::SAMS:ALS incidents etc. the output of homophyletic system.In the time will combining, between positive strain system of GAT7 between the construct and the negative strain of GAT7 system and in particular event, do not have a remarkable volume variance at the yield data of these environment.For three guide's incidents (EAFS 3559.2.1, EAFS 3560.4.3, EAFS 356 1.1.1), when relatively the positive strain of GAT7 system with the negative sibling of GAT7 is, do not detect the volume variance on the statistics.In a word, as if the data of testing these strains system show that the genetically modified existence of GAT7 does not influence final output.

Material and method

2004 D test material and methods:

Transform kind Jack with constitutive promoter (SCP1), the expression of this promoters driven glyphosate acetyl based transferase round 7 (GAT7) is connected to selective marker and inserts fragment SAMS:ALS.SCP:GAT7::SAMS:ALS to 40 preliminary incident advanced for arriving T2 generation.By each strain be 12 at random plant tentatively determine to advance for the T2 connectivity in generation, be used for that GAT is inserted fragment and carry out pcr amplification.454 strains of tentative selection system, they for GAT for isozygotying the positive or isozygoty negative.To selected strain is to carry out piecemeal by incident, and in the output test (1 repetition of two 10 feet row) of D level, 2004 in Cedar Falls (planting for 6/5/04 kind), Dallas Center (planting for 6/4/04 kind) and Johnston, IA (planting for 6/9/04 kind) makes its growth.Use glyphosate to be sprayed at 12 remaining T3 seeds that the V3 growth phase screens each strain system, perhaps will remain in the seed immersion sulfonylurea solution and screen.Handle or the immersion of SU seed based on glyphosate, verified that 342 SCP:GAT7::ALS strains from 30 incidents are the isozygoty positive or the feminine gender of isozygotying.Dallas Center or Johnston place are collected ripe score to all clauses and subclauses.Collect yield data and carry out multiple regression, ANOVA, separate with mean value with SAS.

2005 C test material and methods

Based on output performances in 2004 and weedicide effect, the horizontal output of C that 12 GAT7 incidents were further carried out 2005 is tested.From 12 incidents of these selections, select 28 positives and 23 homophyletics such as feminine gender systems.Design 2005C tests as randomized district fully group (by incident), and at Cedar Falls, IA, Johnston, IA, Stuart, IA, Monmouth, IL, Princeton, IL and Napoleon, OH growth.Collect ripe score and yield data and carry out multiple regression, ANOVA or mean value and separate with PRISM and/or SAS.

Result and discussion

When the 2004 annual production data that are to institute's roguing of testing are carried out ANOVA, position, incident, position ^*Incident and GAT (positive or negative) variable remarkable different (data not shown).All positive strains of test in 2004 are that the mean value of output is lower than the mean value that all negative strains are.In 2005, position, incident, position ^*Incident, GAT or GAT ^*Location variable significantly different (data not shown).The mean value of the positive strain of all of test in 2005 system significantly is different from all negative strain systems (data not shown) of test.When 2004 or 2005 annual datas are merged, year, position, incident, year ^*Incident, position ^*Incident, year ^*GAT or position ^*GAT variable significantly different (data not shown).In 9 Midwest environment, the positive strain of all GAT system works as the negative strain of all GAT system when mean value (data not shown) when mean value significantly is different from test.

Based on 2004 annual production, weedicide effect and analysis of molecules are selected 3 guide GAT7 incidents, are used to carry out potential condition and product exploitation experiment.When with 2005 homophyletics such as grade being the combination of yield data and 2004 annual datas, the position is significantly different (data not shown) in EAFS 3559.2.1.The output that positive GAT strain in the EAFS 3559.2.1 is waits homophyletic system to compare significantly different (data not shown) with negative sister.In EAFS 3560.4.3,9 positions interact significantly different with position * GAT.Yet, when with similar events as in homophyletics such as GAT feminine gender system relatively the time, homophyletics such as GAT positive system is significantly different (data not shown) not.In incident EAFS3561.1.1, the position is significantly different, and GAT score and position ^*GAT interacts does not have significantly different (data not shown).In EAFS 3561.1.1, the positive strain of GAT system compares not significantly different (data not shown) with the negative sibling of GAT system.

The multiple regression of output x ripening degree of 6 environment of carrying out test in 2005 with 3 guide's incidents is to determine the overall productivity potentiality.Usually, the positive and negative strain of GAT of the GAT in each incident in 3 guide's incidents is at random (data not shown) seemingly.As if this prompting is when existing the GAT7 transgenosis, and output does not significantly change.

Carry out improved t check, the mean value (data not shown) that the positive strain of the interior GAT of each particular event system that comes the position of each test of comparison with the negative strain of GAT is.In 9 positions of test, the positive strain of the GAT in similar events as system compares with the negative sibling of GAT system does not have tangible output shortcoming.For 3 guide's incidents, the positive strain of GAT tie up to negative mean value 2.6% in, show in all environment of test to have overall productivity identical (data not shown).ANOVA that individual strain system is carried out and LSD analysis revealed do not have notable difference (data not shown) in the kind of testing in each incident except EAFS 3560.3.2.In a word, between GAT7 positive strain system and the negative strain of GAT7 system, there is not volume variance.

Embodiment 16 GAT soybean have the tolerance to glyphosate and glyphosate+SU processing

The purpose of this experiment is assessment: directly compare with the tolerance of STS; sulfonylurea (SU) herbicide tolerant of guide GAT7 incident; and determine: in guide GAT7 incident, whether different glyphosate (Gly), Gly+SU and SU can detect tolerance difference between handling.Between all are handled, to compare with STS with unconverted Jack, four guide GAT7 incidents were rated as in back 7 days of spraying and spraying in back 14 days to be had significantly littler crop damage and replys.In 4 guide GAT7 incidents, detect certain difference of replying, EAFS 3560.4.3 behaves oneself best in all are handled, and EAFS 3560.3.2 demonstrates maximum weedicide and replys.Usually, as if the SAMS:ALS construct compares some SU chemical with STS and has obviously better tolerance.In addition, the GAT7 incident of test adds the sulfonylurea chemical treatments to glyphosate, sulfonylurea and the glyphosate of different ratios and has well tolerable property.

Material and method

Weedicide effect (JHM464TGATEFF) and yield potential 1 (JHD4_GAT7 test) have been assessed from GAT round 7 (GAT7) transgenic event of construct in 2004.Based on these PRELIMINARY RESULTS and some commercial potential, select four guide's incidents to be used for carrying out extra effect test at experiment JHM5G030 in 2005.Select 92M90 as the STS kind with the GAT7 incident in the SAMS:ALS construct directly compare.Kind Jack is as unconverted negative control.

Selected strain ties up among the experiment JHM5G030 with two of 12 feet row of paired duplicate growths, uses 11 kinds of different processing.By incident and processing strain system is carried out piecemeal,, between each is handled, have 2 row bounds to catch any spray drift so that the parallel comparison that 11 kinds of different sprayings are handled to be provided.Spraying is handled (unless specify, be in V3) for the 0X (contrast) in V3 stage, 35.03g/ha ai Synchrony, 140.11g/ha ai Synchrony, 8.75g/haai tribenuron-methyl, 35.0g/ha ai tribenuron-methyl, 8.75g/ha ai rimsulfuron 25,35.0g/ha ai rimsulfuron 25,3360.0g/ha ai glyphosate, 3360.0g/ha ai glyphosate, then be the 3360.0g/ha ai glyphosate of R1,3360.0g/ha ai glyphosate adds that 35.0g/ha ai tribenuron-methyl (jar mixture) and 3360.0g/ha ai glyphosate add 70.0g/ha ai rimsulfuron 25 (jar mixture).In processing was to give 100 (responsive fully, 100% infringements) to 0 (tolerance fully, 0% damages) vision grading and in processing vision grading once more in back 14 days to strain in back 7 days.The vision grading is an overall degree of comparing chlorosis, necrosis and plant-growth slow (if obvious) in the row of handling with the contrast row of not spraying separately.Spraying back 7 is carried out ANOVA with 14 days ratings data with SAS separates with mean value.

Result and discussion

When all spraying ratings data of using the 7 and 14 days different treatment in back were all carried out ANOVA, incident was significantly different with processing, and described repeat not significantly different (data not shown).After spraying 7 and 14 days (DAS), compare with the GAT incident with STS, Jack has obviously higher spraying and replys (injury score) (data not shown).After spray applications 7 and 14 days, for all processing, the score of 4 kinds of GAT strain systems showed that infringement significantly can STS (data not shown) less than Jack.

When checking individual the processing, as if has to reference standard certain obvious spray drift, because at 7 DAS (data not shown) and 14 DAS (data not shown), the Jack study plot is compared with four kinds of GAT incidents with the STS study plot and is rated as obviously higher spraying damage score.Spray drift is the potential result of other study plot that makes obscure, but by between handling, using two row bounds to make that spray drift is hopeful to reduce to a certain extent.

In 8.75g/ha ai rimsulfuron 25 was handled, when 7 DAS (data not shown) and 14 DAS (data not shown), 4 GAT incidents were compared with STS with Jack and are obtained obviously less spraying damage score.In 4 GAT incidents, on the evaluation time, do not notice significant difference (data not shown).Check that 35.0g/ha ai rimsulfuron 25 handles, 4 GAT incidents are compared with STS with Jack during with 14 DAS (data not shown) at 7 DAS (data not shown) and are obtained obviously less spraying and damage score.GAT7 incident EAFS 3560.4.3 compares with EAFS 3561.1.1 with GAT7 incident EAFS 3559.2.1 during with 14 DAS (data not shown) at 7 DAS (data not shown) and obtains less damage score.

35.03g/ha after ai Synchrony handled, 4 GAT incidents were compared with STS with Jack during with 14 DAS (data not shown) at 7 DAS (data not shown) and are obtained obviously less spraying and damage score.In 4 GAT incidents, do not notice significant difference at 7 DAS (data not shown) and 14 DAS (data not shown).In checking that 140.11g/ha ai Synchrony handles, 4 GAT incidents are compared with STS with Jack during with 14 DAS (data not shown) at 7 DAS (data not shown) and are obtained obviously less spraying and damage score (data not shown).GAT7 incident EAFS 3560.4.3 compares with EAFS 3560.3.2 with GAT7 incident EAFS 3559.2.1 at 7 DAS with EAFS 356 1.1.1 has less damage score (data not shown).When 14 DAS140.11g/ha ai Synchrony handled, GAT7 incident EAFS 3560.4.2, EAFS3559.2.1 and EAFS 356 1.1.1 were rated as not damage, and EAFS 3560.3.2 score similar to STS (data not shown).

In checking that 8.75g/ha ai tribenuron handles, 4 GAT7 incidents are compared at 7 DAS with Jack with STS has obviously littler vision injury (data not shown).The GAT7 incident is not different on the statistics (data not shown) when 7DAS, but incident EAFS 3560.4.3 and EAFS 3559.2.1 and EAFS 3560.3.2 compare when 14 DAS and have significantly lower injury (data not shown).Handle for 35.0g/ha ai tribenuron-methyl, 7 GAT7 incidents are rated as to compare with STS with Jack to be had remarkable littler spraying when 7 DAS (data not shown) and 14 DAS (data not shown) and replys.4 GAT incidents are not different on the statistics (data not shown) mutually when 7 DAS, but EAFS 3560.3.2 is rated as when 14 DAS than other 3 GAT7 incidents and has significantly lower spraying injury (data not shown).

3360.0g/ha ai glyphosate and 3360.0g/ha ai glyphosate for V3 are followed the 3360.0g/ha ai glyphosate that R1 handles, as expected, and Jack and STS kind destroyed (data not shown) after 7 days.Handle for 3360.0g/ha ai glyphosate, at DAS (data not shown) and 14 DAS (data not shown), 4 GAT7 incidents are damaged without any observed spraying.7 DAS record the minimum spraying damage (data not shown) of 4 GAT7 incidents after processing, and incident EAFS 3560.4.3 and the EAFS 3559.2.1 scoring when 14 DAS is significantly better than EAFS 3560.3.2 (data not shown).

Two jar mixture process that glyphosate adds the sulfonylurea weedicide provide similar result at 7 DAS with 14 DAS.Add the beautiful phonetic sulphur of 70.0g/ha ai for 3360.0g/ha ai glyphosate and handle, 4 GAT incidents have similar weedicide replys, and is about 40% damage (data not shown) at 7 DAS, is about 35% damage (data not shown) at 14 DAS.Add for 3360.0g/ha ai glyphosate that 35.0g/ha ai tribenuron-methyl is handled and observe less total crop and reply, and 4 GAT incidents not different on the statistics in 7 DAS (data not shown) with 14 DAS (data not shown).

The mean value that ties up to the incident scoring of 7 DAS and 14 DAS at four guide GAT incidents, Jack and STS strains is mapped to allow the visual interpretation (data not shown) of data.Handle for rimsulfuron 25, observe crop with 4 guide GAT incidents and reply, notice that EAFS 3560.4.3 has maximum tolerance (data not shown).Handle for rimsulfuron 25, at 7 DAS and 14DAS, replying significantly of GAT7 incident contrasts (data not shown) less than STS and Jack.

Check to 1X and 140.11g/ha ai Synchrony handle on average reply score the time, GAT7 incident EAFS 3560.4.3 and EAFS 3561.1.1 be injury not obviously, and GAT 7 incident EAFS 3559.2.1 and EAFS 3560.3.2 reply minimum (data not shown).All GAT incidents and Jack compare with STS strain system to have significantly littler crop and replys (data not shown).

At 7 DAS and 14 DAS 1X and 35.0g/ha ai tribenuron-methyl are used when 4 GAT7 incidents are compared with STS with Jack and had significantly less crop and reply (data not shown).As if in the GAT7 incident, EAFS 3560.4.3 behaves oneself best, and EAFS 3560.3.2 demonstrates maximum generally reply (data not shown).

Use for 3360.0g/ha ai glyphosate, do not have tangible crop to reply (data not shown) at 7 DAS and all 4 GAT7 incidents of 14 DAS.3360.0g/ha ai glyphosate during for V3 and the then 3360.0g/ha ai glyphosate during R1, when 7 DAS, in 4 GAT7 incidents, do not notice significant difference, but EAFS 3560.4.3 and EAFS 3559.2.1 and EAFS 3561.1.1 and EAFS 3560.3.2 compare when 14 DAS and have less replying (data not shown).

In two jar mixture process, 70.0g/ha ai rimsulfuron 25 adds that 3360.0g/ha ai glyphosate and 35.0g/ha ai tribenuron-methyl add that 3360.0g/ha ai glyphosate compares the crop damage (data not shown) that causes higher level.In 4 guide GAT7 incidents, significant difference (data not shown) is not observed in the vision evaluation when 7 DAS and 14DAS.

The level of the those skilled in the art under the present invention is all indicated in all publications mentioned in the specification sheets and patent application.All incorporating all publications and patent application into this paper by reference, just looks like that each independent publication or patent application are all by especially with to point out to incorporate this paper by reference into individually the same.

Although for the clear purpose of understanding by illustrating the invention that has described the front with embodiment in detail, obviously can implement certain change and modification within the scope of the appended claims.

<110>McCutchen，Billy Fred

Castle，Linda A.

Chicoine，Timothy K.

Cho，Hyeon-Je

Claus，Jon S.

Green，Jerry M.

Guida，Anthony D.

Hazel，Christine B.

Heckert，Matthew J.

Hegstad，Jeffrey M.

Hutchison，James M.

Liu，Donglong

Lu，Albert L.

Mehre，Wayne J.

Moy，York

Olson，Paul D.

Peeples，Kenneth A.

Saunders，David W.

Vogt，Mark D.

Wilkinson，Jack Q.

Wong，James F.H.

＜120〉provide composition and its using method to the tolerance of multiple weedicide

<130>035718/314461

<150>60/710,854

<151>2005-08-24

<150>60/817,011

<151>2006-06-28

<160>89

<170>FastSEQ for Windows Version 4.0

<210>1

<211>534

<212>DNA

＜213〉cauliflower mosaic virus

<220>

＜221〉enhanser

<222>(0)...(0)

＜223〉enhancer element of 35S promoter

<400>1

ccctgtcctc tccaaatgaa atgaacttcc ttatatagag gaagggtctt gcgaagctta 60

gtgggattgt gcgtcatccc ttacgtcagt ggagatatca catcaatcca cttgctttga 120

agacgtggtt ggaacgtctt ctttttccac gatgctcctc gtgggtgggg gtccatcttt 180

gggaccactg tcggcagagg catcttcaac gatggccttt cctttatcgc aatgatggca 240

tttgtaggag ccaccttcct tttccactat cttcacaata aagtgacaga tagctgggca 300

atggaatccg aggaggtttc cggatattac cctttgttga aaagtctcaa ttgccctttg 360

gtcttctgag actgtatctt tgatattttt ggagtagaca agcgtgtcgt gctccaccat 420

gttgacgaag attttcttct tgtcattgag tcgtaagaga ctctgtatga actgttcgcc 480

agtctttacg gcgagttctg ttaggtcctc tatttgaatc tttgactcca tggg 534

<210>2

<211>7565

<212>DNA

＜213〉cauliflower mosaic virus

<220>

＜221〉promotor

<222>(0)...(0)

＜223〉S35 promotor: the PHP24279 from the left margin to the right margin

<400>2

tttacccgcc aatatatcct gtcaaacact gatagtttaa actgaaggcg ggaaacgaca 60

atctgatcat gagcggagaa ttaagggagt cacgttatga cccccgccga tgacgcggga 120

caagccgttt tacgtttgga actgacagaa ccgcaacgtt gaaggagcca ctcagcaagc 180

tgggcccccc ctcgaggtcg gccgcattcg caaaacacac ctagactaga tttgttttgc 240

taacccaatt gatattaatt atatatgatt aatatttata tgtatatgga tttggttaat 300

gaaatgcatc tggttcatca aagaattata aagacacgtg acattcattt aggataagaa 360

atatggatga tctctttctc ttttattcag ataactagta attacacata acacacaact 420

ttgatgccca cattatagtg attagcatgt cactatgtgt gcatcctttt atttcataca 480

ttaattaagt tggccaatcc agaagatgga caagtctagg ttaactgact agctagtcag 540

tacacagtcc tgccatcacc atccaggatc atatccttga aagccccacc actagggatc 600

ataggcaaca catgctcctg gtgtgggacg attatatcca agaggtacgg ccctggagtc 660

tcgagcatct tctttatcgc tgcgcggact tcgttcttct ttgtcacacg gaccgctgga 720

atgttgaacc ctttggcgat cgtcacgaaa tctggatata tctcactttc attctctggg 780

tttcccaagt atgtgtgcgc tctgttggcc ttatagaacc tgtcctccaa ctgcaccacc 840

atccccaggt gctggttgtt tagcacaaag accttcactg ggaggttctc aattcggatc 900

atagctagct cctgaacgtt catgagaaag ctaccatctc catcgatgtc aacaacagtg 960

acacctgggt ttgccacaga agcaccagca gcagccggca aaccaaatcc catagcccca 1020

agaccagctg aagacaacca ctgccttggc cgcttgtaag tgtagtactg tgccgcccac 1080

atctggtgct gcccaacacc tgtgccgatg atggcctcgc ctttcgtcag ctcatcaaga 1140

acctgaatag catattgtgg ctggatctcc tcattagatg ttttataccc aagggggaat 1200

tccctcttct gctgatccaa ctcatcgttc catgagccaa agtcaaagct cttctttgat 1260

gtgcttcctt caagaagagc attcatgccc tgcaaagcaa gcttaacatc tgcacagatg 1320

gacacatgtg gctgcttgtt cttgccaatc tcagccggat caatatcaac gtgcacaatc 1380

ttagccctgc ttgcaaaagc ctcaatcttc cctgtcacgc gatcatcaaa ccgcacacca 1440

agtgcaagca acagatcggc cttatccact gcataatttg catacaccgt cccatgcata 1500

cctagcatgc gcagagacag tgggtcgtcg ctggggaagt tgccgaggcc cataagagta 1560

gttgtgaccg ggattccagt cagctccaca aagcgtcgca actcctcacc agatgctgcg 1620

cagccaccgc ccacataaag aacagggcgc cgcgattcac caacaagacg cagcacctgc 1680

tcaagcaact cagtcgcagg gggcttggga aggcgcgcaa tgtacccagg cagactcatg 1740

ggcttgtccc agacaggcac cgccatctgc tgctggatgt ccttggggat gtcgacaagc 1800

accggccctg gtcgaccaga ggaggcgagg aagaaagcct cctgcacgac gcgggggatg 1860

tcgtcgacgt cgaggaccag gtagttgtgc ttggtgatgg agcgggtgac ctcgacgatg 1920

ggcgtctcct ggaaggcgtc ggtgccaatc atgcgtcgcg ccacctgtcc cgtgatggcg 1980

accatgggga cggaatcgag cagcgcgtcg gcgagcgcgg agactaggtt ggtggcgccg 2040

gggccggagg tggcgatgca gacgccgacg cggcccgagg agcgcgcgta gccggaggcg 2100

gcaaaggcct ccccttgctc gtggcggaag aggtggttgg cgatgacggg ggagcgggtg 2160

agtgcctggt ggatctccat ggacgcgccg ccggggtagg cgaagacgtc gcggacgccg 2220

cagcgctcga gggactcgac gaggatgtca gcacccttgc ggggctcggt ggggccccac 2280

ggccggagcg gggtggccgg gggagccatc ggcatggcgg gtgacgccgc tgagcacctg 2340

atgggcgcgg cgagggcgcg gcgggtggcc aggaggtgcg cccggcgcct cgccttgggc 2400

gcagcggtag tggcgccagt gagcgcggta gacgcggcgg cggcggtggc catggttgcg 2460

gcggctgtct cggaggcggc gcgagggttt ggggtgggtg ccacggacac ggagtgggag 2520

aaagggggat gtgcgtggag gcctccctgc ttttgttcag aggatgtgtg gctcagatgg 2580

tgatgggaat gggactcgca agacgacgac gacacgtccg tcgcccgaat acgtacacgc 2640

tacagaccgg acggtggggc ctgtcgacgt gggaccgacg tgtcggcctg gattacaaac 2700

gtggtgtcca ccgagtgctg gtacacgaca gcgtgcgtca aggaggtttt gaactgttcc 2760

gttaaaaaaa gaggggagat tttggacttg actgtggacg acggtgcatg tcatcggagt 2820

acagacggta ctgacacaag gggcccagac aagggaatcc aaacgggtcg cacccacctg 2880

ccaggctgcc acccgcaatc cgcaacaggg aaaccgggca cagcccacaa ccacaagatg 2940

agcagctgcg gcgacagcgt caggcccggt gtcggtgtta gggatggcac cctttggctc 3000

cccgtatccg tccccgcgac aaaaaaattt cccgcgggga ttcccacgaa ctcttgcgag 3060

agacatttct tccccatccc cgttccccac ggggataaat ccccatcggg gatcctctag 3120

agtcgacctg caggcatgca agcttcggtc cgcggccagc ttgctaaccc gggccccccc 3180

tcgaggtcat cacatcaatc cacttgcttt gaagacgtgg ttggaacgtc ttctttttcc 3240

acgatgctcc tcgtgggtgg gggtccatct ttgggaccac tgtcggcaga ggcatcttca 3300

acgatggcct ttcctttatc gcaatgatgg catttgtagg agccaccttc cttttccact 3360

atcttcacaa taaagtgaca gatagctggg caatggaatc cgaggaggtt tccggatatt 3420

accctttgtt gaaaagtctc aattgccctt tggtcttctg agactgtatc tttgatattt 3480

ttggagtaga caagcgtgtc gtgctccacc atgttgacga agattttctt cttgtcattg 3540

agtcgtaaga gactctgtat gaactgttcg ccagtcttta cggcgagttc tgttaggtcc 3600

tctatttgaa tctttgactc catggacggt atcgataagc tagcttgata tcacatcaat 3660

ccacttgctt tgaagacgtg gttggaacgt cttctttttc cacgatgctc ctcgtgggtg 3720

ggggtccatc tttgggacca ctgtcggcag aggcatcttc aacgatggcc tttcctttat 3780

cgcaatgatg gcatttgtag gagccacctt ccttttccac tatcttcaca ataaagtgac 3840

agatagctgg gcaatggaat ccgaggaggt ttccggatat taccctttgt tgaaaagtct 3900

caattgccct ttggtcttct gagactgtat ctttgatatt tttggagtag acaagcgtgt 3960

cgtgctccac catgttgacg aagattttct tcttgtcatt gagtcgtaag agactctgta 4020

tgaactgttc gccagtcttt acggcgagtt ctgttaggtc ctctatttga atctttgact 4080

ccatgatcga attatcacat caatccactt gctttgaaga cgtggttgga acgtcttctt 4140

tttccacgat gctcctcgtg ggtgggggtc catctttggg accactgtcg gcagaggcat 4200

cttcaacgat ggcctttcct ttatcgcaat gatggcattt gtaggagcca ccttcctttt 4260

ccactatctt cacaataaag tgacagatag ctgggcaatg gaatccgagg aggtttccgg 4320

atattaccct ttgttgaaaa gtctcaattg ccctttggtc ttctgagact gtatctttga 4380

tatttttgga gtagacaagc gtgtcgtgct ccaccatgtt gacgaagatt ttcttcttgt 4440

cattgagtcg taagagactc tgtatgaact gttcgccagt ctttacggcg agttctgtta 4500

ggtcctctat ttgaatcttt gactccatgg gaattcctgc agcccgggat ctaggagctt 4560

gcatgcctgc agtgcagcgt gacccggtcg tgcccctctc tagagataat gagcattgca 4620

tgtctaagtt ataaaaaatt accacatatt ttttttgtca cacttgtttg aagtgcagtt 4680

tatctatctt tatacatata tttaaacttt actctacgaa taatataatc tatagtacta 4740

caataatatc agtgttttag agaatcatat aaatgaacag ttagacatgg tctaaaggac 4800

aattgagtat tttgacaaca ggactctaca gttttatctt tttagtgtgc atgtgttctc 4860

cttttttttt gcaaatagct tcacctatat aatacttcat ccattttatt agtacatcca 4920

tttagggttt agggttaatg gtttttatag actaattttt ttagtacatc tattttattc 4980

tattttagcc tctaaattaa gaaaactaaa actctatttt agttttttta tttaataatt 5040

tagatataaa atagaataaa ataaagtgac taaaaattaa acaaataccc tttaagaaat 5100

taaaaaaact aaggaaacat ttttcttgtt tcgagtagat aatgccagcc tgttaaacgc 5160

cgtcgacgag tctaacggac accaaccagc gaaccagcag cgtcgcgtcg ggccaagcga 5220

agcagacggc acggcatctc tgtcgctgcc tctggacccc tctcgagagt tccgctccac 5280

cgttggactt gctccgctgt cggcatccag aaattgcgtg gcggagcggc agacgtgagc 5340

cggcacggca ggcggcctcc tcctcctctc acggcaccgg cagctacggg ggattccttt 5400

cccaccgctc cttcgctttc ccttcctcgc ccgccgtaat aaatagacac cccctccaca 5460

ccctctttcc ccaacctcgt gttgttcgga gcgcacacac acacaaccag atctccccca 5520

aatccacccg tcggcacctc cgcttcaagg tacgccgctc gtcctccccc ccccccctct 5580

ctaccttctc tagatcggcg ttccggtcca tggttagggc ccggtagttc tacttctgtt 5640

catgtttgtg ttagatccgt gtttgtgtta gatccgtgct gctagcgttc gtacacggat 5700

gcgacctgta cgtcagacac gttctgattg ctaacttgcc agtgtttctc tttggggaat 5760

cctgggatgg ctctagccgt tccgcagacg ggatcgattt catgattttt tttgtttcgt 5820

tgcatagggt ttggtttgcc cttttccttt atttcaatat atgccgtgca cttgtttgtc 5880

gggtcatctt ttcatgcttt tttttgtctt ggttgtgatg atgtggtctg gttgggcggt 5940

cgttctagat cggagtagaa ttctgtttca aactacctgg tggatttatt aattttggat 6000

ctgtatgtgt gtgccataca tattcatagt tacgaattga agatgatgga tggaaatatc 6060

gatctaggat aggtatacat gttgatgcgg gttttactga tgcatataca gagatgcttt 6120

ttgttcgctt ggttgtgatg atgtggtgtg gttgggcggt cgttcattcg ttctagatcg 6180

gagtagaata ctgtttcaaa ctacctggtg tatttattaa ttttggaact gtatgtgtgt 6240

gtcatacatc ttcatagtta cgagtttaag atggatggaa atatcgatct aggataggta 6300

tacatgttga tgtgggtttt actgatgcat atacatgatg gcatatgcag catctattca 6360

tatgctctaa ccttgagtac ctatctatta taataaacaa gtatgtttta taattatttt 6420

gatcttgata tacttggatg atggcatatg cagcagctat atgtggattt ttttagccct 6480

gccttcatac gctatttatt tgcttggtac tgtttctttt gtcgatgctc accctgttgt 6540

ttggtgttac ttctgcaggt cgaccgccgg ggatccacac gacaccatgg ctattgaggt 6600

taagcctatc aacgcagagg atacctatga ccttaggcat agagtgctca gaccaaacca 6660

gcctatcgaa gcctgcatgt ttgagtctga ccttactagg agtgcatttc accttggtgg 6720

attctacgga ggtaaactga tttccgtggc ttcattccac caagctgagc actctgaact 6780

tcaaggtaag aagcagtacc agcttagagg tgtggctacc ttggaaggtt atagagagca 6840

gaaggctggt tccagtctcg tgaaacacgc tgaagagatt ctcagaaaga gaggtgctga 6900

catgatctgg tgtaatgcca ggacatctgc ttcaggatac tacaggaagt tgggattcag 6960

tgagcaagga gaggtgttcg atactcctcc agttggacct cacatcctga tgtataagag 7020

gatcacataa ctagctagtc agttaaccta gacttgtcca tcttctggat tggccaactt 7080

aattaatgta tgaaataaaa ggatgcacac atagtgacat gctaatcact ataatgtggg 7140

catcaaagtt gtgtgttatg tgtaattact agttatctga ataaaagaga aagagatcat 7200

ccatatttct tatcctaaat gaatgtcacg tgtctttata attctttgat gaaccagatg 7260

catttcatta accaaatcca tatacatata aatattaatc atatataatt aatatcaatt 7320

gggttagcaa aacaaatcta gtctaggtgt gttttgcgaa ttcagtacat taaaaacgtc 7380

cgcaatgtgt tattaagttg tctaagcgtc aatttgttta caccacaata tatcctgcca 7440

ccagccagcc aacagctccc cgaccggcag ctcggcacaa aatcaccact cgatacaggc 7500

agcccatcag tccgggacgg cgtcagcggg agagccgttg taaggcggca gactttgctc 7560

atgtt 7565

<210>3

<211>441

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the D_S00341806_GAT20-8H12 of You Huaing

<221>CDS

<222>(1)...(441)

<400>3

atg ata gag gta aaa ccg att aac gca gag gat acc tat gaa cta agg 48

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr TyrGlu Leu Arg

1 5 10 15

cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atc ttt gaa 96

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Ile Phe Glu

20 25 30

agc gat tta atg cgt ggt gca ttt cac tta ggc ggc ttc tac ggg ggc 144

Ser Asp Leu Met Arg GlyAla Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

aga ctg att tcc gtc gct tca ttc cac cag gcc gag cac tcg gaa ctt 192

Arg Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu

50 55 60

caa ggc cag aaa cag tac cag ctt cga ggt atg gct acc ttg gaa ggt 240

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Met Ala Thr Leu Glu Gly

65 70 75 80

tat cgt gag cag aag gcg gga tcc agt cta gtt aaa cac gct gaa gaa 288

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

att cta cgt aag agg ggg gcg gac cta ctt tgg tgt aat gcg cgg aca 336

Ile Leu Arg Lys Arg Gly Ala Asp Leu Leu Trp Cys Asn Ala Arg Thr

100 105 110

tcc gcc tca ggc tac tac aaa aag tta ggc ttc agc gag cag gga gag 384

Ser Ala Ser Gly Tyr Tyr Lys Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

gta ttc gac acg ccg cca gta gga cctcac atc ctg atg tat aaa agg 432

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

atc aca taa 441

Ile Thr *

145

<210>4

<211>441

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the GAT4604SR of You Huaing

<221>CDS

<222>(1)...(441)

＜223〉coding 20-H812

<400>4

atg ata gag gtg aaa ccg att aac gca gag gat acc tat gaa cta agg 48

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Glu Leu Arg

1 5 10 15

cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atc ttt gaa 96

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Ile Phe Glu

20 25 30

agc gat tta atg cgt ggt gca ttt cac tta ggc ggc ttc tac ggg ggc 144

Ser Asp Leu Met Arg Gly Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

aga ctg att tcc gtc gct tca ttc cac cag gcc gag cac tct gaa ctt 192

Arg Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu

50 55 60

caa ggc cag aaa cag tac cag ctt cga ggt atg gct acc ttg gaa ggt 240

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Met Ala Thr Leu Glu Gly

65 70 75 80

tat cgt gag cag aag gcg ggt tcc agt cta gtt aaa cac gct gaa gaa 288

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

att cta cgt aag agg ggg gcg gac cta ctt tgg tgt aat gcg agg aca 336

Ile Leu Arg Lys Arg Gly Ala Asp Leu Leu Trp Cys Asn Ala Arg Thr

100 105 110

tcc gcc tca ggc tac tac aaa aag tta ggc ttc agc gag cag gga gag 384

Ser Ala Ser Gly Tyr Tyr Lys Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

gta ttc gac acg ccg cca gta gga cct cac atc ctg atg tat aaa agg 432

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

atc aca taa 441

Ile Thr *

145

<210>5

<211>146

<212>PRT

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the D_S00341806_GAT20-8H12 of You Huaing

<400>5

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Glu Leu Arg

1 5 10 15

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Ile Phe Glu

20 25 30

Ser Asp Leu Met Arg Gly Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

Arg Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu

50 55 60

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Met Ala Thr Leu Glu Gly

65 70 75 80

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

Ile Leu Arg Lys Arg Gly Ala Asp Leu Leu Trp Cys Asn Ala Arg Thr

100 105 110

Ser Ala Ser Gly Tyr Tyr Lys Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

Ile Thr

145

<210>6

<211>441

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the D_S00398097_GAT22-18C5 of You Huaing

<221>CDS

<222>(1)...(441)

<400>6

atg ata gag gta aaa ccg att aac gca gag gat acc tat gac cta agg 48

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg

1 5 10 15

cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt gaa 96

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu

20 25 30

agc gat tta acg cgt ggt gca ttt cac tta ggc ggc ttc tac ggg ggc 144

Ser Asp Leu Thr Arg Gly Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac tcg gaa ctt 192

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu

50 55 60

caa ggc cag aaa cag tat cag ctt cga ggt gtg gct acc ttg gaa ggt 240

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

tat cgt gag cag aag gcg gga acc agt cta gtt aaa cac gct gaa gaa 288

Tyr Arg Glu Gln Lys Ala Gly Thr Ser Leu Val Lys His Ala Glu Glu

85 90 95

att cta cgt aag agg ggg gtg gac cta ctt tgg tgt aat gcg cgg aca 336

Ile Leu Arg Lys Arg Gly Val Asp Leu Leu Trp Cys Asn Ala Arg Thr

100 105 110

tcc gcc tca ggc tac tac aga aag tta ggc ttc agc gag cag gga gag 384

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

gta ttc gac acg ccg cca gta gga cct cac atc ctg atg tat aaa agg 432

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

atc aca taa 441

Ile Thr *

145

<210>7

<211>449

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the GAT4609SR of You Huaing

<221>CDS

<222>(1)...(441)

＜223〉coding 22-18C5

<400>7

atg ata gag gta aaa ccg att aac gca gag gat acc tat gac cta agg 48

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg

1 5 10 15

cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt gaa 96

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu

20 25 30

agc gat tta acg cgt ggt gca ttt cac tta ggc ggc ttc tac ggg ggc 144

Ser Asp Leu Thr Arg Gly Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac tct gaa ctt 192

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu

50 55 60

caa ggc cag aaa cag tat cag ctt cga ggt gtg gct acc ttg gaa ggt 240

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

tat cgt gag cag aag gcg gga acc agt cta gtt aaa cac gct gaa gaa 288

Tyr Arg Glu Gln Lys Ala Gly Thr Ser Leu Val Lys His Ala Glu Glu

85 90 95

att cta cgt aag agg ggg gtg gac cta ctt tgg tgt aat gcg agg aca 336

Ile Leu Arg Lys Arg Gly Val Asp Leu Leu Trp Cys Asn Ala Arg Thr

100 105 110

tcc gcc tca ggc tac tac aga aag tta ggc ttc agc gag cag gga gag 384

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

gta ttc gac acg ccg cca gta gga cct cac atc ctg atg tat aaa agg 432

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

atc aca taa ggcgcgcc 449

Ile Thr *

145

<210>8

<211>146

<212>PRT

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the D_S00398097_GAT221-8C5 of You Huaing

<400>8

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg

1 5 10 15

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu

20 25 30

Ser Asp Leu Thr Arg Gly Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu

50 55 60

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

Tyr Arg Glu Gln Lys Ala Gly Thr Ser Leu Val Lys His Ala Glu Glu

85 90 95

Ile Leu Arg Lys Arg Gly Val Asp Leu Leu Trp Cys Asn Ala Arg Thr

100 105 110

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

Ile Thr

145

<210>9

<211>441

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the D_S00397944_22-16D8 of You Huaing

<221>CDS

<222>(1)...(441)

<400>9

atg ata gag gta aaa ccg att aac gca gag gat acc tat gaa cta agg 48

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Glu Leu Arg

1 5 10 15

cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt gaa 96

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu

20 25 30

agc gat tta ctg cgt ggt gca ttt cac tta ggc ggc ttc tac ggg ggc 144

Ser Asp Leu Leu Arg Gly Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac acg gaa ctt 192

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Thr Glu Leu

50 55 60

caa ggc cag aaa cag tac cag ctt cga ggt gtg gct acc ttg gaa ggt 240

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

tat cgt gag cag aag gcg gga acc agt cta gtt aaa cac gct gaa gaa 288

Tyr Arg Glu Gln Lys Ala Gly Thr Ser Leu Val Lys His Ala Glu Glu

85 90 95

att cta cgt aag agg ggg gcg gac atg ctt tgg tgt aat gcg cgg aca 336

Ile Leu Arg Lys Arg Gly Ala Asp Met Leu Trp Cys Asn Ala Arg Thr

100 105 110

tcc gcc tca ggc tac tac aga aag tta ggc ttt agc gag cag gga gag 384

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

gta ttc gac acg ccg cca gta gga cct cac atc ctg atg tat aaa agg 432

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

atc aca taa 441

Ile Thr *

145

<210>10

<211>449

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the GAT4610R of You Huaing

<221>CDS

<222>(1)...(441)

＜223〉coding 22-16D8

<400>10

atg ata gag gta aaa ccg att aac gca gag gat acc tat gaa cta agg 48

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Glu Leu Arg

1 5 10 15

cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt gaa 96

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu

20 25 30

agc gat tta ctg cgt ggt gca ttt cac ttaggc ggc ttc tac ggg ggc 144

Ser Asp Leu Leu Arg Gly Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac acg gaa ctt 192

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Thr Glu Leu

50 55 60

caa ggc cag aaa cag tac cag ctt cga ggt gtg gct acc ttg gaa ggt 240

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

tat cgt gag cag aag gcg gga acc agt cta gtt aaa cac gct gaa gaa 288

Tyr Arg Glu Gln Lys Ala Gly Thr Ser Leu Val Lys His Ala Glu Glu

85 90 95

att cta cgt aag agg ggg gcg gac atg ctt tgg tgt aat gcg agg aca 336

Ile Leu Arg Lys Arg Gly Ala Asp Met Leu Trp Cys Asn Ala Arg Thr

100 105 110

tcc gcc tca ggc tac tac aga aag tta ggc ttt agc gag cag gga gag 384

Ser Ala Ser Gly Tyr TyrArg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

gta ttc gac acg ccg cca gta gga cct cac atc ctg atg tat aaa agg 432

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

atc aca taa ggcgcgcc 449

Ile Thr *

145

<210>11

<211>146

<212>PRT

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the D_S00397944_22-16D8 of You Huaing

<400>11

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Glu Leu Arg

1 5 10 15

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu

20 25 30

Ser Asp Leu Leu Arg Gly Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Thr Glu Leu

50 55 60

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

Tyr Arg Glu Gln Lys Ala Gly Thr Ser Leu Val Lys His Ala Glu Glu

85 90 95

Ile Leu Arg Lys Arg Gly Ala Asp Met Leu Trp Cys Asn Ala Arg Thr

100 105 110

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

Ile Thr

145

<210>12

<211>441

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the D_S00397832_GAT22-15B4 of You Huaing

<221>CDS

<222>(1)...(441)

<400>12

atg ata gag gta aaa ccg att aac gca gaa gat acc tat gac cta agg 48

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg

1 5 10 15

cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt gat 96

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Asp

20 25 30

agc gat tta atg cgt agt gca ttt cac tta ggc ggc ttc tac ggg ggc 144

Ser Asp Leu Met Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac acg gaa ctt 192

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Thr Glu Leu

50 55 60

caa ggc cag aaa cag tac cag ctt cga ggt gtg gct acc ttg gaa ggt 240

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

tat cgt gag cag aag gcg ggt tcc agt cta gtt aaa cac gct gaa gaa 288

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

att cta cgt aag agg ggg gtg gac cta ctt tgg tgt aat gcg cgg aca 336

Ile Leu Arg Lys Arg Gly Val Asp Leu Leu Trp Cys Asn Ala Arg Thr

100 105 110

tcc gcc tca ggc tac tac aaa aag tta ggc ttc agc gag cag gga gag 384

Ser Ala Ser Gly Tyr Tyr Lys Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

gta ttc gac acg ccg cca gta gga cct cac atc ctg atg tat aaa agg 432

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

atc aca taa 441

Ile Thr *

145

<210>13

<211>449

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the GAT4611R of You Huaing

<221>CDS

<222>(1)...(441)

＜223〉coding 22-15B4

<400>13

atg ata gag gta aaa ccg att aac gca gaa gat acc tat gac cta agg 48

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg

1 5 10 15

cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt gat 96

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Asp

20 25 30

agc gat tta atg cgt agt gca ttt cac tta ggc ggc ttc tac ggg ggc 144

Ser Asp Leu Met Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac acg gaa ctt 192

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Thr Glu Leu

50 55 60

caa ggc cag aaa cag tac cag ctt cga ggt gtg gct acc ttg gaa ggt 240

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

tat cgt gag cag aag gcg ggt tcc agt cta gtt aaa cac gct gaa gaa 288

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

att cta cgt aag agg ggg gtg gac cta ctt tgg tgt aat gcg agg aca 336

Ile Leu Arg Lys Arg Gly Val Asp Leu Leu Trp Cys Asn Ala Arg Thr

100 105 110

tcc gcc tca ggc tac tac aaa aag tta ggc ttc agc gag cag gga gag 384

Ser Ala Ser Gly Tyr Tyr Lys Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

gta ttc gac acg ccg cca gta gga cct cac atc ctg atg tat aaa agg 432

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

atc aca taa ggcgcgcc 449

Ile Thr *

145

<210>14

<211>146

<212>PRT

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the D_S00397832_GAT22-15B4 of You Huaing

<400>14

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg

1 5 10 15

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Asp

20 25 30

Ser Asp Leu Met Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Thr Glu Leu

50 55 60

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

Ile Leu Arg Lys Arg Gly Val Asp Leu Leu Trp Cys Asn Ala Arg Thr

100 105 110

Ser Ala Ser Gly Tyr Tyr Lys Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

Ile Thr

145

<210>15

<211>441

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the GAT24-5H5 of You Huaing

<221>CDS

<222>(1)...(441)

<400>15

atg ata gag gta aaa ccg att aac gca gaa gat acc tat gac cta agg 48

Met Ile Glu Val Lys ProIle Asn Ala Glu Asp Thr Tyr Asp Leu Arg

1 5 10 15

cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt gat 96

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Asp

20 25 30

aac gat tta atg cgt agt gca ttt cac tta ggc ggc ttc cac ggg ggc 144

Asn Asp Leu Met Arg Ser Ala Phe His Leu Gly Gly Phe His Gly Gly

35 40 45

aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac tcg gaa ctt 192

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu

50 55 60

caa ggc cag aaa cag tat cag ctt cga ggt gtg gct acc ttg gaa ggt 240

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

tat cgt gag cag aag gcg ggt tcc agt cta gtt aaa cac gct gaa gaa 288

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

att cta cgt aag agg ggg gcg gac atg ctt tgg tgt aat gcg cgg aca 336

Ile Leu Arg Lys Arg Gly Ala Asp Met Leu Trp Cys Asn Ala Arg Thr

100 105 110

tcc gcc tca ggc tac tac aga aag ttg ggc ttc agc gag cag gga gag 384

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

gta ttc gac acg ccg ccg gta gga cct cac atc ctg atg tat aaa agg 432

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

atc aca taa 441

Ile Thr *

145

<210>16

<211>441

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the GAT4614SR of You Huaing

<221>CDS

<222>(1)...(441)

＜223〉coding 24-5H5

<400>16

atg ata gag gta aaa ccg att aac gca gaa gat acc tat gac cta agg 48

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg

1 5 10 15

cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt gat 96

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Asp

20 25 30

aac gat tta atg cgt agt gca ttt cac tta ggc ggc ttc cac ggg ggc 144

Asn Asp Leu Met Arg Ser Ala Phe His Leu Gly Gly Phe His Gly Gly

35 40 45

aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac tct gaa ctt 192

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu

50 55 60

caa ggc cag aaa cag tat cag ctt cga ggt gtg gct acc ttg gaa ggt 240

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

tat cgt gag cag aag gcg ggt tcc agt cta gtt aaa cac gct gaa gaa 288

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

att cta cgt aag agg ggg gcg gac atg ctt tgg tgt aat gcg agg aca 336

Ile Leu Arg Lys Arg Gly Ala Asp Met Leu Trp Cys Asn Ala Arg Thr

100 105 110

tcc gcc tca ggc tac tac aga aag ttg ggc ttc agc gag cag gga gag 384

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

gta ttc gac acg ccg ccg gta gga cct cac atc ctg atg tat aaa agg 432

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

atc aca taa 441

Ile Thr*

145

<210>17

<211>146

<212>PRT

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the 24-5H5 of You Huaing

<400>17

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg

1 5 10 15

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Asp

20 25 30

Asn Asp Leu Met Arg Ser Ala Phe His Leu Gly Gly Phe His Gly Gly

35 40 45

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu

50 55 60

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

Ile Leu Arg Lys Arg Gly Ala Asp Met Leu Trp Cys Asn Ala Arg Thr

100 105 110

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

Ile Thr

145

<210>18

<211>441

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the GAT4614VSR of You Huaing

<221>CDS

<222>(1)...(441)

＜223〉coding 24-5H5

<400>18

atg ata gag gtg aaa ccg att aac gca gaa gat acc tat gac cta agg 48

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg

1 5 10 15

cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt gat 96

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Asp

20 25 30

aac gat tta atg cgt agt gca ttt cac tta ggc ggc ttc cac ggg ggc 144

Asn Asp Leu Met Arg Ser Ala Phe His Leu Gly Gly Phe His Gly Gly

35 40 45

aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac tct gaa ctt 192

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu

50 55 60

caa ggc cag aaa cag tat cag ctt cga ggt gtg gct acc ttg gaa ggt 240

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

tat cgt gag cag aag gcg ggt tcc agt cta gtt aaa cac gct gaa gaa 288

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

att cta cgt aag agg ggg gcg gac atg ctt tgg tgt aat gcg agg aca 336

Ile Leu Arg Lys Arg Gly Ala Asp Met Leu Trp Cys Asn Ala Arg Thr

100 105 110

tcc gcc tca ggc tac tac aga aag ttg ggc ttc agc gag cag gga gag 384

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

gta ttc gac acg ccg ccg gta gga cct cac atc ctg atg tat aaa agg 432

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

atc aca taa 441

Ile Thr*

145

<210>19

<211>441

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the GAT23-2H11 of You Huaing

<221>CDS

<222>(1)...(441)

<400>19

atg ata gag gta aaa ccg att aac gca gag gat acc tat gac cta agg 48

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp ThrTyr Asp Leu Arg

1 5 10 15

cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt gaa 96

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu

20 25 30

ggc gat tta atg cgt ggt gca ttt cac tta ggc ggc ttc tac ggg ggc 144

Gly Asp Leu Met Arg Gly Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac tcg gaa ctt 192

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu

50 55 60

caa ggc cag aaa cag tac cag ctt cga ggt gtg gct acc ttg gaa ggt 240

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

tat cgt gag cag aag gcg ggt tcc agt cta gtt aaa cat gct gaa gaa 288

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

att cta cgc aag agg ggg gcg gac cta ctt tgg tgt aat gcg cgg aca 336

Ile Leu Arg Lys Arg Gly Ala Asp Leu Leu Trp Cys Asn Ala Arg Thr

100 105 110

tcc gcc tca ggc tac tac aga aag tta ggc ttc agc gag cag gga gag 384

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

gta ttc gac acg ccg cca gta gga cct cac atc ctg atg tat aaa agg 432

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

atc aca taa 441

Ile Thr *

145

<210>20

<211>441

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the GAT4615R of You Huaing

<221>CDS

<222>(1)...(441)

＜223〉coding 23-2H11

<400>20

atg ata gag gta aaa ccg att aac gca gag gat acc tat gac cta agg 48

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg

1 5 10 15

cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt gaa 96

HisArg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu

20 25 30

ggc gat tta atg cgt ggt gca ttt cac tta ggc ggc ttc tac ggg ggc 144

Gly Asp Leu Met Arg Gly Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac tcg gaa ctt 192

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu

50 55 60

caa ggc cag aaa cag tac cag ctt cga ggt gtg gct acc ttg gaa ggt 240

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

tat cgt gag cag aag gcg ggt tcc agt cta gtt aaa cat gct gaa gaa 288

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

att cta cgc aag agg ggg gcg gac cta ctt tgg tgt aat gcg agg aca 336

Ile Leu Arg Lys Arg Gly Ala Asp Leu Leu Trp Cys Asn Ala Arg Thr

100 105 110

tcc gcc tca ggc tac tac aga aag tta ggc ttc agc gag cag gga gag 384

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

gta ttc gac acg ccg cca gta gga cct cac atc ctg atg tat aaa agg 432

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

atc acataa 441

Ile Thr *

145

<210>21

<211>146

<212>PRT

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the 23-2H11 of You Huaing

<400>21

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg

1 5 10 15

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu

20 25 30

Gly Asp Leu Met Arg Gly Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu

50 55 60

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

Ile Leu Arg Lys Arg Gly Ala Asp Leu Leu Trp Cys Asn Ala Arg Thr

100 105 110

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

Ile Thr

145

<210>22

<211>441

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the GAT24-15C3 of You Huaing

<221>CDS

<222>(1)...(441)

<400>22

atg ata gag gta aaa ccg att aac gca gag gat acc tat gac cta agg 48

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg

1 5 10 15

cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt gaa 96

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu

20 25 30

agc gat tta acg cgt agt gca ttt cac tta ggc ggc ttc tac ggg ggc 144

Ser Asp Leu Thr Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac tcg gaa ctt 192

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu

50 55 60

cag ggc cag aaa cag tac cag ctt cga ggt gtg gct acc ttg gaa ggt 240

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

tat cgt gag cag aag gcg gga acc agt cta gtt aaa cac gct gaa gaa 288

Tyr Arg Glu Gln Lys Ala Gly Thr Ser Leu Val Lys His Ala Glu Glu

85 90 95

att cta cgt aag agg ggg gcg gac cta ctt tgg tgt aat gcg cgg aca 336

Ile Leu Arg Lys Arg Gly Ala Asp Leu Leu Trp Cys Asn Ala Arg Thr

100 105 110

tcc gcc tca ggc tac tac aga aag tta ggc ttc agc gag cag gga gag 384

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

gta ttc gac acg ccg cca gta gga cct cac atc ctg atg tat aaa agg 432

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

atc aca taa 441

Ile Thr*

145

<210>23

<211>441

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the GAT4616R of You Huaing

<221>CDS

<222>(1)...(441)

＜223〉coding 24-15C3

<400>23

atg ata gag gta aaa ccg att aac gca gag gat acc tat gac cta agg 48

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg

1 5 10 15

cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt gaa 96

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu

20 25 30

agc gat tta acg cgt agt gca ttt cac tta ggc ggc ttc tac ggg ggc 144

Ser Asp Leu Thr Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac tcg gaa ctt 192

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu

50 55 60

cag ggc cag aaa cag tac cag ctt cga ggt gtg gct acc ttg gaa ggt 240

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

tat cgt gag cag aag gcg gga acc agt cta gtt aaa cac gct gaa gaa 288

Tyr Arg Glu Gln Lys Ala Gly Thr Ser Leu Val Lys His Ala Glu Glu

859095

att cta cgt aag agg ggg gcg gac cta ctt tgg tgt aat gcg agg aca 336

Ile Leu Arg Lys Arg Gly Ala Asp Leu Leu Trp Cys Asn Ala Arg Thr

100 105 110

tcc gcc tca ggc tac tac aga aag tta ggc ttc agc gag cag gga gag 384

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

gta ttc gac acg ccg cca gta gga cct cac atc ctg atg tat aaa agg 432

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

atc aca taa 441

Ile Thr *

145

<210>24

<211>146

<212>PRT

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the 24-15C3 of You Huaing

<400>24

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg

1 5 10 15

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu

20 25 30

Ser Asp Leu Thr Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu

50 55 60

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

Tyr Arg Glu Gln Lys Ala Gly Thr Ser Leu Val Lys His Ala Glu Glu

85 90 95

Ile Leu Arg Lys Arg Gly Ala Asp Leu Leu Trp Cys Asn Ala Arg Thr

100 105 110

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

Ile Thr

145

<210>25

<211>441

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the GAT sequence-GAT23-6H10 of You Huaing

<221>CDS

<222>(1)...(441)

<400>25

atg ata gag gta aaa ccg att aac gca gag gat acc tat gaa cta agg 48

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Glu Leu Arg

1 5 10 15

cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt gaa 96

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu

20 25 30

agc gat tta acg cgt ggt gca ttt cac cta ggc ggc ttc tac ggg ggc 144

Ser Asp Leu Thr Arg Gly Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac acg gaa ctt 192

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Thr Glu Leu

50 55 60

caa ggc cag aaa cag tac cag ctt cga ggt gtg gct acc ttg gaa ggt 240

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

tat cgt gag cag aag gcg ggt tcc agt cta gtt aaa cac gct gaa gaa 288

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

att cta cgt aag agg ggg gcg gac cta ctt tgg tgt aat gcg cgg aca 336

Ile Leu Arg Lys Arg Gly Ala Asp Leu Leu Trp Cys Asn Ala Arg Thr

100 105 110

tcc gcc tca ggc tac tac aga aag tta ggc ttc agc gag cag ggg gag 384

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

gta ttc gac acg ccg cca gta gga cct cac atc ctg atg tat aaa agg 432

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

atc aca taa 441

Ile Thr *

145

<210>26

<211>441

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the GAT4617R of You Huaing

<221>CDS

<222>(1)...(440)

＜223〉coding 23-6H10

<400>26

atg ata gag gta aaa ccg att aac gca gag gat acc tat gaa cta agg 48

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Glu Leu Arg

1 5 10 15

cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt gaa 96

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu

20 25 30

agc gat tta acg cgt ggt gca ttt cac cta ggc ggc ttc tac ggg ggc 144

Ser Asp Leu Thr Arg Gly Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac acg gaa ctt 192

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Thr Glu Leu

50 55 60

caa ggc cag aaa cag tac cag ctt cga ggt gtg gct acc ttg gaa ggt 240

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

tat cgt gag cag aag gcg ggt tcc agt cta gtt aaa cac gct gaa gaa 288

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

att cta cgt aag agg ggg gcg gac cta ctt tgg tgt aat gcg agg aca 336

Ile Leu Arg Lys Arg Gly Ala Asp Leu Leu Trp Cys Asn Ala Arg Thr

100 105 110

tcc gcc tca ggc tac tac aga aag tta ggc ttc agc gag cag ggg gag 384

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

gta ttc gac acg ccg cca gta gga cct cac atc ctg atg tat aaa agg 432

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

atc aca ta a 441

Ile Thr

145

<210>27

<211>146

<212>PRT

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the 23-6H10 of You Huaing

<400>27

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Glu Leu Arg

1 5 10 15

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu

20 25 30

Ser Asp Leu Thr Arg Gly Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Thr Glu Leu

50 55 60

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

Ile Leu Arg Lys Arg Gly Ala Asp Leu Leu Trp Cys Asn Ala Arg Thr

100 105 110

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

Ile Thr

145

<210>28

<211>441

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the GAT25-8H7 of You Huaing

<221>CDS

<222>(1)...(441)

<400>28

atg ata gag gta aaa ccg att aac gca gag gat acc tat gac cta agg 48

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg

1 5 10 15

cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt gaa 96

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu

20 25 30

agc gat tta acg cgt agt gca ttt cac tta ggc ggc ttc tac ggg ggc 144

Ser Asp Leu Thr Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac tcg gaa ctt 192

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu

50 55 60

caa ggc aag aaa cag tac cag ctt cga ggt gtg gct acc ttg gaa ggt 240

Gln Gly Lys Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

tat cgt gag cag aag gcg ggt tcc agt cta gtt aaa cac gct gaa gaa 288

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

att cta cgt aag agg ggg gcg gac atg att tgg tgt aat gcg cgg aca 336

Ile Leu Arg Lys Arg Gly Ala Asp Met Ile Trp Cys Asn Ala Arg Thr

100 105 110

tct gcc tca ggc tac tac aga aag tta ggc ttc agc gag cag gga gag 384

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

gta ttc gac acg ccg cca gta gga cct cac atc ctg atg tat aaa agg 432

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

atc aca taa 441

Ile Thr *

145

<210>29

<211>441

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the GAT4618SR of You Huaing

<221>CDS

<222>(1)...(441)

＜223〉coding 25-8H7

<400>29

atg ata gag gta aaa ccg att aac gca gag gat acc tat gac cta agg 48

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg

1 5 10 15

cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt gaa 96

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu

20 25 30

agc gat tta acg cgt agt gca ttt cac tta ggc ggc ttc tac ggg ggc 144

Ser Asp Leu Thr Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac tct gaa ctt 192

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu

50 55 60

caa ggc aag aaa cag tac cag ctt cga ggt gtg gct acc ttg gaa ggt 240

Gln Gly Lys Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

tat cgt gag cag aag gcg ggt tcc agt cta gtt aaa cac gct gaa gaa 288

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

att cta cgt aag agg ggg gcg gac atg att tgg tgt aat gcg agg aca 336

Ile Leu Arg Lys Arg Gly Ala Asp Met Ile Trp Cys Asn Ala Arg Thr

100 105 110

tct gcc tca ggc tac tac aga aag tta ggc ttc agc gag cag gga gag 384

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

gta ttc gac acg ccg cca gta gga cct cac atc ctg atg tat aaa agg 432

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

atc aca taa 441

Ile Thr *

145

<210>30

<211>146

<212>PRT

＜213〉artificial sequence

<220>

＜223〉the GAT sequence of You Huaing--coding 25-8H7

<400>30

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg

1 5 10 15

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu

20 25 30

Ser Asp Leu Thr Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu

50 55 60

Gln Gly Lys Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

Ile Leu Arg Lys Arg Gly Ala Asp Met Ile Trp Cys Asn Ala Arg Thr

100 105 110

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

Ile Thr

145

<210>31

<211>146

<212>PRT

＜213〉artificial sequence

<220>

＜223〉the GAT sequence of You Huaing--con alt e

＜221〉variant

<222>14

＜223〉Asp or Glu

＜221〉variant

<222>33

＜223〉Gly or Ser or Asn

＜221〉variant

<222>38

＜223〉Gly or Ser

＜221〉variant

<222>46

＜223〉His or Tyr

＜221〉variant

<222>51

＜223〉Ile or Val

＜221〉variant

<222>(58)...(58)

＜223〉Gln or Arg

＜221〉variant

<222>(60)...(60)

＜223〉Glu or Gly

＜221〉variant

<222>(62)...(62)

＜223〉Ser or Thr

＜221〉variant

<222>(67)...(67)

＜223〉Gln or Lys or Arg

＜221〉variant

<222>(88)...(88)

＜223〉Ser or Thr

＜221〉variant

<222>(103)...(103)

＜223〉Ala or Val

＜221〉variant

<222>(105)...(105)

＜223〉Leu or Met

＜221〉variant

<222>(106)...(106)

＜223〉Ile or Leu

＜221〉variant

<222>(119)...(119)

＜223〉Arg or Lys

＜221〉variant

<222>(139)...(139)

＜223〉Ile or Val

<400>31

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Xaa Leu Arg

1 5 10 15

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Asp

20 25 30

Xaa Asp Leu Thr Arg Xaa Ala Phe His Leu Gly Gly Phe Xaa Gly Gly

35 40 45

Lys Leu Xaa Ser Val Ala Ser Phe His Xaa Ala Xaa His Xaa Glu Leu

50 55 60

Gln Gly Xaa Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

Tyr Arg Glu Gln Lys Ala Gly Xaa Ser Leu Val Lys His Ala Glu Glu

85 90 95

Ile Leu Arg Lys Arg Gly Xaa Asp Xaa Xaa Trp Cys Asn Ala Arg Thr

100 105 110

Ser Ala Ser Gly Tyr Tyr Xaa Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

Val Phe Asp Thr Pro Pro Val Gly Pro His Xaa Leu Met Tyr Lys Arg

130 135 140

Ile Thr

145

<210>32

<211>441

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the GAT4618VSR of You Huaing

<221>CDS

<222>(1)...(441)

＜223〉coding 25-8H7

<400>32

atg ata gag gtg aaa ccg att gac gca gag gat acc tat gac cta agg 48

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg

1 5 10 15

cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt gaa 96

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu

20 25 30

agc gat tta acg cgt agt gca ttt cac tta ggc ggc ttc tac ggg ggc 144

Ser Asp Leu Thr Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac tct gaa ctt 192

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu

50 55 60

caa ggc aag aaa cag tac cag ctt cga ggt gtg gct acc ttg gaa ggt 240

Gln Gly Lys Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

tat cgt gag cag aag gcg ggt tcc agt cta gtt aaa cac gct gaa gaa 288

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

att cta cgt aag agg ggg gcg gac atg atttgg tgt aat gcg agg aca 336

Ile Leu Arg Lys Arg Gly Ala Asp Met Ile Trp Cys Asn Ala Arg Thr

100 105 110

tct gcc tca ggc tac tac aga aag tta ggc ttc agc gag cag gga gag 384

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

gta ttc gac acg ccg cca gta gga cct cac atc ctg atg tat aaa agg 432

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

atc aca taa 441

Ile Thr *

145

<210>33

<211>441

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the GAT sequence of You Huaing

<221>CDS

<222>(1)...(441)

<223>GAT25-19C8

<400>33

atg ata gag gta aaa ccg att aac gca gaa gat acc tat gac cta agg 48

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg

1 5 10 15

cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt gaa 96

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu

20 25 30

agc gat tta acg cgt agt gca ttt cac tta ggc ggc ttc tac ggg ggc 144

Ser Asp Leu Thr Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac tcg gaa ctt 192

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu

50 55 60

caa ggc cag aaa cag tat cag ctt cga ggc gtg gct acc ttg gaa ggt 240

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

tat cgt gag cag aag gcg ggt tcc agt cta gtc aaa cac gct gaa gaa 288

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

att cta cgt aag agg ggg gtg gac cta ctt tgg tgt aat gcg cgg aca 336

Ile Leu Arg Lys Arg Gly Val Asp Leu Leu Trp Cys Asn Ala Arg Thr

100 105 110

tcc gcc tca ggc tac tac aga aag tta ggc ttc agc gag cag gga gag 384

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

gta ttc gac acg ccg cca gta ggt cct cac atc ctg atg tat aaa agg 432

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

atc aca taa 441

Ile Thr *

145

<210>34

<211>441

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the GAT4619SR of You Huaing

<221>CDS

<222>(1)...(441)

＜223〉coding 25-19C8

<400>34

atg ata gag gta aaa ccg att aac gca gaa gat acc tat gac cta agg 48

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg

1 5 10 15

cataga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt gaa 96

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu

20 25 30

agc gat tta acg cgt agt gca ttt cac tta ggc ggc ttc tac ggg ggc 144

Ser Asp Leu Thr Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac tct gaa ctt 192

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu

50 55 60

caa ggc cag aaa cag tat cag ctt cga ggc gtg gct acc ttg gaa ggt 240

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

tat cgt gag cag aag gcg ggt tcc agt cta gtc aaa cac gct gaa gaa 288

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

att cta cgt aag agg ggg gtg gac cta ctt tgg tgt aat gcg agg aca 336

Ile Leu Arg Lys Arg Gly Val Asp Leu Leu Trp Cys Asn Ala Arg Thr

100 105 110

tcc gcc tca ggc tac tac aga aag tta ggc ttc agc gag cag gga gag 384

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

gta ttc gac acg ccg cca gta ggt cct cac atc ctg atg tat aaa agg 432

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

atc aca taa 441

Ile Thr *

145

<210>35

<211>146

<212>PRT

＜213〉artificial sequence

<220>

＜223〉the GAT sequence encoding 25-19C8 of You Huaing

<400>35

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg

1 5 10 15

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu

20 25 30

Ser Asp Leu Thr Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu

50 55 60

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

Ile Leu Arg Lys Arg Gly Val Asp Leu Leu Trp Cys Asn Ala Arg Thr

100 105 110

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

Ile Thr

145

<210>36

<211>441

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the GAT4619VSR of You Huaing

<221>CDS

<222>(1)...(441)

＜223〉coding 25-19C8

<400>36

atg ata gag gtg aaa ccg att aac gca gaa gatacc tat gac cta agg 48

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg

1 5 10 15

cat aga gtc ctc aga cca aac cag ccg atagaa gcg tgt atg ttt gaa 96

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu

20 25 30

agc gat tta acg cgt agt gca ttt cac tta ggc ggc ttc tac ggg ggc 144

Ser Asp Leu Thr Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac tct gaa ctt 192

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu

50 55 60

caa ggc cag aaa cag tat cag ctt cga ggc gtg gct acc ttg gaa ggt 240

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

tat cgt gag cag aag gcg ggt tcc agt cta gtc aaa cac gct gaa gaa 288

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

att cta cgt aag agg ggg gtg gac cta ctt tgg tgt aat gcg agg aca 336

Ile Leu Arg Lys Arg Gly Val Asp Leu Leu Trp Cys Asn Ala Arg Thr

100 105 110

tcc gcc tca ggc tac tac aga aag tta ggc ttc agc gag cag gga gag 384

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

gra ttc gac acg ccg cca gta ggt cct cac atc ctg atg tat aaa agg 432

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

atc aca taa 441

Ile Thr *

145

<210>37

<211>441

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the D_S00397832_GAT22-15B4 of You Huaing

<221>CDS

<222>(1)...(441)

<400>37

atg ata gag gta aaa ccg att aac gca gaa gat acc tat gac cta agg 48

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg

1 5 10 15

cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt gat 96

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Asp

20 25 30

agc gat tta atg cgt agt gca ttt cac tta ggc ggc ttc tac ggg ggc 144

Ser Asp Leu Met Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac acg gaa ctt 192

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Thr Glu Leu

50 55 60

caa ggc cag aaa cag tac cag ctt cga ggt gtg gct acc ttg gaa ggt 240

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

tat cgt gag cag aag gcg ggt tcc agt cta gtt aaa cac gct gaa gaa 288

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

att cta cgt aag agg ggg gtg gac cta ctt tgg tgt aat gcg cgg aca 336

Ile Leu Arg Lys Arg Gly Val Asp Leu Leu Trp Cys Asn Ala Arg Thr

100 105 110

tcc gcc tca ggc tac tac aaa aag tta ggc ttc agc gag cag gga gag 384

Ser Ala Ser Gly Tyr Tyr Lys Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

gta ttc gac acg ccg cca gta gga cct cac atc ctg atg tat aaa agg 432

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

atc aca taa 441

Ile Thr *

145

<210>38

<211>452

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the GAT4611A of You Huaing

<221>CDS

<222>(1)...(441)

＜223〉coding 22-15B4M1MA

<400>38

atg gcg ata gag gta aaa ccg att aac gca gaa gat acc tat gac cta 48

Met Ala Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu

1 5 10 15

agg cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt 96

Arg His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe

20 25 30

gat agc gat tta atg cgt agt gca ttt cac tta ggc ggc ttc tac ggg 144

Asp Ser Asp Leu Met Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly

35 40 45

ggc aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac acg gaa 192

Gly Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Thr Glu

50 55 60

ctt caa ggc cag aaa cag tac cag ctt cga ggt gtg gct acc ttg gaa 240

Leu Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu

65 70 75 80

ggt tat cgt gag cag aag gcg ggt tcc agt cta gtt aaa cac gct gaa 288

Gly Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu

85 90 95

gaa att cta cgt aag agg ggg gtg gac cta ctt tgg tgt aat gcg cgg 336

Glu Ile Leu Arg Lys Arg Gly Val Asp Leu Leu Trp Cys Asn Ala Arg

100 105 110

aca tcc gcc tca ggc tac tac aaa aag tta ggc ttc agc gag cag gga 384

Thr Ser Ala Ser Gly Tyr Tyr Lys Lys Leu Gly Phe Ser Glu Gln Gly

115 120 125

gag gta ttc gac acg ccg cca gta gga cct cac atc ctg atg tat aaa 432

Glu Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys

130 135 140

agg atc aca taaggcgcgc c 452

Arg Ile Thr

145

<210>39

<211>147

<212>PRT

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the 22-15B4M1MA of You Huaing

<400>39

Met Ala Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu

1 5 10 15

Arg His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe

20 25 30

Asp Ser Asp Leu Met Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly

35 40 45

Gly Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Thr Glu

50 55 60

Leu Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu

65 70 75 80

Gly Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu

85 90 95

Glu Ile Leu Arg Lys Arg Gly Val Asp Leu Leu Trp Cys Asn Ala Arg

100 105 110

Thr Ser Ala Ser Gly Tyr Tyr Lys Lys Leu Gly Phe Ser Glu Gln Gly

115 120 125

Glu Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys

130 135 140

Arg Ile Thr

145

<210>40

<211>441

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the GAT sequence of You Huaing

<221>CDS

<222>(1)..(441)

<223>D_S00397832_GAT22-15B4

<400>40

atg ata gag gta aaa ccg att aac gca gaa gat acc tat gac cta agg 48

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg

1 5 10 15

cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt gat 96

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Asp

20 25 30

agc gat tta atg cgt agt gca ttt cac tta ggc ggc ttc tac ggg ggc 144

Ser Asp Leu Met Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac acg gaa ctt 192

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Thr Glu Leu

50 55 60

caa ggc cag aaa cag tac cag ctt cga ggt gtg gct acc ttg gaa ggt 240

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

tat cgt gag cag aag gcg ggt tcc agt cta gtt aaa cac gct gaa gaa 288

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

att cta cgt aag agg ggg gtg gac cta ctt tgg tgt aat gcg cgg aca 336

Ile Leu Arg Lys Arg Gly Val Asp Leu Leu Trp Cys Asn Ala Arg Thr

100 105 110

tcc gcc tca ggc tac tac aaa aag tta ggc ttc agc gag cag gga gag 384

Ser Ala Ser Gly Tyr Tyr Lys Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

gta ttc gac acg ccg cca gta gga cct cac atc ctg atg tat aaa agg 432

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

atc aca taa 441

Ile Thr *

145

<210>41

<211>455

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the GAT4611AA of You Huaing

<221>CDS

<222>(1)...(447)

＜223〉coding 22-15B4M1MAA

<400>41

atg gcg gcc ata gag gta aaa ccg att aac gca gaa gat acc tat gac 48

Met Ala Ala Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp

1 5 10 15

cta agg cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg 96

Leu Arg His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met

20 25 30

ttt gat agc gat tta atg cgt agt gca ttt cac tta ggc ggc ttc tac 144

Phe Asp Ser Asp Leu Met Arg Ser Ala Phe His Leu Gly Gly Phe Tyr

35 40 45

ggg ggc aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac acg 192

Gly Gly Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Thr

50 55 60

gaa ctt caa ggc cag aaa cag tac cag ctt cga ggt gtg gct acc ttg 240

Glu Leu Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu

65 70 75 80

gaa ggt tat cgt gag cag aag gcg ggt tcc agt cta gtt aaa cac gct 288

Glu Gly Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala

85 90 95

gaa gaa att cta cgt aag agg ggg gtg gac cta ctt tgg tgt aat gcg 336

Glu Glu Ile Leu Arg Lys Arg Gly Val Asp Leu Leu Trp Cys Asn Ala

100 105 110

cgg acatcc gcc tca ggc tac tac aaa aag tta ggc ttc agc gag cag 384

Arg Thr Ser Ala Ser Gly Tyr Tyr Lys Lys Leu Gly Phe Ser Glu Gln

115 120 125

gga gag gta ttc gac acg ccg cca gta gga cct cac atc ctg atg tat 432

Gly Glu Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr

130 135 140

aaa agg atc aca taa ggcgcgcc 455

Lys Arg Ile Thr*

145

<210>42

<211>148

<212>PRT

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the 22-15B4M1MAA of You Huaing

<400>42

Met Ala Ala Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp

1 5 10 15

Leu Arg His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met

20 25 30

Phe Asp Ser Asp Leu Met Arg Ser Ala Phe His Leu Gly Gly Phe Tyr

35 40 45

Gly Gly Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Thr

50 55 60

Glu Leu Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu

65 70 75 80

Glu Gly Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala

85 90 95

Glu Glu Ile Leu Arg Lys Arg Gly Val Asp Leu Leu Trp Cys Asn Ala

100 105 110

Arg Thr Ser Ala Ser Gly Tyr Tyr Lys Lys Leu Gly Phe Ser Glu Gln

115 120 125

Gly Glu Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr

130 135 140

Lys Arg Ile Thr

145

<210>43

<211>444

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the GAT4620 of You Huaing

<221>CDS

<222>(1)...(444)

＜223〉coding 25-8H7M1MA

<400>43

atg gct att gag gtt aaa cct att aac gca gag gat acc tat gac cta 48

Met Ala Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu

1 5 10 15

agg cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt 96

Arg His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe

20 25 30

gaa agc gat tta acg cgt agt gca ttt cac tta ggc ggc ttc tac ggg 144

Glu Ser Asp Leu Thr Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly

35 40 45

ggc aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac tct gaa 192

Gly Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu

50 55 60

ctt caa ggc aag aaa cag tac cag ctt cga ggt gtg gct acc ttg gaa 240

Leu Gln Gly Lys Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu

65 70 75 80

ggt tat cgt gag cag aag gcg ggt tcc agt cta gtt aaa cac gct gaa 288

Gly Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu

85 90 95

gaa att cta cgt aag agg ggg gcg gac atg att tgg tgt aat gcg agg 336

Glu Ile Leu Arg Lys Arg Gly Ala Asp Met Ile Trp Cys Asn Ala Arg

100 105 110

aca tct gcc tca ggc tac tac aga aag tta ggc ttc agc gag cag gga 384

Thr Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly

115 120 125

gag gta ttc gac acg ccg cca gta gga cct cac atc ctg atg tat aaa 432

Glu Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys

130 135 140

agg atc aca taa 444

Arg Ile Thr*

145

<210>44

<211>444

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the GAT4618A of You Huaing

<221>CDS

<222>(1)...(444)

＜223〉coding 25-8H7M1MA

<400>44

atg gcg ata gag gta aaa ccg att aac gca gag gat acc tat gac cta 48

Met Ala Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu

1 5 10 15

agg cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt 96

Arg His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe

20 25 30

gaa agc gat tta acg cgt agt gca ttt cac tta ggc ggc ttc tac ggg 144

Glu Ser Asp Leu Thr Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly

35 40 45

ggc aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac tcg gaa 192

Gly Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu

50 55 60

ctt caa ggc aag aaa cag tac cag ctt cga ggt gtg gct acc ttg gaa 240

Leu Gln Gly Lys Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu

65 70 75 80

ggt tat cgt gag cag aag gcg ggt tcc agt cta gtt aaa cac gct gaa 288

Gly Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu

85 90 95

gaa att cta cgt aag agg ggg gcg gac atg att tgg tgt aat gcg cgg 336

Glu Ile Leu Arg Lys Arg Gly Ala Asp Met Ile Trp Cys Asn Ala Arg

100 105 110

aca tct gcc tca ggc tac tac aga aag tta ggc ttc agc gag cag gga 384

Thr Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly

115 120 125

gag gta ttc gac acg ccg cca gta gga cct cac atc ctg atg tat aaa 432

Glu Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys

130 135 140

agg atc aca taa 444

Arg Ile Thr*

145

<210>45

<211>147

<212>PRT

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the 25-8H7M1MA of You Huaing

<400>45

Met Ala Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu

1 5 10 15

Arg His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe

20 25 30

Glu Ser Asp Leu Thr Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly

35 40 45

Gly Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu

50 55 60

Leu Gln Gly Lys Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu

65 70 75 80

Gly Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu

85 90 95

Glu Ile Leu Arg Lys Arg Gly Ala Asp Met Ile Trp Cys Asn Ala Arg

100 105 110

Thr Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly

115 120 125

Glu Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys

130 135 140

Arg Ile Thr

145

<210>46

<211>146

<212>PRT

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the R12G1 of You Huaing

<400>46

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg

1 5 10 15

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu

20 25 30

Ser Asp Leu Thr Arg Gly Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Thr Glu Leu

50 55 60

Gln Gly Lys Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

Ile Leu Arg Lys Arg Gly Ala Asp Met Ile Trp Cys Asn Ala Arg Thr

100 105 110

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

Ile Thr

145

<210>47

<211>146

<212>PRT

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the R12G2 of You Huaing

<400>47

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg

1 5 10 15

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu

20 25 30

Ser Asp Leu Thr Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Thr Glu Leu

50 55 60

Gln Gly Lys Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

Ile Leu Arg Lys Arg Gly Ala Asp Met Ile Trp Cys Asn Ala Arg Thr

100 105 110

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

Ile Thr

145

<210>48

<211>146

<212>PRT

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the R12G3 of You Huaing

<400>48

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg

1 5 10 15

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Asp

20 25 30

Asn Asp Leu Thr Arg Gly Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu

50 55 60

Gln Gly Lys Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

Ile Leu Arg Lys Arg Gly Ala Asp Met Ile Trp Cys Asn Ala Arg Thr

100 105 110

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

Ile Thr

145

<210>49

<211>146

<212>PRT

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the R12G4 of You Huaing

<400>49

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Glu Leu Arg

1 5 10 15

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Asp

20 25 30

Ser Asp Leu Thr Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu

50 55 60

Gln Gly Lys Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

Ile Leu Arg Lys Arg Gly Ala Asp Met Ile Trp Cys Asn Ala Arg Thr

100 105 110

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

Ile Thr

145

<210>50

<211>146

<212>PRT

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the R12G5 of You Huaing

<400>50

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Glu Leu Arg

1 5 10 15

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Asp

20 25 30

Ser Asp Leu Thr Arg Gly Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu

50 55 60

Gln Gly Lys Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

Ile Leu Arg Lys Arg Gly Ala Asp Met Ile Trp Cys Asn Ala Arg Thr

100 105 110

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

Ile Thr

145

<210>51

<211>146

<212>PRT

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the R12G6 of You Huaing

<400>51

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg

1 5 10 15

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Asp

20 25 30

Asn Asp Leu Thr Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu

50 55 60

Gln Gly Lys Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

Ile Leu Arg Lys Arg Gly Ala Asp Met Ile Trp Cys Asn Ala Arg Thr

100 105 110

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

Ile Thr

145

<210>52

<211>146

<212>PRT

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the R12G7 of You Huaing

<400>52

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg

1 5 10 15

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Asp

20 25 30

Asn Asp Leu Met Arg Gly Ala Phe His Leu Gly Gly Phe His Gly Gly

35 40 45

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Thr Glu Leu

50 55 60

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

Ile Leu Arg Lys Arg Gly Ala Asp Met Leu Trp Cys Asn Ala Arg Thr

100 105 110

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

Ile Thr

145

<210>53

<211>146

<212>PRT

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the R12G8 of You Huaing

<400>53

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg

1 5 10 15

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Asp

20 25 30

Asn Asp Leu Met Arg Ser Ala Phe His Leu Gly Gly Phe His Gly Gly

35 40 45

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Thr Glu Leu

50 55 60

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

Ile Leu Arg Lys Arg Gly Ala Asp Met Leu Trp Cys Asn Ala Arg Thr

100 105 110

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

Ile Thr

145

<210>54

<211>146

<212>PRT

＜213〉artificial sequence

<220>

＜223〉the GAT sequence of You Huaing--con alt e

＜221〉variant

<222>14

＜223〉Asp or Glu

＜221〉variant

<222>33

＜223〉Gly or Ser or Asn

＜221〉variant

<222>38

＜223〉Gly or Ser

＜221〉variant

<222>46

＜223〉His or Tyr

＜221〉variant

<222>51

＜223〉Ile or Val

＜221〉variant

<222>(58)...(58)

＜223〉Gln or Arg

＜221〉variant

<222>(60)...(60)

＜223〉Glu or Gly

＜221〉variant

<222>(62)...(62)

＜223〉Ser or Thr

＜221〉variant

<222>(67)...(67)

＜223〉Gln or Lys or Arg

＜221〉variant

<222>(88)...(88)

＜223〉Ser or Thr

＜221〉variant

<222>(103)...(103)

＜223〉Ala or Val

＜221〉variant

<222>(105)...(105)

＜223〉Leu or Met

＜221〉variant

<222>(106)...(106)

＜223〉Ile or Leu

＜221〉variant

<222>(119)...(119)

＜223〉Arg or Lys

＜221〉variant

<222>(139)...(139)

＜223〉Ile or Val

<400>54

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Xaa Leu Arg

1 5 10 15

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Asp

20 25 30

Xaa Asp Leu Thr Arg Xaa Ala Phe His Leu Gly Gly Phe Xaa Gly Gly

35 40 45

Lys Leu Xaa Ser Val Ala Ser Phe His Xaa Ala Xaa His Xaa Glu Leu

50 55 60

Gln Gly Xaa Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

Tyr Arg Glu Gln Lys Ala Gly Xaa Ser Leu Val Lys His Ala Glu Glu

85 90 95

Ile Leu Arg Lys Arg Gly Xaa Asp Xaa Xaa Trp Cys Asn Ala Arg Thr

100 105 110

Ser Ala Ser Gly Tyr Tyr Xaa Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

Val Phe Asp Thr Pro Pro Val Gly Pro His Xaa Leu Met Tyr Lys Arg

130 135 140

Ile Thr

145

<210>55

<211>444

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the GAT4621 of You Huaing

<221>CDS

<222>(1)...(444)

＜223〉coding 25-8H7M1MA

<400>55

atg gct att gag gtt aag cct atc aac gca gag gat acc tat gac ctt 48

Met Ala Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu

1 5 10 15

agg cat aga gtg ctc aga cca aac cag cct atc gaa gcc tgc atg ttt 96

Arg His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe

20 25 30

gag tct gac ctt act agg agt gca ttt cac ctt ggt gga ttc tac gga 144

Glu Ser Asp Leu Thr Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly

35 40 45

ggt aaa ctg att tcc gtg gct tca ttc cac caa gct gag cac tct gaa 192

Gly Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu

50 55 60

ctt caa ggt aag aag cag tac cag ctt aga ggt gtg gct acc ttg gaa 240

Leu Gln Gly Lys Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu

65 70 75 80

ggt tat aga gag cag aag gct ggt tcc agt ctc gtg aaa cac gct gaa 288

Gly Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu

85 90 95

gag att ctc aga aag aga ggt gct gac atg atc tgg tgt aat gcc agg 336

Glu Ile Leu Arg Lys Arg Gly Ala Asp Met Ile Trp Cys Asn Ala Arg

100 105 110

aca tct gct tca gga tac tac agg aag ttg gga ttc agt gag caa gga 384

Thr Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly

115 120 125

gag gtg ttc gat act cct cca gtt gga cct cac atc ctg atg tat aag 432

Glu Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys

130 135 140

agg atc aca taa 444

Arg Ile Thr*

145

<210>56

<211>147

<212>PRT

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the GAT4621 of You Huaing, coding 25-8H7

M1MA

<400>56

Met Ala Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu

1 5 10 15

Arg His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe

20 25 30

Glu Ser Asp Leu Thr Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly

35 40 45

Gly Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu

50 55 60

Leu Gln Gly Lys Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu

65 70 75 80

Gly Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu

85 90 95

Glu Ile Leu Arg Lys Arg Gly Ala Asp Met Ile Trp Cys Asn Ala Arg

100 105 110

Thr Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly

115 120 125

Glu Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys

130 135 140

Arg Ile Thr

145

<210>57

<211>441

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the R12G1 of You Huaing

<221>CDS

<222>(1)...(441)

<400>57

atg ata gag gta aaa ccg att aac gca gag gat acc tat gac cta agg 48

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg

1 5 10 15

cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt gaa 96

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu

20 25 30

agc gat tta acg cgt ggt gca ttt cac tta ggc ggc ttc tac ggg ggc 144

Ser Asp Leu Thr Arg Gly Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac act gaa ctt 192

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Thr Glu Leu

50 55 60

caa ggc aag aaa cag tac cag ctt cga ggt gtg gct acc ttg gaa ggt 240

Gln Gly Lys Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

tat cgt gag cag aag gcg ggt tcc agt cta gtt aaa cac gct gaa gaa 288

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

att cta cgt aag agg ggg gcg gac atg att tgg tgt aat gcg cgg aca 336

Ile Leu Arg Lys Arg Gly Ala Asp Met Ile Trp Cys Asn Ala Arg Thr

100 105 110

tct gcc tca ggc tac tac aga aag tta ggc ttc agc gag cag gga gag 384

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

gta ttc gac acg ccg cca gta gga cct cac atc ctg atg tat aaa agg 432

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

atc aca taa 441

Ile Thr *

145

<210>58

<211>441

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the R12G2 of You Huaing

<400>58

atgatagagg taaaaccgat taacgcagag gatacctatg acctaaggca tagagtcctc 60

agaccaaacc agccgataga agcgtgtatg tttgaaagcg atttaacgcg tagtgcattt 120

cacttaggcg gcttctacgg gggcaaactg atttccgtcg cttcattcca ccaggccgag 180

cacactgaac ttcaaggcaa gaaacagtac cagcttcgag gtgtggctac cttggaaggt 240

tatcgtgagc agaaggcggg ttccagtcta gttaaacacg ctgaagaaat tctacgtaag 300

aggggggcgg acatgatttg gtgtaatgcg cggacatctg cctcaggcta ctacagaaag 360

ttaggcttca gcgagcaggg agaggtattc gacacgccgc cagtaggacc tcacatcctg 420

atgtataaaa ggatcacata a 441

<210>59

<211>441

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the R12G3 of You Huaing

<221>CDS

<222>(1)...(441)

<400>59

atg ata gag gta aaa ccg att aac gca gag gat acc tat gac cta agg 48

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg

1 5 10 15

cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt gat 96

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Asp

20 25 30

aac gat tta acg cgt ggt gca ttt cac tta ggc ggc ttc tac ggg ggc 144

Asn Asp Leu Thr Arg Gly Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac tcg gaa ctt 192

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu

50 55 60

caa ggc aag aaa cag tac cag ctt cga ggt gtg gct acc ttg gaa ggt 240

Gln Gly Lys Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

tat cgt gag cag aag gcg ggt tcc agt cta gtt aaa cac gct gaa gaa 288

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

att cta cgt aag agg ggg gcg gac atg att tgg tgt aat gcg cgg aca 336

Ile Leu Arg Lys Arg Gly Ala Asp Met Ile Trp Cys Asn Ala Arg Thr

100 105 110

tct gcc tca ggc tac tac aga aag tta ggc ttc agc gag cag gga gag 384

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

gta ttc gac acg ccg cca gta gga cct cac atc ctg atg tat aaa agg 432

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

atc aca taa 441

Ile Thr *

145

<210>60

<211>441

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the R12G4 of You Huaing

<400>60

atgatagagg taaaaccgat taacgcagag gatacctatg aactaaggca tagagtcctc 60

agaccaaacc agccgataga agcgtgtatg tttgatagcg atttaacgcg tagtgcattt 120

cacttaggcg gcttctacgg gggcaaactg atttccgtcg cttcattcca ccaggccgag 180

cactcggaac ttcaaggcaa gaaacagtac cagcttcgag gtgtggctac cttggaaggt 240

tatcgtgagc agaaggcggg ttccagtcta gttaaacacg ctgaagaaat tctacgtaag 300

aggggggcgg acatgatttg gtgtaatgcg cggacatctg cctcaggcta ctacagaaag 360

ttaggcttca gcgagcaggg agaggtattc gacacgccgc cagtaggacc tcacatcctg 420

atgtataaaa ggatcacata a 441

<210>61

<211>441

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the R12G5 of You Huaing

<221>CDS

<222>(1)...(441)

<400>61

atg ata gag gta aaa ccg att aac gca gag gat acc tat gaa cta agg 48

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Glu Leu Arg

1 5 10 15

cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt gat 96

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Asp

20 25 30

agc gat tta acg cgt ggt gca ttt cac tta ggc ggc ttc tac ggg ggc 144

Ser Asp Leu Thr Arg Gly Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac tcg gaa ctt 192

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu

50 55 60

caa ggc aag aaa cag tac cag ctt cga ggt gtg gct acc ttg gaa ggt 240

Gln Gly Lys Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

tat cgt gag cag aag gcg ggt tcc agt cta gtt aaa cac gct gaa gaa 288

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

att cta cgt aag agg ggg gcg gac atg att tgg tgt aat gcg cgg aca 336

Ile Leu Arg Lys Arg Gly Ala Asp Met Ile Trp Cys Asn Ala Arg Thr

100 105 110

tct gcc tca ggc tac tac aga aag tta ggc ttc agc gag cag gga gag 384

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

gta ttc gac acg ccg cca gta gga cct cac atc ctg atg tat aaa agg 432

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

atc aca taa 441

Ile Thr *

145

<210>62

<211>441

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the R12G6 of You Huaing

<221>CDS

<222>(1)...(441)

<400>62

atg ata gag gta aaa ccg att aac gca gag gat acc tat gac cta agg 48

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg

1 5 10 15

cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt gat 96

His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Asp

20 25 30

aac gat tta acg cgt agt gca ttt cac tta ggc ggc ttc tac ggg ggc 144

Asn Asp Leu Thr Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly Gly

35 40 45

aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac tcg gaa ctt 192

Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu

50 55 60

caa ggc aag aaa cag tac cag ctt cga ggt gtg gct acc ttg gaa ggt 240

Gln Gly Lys Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly

65 70 75 80

tat cgt gag cag aag gcg ggt tcc agt cta gtt aaa cac gct gaa gaa 288

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu

85 90 95

att cta cgt aag agg ggg gcg gac atg att tgg tgt aat gcg cgg aca 336

Ile Leu Arg Lys Arg Gly Ala Asp Met Ile Trp Cys Asn Ala Arg Thr

100 105 110

tct gcc tca ggc tac tac aga aag tta ggc ttc agc gag cag gga gag 384

Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

gta ttc gac acg ccg cca gta gga cct cac atc ctg atg tat aaa agg 432

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

atc aca taa 441

Ile Thr *

145

<210>63

<211>441

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the R12G7 of You Huaing

<221>CDS

<222>(1)...(441)

<400>63

atgatagag gta aaa ccg att aac gca gaa gat acc tat gac cta agg cat 51

Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg His

1 5 10

aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt gat aac 99

Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Asp Asn

15 20 25 30

gat tta atg cgt ggt gca ttt cac tta ggc ggc ttc cac ggg ggc aaa 147

Asp Leu Met Arg Gly Ala Phe His Leu Gly Gly Phe His Gly Gly Lys

35 40 45

ctg att tcc gtc gct tca ttc cac cag gcc gag cac act gaa ctt caa 195

Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Thr Glu Leu Gln

50 55 60

ggc cag aaa cag tat cag ctt cga ggt gtg gct acc ttg gaa ggt tat 243

Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly Tyr

65 70 75

cgt gag cag aag gcg ggt tcc agt cta gtt aaa cac gct gaa gaa att 291

Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu Ile

80 85 90

cta cgt aag agg ggg gcg gac atg ctt tgg tgt aat gcg cgg aca tcc 339

Leu Arg Lys Arg Gly Ala Asp Met Leu Trp Cys Asn Ala Arg Thr Ser

95 100 105 110

gcc tca ggc tac tac aga aag ttg ggc ttc agc gag cag gga gag gta 387

Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu Val

115 120 125

ttc gac acg ccg ccg gta gga cct cac atc ctg atg tat aaa agg atc 435

Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg Ile

130 135 140

aca taa 441

Thr *

<210>64

<211>441

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAT sequence--the R12G8 of You Huaing

<400>64

atgatagagg taaaaccgat taacgcagaa gatacctatg acctaaggca tagagtcctc 60

agaccaaacc agccgataga agcgtgtatg tttgataacg atttaatgcg tagtgcattt 120

cacttaggcg gcttccacgg gggcaaactg atttccgtcg cttcattcca ccaggccgag 180

cacactgaac ttcaaggcca gaaacagtat cagcttcgag gtgtggctac cttggaaggt 240

tatcgtgagc agaaggcggg ttccagtcta gttaaacacg ctgaagaaat tctacgtaag 300

aggggggcgg acatgctttg gtgtaatgcg cggacatccg cctcaggcta ctacagaaag 360

ttgggcttca gcgagcaggg agaggtattc gacacgccgc cggtaggacc tcacatcctg 420

atgtataaaa ggatcacata a 441

<210>65

<211>3936

<212>DNA

<213>Glycinemax

<220>

<221>misc_feature

<222>(0)...(0)

＜223〉HRA sequence

<400>65

atgctacgca cacaacacaa tggcggccac cgcttccaga accacccgat tctcttcttc 60

ctcttcacac cccaccttcc ccaaacgcat tactagatcc accctcccgt gtgttgtgtt 120

accgccggtg gcgaaggtct tggtgggcta agagaagaag gagaagtgtg gggtggaagg 180

ggtttgcgta atgatctagg tgggagggtc tctctcatca aaccctcacc aaacccaacc 240

acgctctcaa aatcaaatgt tccatctcca aaccccccac ggcggcgccc ttcaccaagg 300

aagcgccgag agagagtagt ttgggagtgg tttgggttgg tgcgagagtt ttagtttaca 360

aggtagaggt ttggggggtg ccgccgcggg aagtggttcc ttcgcggcac cacggagccc 420

ttcgtgtcac ggttcgcctc cggcgaacct cgcaagggcg cggacatcct tgtggaggcg 480

ctggagaggc agggcgtgac gacggtgttg gtgcctcggg aagcacagtg ccaagcggag 540

gccgcttgga gcgttcccgc gcctgtagga acacctccgc gacctctccg tcccgcactg 600

ctgccacatc gcgtaccccg gcggtgcgtc gatggagatc caccaggcgc tcacgcgctc 660

cgccgccatc cgcaacgtgc tcccgcgcca cgagcagggc ggcgtcttag cgcatggggc 720

cgccacgcag ctacctctag gtggtccgcg agtgcgcgag gcggcggtag gcgttgcacg 780

agggcgcggt gctcgtcccg ccgcagaacg ccgccgaagg ctacgcgcgt tcctccggcc 840

tccccggcgt ctgcattgcc acctccggcc ccggcgccac caacctcgtg agcggcctcg 900

ccgacgctgc ggcggcttcc gatgcgcgca aggaggccgg aggggccgca gacgtaacgg 960

tggaggccgg ggccgcggtg gttggagcac tcgccggagc ggctgcgatt aatggacagc 1020

gtcccagtcg tcgccatcac cggccaggtc gcccgccgga tgatcggcac cgacgccttc 1080

caagaaaccc cgatcgtgga ggtgagcaaa ttacctgtcg cagggtcagc agcggtagtg 1140

gccggtccag cgggcggcct actagccgtg gctgcggaag gttctttggg gctagcacct 1200

ccactcgtga tccatcacga agcacaacta cctcatcctc gacgtcgacg acatcccccg 1260

cgtcgtcgcc gaggctttct tcgtcgccac ctccggccgc cccggtccct aggtagtgct 1320

tcgtgttgat ggagtaggag ctgcagctgc tgtagggggc gcagcagcgg ctccgaaaga 1380

agcagcggtg gaggccggcg gggccagggg tcctcatcga cattcccaaa gacgttcagc 1440

agcaactcgc cgtgcctaat tgggacgagc ccgttaacct ccccggttac ctcgccaggc 1500

tgcccaggcc aggagtagct gtaagggttt ctgcaagtcg tcgttgagcg gcacggatta 1560

accctgctcg ggcaattgga ggggccaatg gagcggtccg acgggtcccc ccccgccgag 1620

gcccaattgg aacacattgt cagactcatc atggaggccc aaaagcccgt tctctacgtc 1680

ggcggtggca gtttgaattc cagtgctggg ggggcggctc cgggttaacc ttgtgtaaca 1740

gtctgagtag tacctccggg ttttcgggca agagatgcag ccgccaccgt caaacttaag 1800

gtcacgacaa ttgaggcgct ttgttgaact cactggtatt cccgttgcta gcactttaat 1860

gggtcttgga acttttccta ttggtgatga atattccctt cagatgcttt aactccgcga 1920

aacaacttga gtgaccataa gggcaacgat cgtgaaatta cccagaacct tgaaaaggat 1980

aaccactact tataagggaa gtctacgagg gtatgcatgg tactgtttat gctaactatg 2040

ctgttgacaa tagtgatttg ttgcttgcct ttggggtaag gtttgatgac cgtgttactg 2100

ggaagcttcc catacgtacc atgacaaata cgattgatac gacaactgtt atcactaaac 2160

aacgaacgga aaccccattc caaactactg gcacaatgac ccttcgaaga ggcttttgct 2220

agtagggcta agattgttca cattgatatt gattctgccg agattgggaa gaacaagcag 2280

gcgcacgtgt cggtttgcgc ggatttgact ccgaaaacga tcatcccgat tctaacaagt 2340

gtaactataa ctaagacggc tctaaccctt cttgttcgtc cgcgtgcaca gccaaacgcg 2400

cctaaactag ttggccttga agggaattaa tatgattttg gaggagaaag gagtggaggg 2460

taagtttgat cttggaggtt ggagagaaga gattaatgtg cagaaacatc aaccggaact 2520

tcccttaatt atactaaaac ctcctctttc ctcacctccc attcaaacta gaacctccaa 2580

cctctcttct ctaattacac gtctttgtca agtttccatt gggttacaag acattccagg 2640

acgcgatttc tccgcagcat gctatcgagg ttcttgatga gttgactaat ggagatgcta 2700

ttgttagtgt tcaaaggtaa cccaatgttc tgtaaggtcc tgcgctaaag aggcgtcgta 2760

cgatagctcc aagaactact caactgatta cctctacgat aacaatcaac tggggttggg 2820

cagcatcaaa tgtgggctgc gcagttttac aagtacaaga gaccgaggca gtggttgacc 2880

tcagggggtc ttggagccat gggttttgtg accccaaccc gtcgtagttt acacccgacg 2940

cgtcaaaatg ttcatgttct ctggctccgt caccaactgg agtcccccag aacctcggta 3000

cccaaaacga ttgcctgcgg ctattggtgc tgctgttgct aaccctgggg ctgttgtggt 3060

tgacattgat ggggatggta gtttcatcat gaatgttcag gagttggcct aacggacgcc 3120

gataaccacg acgacaacga ttgggacccc gacaacacca actgtaacta cccctaccat 3180

caaagtagta cttacaagtc ctcaaccgca ctataagagt ggagaatctc ccagttaaga 3240

tattgttgtt gaacaatcag catttgggta tggtggttca gttggaggat aggttctaca 3300

agtccaatgt gatattctca cctcttagag ggtcaattct ataacaacaa cttgttagtc 3360

gtaaacccat accaccaagt caacctccta tccaagatgt tcaggttaag agctcacacc 3420

tatcttggag atccgtctag cgagagcgag atattcccaa acatgctcaa gtttgctgat 3480

gcttgtggga taccggcagc gcgagtgatc tcgagtgtgg atagaacctc taggcagatc 3540

gctctcgctc tataagggtt tgtacgagtt caaacgacta cgaacaccct atggccgtcg 3600

cgctcactcg aagaaggaag agcttagagc ggcaattcag agaatgttgg acacccctgg 3660

cccctacctt cttgatgtca ttgtgcccca tcaggagcat gtgttgccgc ttcttccttc 3720

tcgaatctcg ccgttaagtc tcttacaacc tgtggggacc ggggatggaa gaactacagt 3780

aacacggggt agtcctcgta cacaacggga tgattcccag taatggatcc ttcaaggatg 3840

tgataactga gggtgatggt agaacgaggt acctactaag ggtcattacc taggaagttc 3900

ctacactatt gactcccact accatcttgc tccatg 3936

<210>66

<211>3834

<212>DNA

<213>Zea mays

<220>

<221>misc_feature

<222>(0)...(0)

＜223〉HRA sequence

<400>66

cagtacacag tcctgccatc accatccagg atcatatcct tgaaagcccc accactaggg 60

atcataggca acacatgtca tgtgtcagga cggtagtggt aggtcctagt ataggaactt 120

tcggggtggt gatccctagt atccgttgtg tagctcctgg tgtgggacga ttatatccaa 180

gaggtacggc cctggagt1t cgagcatctt ctttatcgct gcgcggactt cgttcttctt 240

tgtcacacgg accgaggacc acaccctgct aatataggtt ctccatgccg ggacctcaga 300

gctcgtagaa gaaatagcga cgcgcctgaa gcaagaagaa acagtgtgcc tgcgctggaa 360

tgttgaaccc tttggcgatc gtcacgaaat ctggatatat ctcactttca ttctctgggt 420

ttcccaagta tgtgtgcgct ctgttggcct tagcgacctt acaacttggg aaaccgctag 480

cagtgcttta gacctatata gagtgaaagt aagagaccca aagggttcat acacacgcga 540

gacaaccgga attagaacct gtcctccaac tgcaccacca tccccaggtg ctggttgttt 600

agcacaaaga ccttcactgg gaggttctca attcggatca tagctagctc ctatcttgga 660

caggaggttg acgtggtggt aggggtccac gaccaacaaa tcgtgtttct ggaagtgacc 720

ctccaagagt taagcctagt atcgatcgag gagaacgttc atgagaaagc taccatctcc 780

atcgatgtca acaacagtga cacctgggtt tgccacagaa gcaccagcag cagccggcaa 840

accaaatccc atcttgcaag tactctttcg atggtagagg tagctacagt tgttgtcact 900

gtggacccaa acggtgtctt cgtggtcgtc gtcggccgtt tggtttaggg taagccccaa 960

gaccagctga agacaaccac tgccttggcc gcttgtaagt gtagtactgt gccgcccaca 1020

tctggtgctg cccaacacct gtgccgatga tgtcggggtt ctggtcgact tctgttggtg 1080

acggaaccgg cgaacattca catcatgaca cggcgggtgt agaccacgac gggttgtgga 1140

cacggctact acgcctcgcc tttcgtcagc tcatcaagaa cctgaatagc atattgtggc 1200

tggatctcct cattagatgt tttataccca agggggaatt ccctcttctg ctcggagcgg 1260

aaagcagtcg agtagttctt ggacttatcg tataacaccg acctagagga gtaatctaca 1320

aaatatgggt tcccccttaa gggagaagac gagatccaac tcatcgttcc atgagccaaa 1380

gtcaaagctc ttctttgatg tgcttccttc aagaagagca ttcatgccct gcaaagcaag 1440

cttaacatct gcctaggttg agtagcaagg tactcggttt cagtttcgag aagaaactac 1500

acgaaggaag ttcttctcgt aagtacggga cgtttcgttc gaattgtaga cgacagatgg 1560

acacatgtgg ctgcttgttc ttgccaatct cagccggatc aatatcaacgtgcacaatct 1620

tagccctgct tgcaaaagcc tcaatcttcc cttgtctacc tgtgtacacc gacgaacaag 1680

aacggttaga gtcggcctag ttatagttgc acgtgttaga atcgggacga acgttttcgg 1740

agttagaagg gagtcacgcg atcatcaaac cgcacaccaa gtgcaagcaa cagatcggcc 1800

ttatccactg cataatttgc atacaccgtc ccatgcatac ctagcatgcg cacagtgcgc 1860

tagtagtttg gcgtgtggtt cacgttcgtt gtctagccgg aataggtgac gtattaaacg 1920

tatgtggcag ggtacgtatg gatcgtacgc gtgagacagt gggtcgtcgc tggggaagtt 1980

gccgaggccc ataagagtag ttgtgaccgg gattccagtc agctccacaa agcgtcgcaa 2040

ctcctcacca gactctgtca cccagcagcg accccttcaa cggctccggg tattctcatc 2100

aacactggcc ctaaggtcag tcgaggtgtt tcgcagcgtt gaggagtggt cttgctgcgc 2160

agccaccgcc cacataaaga acagggcgcc gcgattcacc aacaagacgc agcacctgct 2220

caagcaactc agtcgcaggg ggcttgggaa ggacgacgcg tcggtggcgg gtgtatttct 2280

tgtcccgcgg cgctaagtgg ttgttctgcg tcgtggacga gttcgttgag tcagcgtccc 2340

ccgaaccctt cccgcgcaat gtacccaggc agactcatgg gcttgtccca gacaggcacc 2400

gccatctgct gctggatgtc cttggggatg tcgacaagca ccggccctgg tcgcgcgtta 2460

catgggtccg tctgagtacc cgaacagggt ctgtccgtgg cggtagacga cgacctacag 2520

gaacccctac agctgttcgt ggccgggacc aggaccagag gaggcgagga agaaagcctc 2580

ctgcacgacg cgggggatgt cgtcgacgtc gaggaccagg tagttgtgct tggtgatgga 2640

gcgggtgacc tcctggtctc ctccgctcct tctttcggag gacgtgctgc gccccctaca 2700

gcagctgcag ctcctggtcc atcaacacga accactacct cgcccactgg aggacgatgg 2760

gcgtctcctg gaaggcgtcg gtgccaatca tgcgtcgcgc cacctgtccc gtgatggcga 2820

ccatggggac ggaatcgagc agcgcgtcgg cgctgctacc cgcagaggac cttccgcagc 2880

cacggttagt acgcagcgcg gtggacaggg cactaccgct ggtacccctg ccttagctcg 2940

tcgcgcagcc gcagcgcgga gactaggttg gtggcgccgg ggccggaggt ggcgatgcag 3000

acgccgacgc ggcccgagga gcgcgcgtag ccggaggcgg caaaggcctc cctcgcgcct 3060

ctgatccaac caccgcggcc ccggcctcca ccgctacgtc tgcggctgcg ccgggctcct 3120

cgcgcgcatc ggcctccgcc gtttccggag ggcttgctcg tggcggaaga ggtggttggc 3180

gatgacgggg gagcgggtga gtgcctggtg gatctccatg gacgcgccgc cggggtaggc 3240

gaagacgtcg cggaacgagc accgccttct ccaccaaccg ctactgcccc ctcgcccact 3300

cacggaccac ctagaggtac ctgcgcggcg gccccatccg cttctgcagc gcgacgccgc 3360

agcgctcgag ggactcgacg aggatgtcag cacccttgcg gggctcggtg gggccccacg 3420

gccggagcgg ggtggccggg ggagccatcg gcctgcggcg tcgcgagctc cctgagctgc 3480

tcctacagtc gtgggaacgc cccgagccac cccggggtgc cggcctcgcc ccaccggccc 3540

cctcggtagc cgatggcggg tgacgccgct gagcacctga tgggcgcggc gagggcgcgg 3600

cgggtggcca ggaggtgcgc ccggcgcctc gccttgggcg cagcggtagt ggtaccgccc 3660

actgcggcga ctcgtggact acccgcgccg ctcccgcgcc gcccaccggt cctccacgcg 3720

ggccgcggag cggaacccgc gtcgccatca cccgccagtg agcgcggtag acgcggcggc 3780

ggcggtggcc atggcggtca ctcgcgccat ctgcgccgcc gccgccaccg gtac 3834

<210>67

<211>4278

<212>DNA

<213>Arabidopsis

<220>

<221>misc_feature

<222>(0)...(0)

＜223〉HRA sequence

<400>67

aaatacgttt tatgcaacct acgcaccctg cgctaccatc cctagagctg cagcttattt 60

ttacaacaat taccaacaac aacaaacaac aaacaacatt acaattacta tttacatgga 120

tgcgtgggac gcgatggtag ggatctcgac gtcgaataaa aatgttgtta atggttgttg 180

ttgtttgttg tttgttgtaa tgttaatgat aaatgtatta cagtcgaccc gggatccatg 240

gcggcggcaa caacaacaac aacaacatct tcttcgatct ccttctccac caaaccatct 300

ccttcctcct ccaaattaat gtcagctggg ccctaggtac cgccgccgtt gttgttgttg 360

ttgttgtaga agaagctaga ggaagaggtg gtttggtaga ggaaggagga ggtttacacc 420

attaccaatc tccagattct ccctcccatt ctccctaaac cccaacaaat catcctcctc 480

ctcccgccgc cgcggtatca aatccagctc tccctcgtgg taatggttag aggtctaaga 540

gggagggtaa gagggatttg gggttgttta gtaggaggag gagggcggcg gcgccatagt 600

ttaggtcgag agggagctcc atctccgccg tgctcaacac aaccaccaat gtcacaacca 660

ctccctctcc aaccaaacct accaaacccg aaacattcat ctcccgattc gctccagagg 720

tagaggcggc acgagttgtg ttggtggtta cagtgttggt gagggagagg ttggtttgga 780

tggtttgggc tttgtaagta gagggctaag cgaggtgatc aaccccgcaa aggcgctgat 840

atcctcgtcg aagctttaga acgtcaaggc gtagaaaccg tattcgctta ccctggaggt 900

gcatcaatgg agattcctag ttggggcgtt tccgcgacta taggagcagc ttcgaaatct 960

tgcagttccg catctttggc ataagcgaat gggacctcca cgtagttacc tctaagacca 1020

agccttaacc cgctcttcct caatccgtaa cgtccttcct cgtcacgaac aaggaggtgt 1080

attcgcagca gaaggatacg ctcgatcctc aggtaatggt tcggaattgg gcgagaagga 1140

gttaggcatt gcaggaagga gcagtgcttg ttcctccaca taagcgtcgt cttcctatgc 1200

gagctaggag tccattacca ggtatctgta tagccacttc aggtcccgga gctacaaatc 1260

tcgttagcgg attagccgat gcgttgttag atagtgttcc tcttgtagca atcacatggt 1320

ccatagacat atcggtgaag tccagggcct cgatgtttag agcaatcgcc taatcggcta 1380

cgcaacaatc tatcacaagg agaacatcgt tagtgtggac aagtcgctcg tcgtatgatt 1440

ggtacagatg cgtttcaaga gactccgatt gttgaggtaa cgcgttcgat tacgaagcat 1500

aactatcttg tgatggcctg ttcagcgagc agcatactaa ccatgtctac gcaaagttct 1560

ctgaggctaa caactccatt gcgcaagcta atgcttcgta ttgatagaac actaccatgt 1620

tgaagatatc cctaggatta ttgaggaagc tttcttttta gctacttctg gtagacctgg 1680

acctgttttg gttgatgttc ctaaagatat tcaacataca acttctatag ggatcctaat 1740

aactccttcg aaagaaaaat cgatgaagac catctggacc tggacaaaac caactacaag 1800

gatttctata agttgtacag cttgcgattc ctaattggga acaggctatg agattacctg 1860

gttatatgtc taggatgcct aaacctccgg aagattctca tttggagcag attgtttgtc 1920

gaacgctaag gattaaccct tgtccgatac tctaatggac caatatacag atcctacgga 1980

tttggaggcc ttctaagagt aaacctcgtc taacaaaggt tgatttctga gtctaagaag 2040

cctgtgttgt atgttggtgg tggttgtttg aattctagcg atgaattggg taggtttgtt 2100

gagcttacgg ggatcctcca actaaagact cagattcttc ggacacaaca tacaaccacc 2160

accaacaaac ttaagatcgc tacttaaccc atccaaacaa ctcgaatgcc cctaggctgt 2220

tgcgagtacg ttgatggggc tgggatctta tccttgtgat gatgagttgt cgttacatat 2280

gcttggaatg catgggactg tgtatgcaaa ttacgcgaca acgctcatgc aactaccccg 2340

accctagaat aggaacacta ctactcaaca gcaatgtata cgaaccttac gtaccctgac 2400

acatacgttt aatgcgtgtg gagcatagtg atttgttgtt ggcgtttggg gtaaggtttg 2460

atgatcgtgt cacgggtaag cttgaggctt ttgctagtag ggctaagatt gttcatacac 2520

ctcgtatcac taaacaacaa ccgcaaaccc cattccaaac tactagcaca gtgcccattc 2580

gaactccgaa aacgatcatc ccgattctaa caagtaattg atattgactc ggctgagatt 2640

gggaagaata agactcctca tgtgtctgtg tgtggtgatg ttaagctggc tttgcaaggg 2700

atgaatatga ttcttgtaac tataactgag ccgactctaa cccttcttat tctgaggagt 2760

acacagacac acaccactac aattcgaccg aaacgttccc tacttatact aagaacagag 2820

ccgagcggag gagcttaagc ttgattttgg agtttggagg aatgagttga acgtacagaa 2880

acagaagttt ccgttgagct ttaagacgtt tggggatctc ggctcgcctc ctcgaattcg 2940

aactaaaacc tcaaacctcc ttactcaact tgcatgtctt tgtcttcaaa ggcaactcga 3000

aattctgcaa acccctagct attcctccac agtatgcgat taaggtcctt gatgagttga 3060

ctgatggaaa agccataata agtactggtg tcgggcaaca tcaaatgtgg gcggcgtcga 3120

taaggaggtg tcatacgcta attccaggaa ctactcaact gactaccttt tcggtattat 3180

tcatgaccac agcccgttgt agtttacacc cgccgccagt tctacaatta caagaaacca 3240

aggcagtggc tatcatcagg aggccttgga gctatgggat ttggacttcc tgctgcgatt 3300

ggagcgtctg ttgctagtca agatgttaat gttctttggt tccgtcaccg atagtagtcc 3360

tccggaacct cgatacccta aacctgaagg acgacgctaa cctcgcagac aacgataccc 3420

tgatgcgata gttgtggata ttgacggaga tggaagcttt ataatgaatg tgcaagagct 3480

agccactatt cgtgtagaga atcttccagt gaaggttggg actacgctat caacacctat 3540

aactgcctct accttcgaaa tattacttac acgttctcga tcggtgataa gcacatctct 3600

tagaaggtca cttccaactt ttattaaaca accagcatct tggcatggtt atgcaattgg 3660

aagatcggtt ctacaaagct aaccgagctc acacatttct cggggatccg gctcagtgaa 3720

aataatttgt tggtcgtaga accgtaccaa tacgttaacc ttctagccaa gatgtttcga 3780

ttggctcgag tgtgtaaaga gcccctaggc cgagtcgagg acgagatatt cccgaacatg 3840

ttgctgtttg cagcagcttg cgggattcca gcggcgaggg tgacaaagaa agcagatctc 3900

cgagaagcta ttcagactcc tgctctataa gggcttgtac aacgacaaac gtcgtcgaac 3960

gccctaaggt cgccgctccc actgtttctt tcgtctagag gctcttcgat aagtctcaat 4020

gctggataca ccaggacctt acctgttgga tgtgatttgt ccgcaccaag aacatgtgtt 4080

gccgatgatc ccgagtggtg gcactttcaa cgatgtgtta cgacctatgt ggtcctggaa 4140

tggacaacct acactaaaca ggcgtggttc ttgtacacaa cggctactag ggctcaccac 4200

cgtgaaagtt gctacacata acggaaggag atggccggat taaatacgta ttgccttcct 4260

ctaccggcct aatttatg 4278

<210>68

<211>442

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the GAT sequence (GAT4601) of You Huaing

<221>CDS

<222>(2)...(442)

<400>68

c atg ata gag gtg aaa ccg att aac gca gag gat acc tat gaa cta agg 49

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Glu Leu Arg

1 5 10 15

cat aga ata ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt gaa 97

His Arg Ile Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu

20 25 30

agc gat tta ctt cgt ggt gca ttt cac tta ggc ggc ttt tac agg ggc 145

Ser Asp Leu Leu Arg Gly Ala Phe His Leu Gly Gly Phe Tyr Arg Gly

35 40 45

aaa ctg att tcc ata gct tca ttc cac cag gcc gag cac tcg gaa ctc 193

Lys Leu Ile Ser Ile Ala Ser Phe His Gln Ala Glu His Ser Glu Leu

50 55 60

caa ggc cag aaa cag tac cag ctc cga ggt atg gct acc ttg gaa ggt 241

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Met Ala Thr Leu Glu Gly

65 70 75 80

tat cgt gag cag aaa gcg gga tca act cta gtt aaa cac gct gaa gaa 289

Tyr Arg Glu Gln Lys Ala Gly Ser Thr Leu Val Lys His Ala Glu Glu

85 90 95

atc ctt cgt aag agg ggg gcg gac atg ctt tgg tgt aat gcg agg aca 337

Ile Leu Arg Lys Arg Gly Ala Asp Met Leu Trp Cys Asn Ala Arg Thr

100 105 110

tcc gcc tca ggc tac tac aaa aag tta ggc ttc agc gag cag gga gag 385

Ser Ala Ser Gly Tyr Tyr Lys Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

ata ttt gac acg ccg cca gta gga cct cac atc ctg atg tat aaa agg 433

Ile Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

atc aca taa 442

Ile Thr *

145

<210>69

<211>146

<212>PRT

＜213〉artificial sequence

<400>69

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Glu Leu Arg

1 5 10 15

His Arg Ile Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu

20 25 30

Ser Asp Leu Leu Arg Gly Ala Phe His Leu Gly Gly Phe Tyr Arg Gly

35 40 45

Lys Leu Ile Ser Ile Ala Ser Phe His Gln Ala Glu His Ser Glu Leu

50 55 60

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Met Ala Thr Leu Glu Gly

65 70 75 80

Tyr Arg Glu Gln Lys Ala Gly Ser Thr Leu Val Lys His Ala Glu Glu

85 90 95

Ile Leu Arg Lys Arg Gly Ala Asp Met Leu Trp Cys Asn Ala Arg Thr

100 105 110

Ser Ala Ser Gly Tyr Tyr Lys Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

Ile Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

Ile Thr

145

<210>70

<211>441

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the GAT sequence (GAT4602) of You Huaing

<221>CDS

<222>(1)...(441)

<400>70

atg ata gag gtg aaa ccg att aac gca gag gat acc tat gaa cta agg 48

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Glu Leu Arg

1 5 10 15

cat aga ata ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt gaa 96

His Arg Ile Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu

20 25 30

agc gat tta ctt cgt ggt gca ttt cac tta ggc ggc tat tac ggg ggc 144

Ser Asp Leu Leu Arg Gly Ala Phe His Leu Gly Gly Tyr Tyr Gly Gly

35 40 45

aaa ctg att tcc ata gct tca ttc cac cag gcc gag cac tca gaa ctc 192

Lys Leu Ile Ser Ile Ala Ser Phe His Gln Ala Glu His Ser Glu Leu

50 55 60

caa ggc cag aaa cag tac cag ctc cga ggt atg gct acc ttg gaa ggt 240

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Met Ala Thr Leu Glu Gly

65 70 75 80

tat cgt gag cag aag gcg gga tcg agt cta att aaa cac gct gaa gaa 288

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Ile Lys His Ala Glu Glu

85 90 95

att ctt cgt aag agg ggg gcg gac ttg ctt tgg tgt aat gcg cgg aca 336

Ile Leu Arg Lys Arg Gly Ala Asp Leu Leu Trp Cys Asn Ala Arg Thr

100 105 110

tcc gcc tca ggc tac tac aaa aag tta ggc ttc agc gag cag gga gag 384

Ser Ala Ser Gly Tyr Tyr Lys Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

gta ttc gac acg ccg cca gta gga cct cac atc ctg atg tat aaa agg 432

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

atc aca taa 441

Ile Thr *

145

<210>71

<211>146

<212>PRT

＜213〉artificial sequence

<400>71

Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Glu Leu Arg

1 5 10 15

His Arg Ile Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu

20 25 30

Ser Asp Leu Leu Arg Gly Ala Phe His Leu Gly Gly Tyr Tyr Gly Gly

35 40 45

Lys Leu Ile Ser Ile Ala Ser Phe His Gln Ala Glu His Ser Glu Leu

50 55 60

Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Met Ala Thr Leu Glu Gly

65 70 75 80

Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Ile Lys His Ala Glu Glu

85 90 95

Ile Leu Arg Lys Arg Gly Ala Asp Leu Leu Trp Cys Asn Ala Arg Thr

100 105 110

Ser Ala Ser Gly Tyr Tyr Lys Lys Leu Gly Phe Ser Glu Gln Gly Glu

115 120 125

Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg

130 135 140

Ile Thr

145

<210>72

<211>438

<212>DNA

＜213〉cauliflower mosaic virus

<220>

＜221〉enhanser

<222>(0)...(0)

＜223〉35S enhanser

<400>72

cccatggagt caaagattca aatagaggac ctaacagaac tcgccgtaaa gactggcgaa 60

cagttcatac agagtctctt acgactcaat gacaagaaga aaatcttcgt caacatggtg 120

gagcacgaca cgcttgtcta ctccaaaaat atcaaagata cagtctcaga agaccaaagg 180

gcaattgaga cttttcaaca aagggtaata tccggaaacc tcctcggatt ccattgccca 240

gctatctgtc actttattgt gaagatagtg gaaaaggaag gtggctccta caaatgccat 300

cattgcgata aaggaaaggc catcgttgaa gatgcctctg ccgacagtgg tcccaaagat 360

ggacccccac ccacgaggag catcgtggaa aaagaagacg ttccaaccac gtcttcaaag 420

caagtggatt gatgtgat 438

<210>73

<211>534

<212>DNA

＜213〉cauliflower mosaic virus

<220>

＜221〉promotor

<222>(0)...(0)

＜223〉has the S35 enhanser of lease core promotor

<400>73

cccatggagt caaagattca aatagaggac ctaacagaac tcgccgtaaa gactggcgaa 60

cagttcatac agagtctctt acgactcaat gacaagaaga aaatcttcgt caacatggtg 120

gagcacgaca cgcttgtcta ctccaaaaat atcaaagata cagtctcaga agaccaaagg 180

gcaattgaga cttttcaaca aagggtaata tccggaaacc tcctcggatt ccattgccca 240

gctatctgtc actttattgt gaagatagtg gaaaaggaag gtggctccta caaatgccat 300

cattgcgata aaggaaaggc catcgttgaa gatgcctctg ccgacagtgg tcccaaagat 360

ggacccccac ccacgaggag catcgtggaa aaagaagacg ttccaaccac gtcttcaaag 420

caagtggatt gatgtgatat ctccactgac gtaagggatg acgcacaatc ccactaagct 480

tcgcaagacc cttcctctat ataaggaagt tcatttcatt tggagaggac aggg 534

<210>74

<211>52

<212>DNA

＜213〉cauliflower mosaic virus

<220>

＜221〉promotor

<222>(0)...(0)

＜223〉lease core promotor

<400>74

gcaagaccct tcctctatat aaggaagttc atttcatttg gagaggacag gg 52

<210>75

<211>162

<212>DNA

＜213〉cauliflower mosaic virus

<400>75

catcgttgaa gatgcctctg ccgacagtgg tcccaaagat ggacccccac ccacgaggag 60

catcgtggaa aaagaagacg ttccaaccac gtcttcaaag caagtggatt gatgtgatat 120

ctccactgac gtaagggatg acgcacaatc ccactaagct tc 162

<210>76

<211>44

<212>DNA

＜213〉cauliflower mosaic virus

<400>76

atctccactg acgtaaggga tgacgcacaa tcccactaag cttc 44

<210>77

<211>1991

<212>DNA

＜213〉artificial sequence

<220>

＜223〉comprise the promoter sequence of ZmUBI PR0-5 ' UTR-ZMUBI

Introne 1

<400>77

gcagtgcagc gtgacccggt cgtgcccctc tctagagata atgagcattg catgtctaag 60

ttataaaaaa ttaccacata ttttttttgt cacacttgtt tgaagtgcag tttatctatc 120

tttatacata tatttaaact ttactctacg aataatataa tctatagtac tacaataata 180

tcagtgtttt agagaatcat ataaatgaac agttagacat ggtctaaagg acaattgagt 240

attttgacaa caggactcta cagttttatc tttttagtgt gcatgtgttc tccttttttt 300

ttgcaaatag cttcacctat ataatacttc atccatttta ttagtacatc catttagggt 360

ttagggttaa tggtttttat agactaattt ttttagtaca tctattttat tctattttag 420

cctctaaatt aagaaaacta aaactctatt ttagtttttt tatttaataa tttagatata 480

aaatagaata aaataaagtg actaaaaatt aaacaaatac cctttaagaa attaaaaaaa 540

ctaaggaaac atttttcttg tttcgagtag ataatgccag cctgttaaac gccgtcgacg 600

agtctaacgg acaccaacca gcgaaccagc agcgtcgcgt cgggccaagc gaagcagacg 660

gcacggcatc tctgtcgctg cctctggacc cctctcgaga gttccgctcc accgttggac 720

ttgctccgct gtcggcatcc agaaattgcg tggcggagcg gcagacgtga gccggcacgg 780

caggcggcct cctcctcctc tcacggcacc ggcagctacg ggggattcct ttcccaccgc 840

tccttcgctt tcccttcctc gcccgccgta ataaatagac accccctcca caccctcttt 900

ccccaacctc gtgttgttcg gagcgcacac acacacaacc agatctcccc caaatccacc 960

cgtcggcacc tccgcttcaa ggtacgccgc tcgtcctccc ccccccccct ctctaccttc 1020

tctagatcgg cgttccggtc catggttagg gcccggtagt tctacttctg ttcatgtttg 1080

tgttagatcc gtgtttgtgt tagatccgtg ctgctagcgt tcgtacacgg atgcgacctg 1140

tacgtcagac acgttctgat tgctaacttg ccagtgtttc tctttgggga atcctgggat 1200

ggctctagcc gttccgcaga cgggatcgat ttcatgattt tttttgtttc gttgcatagg 1260

gtttggtttg cccttttcct ttatttcaat atatgccgtg cacttgtttg tcgggtcatc 1320

ttttcatgct tttttttgtc ttggttgtga tgatgtggtc tggttgggcg gtcgttctag 1380

atcggagtag aattctgttt caaactacct ggtggattta ttaattttgg atctgtatgt 1440

gtgtgccata catattcata gttacgaatt gaagatgatg gatggaaata tcgatctagg 1500

ataggtatac atgttgatgc gggttttact gatgcatata cagagatgct ttttgttcgc 1560

ttggttgtga tgatgtggtg tggttgggcg gtcgttcatt cgttctagat cggagtagaa 1620

tactgtttca aactacctgg tgtatttatt aattttggaa ctgtatgtgt gtgtcataca 1680

tcttcatagt tacgagttta agatggatgg aaatatcgat ctaggatagg tatacatgtt 1740

gatgtgggtt ttactgatgc atatacatga tggcatatgc agcatctatt catatgctct 1800

aaccttgagt acctatctat tataataaac aagtatgttt tataattatt ttgatcttga 1860

tatacttgga tgatggcata tgcagcagct atatgtggat ttttttagcc ctgccttcat 1920

acgctattta tttgcttggt actgtttctt ttgtcgatgc tcaccctgtt gtttggtgtt 1980

acttctgcag g 1991

<210>78

<211>3359

<212>DNA

＜213〉artificial sequence

<220>

＜223〉can be operatively connected to the 3X35S ENH of ZmUbi PR0-5UTR ZmUbi introne 1 promotor;

Reverse 35S enhanser

<400>78

atcacatcaa tccacttgct ttgaagacgt ggttggaacg tcttcttttt ccacgatgct 60

cctcgtgggt gggggtccat ctttgggacc actgtcggca gaggcatctt caacgatggc 120

ctttccttta tcgcaatgat ggcatttgta ggagccacct tccttttcca ctatcttcac 180

aataaagtga cagatagctg ggcaatggaa tccgaggagg tttccggata ttaccctttg 240

ttgaaaagtc tcaattgccc tttggtcttc tgagactgta tctttgatat ttttggagta 300

gacaagcgtg tcgtgctcca ccatgttgac gaagattttc ttcttgtcat tgagtcgtaa 360

gagactctgt atgaactgtt cgccagtctt tacggcgagt tctgttaggt cctctatttg 420

aatctttgac tccatggacg gtatcgataa gctagcttga tatcacatca atccacttgc 480

tttgaagacg tggttggaac gtcttctttt tccacgatgc tcctcgtggg tgggggtcca 540

tctttgggac cactgtcggc agaggcatct tcaacgatgg cctttccttt atcgcaatga 600

tggcatttgt aggagccacc ttccttttcc actatcttca caataaagtg acagatagct 660

gggcaatgga atccgaggag gtttccggat attacccttt gttgaaaagt ctcaattgcc 720

ctttggtctt ctgagactgt atctttgata tttttggagt agacaagcgt gtcgtgctcc 780

accatgttga cgaagatttt cttcttgtca ttgagtcgta agagactctg tatgaactgt 840

tcgccagtct ttacggcgag ttctgttagg tcctctattt gaatctttga ctccatgatc 900

gaattatcac atcaatccac ttgctttgaa gacgtggttg gaacgtcttc tttttccacg 960

atgctcctcg tgggtggggg tccatctttg ggaccactgt cggcagaggc atcttcaacg 1020

atggcctttc ctttatcgca atgatggcat ttgtaggagc caccttcctt ttccactatc 1080

ttcacaataa agtgacagat agctgggcaa tggaatccga ggaggtttcc ggatattacc 1140

ctttgttgaa aagtctcaat tgccctttgg tcttctgaga ctgtatcttt gatatttttg 1200

gagtagacaa gcgtgtcgtg ctccaccatg ttgacgaaga ttttcttctt gtcattgagt 1260

cgtaagagac tctgtatgaa ctgttcgcca gtctttacgg cgagttctgt taggtcctct 1320

atttgaatct ttgactccat gggaattcct gcagcccagc ttgcatgcct gcagtgcagc 1380

gtgacccggt cgtgcccctc tctagagata atgagcattg catgtctaag ttataaaaaa 1440

ttaccacata ttttttttgt cacacttgtt tgaagtgcag tttatctatc tttatacata 1500

tatttaaact ttactctacg aataatataa tctatagtac tacaataata tcagtgtttt 1560

agagaatcat ataaatgaac agttagacat ggtctaaagg acaattgagt attttgacaa 1620

caggactcta cagttttatc tttttagtgt gcatgtgttc tccttttttt ttgcaaatag 1680

cttcacctat ataatacttc atccatttta ttagtacatc catttagggt ttagggttaa 1740

tggtttttat agactaattt ttttagtaca tctattttat tctattttag cctctaaatt 1800

aagaaaacta aaactctatt ttagtttttt tatttaataa tttagatata aaatagaata 1860

aaataaagtg actaaaaatt aaacaaatac cctttaagaa attaaaaaaa ctaaggaaac 1920

atttttcttg tttcgagtag ataatgccag cctgttaaac gccgtcgacg agtctaacgg 1980

acaccaacca gcgaaccagc agcgtcgcgt cgggccaagc gaagcagacg gcacggcatc 2040

tctgtcgctg cctctggacc cctctcgaga gttccgctcc accgttggac ttgctccgct 2100

gtcggcatcc agaaattgcg tggcggagcg gcagacgtga gccggcacgg caggcggcct 2160

cctcctcctc tcacggcacc ggcagctacg ggggattcct ttcccaccgc tccttcgctt 2220

tcccttcctc gcccgccgta ataaatagac accccctcca caccctcttt ccccaacctc 2280

gtgttgttcg gagcgcacac acacacaacc agatctcccc caaatccacc cgtcggcacc 2340

tccgcttcaa ggtacgccgc tcgtcctccc ccccccccct ctctaccttc tctagatcgg 2400

cgttccggtc catggttagg gcccggtagt tctacttctg ttcatgtttg tgttagatcc 2460

gtgtttgtgt tagatccgtg ctgctagcgt tcgtacacgg atgcgacctg tacgtcagac 2520

acgttctgat tgctaacttg ccagtgtttc tctttgggga atcctgggat ggctctagcc 2580

gttccgcaga cgggatcgat ttcatgattt tttttgtttc gttgcatagg gtttggtttg 2640

cccttttcct ttatttcaat atatgccgtg cacttgtttg tcgggtcatc ttttcatgct 2700

tttttttgtc ttggttgtga tgatgtggtc tggttgggcg gtcgttctag atcggagtag 2760

aattctgttt caaactacct ggtggattta ttaattttgg atctgtatgt gtgtgccata 2820

catattcata gttacgaatt gaagatgatg gatggaaata tcgatctagg ataggtatac 2880

atgttgatgc gggttttact gatgcatata cagagatgct ttttgttcgc ttggttgtga 2940

tgatgtggtg tggttgggcg gtcgttcatt cgttctagat cggagtagaa tactgtttca 3000

aactacctgg tgtatttatt aattttggaa ctgtatgtgt gtgtcataca tcttcatagt 3060

tacgagttta agatggatgg aaatatcgat ctaggatagg tatacatgtt gatgtgggtt 3120

ttactgatgc atatacatga tggcatatgc agcatctatt catatgctct aaccttgagt 3180

acctatctat tataataaac aagtatgttt tataattatt ttgatcttga tatacttgga 3240

tgatggcata tgcagcagct atatgtggat ttttttagcc ctgccttcat acgctattta 3300

tttgcttggt actgtttctt ttgtcgatgc tcaccctgtt gtttggtgtt acttctgca 3359

<210>79

<211>1343

<212>DNA

＜213〉cauliflower mosaic virus

<220>

＜221〉enhanser

<222>(0)...(0)

＜223〉reverse 35S enhanser 3X

<400>79

atcacatcaa tccacttgct ttgaagacgt ggttggaacg tcttcttttt ccacgatgct 60

cctcgtgggt gggggtccat ctttgggacc actgtcggca gaggcatctt caacgatggc 120

ctttccttta tcgcaatgat ggcatttgta ggagccacct tccttttcca ctatcttcac 180

aataaagtga cagatagctg ggcaatggaa tccgaggagg tttccggata ttaccctttg 240

ttgaaaagtc tcaattgccc tttggtcttc tgagactgta tctttgatat ttttggagta 300

gacaagcgtg tcgtgctcca ccatgttgac gaagattttc ttcttgtcat tgagtcgtaa 360

gagactctgt atgaactgtt cgccagtctt tacggcgagt tctgttaggt cctctatttg 420

aatctttgac tccatggacg gtatcgataa gctagcttga tatcacatca atccacttgc 480

tttgaagacg tggttggaac gtcttctttt tccacgatgc tcctcgtggg tgggggtcca 540

tctttgggac cactgtcggc agaggcatct tcaacgatgg cctttccttt atcgcaatga 600

tggcatttgt aggagccacc ttccttttcc actatcttca caataaagtg acagatagct 660

gggcaatgga atccgaggag gtttccggat attacccttt gttgaaaagt ctcaattgcc 720

ctttggtctt ctgagactgt atctttgata tttttggagt agacaagcgt gtcgtgctcc 780

accatgttga cgaagatttt cttcttgtca ttgagtcgta agagactctg tatgaactgt 840

tcgccagtct ttacggcgag ttctgttagg tcctctattt gaatctttga ctccatgatc 900

gaattatcac atcaatccac ttgctttgaa gacgtggttg gaacgtcttc tttttccacg 960

atgctcctcg tgggtggggg tccatctttg ggaccactgt cggcagaggc atcttcaacg 1020

atggcctttc ctttatcgca atgatggcat ttgtaggagc caccttcctt ttccactatc 1080

ttcacaataa agtgacagat agctgggcaa tggaatccga ggaggtttcc ggatattacc 1140

ctttgttgaa aagtctcaat tgccctttgg tcttctgaga ctgtatcttt gatatttttg 1200

gagtagacaa gcgtgtcgtg ctccaccatg ttgacgaaga ttttcttctt gtcattgagt 1260

cgtaagagac tctgtatgaa ctgttcgcca gtctttacgg cgagttctgt taggtcctct 1320

atttgaatct ttgactccat ggg 1343

<210>80

<211>2479

<212>DNA

＜213〉artificial sequence

<220>

＜223〉35S ENH (+): ZmUBI PR0-5UTR-UBI introne 1;

Forward 35S enhanser

<400>80

cccatggagt caaagattca aatagaggac ctaacagaac tcgccgtaaa gactggcgaa 60

cagttcatac agagtctctt acgactcaat gacaagaaga aaatcttcgt caacatggtg 120

gagcacgaca cgcttgtcta ctccaaaaat atcaaagata cagtctcaga agaccaaagg 180

gcaattgaga cttttcaaca aagggtaata tccggaaacc tcctcggatt ccattgccca 240

gctatctgtc actttattgt gaagatagtg gaaaaggaag gtggctccta caaatgccat 300

cattgcgata aaggaaaggc catcgttgaa gatgcctctg ccgacagtgg tcccaaagat 360

ggacccccac ccacgaggag catcgtggaa aaagaagacg ttccaaccac gtcttcaaag 420

caagtggatt gatgtgatat caagcttatc gataccgtcg acctcgaggg ggggcccagc 480

ttgcatgcct gcagtgcagc gtgacccggt cgtgcccctc tctagagata atgagcattg 540

catgtctaag ttataaaaaa ttaccacata ttttttttgt cacacttgtt tgaagtgcag 600

tttatctatc tttatacata tatttaaact ttactctacg aataatataa tctatagtac 660

tacaataata tcagtgtttt agagaatcat ataaatgaac agttagacat ggtctaaagg 720

acaattgagt attttgacaa caggactcta cagttttatc tttttagtgt gcatgtgttc 780

tccttttttt ttgcaaatag cttcacctat ataatacttc atccatttta ttagtacatc 840

catttagggt ttagggttaa tggtttttat agactaattt ttttagtaca tctattttat 900

tctattttag cctctaaatt aagaaaacta aaactctatt ttagtttttt tatttaataa 960

tttagatata aaatagaata aaataaagtg actaaaaatt aaacaaatac cctttaagaa 1020

attaaaaaaa ctaaggaaac atttttcttg tttcgagtag ataatgccag cctgttaaac 1080

gccgtcgacg agtctaacgg acaccaacca gcgaaccagc agcgtcgcgt cgggccaagc 1140

gaagcagacg gcacggcatc tctgtcgctg cctctggacc cctctcgaga gttccgctcc 1200

accgttggac ttgctccgct gtcggcatcc agaaattgcg tggcggagcg gcagacgtga 1260

gccggcacgg caggcggcct cctcctcctc tcacggcacc ggcagctacg ggggattcct 1320

ttcccaccgc tccttcgctt tcccttcctc gcccgccgta ataaatagac accccctcca 1380

caccctcttt ccccaacctc gtgttgttcg gagcgcacac acacacaacc agatctcccc 1440

caaatccacc cgtcggcacc tccgcttcaa ggtacgccgc tcgtcctccc ccccccccct 1500

ctctaccttc tctagatcgg cgttccggtc catggttagg gcccggtagt tctacttctg 1560

ttcatgtttg tgttagatcc gtgtttgtgt tagatccgtg ctgctagcgt tcgtacacgg 1620

atgcgacctg tacgtcagac acgttctgat tgctaacttg ccagtgtttc tctttgggga 1680

atcctgggat ggctctagcc gttccgcaga cgggatcgat ttcatgattt tttttgtttc 1740

gttgcatagg gtttggtttg cccttttcct ttatttcaat atatgccgtg cacttgtttg 1800

tcgggtcatc ttttcatgct tttttttgtc ttggttgtga tgatgtggtc tggttgggcg 1860

gtcgttctag atcggagtag aattctgttt caaactacct ggtggattta ttaattttgg 1920

atctgtatgt gtgtgccata catattcata gttacgaatt gaagatgatg gatggaaata 1980

tcgatctagg ataggtatac atgttgatgc gggttttact gatgcatata cagagatgct 2040

ttttgttcgc ttggttgtga tgatgtggtg tggttgggcg gtcgttcatt cgttctagat 2100

cggagtagaa tactgtttca aactacctgg tgtatttatt aattttggaa ctgtatgtgt 2160

gtgtcataca tcttcatagt tacgagttta agatggatgg aaatatcgat ctaggatagg 2220

tatacatgtt gatgtgggtt ttactgatgc atatacatga tggcatatgc agcatctatt 2280

catatgctct aaccttgagt acctatctat tataataaac aagtatgttt tataattatt 2340

ttgatcttga tatacttgga tgatggcata tgcagcagct atatgtggat ttttttagcc 2400

ctgccttcat acgctattta tttgcttggt actgtttctt ttgtcgatgc tcaccctgtt 2460

gtttggtgtt acttctgca 2479

<210>81

<211>3331

<212>DNA

＜213〉artificial sequence

<220>

＜223〉3X35S ENH (+): ZmUBI PR0-5UTR-UBI introne 1;

Forward 35S enhanser

<400>81

cccatggagt caaagattca aatagaggac ctaacagaac tcgccgtaaa gactggcgaa 60

cagttcatac agagtctctt acgactcaat gacaagaaga aaatcttcgt caacatggtg 120

gagcacgaca cgcttgtcta ctccaaaaat atcaaagata cagtctcaga agaccaaagg 180

gcaattgaga cttttcaaca aagggtaata tccggaaacc tcctcggatt ccattgccca 240

gctatctgtc actttattgt gaagatagtg gaaaaggaag gtggctccta caaatgccat 300

cattgcgata aaggaaaggc catcgttgaa gatgcctctg ccgacagtgg tcccaaagat 360

ggacccccac ccacgaggag catcgtggaa aaagaagacg ttccaaccac gtcttcaaag 420

caagtggatt gatgtgataa ttcgatcatg gagtcaaaga ttcaaataga ggacctaaca 480

gaactcgccg taaagactgg cgaacagttc atacagagtc tcttacgact caatgacaag 540

aagaaaatct tcgtcaacat ggtggagcac gacacgcttg tctactccaa aaatatcaaa 600

gatacagtct cagaagacca aagggcaatt gagacttttc aacaaagggt aatatccgga 660

aacctcctcg gattccattg cccagctatc tgtcacttta ttgtgaagat agtggaaaag 720

gaaggtggct cctacaaatg ccatcattgc gataaaggaa aggccatcgt tgaagatgcc 780

tctgccgaca gtggtcccaa agatggaccc ccacccacga ggagcatcgt ggaaaaagaa 840

gacgttccaa ccacgtcttc aaagcaagtg gattgatgtg atatcaagct tatcgatacc 900

gccatggagt caaagattca aatagaggac ctaacagaac tcgccgtaaa gactggcgaa 960

cagttcatac agagtctctt acgactcaat gacaagaaga aaatcttcgt caacatggtg 1020

gagcacgaca cgcttgtcta ctccaaaaat atcaaagata cagtctcaga agaccaaagg 1080

gcaattgaga cttttcaaca aagggtaata tccggaaacc tcctcggatt ccattgccca 1140

gctatctgtc actttattgt gaagatagtg gaaaaggaag gtggctccta caaatgccat 1200

cattgcgata aaggaaaggc catcgttgaa gatgcctctg ccgacagtgg tcccaaagat 1260

ggacccccac ccacgaggag catcgtggaa aaagaagacg ttccaaccac gtcttcaaag 1320

caagtggatt gatgtgatgt ctgcagtgca gcgtgacccg gtcgtgcccc tctctagaga 1380

taatgagcat tgcatgtcta agttataaaa aattaccaca tatttttttt gtcacacttg 1440

tttgaagtgc agtttatcta tctttataca tatatttaaa ctttactcta cgaataatat 1500

aatctatagt actacaataa tatcagtgtt ttagagaatc atataaatga acagttagac 1560

atggtctaaa ggacaattga gtattttgac aacaggactc tacagtttta tctttttagt 1620

gtgcatgtgt tctccttttt ttttgcaaat agcttcacct atataatact tcatccattt 1680

tattagtaca tccatttagg gtttagggtt aatggttttt atagactaat ttttttagta 1740

catctatttt attctatttt agcctctaaa ttaagaaaac taaaactcta ttttagtttt 1800

tttatttaat aatttagata taaaatagaa taaaataaag tgactaaaaa ttaaacaaat 1860

accctttaag aaattaaaaa aactaaggaa acatttttct tgtttcgagt agataatgcc 1920

agcctgttaa acgccgtcga cgagtctaac ggacaccaac cagcgaacca gcagcgtcgc 1980

gtcgggccaa gcgaagcaga cggcacggca tctctgtcgc tgcctctgga cccctctcga 2040

gagttccgct ccaccgttgg acttgctccg ctgtcggcat ccagaaattg cgtggcggag 2100

cggcagacgt gagccggcac ggcaggcggc ctcctcctcc tctcacggca ccggcagcta 2160

cgggggattc ctttcccacc gctccttcgc tttcccttcc tcgcccgccg taataaatag 2220

acaccccctc cacaccctct ttccccaacc tcgtgttgtt cggagcgcac acacacacaa 2280

ccagatctcc cccaaatcca cccgtcggca cctccgcttc aaggtacgcc gctcgtcctc 2340

cccccccccc ctctctacct tctctagatc ggcgttccgg tccatggtta gggcccggta 2400

gttctacttc tgttcatgtt tgtgttagat ccgtgtttgt gttagatccg tgctgctagc 2460

gttcgtacac ggatgcgacc tgtacgtcag acacgttctg attgctaact tgccagtgtt 2520

tctctttggg gaatcctggg atggctctag ccgttccgca gacgggatcg atttcatgat 2580

tttttttgtt tcgttgcata gggtttggtt tgcccttttc ctttatttca atatatgccg 2640

tgcacttgtt tgtcgggtca tcttttcatg cttttttttg tcttggttgt gatgatgtgg 2700

tctggttggg cggtcgttct agatcggagt agaattctgt ttcaaactac ctggtggatt 2760

tattaatttt ggatctgtat gtgtgtgcca tacatattca tagttacgaa ttgaagatga 2820

tggatggaaa tatcgatcta ggataggtat acatgttgat gcgggtttta ctgatgcata 2880

tacagagatg ctttttgttc gcttggttgt gatgatgtgg tgtggttggg cggtcgttca 2940

ttcgttctag atcggagtag aatactgttt caaactacct ggtgtattta ttaattttgg 3000

aactgtatgt gtgtgtcata catcttcata gttacgagtt taagatggat ggaaatatcg 3060

atctaggata ggtatacatg ttgatgtggg ttttactgat gcatatacat gatggcatat 3120

gcagcatcta ttcatatgct ctaaccttga gtacctatct attataataa acaagtatgt 3180

tttataatta ttttgatctt gatatacttg gatgatggca tatgcagcag ctatatgtgg 3240

atttttttag ccctgccttc atacgctatt tatttgcttg gtactgtttc ttttgtcgat 3300

gctcaccctg ttgtttggtg ttacttctgc a 3331

<210>82

<211>2454

<212>DNA

＜213〉artificial sequence

<220>

＜223〉35S ENH (-): ZmUBI PR0-5UTR UBI introne 1;

Reverse 35S enhanser

<400>82

atcacatcaa tccacttgct ttgaagacgt ggttggaacg tcttcttttt ccacgatgct 60

cctcgtgggt gggggtccat ctttgggacc actgtcggca gaggcatctt caacgatggc 120

ctttccttta tcgcaatgat ggcatttgta ggagccacct tccttttcca ctatcttcac 180

aataaagtga cagatagctg ggcaatggaa tccgaggagg tttccggata ttaccctttg 240

ttgaaaagtc tcaattgccc tttggtcttc tgagactgta tctttgatat ttttggagta 300

gacaagcgtg tcgtgctcca ccatgttgac gaagattttc ttcttgtcat tgagtcgtaa 360

gagactctgt atgaactgtt cgccagtctt tacggcgagt tctgttaggt cctctatttg 420

aatctttgac tccatgggaa ttcctgcagc ccagcttgca tgcctgcagt gcagcgtgac 480

ccggtcgtgc ccctctctag agataatgag cattgcatgt ctaagttata aaaaattacc 540

acatattttt tttgtcacac ttgtttgaag tgcagtttat ctatctttat acatatattt 600

aaactttact ctacgaataa tataatctat agtactacaa taatatcagt gttttagaga 660

atcatataaa tgaacagtta gacatggtct aaaggacaat tgagtatttt gacaacagga 720

ctctacagtt ttatcttttt agtgtgcatg tgttctcctt tttttttgca aatagcttca 780

cctatataat acttcatcca ttttattagt acatccattt agggtttagg gttaatggtt 840

tttatagact aattttttta gtacatctat tttattctat tttagcctct aaattaagaa 900

aactaaaact ctattttagt ttttttattt aataatttag atataaaata gaataaaata 960

aagtgactaa aaattaaaca aatacccttt aagaaattaa aaaaactaag gaaacatttt 1020

tcttgtttcg agtagataat gccagcctgt taaacgccgt cgacgagtct aacggacacc 1080

aaccagcgaa ccagcagcgt cgcgtcgggc caagcgaagc agacggcacg gcatctctgt 1140

cgctgcctct ggacccctct cgagagttcc gctccaccgt tggacttgct ccgctgtcgg 1200

catccagaaa ttgcgtggcg gagcggcaga cgtgagccgg cacggcaggc ggcctcctcc 1260

tcctctcacg gcaccggcag ctacggggga ttcctttccc accgctcctt cgctttccct 1320

tcctcgcccg ccgtaataaa tagacacccc ctccacaccc tctttcccca acctcgtgtt 1380

gttcggagcg cacacacaca caaccagatc tcccccaaat ccacccgtcg gcacctccgc 1440

ttcaaggtac gccgctcgtc ctcccccccc cccctctcta ccttctctag atcggcgttc 1500

cggtccatgg ttagggcccg gtagttctac ttctgttcat gtttgtgtta gatccgtgtt 1560

tgtgttagat ccgtgctgct agcgttcgta cacggatgcg acctgtacgt cagacacgtt 1620

ctgattgcta acttgccagt gtttctcttt ggggaatcct gggatggctc tagccgttcc 1680

gcagacggga tcgatttcat gatttttttt gtttcgttgc atagggtttg gtttgccctt 1740

ttcctttatt tcaatatatg ccgtgcactt gtttgtcggg tcatcttttc atgctttttt 1800

ttgtcttggt tgtgatgatg tggtctggtt gggcggtcgt tctagatcgg agtagaattc 1860

tgtttcaaac tacctggtgg atttattaat tttggatctg tatgtgtgtg ccatacatat 1920

tcatagttac gaattgaaga tgatggatgg aaatatcgat ctaggatagg tatacatgtt 1980

gatgcgggtt ttactgatgc atatacagag atgctttttg ttcgcttggt tgtgatgatg 2040

tggtgtggtt gggcggtcgt tcattcgttc tagatcggag tagaatactg tttcaaacta 2100

cctggtgtat ttattaattt tggaactgta tgtgtgtgtc atacatcttc atagttacga 2160

gtttaagatg gatggaaata tcgatctagg ataggtatac atgttgatgt gggttttact 2220

gatgcatata catgatggca tatgcagcat ctattcatat gctctaacct tgagtaccta 2280

tctattataa taaacaagta tgttttataa ttattttgat cttgatatac ttggatgatg 2340

gcatatgcag cagctatatg tggatttttt tagccctgcc ttcatacgct atttatttgc 2400

ttggtactgt ttcttttgtc gatgctcacc ctgttgtttg gtgttacttc tgca 2454

<210>83

<211>3359

<212>DNA

＜213〉artificial sequence

<220>

＜223〉3X35S ENH (-): ZmUBI PR0-5UTR-UBI introne 1;

Reverse 35S enhanser

<400>83

atcacatcaa tccacttgct ttgaagacgt ggttggaacg tcttcttttt ccacgatgct 60

cctcgtgggt gggggtccat ctttgggacc actgtcggca gaggcatctt caacgatggc 120

ctttccttta tcgcaatgat ggcatttgta ggagccacct tccttttcca ctatcttcac 180

aataaagtga cagatagctg ggcaatggaa tccgaggagg tttccggata ttaccctttg 240

ttgaaaagtc tcaattgccc tttggtcttc tgagactgta tctttgatat ttttggagta 300

gacaagcgtg tcgtgctcca ccatgttgac gaagattttc ttcttgtcat tgagtcgtaa 360

gagactctgt atgaactgtt cgccagtctt tacggcgagt tctgttaggt cctctatttg 420

aatctttgac tccatggacg gtatcgataa gctagcttga tatcacatca atccacttgc 480

tttgaagacg tggttggaac gtcttctttt tccacgatgc tcctcgtggg tgggggtcca 540

tctttgggac cactgtcggc agaggcatct tcaacgatgg cctttccttt atcgcaatga 600

tggcatttgt aggagccacc ttccttttcc actatcttca caataaagtg acagatagct 660

gggcaatgga atccgaggag gtttccggat attacccttt gttgaaaagt ctcaattgcc 720

ctttggtctt ctgagactgt atctttgata tttttggagt agacaagcgt gtcgtgctcc 780

accatgttga cgaagatttt cttcttgtca ttgagtcgta agagactctg tatgaactgt 840

tcgccagtct ttacggcgag ttctgttagg tcctctattt gaatctttga ctccatgatc 900

gaattatcac atcaatccac ttgctttgaa gacgtggttg gaacgtcttc tttttccacg 960

atgctcctcg tgggtggggg tccatctttg ggaccactgt cggcagaggc atcttcaacg 1020

atggcctttc ctttatcgca atgatggcat ttgtaggagc caccttcctt ttccactatc 1080

ttcacaataa agtgacagat agctgggcaa tggaatccga ggaggtttcc ggatattacc 1140

ctttgttgaa aagtctcaat tgccctttgg tcttctgaga ctgtatcttt gatatttttg 1200

gagtagacaa gcgtgtcgtg ctccaccatg ttgacgaaga ttttcttctt gtcattgagt 1260

cgtaagagac tctgtatgaa ctgttcgcca gtctttacgg cgagttctgt taggtcctct 1320

atttgaatct ttgactccat gggaattcct gcagcccagc ttgcatgcct gcagtgcagc 1380

gtgacccggt cgtgcccctc tctagagata atgagcattg catgtctaag ttataaaaaa 1440

ttaccacata ttttttttgt cacacttgtt tgaagtgcag tttatctatc tttatacata 1500

tatttaaact ttactctacg aataatataa tctatagtac tacaataata tcagtgtttt 1560

agagaatcat ataaatgaac agttagacat ggtctaaagg acaattgagt attttgacaa 1620

caggactcta cagttttatc tttttagtgt gcatgtgttc tccttttttt ttgcaaatag 1680

cttcacctat ataatacttc atccatttta ttagtacatc catttagggt ttagggttaa 1740

tggtttttat agactaattt ttttagtaca tctattttat tctattttag cctctaaatt 1800

aagaaaacta aaactctatt ttagtttttt tatttaataa tttagatata aaatagaata 1860

aaataaagtg actaaaaatt aaacaaatac cctttaagaa attaaaaaaa ctaaggaaac 1920

atttttcttg tttcgagtag ataatgccag cctgttaaac gccgtcgacg agtctaacgg 1980

acaccaacca gcgaaccagc agcgtcgcgt cgggccaagc gaagcagacg gcacggcatc 2040

tctgtcgctg cctctggacc cctctcgaga gttccgctcc accgttggac ttgctccgct 2100

gtcggcatcc agaaattgcg tggcggagcg gcagacgtga gccggcacgg caggcggcct 2160

cctcctcctc tcacggcacc ggcagctacg ggggattcct ttcccaccgc tccttcgctt 2220

tcccttcctc gcccgccgta ataaatagac accccctcca caccctcttt ccccaacctc 2280

gtgttgttcg gagcgcacac acacacaacc agatctcccc caaatccacc cgtcggcacc 2340

tccgcttcaa ggtacgccgc tcgtcctccc ccccccccct ctctaccttc tctagatcgg 2400

cgttccggtc catggttagg gcccggtagt tctacttctg ttcatgtttg tgttagatcc 2460

gtgtttgtgt tagatccgtg ctgctagcgt tcgtacacgg atgcgacctg tacgtcagac 2520

acgttctgat tgctaacttg ccagtgtttc tctttgggga atcctgggat ggctctagcc 2580

gttccgcaga cgggatcgat ttcatgattt tttttgtttc gttgcatagg gtttggtttg 2640

cccttttcct ttatttcaat atatgccgtg cacttgtttg tcgggtcatc ttttcatgct 2700

tttttttgtc ttggttgtga tgatgtggtc tggttgggcg gtcgttctag atcggagtag 2760

aattctgttt caaactacct ggtggattta ttaattttgg atctgtatgt gtgtgccata 2820

catattcata gttacgaatt gaagatgatg gatggaaata tcgatctagg ataggtatac 2880

atgttgatgc gggttttact gatgcatata cagagatgct ttttgttcgc ttggttgtga 2940

tgatgtggtg tggttgggcg gtcgttcatt cgttctagat cggagtagaa tactgtttca 3000

aactacctgg tgtatttatt aattttggaa ctgtatgtgt gtgtcataca tcttcatagt 3060

tacgagttta agatggatgg aaatatcgat ctaggatagg tatacatgtt gatgtgggtt 3120

ttactgatgc atatacatga tggcatatgc agcatctatt catatgctct aaccttgagt 3180

acctatctat tataataaac aagtatgttt tataattatt ttgatcttga tatacttgga 3240

tgatggcata tgcagcagct atatgtggat ttttttagcc ctgccttcat acgctattta 3300

tttgcttggt actgtttctt ttgtcgatgc tcaccctgtt gtttggtgtt acttctgca 3359

<210>84

<211>1340

<212>DNA

＜213〉artificial sequence

<220>

＜223〉forward 3X 35S enhanser

<400>84

cccatggagt caaagattca aatagaggac ctaacagaac tcgccgtaaa gactggcgaa 60

cagttcatac agagtctctt acgactcaat gacaagaaga aaatcttcgt caacatggtg 120

gagcacgaca cgcttgtcta ctccaaaaat atcaaagata cagtctcaga agaccaaagg 180

gcaattgaga cttttcaaca aagggtaata tccggaaacc tcctcggatt ccattgccca 240

gctatctgtc actttattgt gaagatagtg gaaaaggaag gtggctccta caaatgccat 300

cattgcgata aaggaaaggc catcgttgaa gatgcctctg ccgacagtgg tcccaaagat 360

ggacccccac ccacgaggag catcgtggaa aaagaagacg ttccaaccac gtcttcaaag 420

caagtggatt gatgtgataa ttcgatcatg gagtcaaaga ttcaaataga ggacctaaca 480

gaactcgccg taaagactgg cgaacagttc atacagagtc tcttacgact caatgacaag 540

aagaaaatct tcgtcaacat ggtggagcac gacacgcttg tctactccaa aaatatcaaa 600

gatacagtct cagaagacca aagggcaatt gagacttttc aacaaagggt aatatccgga 660

aacctcctcg gattccattg cccagctatc tgtcacttta ttgtgaagat agtggaaaag 720

gaaggtggct cctacaaatg ccatcattgc gataaaggaa aggccatcgt tgaagatgcc 780

tctgccgaca gtggtcccaa agatggaccc ccacccacga ggagcatcgt ggaaaaagaa 840

gacgttccaa ccacgtcttc aaagcaagtg gattgatgtg atatcaagct tatcgatacc 900

gccatggagt caaagattca aatagaggac ctaacagaac tcgccgtaaa gactggcgaa 960

cagttcatac agagtctctt acgactcaat gacaagaaga aaatcttcgt caacatggtg 1020

gagcacgaca cgcttgtcta ctccaaaaat atcaaagata cagtctcaga agaccaaagg 1080

gcaattgaga cttttcaaca aagggtaata tccggaaacc tcctcggatt ccattgccca 1140

gctatctgtc actttattgt gaagatagtg gaaaaggaag gtggctccta caaatgccat 1200

cattgcgata aaggaaaggc catcgttgaa gatgcctctg ccgacagtgg tcccaaagat 1260

ggacccccac ccacgaggag catcgtggaa aaagaagacg ttccaaccac gtcttcaaag 1320

caagtggatt gatgtgatgt 1340

<210>85

<211>438

<212>DNA

＜213〉cauliflower mosaic virus

<400>85

atcacatcaa tccacttgct ttgaagacgt ggttggaacg tcttcttttt ccacgatgct 60

cctcgtgggt gggggtccat ctttgggacc actgtcggca gaggcatctt caacgatggc 120

ctttccttta tcgcaatgat ggcatttgta ggagccacct tccttttcca ctatcttcac 180

aataaagtga cagatagctg ggcaatggaa tccgaggagg tttccggata ttaccctttg 240

ttgaaaagtc tcaattgccc tttggtcttc tgagactgta tctttgatat ttttggagta 300

gacaagcgtg tcgtgctcca ccatgttgac gaagattttc ttcttgtcat tgagtcgtaa 360

gagactctgt atgaactgtt cgccagtctt tacggcgagt tctgttaggt cctctatttg 420

aatctttgac tccatggg 438

<210>86

<211>657

<212>PRT

<213>Gossypium hirsutum

<400>86

Met Ala Pro His Asn Thr Met Ala Ala Thr Ala Ser Arg Thr Thr Arg

1 5 10 15

Phe Ser Ser Ser Ser Ser His Pro Thr Phe Pro Lys Arg Ile Thr Arg

20 25 30

Ser Thr Leu Pro Leu Ser His Gln Thr Leu Thr Lys Pro Asn His Ala

35 40 45

Leu Lys Ile Lys Cys Ser Ile Ser Lys Pro Pro Thr Ala Ala Pro Phe

50 55 60

Thr Lys Glu Ala Pro Thr Thr Glu Pro Phe Val Ser Arg Phe Ala Ser

65 70 75 80

Gly Glu Pro Arg Lys Gly Ala Asp Ile Leu Val Glu Ala Leu Glu Arg

85 90 95

Gln Gly Val Thr Thr Val Phe Ala Tyr Pro Gly Gly Ala Ser Met Glu

100 105 110

Ile His Gln Ala Leu Thr Arg Ser Ala Ala Ile Arg Asn Val Leu Pro

115 120 125

Arg His Glu Gln Gly Gly Val Phe Ala Ala Glu Gly Tyr Ala Arg Ser

130 135 140

Ser Gly Leu Pro Gly Val Cys Ile Ala Thr Ser Gly Pro Gly Ala Thr

145 150 155 160

Asn Leu Val Ser Gly Leu Ala Asp Ala Leu Met Asp Ser Val Pro Val

165 170 175

Val Ala Ile Thr Gly Gln Val Ala Arg Arg Met Ile Gly Thr Asp Ala

180 185 190

Phe Gln Glu Thr Pro Ile Val Glu Val Ser Arg Ser Ile Thr Lys His

195 200 205

Asn Tyr Leu Ile Leu Asp Val Asp Asp Ile Pro Arg Val Val Ala Glu

210 215 220

Ala Phe Phe Val Ala Thr Ser Gly Arg Pro Gly Pro Val Leu Ile Asp

225 230 235 240

Ile Pro Lys Asp Val Gln Gln Gln Leu Ala Val Pro Asn Trp Asp Glu

245 250 255

Pro Val Asn Leu Pro Gly Tyr Leu Ala Arg Leu Pro Arg Pro Pro Ala

260 265 270

Glu Ala Gln Leu Glu His Ile Val Arg Leu Ile Met Glu Ala Gln Lys

275 280 285

Pro Val Leu Tyr Val Gly Gly Gly Ser Phe Asn Ser Ser Ala Glu Leu

290 295 300

Arg Arg Phe Val Glu Leu Thr Gly Ile Pro Val Ala Ser Thr Leu Met

305 310 315 320

Gly Leu Gly Thr Phe Pro Ile Gly Asp Glu Tyr Ser Leu Gln Met Leu

325 330 335

Gly Met His Gly Thr Val Tyr Ala Asn Tyr Ala Val Asp Asn Ser Asp

340 345 350

Leu Leu Leu Ala Phe Gly Val Arg Phe Asp Asp Arg Val Thr Gly Lys

355 360 365

Leu Glu Ala Phe Ala Ser Arg Ala Lys Ile Val His Ile Asp Ile Asp

370 375 380

Ser Ala Glu Ile Gly Lys Asn Lys Gln Ala His Val Ser Val Cys Ala

385 390 395 400

Asp Leu Lys Leu Ala Leu Lys Gly Ile Asn Met Ile Leu Glu Glu Lys

405 410 415

Gly Val Glu Gly Lys Phe Asp Leu Gly Gly Trp Arg Glu Glu Ile Asn

420 425 430

Val Gln Lys His Lys Phe Pro Leu Gly Tyr Lys Thr Phe Gln Asp Ala

435 440 445

Ile Ser Pro Gln His Ala Ile Glu Val Leu Asp Glu Leu Thr Asn Gly

450 455 460

Asp Ala Ile Val Ser Thr Gly Val Gly Gln His Gln Met Trp Ala Ala

465 470 475 480

Gln Phe Tyr Lys Tyr Lys Arg Pro Arg Gln Trp Leu Thr Ser Gly Gly

485 490 495

Leu Gly Ala Met Gly Phe Gly Leu Pro Ala Ala Ile Gly Ala Ala Val

500 505 510

Ala Asn Pro Gly Ala Val Val Val Asp Ile Asp Gly Asp Gly Ser Phe

515 520 525

Ile Met Asn Val Gln Glu Leu Ala Thr Ile Arg Val Glu Asn Leu Pro

530 535 540

Val Lys Ile Leu Leu Leu Asn Asn Gln His Leu Gly Met Val Val Gln

545 550 555 560

Leu Glu Asp Arg Phe Tyr Lys Ser Asn Arg Ala His Thr Tyr Leu Gly

565 570 575

Asp Pro Ser Ser Glu Ser Glu Ile Phe Pro Asn Met Leu Lys Phe Ala

580 585 590

Asp Ala Cys Gly Ile Pro Ala Ala Arg Val Thr Lys Lys Glu Glu Leu

595 600 605

Arg Ala Ala Ile Gln Arg Met Leu Asp Thr Pro Gly Pro Tyr Leu Leu

610 615 620

Asp Val Ile Val Pro His Gln Glu His Val Leu Pro Met Ile Pro Ser

625 630 635 640

Asn Gly Ser Phe Lys Asp Val Ile Thr Glu Gly Asp Gly Arg Thr Arg

645 650 655

Tyr

<210>87

<211>1309

<212>DNA

<213>Glycine max

<220>

＜221〉promotor

<222>(0)...(0)

＜223〉SAM promotor

<400>87

ctagatcaaa ctcacatcca aacataacat ggatatcttc cttaccaatc atactaatta 60

ttttgggtta aatattaatc attattttta agatattaat taagaaatta aaagattttt 120

taaaaaaatg tataaaatta tattattcat gatttttcat acatttgatt ttgataataa 180

atatattttt tttaatttct taaaaaatgt tgcaagacac ttattagaca tagtcttgtt 240

ctgtttacaa aagcattcat catttaatac attaaaaaat atttaatact aacagtagaa 300

tcttcttgtg agtggtgtgg gagtaggcaa cctggcattg aaacgagaga aagagagtca 360

gaaccagaag acaaataaaa agtatgcaac aaacaaatca aaatcaaagg gcaaaggctg 420

gggttggctc aattggttgc tacattcaat tttcaactca gtcaacggtt gagattcact 480

ctgacttccc caatctaagc cgcggatgca aacggttgaa tctaacccac aatccaatct 540

cgttacttag gggcttttcc gtcattaact cacccctgcc acccggtttc cctataaatt 600

ggaactcaat gctcccctct aaactcgtat cgcttcagag ttgagaccaa gacacactcg 660

ttcatatatc tctctgctct tctcttctct tctacctctc aaggtacttt tcttctccct 720

ctaccaaatc ctagattccg tggttcaatt tcggatcttg cacttctggt ttgctttgcc 780

ttgctttttc ctcaactggg tccatctagg atccatgtga aactctactc tttctttaat 840

atctgcggaa tacgcgttgg actttcagat ctagtcgaaa tcatttcata attgcctttc 900

tttcttttag cttatgagaa ataaaatcac ttttttttta tttcaaaata aaccttgggc 960

cttgtgctga ctgagatggg gtttggtgat tacagaattt tagcgaattt tgtaattgta 1020

cttgtttgtc tgtagttttg ttttgttttc ttgtttctca tacattcctt aggcttcaat 1080

tttattcgag tataggtcac aataggaatt caaactttga gcaggggaat taatcccttc 1140

cttcaaatcc agtttgtttg tatatatgtt taaaaaatga aacttttgct ttaaattcta 1200

ttataacttt ttttatggct gaaatttttg catgtgtctt tgctctctgt tgtaaattta 1260

ctgtttaggt actaactcta ggcttgttgt gcagtttttg aagtataac 1309

<210>88

<211>1344

<212>DNA

＜213〉artificial sequence

<220>

＜223〉forward 3X 35S enhanser

<400>88

cccatggagt caaagattca aatagaggac ctaacagaac tcgccgtaaa gactggcgaa 60

cagttcatac agagtctctt acgactcaat gacaagaaga aaatcttcgt caacatggtg 120

gagcacgaca cgcttgtcta ctccaaaaat atcaaagata cagtctcaga agaccaaagg 180

gcaattgaga cttttcaaca aagggtaata tccggaaacc tcctcggatt ccattgccca 240

gctatctgtc actttattgt gaagatagtg gaaaaggaag gtggctccta caaatgccat 300

cattgcgata aaggaaaggc catcgttgaa gatgcctctg ccgacagtgg tcccaaagat 360

ggacccccac ccacgaggag catcgtggaa aaagaagacg ttccaaccac gtcttcaaag 420

caagtggatt gatgtgataa ttcgatcatg gagtcaaaga ttcaaataga ggacctaaca 480

gaactcgccg taaagactgg cgaacagttc atacagagtc tcttacgact caatgacaag 540

aagaaaatct tcgtcaacat ggtggagcac gacacgcttg tctactccaa aaatatcaaa 600

gatacagtct cagaagacca aagggcaatt gagacttttc aacaaagggt aatatccgga 660

aacctcctcg gattccattg cccagctatc tgtcacttta ttgtgaagat agtggaaaag 720

gaaggtggct cctacaaatg ccatcattgc gataaaggaa aggccatcgt tgaagatgcc 780

tctgccgaca gtggtcccaa agatggaccc ccacccacga ggagcatcgt ggaaaaagaa 840

gacgttccaa ccacgtcttc aaagcaagtg gattgatgtg atatcaagct agcttatcga 900

taccgtccat ggagtcaaag attcaaatag aggacctaac agaactcgcc gtaaagactg 960

gcgaacagtt catacagagt ctcttacgac tcaatgacaa gaagaaaatc ttcgtcaaca 1020

tggtggagca cgacacgctt gtctactcca aaaatatcaa agatacagtc tcagaagacc 1080

aaagggcaat tgagactttt caacaaaggg taatatccgg aaacctcctc ggattccatt 1140

gcccagctat ctgtcacttt attgtgaaga tagtggaaaa ggaaggtggc tcctacaaat 1200

gccatcattg cgataaagga aaggccatcg ttgaagatgc ctctgccgac agtggtccca 1260

aagatggacc cccacccacg aggagcatcg tggaaaaaga agacgttcca accacgtctt 1320

caaagcaagt ggat t gatgt gat g 1344

<210>89

<211>1344

<212>DNA

＜213〉artificial sequence

<220>

＜223〉reverse 3X 35S enhanser

<400>89

catcacatca atccacttgc tttgaagacg tggttggaac gtcttctttt tccacgatgc 60

tcctcgtggg tgggggtcca tctttgggac cactgtcggc agaggcatct tcaacgatgg 120

cctttccttt atcgcaatga tggcatttgt aggagccacc ttccttttcc actatcttca 180

caataaagtg acagatagct gggcaatgga atccgaggag gtttccggat attacccttt 240

gttgaaaagt ctcaattgcc ctttggtctt ctgagactgt atctttgata tttttggagt 300

agacaagcgt gtcgtgctcc accatgttga cgaagatttt cttcttgtca ttgagtcgta 360

agagactctg tatgaactgt tcgccagtct ttacggcgag ttctgttagg tcctctattt 420

gaatctttga ctccatggac ggtatcgata agctagcttg atatcacatc aatccacttg 480

ctttgaagac gtggttggaa cgtcttcttt ttccacgatg ctcctcgtgg gtgggggtcc 540

atctttggga ccactgtcgg cagaggcatc ttcaacgatg gcctttcctt tatcgcaatg 600

atggcatttg taggagccac cttccttttc cactatcttc acaataaagt gacagatagc 660

tgggcaatgg aatccgagga ggtttccgga tattaccctt tgttgaaaag tctcaattgc 720

cctttggtct tctgagactg tatctttgat atttttggag tagacaagcg tgtcgtgctc 780

caccatgttg acgaagattt tcttcttgtc attgagtcgt aagagactct gtatgaactg 840

ttcgccagtc tttacggcga gttctgttag gtcctctatt tgaatctttg actccatgat 900

cgaattatca catcaatcca cttgctttga agacgtggtt ggaacgtctt ctttttccac 960

gatgctcctc gtgggtgggg gtccatcttt gggaccactg tcggcagagg catcttcaac 1020

gatggccttt cctttatcgc aatgatggca tttgtaggag ccaccttcct tttccactat 1080

cttcacaata aagtgacaga tagctgggca atggaatccg aggaggtttc cggatattac 1140

cctttgttga aaagtctcaa ttgccctttg gtcttctgag actgtatctt tgatattttt 1200

ggagtagaca agcgtgtcgt gctccaccat gttgacgaag attttcttct tgtcattgag 1260

tcgtaagaga ctctgtatga actgttcgcc agtctttacg gcgagttctg ttaggtcctc 1320

tatttgaatc tttgactcca tggg 1344

Claims (112)

1. method for weed in the control cultivation area, it comprises

A) plantation crop seed or plant in described district, it comprises

I) first kind of polynucleotide, but the polypeptide of its coding conferring glyphosate tolerance, these polynucleotide are operably connected in described plant on the promoters active; With

Ii) second kind of polynucleotide, its coding ALS inhibitor tolerance polypeptide, these polynucleotide are operably connected in described plant on the promoters active;

B) combinations of herbicides is used in any crop, crop part, weeds or its cultivation area, this combinations of herbicides comprises first kind of weedicide of significant quantity at least and second kind of weedicide of significant quantity, wherein said combinations of herbicides does not comprise glyphosate, and wherein, described first kind of described significant quantity with described second kind of weedicide tolerated by described crop, and can control weeds.

2. the process of claim 1 wherein that described first kind of weedicide comprises the ALS inhibitor.

3. the method for claim 2, wherein said second kind of weedicide comprises second kind of ALS inhibitor.

4. claim 2 or 3 method, wherein the described significant quantity of first kind of ALS inhibitor comprises about 0.1 to about 5000g ai/ hectare.

5. the method for claim 4, wherein the described significant quantity of first kind of ALS inhibitor comprises about 0.5 and arrives about 150g ai/ hectare to about 350g ai/ hectare or about 1.

6. the method for claim 3, wherein the described significant quantity of second kind of ALS inhibitor comprises about 0.1 to about 5000g ai/ hectare, and about 0.5 arrives about 150g ai/ hectare to about 350g ai/ hectare or about 1.

7. each method of claim 1-6, wherein said first kind of polynucleotide encoding glyphosate-N-acetyl-transferase.

8. each method of claim 1-6, the 5-enol acetonyl shikimic acid-3-phosphate synthase of wherein said first kind of polynucleotide encoding glyphosate tolerant or the glyphosate oxidoreductase of glyphosate tolerant.

9. each method of claim 1-6, wherein said ALS inhibitor tolerance polypeptide comprises the acetolactate synthase polypeptide of sudden change.

10. the method for claim 9, the acetolactate synthase polypeptide of wherein said sudden change comprises HRA.

11. each method of claim 1-10, the combination of wherein said weedicide comprises the ALS inhibitor that is selected from the group of being made up of sulfonylurea, triazolo pyrimidine, 2-pyrimidinyl oxy (sulfo-) phenylformic acid, imidazolone and sulfonyl amino carbonyl Triazolinones.

12. the method for claim 11, wherein said ALS inhibitor are selected from by the group of forming below:

A) azimsulfuron;

B) chlorimuronethyl;

C) metsulfuronmethyl;

D) nicosulfuron;

E) rimsulfuron 25;

F) sulfometuronmethyl;

G) thiameturonmethyl;

H) tribenuron-methyl;

I) amidosulfuron;

J) benbbensulfuronmethyl;

K) chlorine sulphur is grand;

L) cinosulfuron;

M) cyclammonium sulphur is grand;

N) ethametsulfuron;

O) ethoxy sulphur is grand;

P) flazasulfuron;

Q) the fluorine pyrrole is yellow grand;

R) foramsulfuron;

S) imidazoles sulphur is grand;

T) iodine metsulfuronmethyl;

U) two sulphurs are grand;

V) oxasulfuron;

W) Fluoropyrimidinesulfuron;

X) prosulfuron;

Y) pyrazosulfuronmethyl;

Z) sulfosulfuron;

Aa) triasulfuron;

Bb) trifloxysulfuron;

Cc) sulfonium triflate methyl;

Dd) tritosulfuron;

Ee) frighten careless sulphur first;

FF) flucarbazonesodium;

Gg) procarbazone;

Hh) cloransulammethyl;

Ii) flumetsulam;

Jj) diclosulam;

Kk) florasulam;

Ll) imazamox;

Mm) two careless ethers;

Nn) pyriftalid;

Oo) pyribenzoxim;

Pp) pyrithiobacsodium;

Qq) KIH 6127-methyl;

Rr) weed eradication cigarette;

Ss) Imazethapyr;

Tt) weed eradication quinoline;

Uu) imazapic;

Vv) methyl miaow oxalic acid;

Ww) imazamox;

Xx) fluorine pyrrole sulphur is grand;

Yy) metosulam;

Zz) triazole species sulfanilamide (SN); With

aaa)Pyroxsulam。

13. each method of claim 1-12, the combination of wherein said weedicide comprises triazine or phospho acid at least.

14. claim 1,2,4 or each method of 7-12, wherein said second kind of weedicide has the different mechanism of action with described first kind of weedicide.

15. each method of claim 1-13, wherein said second kind of weedicide has the identical mechanism of action with described first kind of weedicide.

16. each method of claim 1-15, the combination of wherein said weedicide includes the third weedicide of effect amount at least.

17. each method of claim 1-16, wherein

Described first kind of weedicide before appearance, the back appears or occur before and occur after be applied to weeds or crop; With

Described second kind of weedicide before appearance, the back appears or occur before or occur after be applied to weeds or crop.

18. each method of claim 1-17, wherein said first kind and described second kind of weedicide used together or separately use.

19. each method of claim 1-17, wherein described at least first kind and described second kind of weedicide comprise the homogeneous granules adulterant.

20. each method of claim 1-19, wherein said method also comprises the application agricultural chemicals, and this agricultural chemicals is selected from mycocide, nematocides, growth regulator, safener, adjuvant, insecticide and its any combination.

21. the method for claim 20, wherein said agricultural chemicals before appearance, the back appears or occur before and occur after be applied to weeds or crop.

22. each method of claim 1-21, wherein said agricultural chemicals is with described first kind of weedicide, described second kind of weedicide or described first kind and described second kind of weedicide or separately use.

23. each method of claim 1-22, wherein said first kind of weedicide comprises sulfonylurea, and described second kind of weedicide comprises the ALS inhibitor.

24. each method of claim 1-22, wherein said first kind of weedicide comprises sulfonylurea, and described second kind of weedicide comprises imidazolone.

25. the method for claim 23 or 24, the significant quantity of wherein said first kind or described second kind of weedicide provides safe effect.

26. each method of claim 1-25 is at least one copy of the enhancer sequence that provides among at least a SEQ of the being operably connected to ID NO:72 of wherein said first kind or described second kind of polynucleotide.

27. each method of claim 1-26, wherein said crop is a dicotyledons.

28. the method for claim 27, wherein said dicotyledons are soybean, rape, Sunflower Receptacle, cotton, clover, ornamental plant, fruit, vegetables, beet or Arabidopis thaliana.

29. each method of claim 1-26, wherein said plant is a monocotyledons.

30. the method for claim 29, wherein said monocotyledons are corn, wheat, rice, barley, Chinese sorghum, sugarcane, switchgrass or rye.

31. the process of claim 1 wherein that described crop is a corn and at V7 stage or the described first kind of weedicide of more late application.

32. the process of claim 1 wherein and carry out at least step (b) before in step (a).

33. method for weed in the control cultivation area, it comprises:

A) envrionment conditions in the assessment cultivation area;

B) combinations of herbicides of selection significant quantity, this combination comprises first kind of weedicide of significant quantity at least and second kind of weedicide of significant quantity, the combination of wherein said weedicide does not comprise glyphosate, and wherein, described first kind and described second kind of weedicide of described significant quantity are tolerated by crop, and can control weeds; With

C) described combinations of herbicides is used in the cultivation area of crop, crop part, seed or described crop, wherein said crop comprises plant, and this plant has

I) be operably connected to first kind of polynucleotide on the promoters active in the described crop, the polypeptide that its coding can the conferring glyphosate tolerance; With

Ii) be operably connected to second kind of polynucleotide on the promoters active in the described crop, its coding ALS inhibitor tolerance polypeptide.

34. the method for claim 33, wherein said first kind of weedicide comprises the ALS inhibitor.

35. the method for claim 34, wherein said second kind of weedicide comprises second kind of ALS inhibitor.

36. the method for claim 34 or 35, the described significant quantity of wherein said first kind or described second kind of ALS inhibitor comprise about 0.1 to about 5000g ai/ hectare.

37. the method for claim 34 or 35, the described significant quantity of wherein said first kind or described second kind of ALS inhibitor comprise about 1 to about 150g ai/ hectare.

38. the method for claim 34 or 35, the described significant quantity of wherein said first kind or described second kind of ALS inhibitor comprise about 0.5 to about 350g ai/ hectare.

39. each method of claim 33-38, wherein said first kind of polynucleotide encoding glyphosate-N-acetyl-transferase.

40. each method of claim 33-38, wherein said ALS inhibitor tolerance polypeptide comprises the acetolactate synthase polypeptide of sudden change.

41. the method for claim 40, the acetolactate synthase polypeptide of wherein said sudden change comprises HRA.

42. each method of claim 33-41, wherein combinations of herbicides comprises the ALS inhibitor that is selected from sulfonylurea, triazolo pyrimidine, 2-pyrimidinyl oxy (sulfo-) phenylformic acid, imidazolone and sulfonyl amino carbonyl Triazolinones.

43. the method for claim 42, wherein said ALS inhibitor is selected from:

A) azimsulfuron;

B) chlorimuronethyl;

C) metsulfuronmethyl;

D) nicosulfuron;

E) rimsulfuron 25;

F) sulfometuronmethyl;

G) thiameturonmethyl;

H) tribenuron-methyl;

I) amidosulfuron;

J) benbbensulfuronmethyl;

K) chlorine sulphur is grand;

L) cinosulfuron;

M) cyclammonium sulphur is grand;

N) ethametsulfuron;

O) ethoxy sulphur is grand;

P) flazasulfuron;

Q) the fluorine pyrrole is yellow grand;

R) foramsulfuron;

S) imidazoles sulphur is grand;

T) iodine metsulfuronmethyl;

U) two sulphurs are grand;

V) oxasulfuron;

W) Fluoropyrimidinesulfuron;

X) prosulfuron;

Y) pyrazosulfuronmethyl;

Z) sulfosulfuron;

Aa) triasulfuron;

Bb) trifloxysulfuron;

Cc) sulfonium triflate methyl;

Dd) tritosulfuron;

Ee) frighten careless sulphur first;

Ff) flucarbazonesodium;

Gg) procarbazone;

Hh) cloransulammethyl;

Ii) flumetsulam;

Jj) diclosulam;

Kk) florasulam;

Ll) imazamox;

Mm) two careless ethers;

Nn) pyriftalid;

Oo) pyribenzoxim;

Pp) pyrithiobacsodium;

Qq) KIH 6127-methyl;

Rr) weed eradication cigarette;

Ss) Imazethapyr;

Tt) weed eradication quinoline;

Uu) imazapic;

Vv) methyl miaow oxalic acid;

Ww) imazamox.

Xx) fluorine pyrrole sulphur is grand;

Yy) metosulam;

Zz) triazole species sulfanilamide (SN); With

aaa)Pyroxsulam。

44. each method of claim 33-43, wherein said second kind of weedicide and described first kind of weedicide have the identical or different mechanism of action.

45. each method of claim 33-44, wherein

Described first kind of weedicide before appearance, the back appears or occur before and occur after be applied to weeds or crop; With

Described second kind of weedicide before appearance, the back appears or occur before and occur after be applied to weeds or crop.

46. each method of claim 33-44, wherein said first kind and described second kind of weedicide used together or separately use.

47. each method of claim 33-44, wherein described at least first kind and described second kind of weedicide comprise the homogeneous granules adulterant.

48. each method of claim 33-47, wherein said method also comprises the application agricultural chemicals, and this agricultural chemicals is selected from mycocide, nematocides, growth regulator, safener, adjuvant, insecticide or its any combination.

49. each method of claim 33-48 is at least one copy of the enhancer sequence that provides among at least a SEQ of the being operably connected to ID NO:72 of wherein said first kind or described second kind of polynucleotide.

50. each method of claim 33-49, wherein said crop is a dicotyledons.

51. the method for claim 50, wherein said dicotyledons are soybean, rape, Sunflower Receptacle, cotton, clover, ornamental plant, fruit, vegetables, beet or Arabidopis thaliana.

52. each method of claim 33-39, wherein said plant is a monocotyledons.

53. the method for claim 52, wherein said monocotyledons be corn, wheat, rice, barley, Chinese sorghum, sugarcane, switchgrass or rye,

54. method for weed in the control cultivation area, it comprises

A) plantation crop seed or plant in this zone, this crop seed or plant comprise

I) first kind of polynucleotide, but the polypeptide of its coding conferring glyphosate tolerance, these polynucleotide are operably connected in described plant on the promoters active; With

Ii) second kind of polynucleotide, its coding ALS inhibitor tolerance polypeptide, these polynucleotide are operably connected in described plant on the promoters active;

B) combinations of herbicides is used in described crop, crop part, weeds or its cultivation area, this combinations of herbicides comprises first kind and second kind of ALS inhibitor of significant quantity at least, wherein

I) significant quantity of this combinations of herbicides control weeds;

Ii) the significant quantity of first kind of ALS inhibitor is not compared with the contrast crop that is not exposed to first kind of ALS inhibitor when using separately and is tolerated by described crop; With

Iii) the significant quantity of second kind of ALS inhibitor enough produces safe effect, and wherein the crop tolerance when only using first kind of ALS inhibitor is compared, and when using first kind and second kind of ALS inhibitor, described safe effect provides the increase of crop tolerance.

55. the method for claim 54, wherein described at least first kind or described second kind of ALS inhibitor comprise sulfonylurea.

56. the method for claim 54, wherein said second kind of ALS inhibitor comprises sulfonylurea, and described first kind of ALS inhibitor comprises imidazolone.

57. the method for claim 54, wherein said combinations of herbicides also comprises glyphosate.

58. method for weed in the control cultivation area, it comprises:

A) envrionment conditions in the assessment cultivation area;

B) select combinations of herbicides, it comprises first kind and second kind of ALS inhibitor of significant quantity at least, the Combination Control weeds of wherein said significant quantity, and first kind of ALS inhibitor of significant quantity do not compared with the contrast crop of using first kind of ALS inhibitor when using separately and tolerated by crop, and second kind of ALS inhibitor of significant quantity is enough to produce safe effect, wherein the crop tolerance when only using first kind of ALS inhibitor is compared, when first kind of application and second kind of ALS inhibitor, described safe effect provides the increase of crop tolerance; With

C) described combinations of herbicides is used in the cultivation area of crop, crop part, seed or described crop, wherein said crop comprises plant, and this plant has

I) first kind of polynucleotide, but the polypeptide of its coding conferring glyphosate tolerance, these polynucleotide are operably connected in described plant on the promoters active; With

Ii) second kind of polynucleotide, its coding ALS inhibitor tolerance polypeptide, these polynucleotide are operably connected in described plant on the promoters active.

59. the method for claim 58, wherein described at least first kind or described second kind of ALS inhibitor comprise sulfonylurea.

60. the method for claim 58, wherein said second kind of ALS inhibitor comprises sulfonylurea, and described first kind of ALS inhibitor comprises imidazolone.

61. method for weed in the control cultivation area, it comprises

A) plantation crop seed or plant in this zone, this crop seed or plant comprise

I) first kind of polynucleotide, but the polypeptide of its coding conferring glyphosate tolerance, these polynucleotide are operably connected in described plant on the promoters active; With

Ii) second kind of polynucleotide, its coding ALS inhibitor tolerance polypeptide, these polynucleotide are operably connected in described plant on the promoters active;

B) to the combinations of herbicides of described crop, crop part, weeds or its cultivation area application significant quantity, this combinations of herbicides is selected from:

I) comprise glyphosate, weed eradication cigarette, chlorimuronethyl, quizalofop and remove the combinations of herbicides of beans green bristlegrass, wherein said significant quantity is tolerated by described crop, and can control weeds;

Ii) comprise glyphosate, weed eradication cigarette, chlorimuronethyl, quizalofop and remove the combinations of herbicides of beans green bristlegrass, that wherein said significant quantity is tolerated by described crop and can control weeds; Or

The combinations of herbicides that iii) comprises glyphosate, chlorimuronethyl and thiameturonmethyl, wherein said significant quantity is tolerated by described crop, and can control weeds.

62. the method for claim 61, wherein said crop are soybean, corn or cotton.

63. the method for claim 59, wherein the significant quantity of part (b) combinations of herbicides (i) comprises about 1110 to about 1130g ai/ hectare; The significant quantity of weed eradication cigarette comprises about 7.5 to about 27.5gai/ hectare; The significant quantity of chlorimuronethyl comprises about 7.5 to about 27.5g ai/ hectare; The significant quantity of quizalofop comprises about 50 to about 70g ai/ hectare; The significant quantity of removing the beans green bristlegrass comprises about 240 to about 260g ai/ hectare.

64. plant, it comprises the polynucleotide of the polypeptide of coding conferring glyphosate tolerance, the polynucleotide of the ALS inhibitor tolerance polypeptide of perhaps encoding, and wherein said polynucleotide are operably connected to

(a) in plant, drive expression promoter; With

(b) enhancer sequence that provides among the SEQ ID NO:1,72,85,88 or 89 or at least one copy of having the enhancer sequence of at least 90% sequence identity with SEQ ID NO:1,72,85,88 or 89, wherein said enhancer sequence can be regulated transcriptional level

Glyphosate or ALS inhibitor that wherein said plant tolerance is used with certain level, described level effectively suppresses the growth of control plant, and described control plant does not comprise the described polynucleotide that are operably connected on the described enhancer sequence.

65. the plant of claim 64, the polynucleotide encoding glyphosate-N-acetyl-transferase of wherein said conferring glyphosate tolerance.

66. the plant of claim 64, the 5-enol acetonyl shikimic acid-3-phosphate synthase of the polynucleotide encoding glyphosate tolerant of wherein said conferring glyphosate tolerance or the glyphosate oxidoreductase of glyphosate tolerant.

67. the transgenic plant of claim 64, wherein said ALS inhibitor tolerance polypeptide comprises HRA.

68. each transgenic plant of claim 64-67, wherein said polynucleotide are operably connected on three copies of the enhancer sequence that provides among the SEQ ID NO:72 at least.

69. each transgenic plant of claim 64-67, wherein said promotor is the ubiquitin promotor.

70. each transgenic plant of claim 64-68, wherein said enhanser and described promotor are allogenic.

71. each transgenic plant of claim 64-70, wherein said promotor is corn ubiquitin promotor or Arabidopis thaliana ubiquitin promotor.

72. each plant of claim 64-71, wherein said crop is a dicotyledons.

73. the plant of claim 72, wherein said dicotyledons are soybean, rape, Sunflower Receptacle, cotton, clover, ornamental plant, fruit, vegetables, beet or Arabidopis thaliana.

74. each plant of claim 64-70, wherein said plant is a monocotyledons.

75. the plant of claim 74, wherein said monocotyledons are corn, wheat, rice, barley, Chinese sorghum, sugarcane, switchgrass or rye.

76. expression cassette, it comprises first polynucleotide of the polypeptide of coding conferring glyphosate tolerance, the polynucleotide of the ALS inhibitor tolerance polypeptide of perhaps encoding, and wherein said polynucleotide are operably connected to

(a) in plant, drive expression promoter; With

(b) enhancer sequence that provides among the SEQ ID NO:1,72,85,88 or 89 or at least one copy of having the enhancer sequence of at least 90% sequence identity with SEQ ID NO:1,72,85,88 or 89, wherein said enhancer sequence is regulated and is transcribed, and described enhancer sequence and described promotor are allogenic;

Wherein said expression cassette is given glyphosate tolerant or the ALS inhibitor tolerance of the plant that contains it, glyphosate or ALS inhibitor that wherein said plant tolerance is used with certain level, the effective inhibition of described level does not contain the growth of the control plant of described expression cassette.

77. the expression cassette of claim 76, the polynucleotide encoding glyphosate-N-acetyl-transferase of wherein said conferring glyphosate tolerance.

78. the expression cassette of claim 76, the polynucleotide encoding glyphosate tolerant 5-enol acetonyl shikimic acid-3-phosphate synthase or the glyphosate tolerant glyphosate oxidoreductase of wherein said conferring glyphosate tolerance.

79. each expression cassette of claim 76-78, wherein said polynucleotide are operably connected on three copies of the enhancer sequence that provides among the SEQ ID NO:72 at least.

80. each expression cassette of claim 76-79, wherein said promotor is the ubiquitin promotor.

81. each expression cassette of claim 76-79, wherein said enhanser and described promotor are allogenic.

82. the expression cassette of claim 81, wherein said promotor are Arabidopis thaliana ubiquitin promotor or corn ubiquitin promotor.

83. each expression cassette of claim 76-83, wherein said polypeptide comprises the sequence that provides among the SEQ IDNO:45.

84. each expression cassette of claim 76-83, wherein said expression cassette comprise the polynucleotide of conferring glyphosate tolerance and the polynucleotide of coding ALS inhibitor tolerance polypeptide.

86. the expression cassette of claim 76 or 84, wherein said ALS inhibitor tolerance polypeptide comprises HRA.

87. select the method for the cotton that second kind of polynucleotide with first kind of polynucleotide of first peptide species of coding conferring glyphosate tolerance and coding ALS inhibitor tolerance polypeptide transform, described method comprises that the cotton healing tissue that will transform is being exposed to the step of growing under glyphosate and/or the ALS inhibitor weedicide.

88. the method for claim 87, wherein the described polypeptide of conferring glyphosate tolerance comprises GAT, and described ALS inhibitor tolerance polypeptide comprises HRA.

89. the method for claim 88, wherein to contain concentration be to grow under the grand substratum of 50-200 micrograms per litre chlorine sulphur being exposed to described callus.

90. the method for claim 88 is wherein grown described callus being exposed to contain under the substratum of concentration up to the glyphosate of 450 μ M.

91. method for weed in the control cultivation area, it comprises

A) field planting crop seed or plant, this crop seed or plant comprise

I) first kind of polynucleotide, but the polypeptide of its coding conferring glyphosate tolerance, these polynucleotide are operably connected in described plant on the promoters active; With

Ii) second kind of polynucleotide, its coding ALS inhibitor tolerance polypeptide, these polynucleotide are operably connected in described plant on the promoters active;

B) weedicide that significant quantity is used in seed or its cultivation area of described crop, crop part, described crop, wherein said significant quantity is tolerated and controls weeds by crop, wherein said weedicide is not glyphosate, chlorimuronethyl, rimsulfuron 25, tribenuron-methyl or thiameturonmethyl.

92. the method for claim 91, wherein said weedicide is selected from

(i) sulfonyl amino carbonyl Triazolinones;

(ii) triazolo pyrimidine;

(iii) pyrimidyl (sulfo-) phenylformic acid;

(iv) imidazolone;

(v) triazine; With

(vi) phospho acid.

93. control contains the method for weed in the field of crop, it comprises

A) this field planting crop seed or plant, this crop seed or plant comprise

I) first kind of polynucleotide, but the polypeptide of its coding conferring glyphosate tolerance; With

Ii) second kind of polynucleotide, its coding ALS inhibitor tolerance polypeptide;

B) any crop in field and weeds are used the first kind of weedicide that contains the ALS inhibitor of significant quantity and at least a extra agriculture medicament of significant quantity, described agriculture medicament is selected from mycocide, nematocides, insecticide, safener or adjuvant,

The described significant quantity of wherein said ALS inhibitor weedicide is tolerated by described crop; With

The described significant quantity of wherein said combination is not expressed described first kind of control plant with described second peptide species to tolerate.

94. the method for claim 93 is wherein carried out step (b) at least once before in step (a).

95. improve transformation efficiency, increase single method that copies the integration incident or increase the conversion effect of plant, it comprises:

A) in plant, introduce box, this box comprises the polynucleotide of polypeptide of coding conferring glyphosate tolerance or the polynucleotide of coding ALS inhibitor tolerance polypeptide, wherein said polynucleotide are operably connected in the described plant on the promoters active, and be operably connected to the enhancer sequence that provides among the SEQID NO:1,72,85,88 or 89 or have at least one copy of enhancer sequence of at least 90% sequence identity with SEQ ID NO:1,72,85,88 or 89, wherein said sequence can be regulated and be transcribed;

B) described plant is contacted with the suitable weedicide of effective concentration; With

C) plant of described polynucleotide is expressed in selection.

96. the method for claim 95, wherein said box also comprises polynucleotide of interest.

97. the method for claim 95 or 96, the polypeptide of wherein said conferring glyphosate tolerance comprises the GAT polypeptide, or described ALS inhibitor tolerance polypeptide comprises HRA.

98. the control method for weed, it comprises

A) plantation crop seed or plant in the zone, its expression

I) first kind of polynucleotide sequence, but the polypeptide of its coding conferring glyphosate tolerance;

With

Ii) second kind of polynucleotide sequence, its coding ALS inhibitor tolerance polypeptide;

B) weedicide that significant quantity is used in seed or the cultivation area of described crop, crop part, described crop, wherein said significant quantity comprises

I) when being applied to first kind of contrast crop, crop part, seed or cultivation area not by the amount of first kind of contrast crop tolerance, wherein said first kind of contrast crop expressed first kind of polynucleotide of conferring glyphosate tolerance and do not expressed second kind of polynucleotide of coding ALS inhibitor tolerance polypeptide;

Ii) when being applied to second kind of crop, crop part, seed or cultivation area not by the amount of second kind of contrast crop tolerance, wherein said second kind of contrast crop expressed described second kind of polynucleotide and do not expressed first kind of polynucleotide; With

The iii) amount that when the crop that is applied to step b), crop part, seed or its cultivation area, is tolerated.

99. method for weed in the control cultivation area, it comprises:

A) envrionment conditions in the assessment cultivation area;

B) significant quantity of selection weedicide, wherein the significant quantity of this weedicide comprises:

I) when being applied to first kind of contrast crop, crop part, seed or cultivation area not by the amount of first kind of contrast crop tolerance, wherein said first kind of contrast crop expressed first kind of polynucleotide of conferring glyphosate tolerance and do not expressed second kind of polynucleotide of coding ALS inhibitor tolerance polypeptide;

Ii) when being applied to second kind of crop, crop part, seed or cultivation area not by the amount of second kind of contrast crop tolerance, wherein said second kind of contrast crop expressed described second kind of polynucleotide and do not expressed first kind of polynucleotide; With

The iii) amount that when being applied to purpose crop, crop part, seed or its cultivation area, is tolerated, but wherein said purpose crop is expressed first kind of polynucleotide sequence of the polypeptide of coding conferring glyphosate tolerance; Second kind of polynucleotide sequence with coding ALS inhibitor tolerance polypeptide;

C) purpose crop, purpose crop part, weeds or its cultivation area are used the described weedicide of significant quantity.

100. method for weed in the control cultivation area, this method comprises:

A) at this ecological region planting crop seed or crop plants, wherein this crop seed or crop plants comprise:

I) first kind of polynucleotide, but the polypeptide of its coding conferring glyphosate tolerance, these polynucleotide are operably connected in described crop seed or crop plants on the promoters active; With

Ii) second kind of polynucleotide, its coding ALS inhibitor tolerance polypeptide, these polynucleotide are operably connected in described crop seed or crop plants on the promoters active; With

B) to the herbicidal composition of arbitrary crop, crop part, weeds, cultivation area or its applied in any combination significant quantity; said composition comprises at least a of the glyphosate of cooperative effective quantity and cooperative effective quantity sulfonylurea weedicide; or its agriculture suitable salt, wherein at least a:

I) cooperative effective quantity of glyphosate is lower than the amount of controlling the required glyphosate of weeds when not having the sulfonylurea weedicide;

Ii) the cooperative effective quantity of sulfonylurea weedicide is lower than the amount of the required sulfonylurea weedicide of the control of glyphosate when not existing weeds; With

Iii) its combination; With

Wherein the significant quantity of this herbicidal composition is by the weeds in crop seed or crop plants tolerance and the control cultivation area.

101. the method for claim 100, wherein first kind of polynucleotide encoding glyphosate-N-acetyl-transferase.

102. the method for claim 100 or 101, wherein ALS inhibitor tolerance polypeptide comprises the mutant acetolactate synthase polypeptide that contains HRA.

103. claim 100,101 or 102 method, wherein the sulfonylurea weedicide is selected from metsulfuronmethyl, chlorine sulphur is grand and triasulfuron.

104. claim 100,101,102 or 103 method, wherein

Described glyphosate before appearance, the back appears or occur before and occur after be applied to weeds or crop plants; With

Described sulfonylurea weedicide before appearance, the back appears or occur before and occur after be applied to weeds or crop plants.

105. each method of claim 100-104, wherein glyphosate and sulfonylurea weedicide are used together or are separately used.

106. the method for claim 100 is wherein carried out step (b) once before at least in step (a).

107. each method of claim 100-106, wherein said herbicidal composition comprises the adjuvant based on ammonium sulfate.

108. the method for claim 107, wherein said herbicidal composition comprise 2-pyrimidinyl oxy (sulfo-) benzoic acid herbicides of significant quantity.

109. the method for claim 108, wherein 2-pyrimidinyl oxy (sulfo-) benzoic acid herbicides comprises two careless ethers or its agriculture suitable salt.

110. claim 54,58,61,91,93,98 or 100 method, wherein said crop plants is a dicotyledons.

111. the method for claim 110, wherein said dicotyledons are soybean, rape, Sunflower Receptacle, cotton, clover, ornamental plant, fruit, vegetables, beet or Arabidopis thaliana.

112. claim 54,58,61,91,93,98 or 100 method, wherein said crop plants is a monocotyledons.

113. the method for claim 112, wherein said monocotyledons are corn, wheat, rice, barley, Chinese sorghum, sugarcane, switchgrass or rye.

Images