CN107982260A - VX-809 is preparing the application in treating Bartter syndrome medicines - Google Patents
VX-809 is preparing the application in treating Bartter syndrome medicines Download PDFInfo
- Publication number
- CN107982260A CN107982260A CN201711319868.8A CN201711319868A CN107982260A CN 107982260 A CN107982260 A CN 107982260A CN 201711319868 A CN201711319868 A CN 201711319868A CN 107982260 A CN107982260 A CN 107982260A
- Authority
- CN
- China
- Prior art keywords
- bartter
- syndromes
- pharmaceutically acceptable
- application according
- clc
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
- A61K31/4427—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems
- A61K31/443—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems containing a five-membered ring with oxygen as a ring hetero atom
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Life Sciences & Earth Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The present invention relates to biochemical pharmaceutical technology field, VX 809 is provided and is preparing the application in treating Bartter syndrome medicines, it is intended to treat Bartter syndromes, especially treats classic Bartter syndromes and a kind of new thinking is provided, expand the prospect for the treatment of Bartter syndromes.Also a kind of new medicament selection is provided for the especially classic Bartter syndrome patients of Bartter syndrome patients.Present invention demonstrates that compound VX 809 can significantly improve the expression of the ClC Kb protein mutants F283del entrained by classic Bartter syndrome patients (especially infant), there is provided new application of 809 compounds of VX in classic Bartter syndrome medicine of the treatment caused by ClC Kb protein mutants F283del is prepared.
Description
Technical field
The invention belongs to biochemical pharmaceutical technology field, and in particular to VX-809 is preparing treatment Bartter syndrome medicines
In application, especially VX-809 in classic Bartter syndromes medicine caused by CLCNKB gene defects is prepared should
With.
Background technology
Bartter syndromes (Bartter Syndrome, BS) are that one group of clinical manifestation is low Potassium Metabolism alkalosis, kidney
Heredity renal tubule disease with the characteristics of plain angiotensiri system activation, blood pressure are normal or relatively low, mode of inheritance
Predominantly autosomal recessive inheritance.The disease incidence is about 19/1000000, and all over the world and all races have been reported that, female
Property is more than male, make a definite diagnosis it is earliest in gestational age 20 weeks, the latest to 50 years old.This disease is common in children, and symptom occur before 5 years old accounts for
It is more than half.The pathogenesis of Bartter syndromes is mainly caused by the gene mutation of control renal tubule ion channel, according to current
Known gene mutation is classified as I~V-type Bartter syndromes and Gitelman syndromes.Type III Bartter syndromes
I.e. classic Bartter syndromes (Classical Bartter Syndrome, cBS) (OMIM, #607364) are more than infancy
Or children early stage fall ill, often show as diuresis, polydipsia, enuresis nocturna increase, myasthenia, thermophilic salt, dehydration, can with vomiting and constipation, urinate
Calcium is normal or slightly increases, and generally can not have pregnancy period hydramnion and premature labor history with kidney calcification, part infant.
Classic Bartter syndromes are caused by CLCNKB gene defects, the valtage-gated chloride channel of the gene code
PROTEIN C lC-Kb, is distributed mainly on medullary loop ascending branch butt end, distal tubule, connection tubule, the basement membrane side of concetrated pipe intercalary cells, is responsible for
Mediate Cl-Transhipment in basilar memebrane side.The C1C-Kb protein inactivations that it is encoded after CLCNKB gene mutations, make ascending thick limb of Henle's loop
Epithelial cell basilar memebrane side Cl-Discharge is reduced, so as to influence teleblem side Na+-K+-2Cl-Cotransport sub transport function, makes NaCl
Reabsorption seriously reduces, and electrolyte disturbance and extracellular fluid capacity deficiency, stimulate insulin resistance aldosterone axis
Activation, blood prostaglandin E increase, and cause hypopotassaemia, stimulate H+Secretion, causes metabolic alkalosis.
Classic Bartter syndromes can not effect a radical cure, at present with potassium chloride and can use in conjunction cyclooxygenase-2 inhibitors such as
Indomethacin etc., to suppress the generation of kidney prostaglandin.But therapeutic effect is not still very good, such as Long-term taking medicine
The problems such as compliance is poor, side effects of pharmaceutical drugs and lifelong treatment are instructed, severe electrolyte, kidney calcium occurs in some patientss
Change, infect, growth and development sluggishness, renal insufficiency even threat to life, seriously affecting the quality of life of patient.Therefore develop new
The classic Bartter syndromes of drug therapy, improve infant health it is very necessary.
VX-809 compounds (Lumacaftor) are a kind of CF transmembrane conductance conditioning agent (cystic
Fibrosis transmemebrane conductance regulator, CFTR), its molecular formula is C24H18F2N2O5, structure
Formula is as follows：
CFTR albumen is a kind of surface epithelial cell chloride channel for being present in a variety of organs.2015, U.S. FDA approval
The compound medicine of VX-809 and VX-770 (ivacaftor) is used for the cystic fibrosis (CF) for carrying F508del mutation in >=12 years old
Infant.The result of F508del mutation can cause CFTR protein Misfoldings, cause processing and the trafficking defect of cell, cause
Target protein is degraded, and reduces the quantity of cell surface CFTR.Have no that VX-809 is used for Bartter syndromes at present, especially pass through
The relevant report of typical Bartter syndromes.
The content of the invention
In view of the deficiencies of the prior art, the present invention provides VX-809 answering in treatment Bartter syndrome medicines are prepared
With, it is intended that a kind of new thinking is provided to treat Bartter syndromes, especially treating classic Bartter syndromes, is expanded
Treat the prospect of Bartter syndromes.
To achieve the above object, the present invention provides following technical solution：
On the one hand, the present invention provides a kind of compound VX-809 or its pharmaceutically acceptable salt and is preparing treatment
Application in Bartter syndrome medicines, the structural formula of the compound VX-809 are as follows：
Further, the Bartter syndromes include classic Bartter syndromes and Gitelman syndromes.
Further, the VX-809 or its pharmaceutically acceptable salt improve classic Bartter syndromes dependency basis
The protein expression level of cause.
Further, the VX-809 or its pharmaceutically acceptable salt improve the expression of ClC-Kb albumen.
Further, the VX-809 or its pharmaceutically acceptable salt improve classic Bartter syndrome patients institute
The expression of the ClC-Kb protein mutants F283del of carrying.
On the one hand, application of a kind of composition of present invention offer in treatment Bartter syndrome medicines are prepared, described group
Compound includes compound VX-809 or its pharmaceutically acceptable salt, and its pharmaceutically acceptable carrier；The compound
The structural formula of VX-809 is as follows：
Further, the composition further includes aldosterone antagonist class medicine, prostaglandin enzymatic synthesis inhibitor, blood vessel
Angiotensin Converting enzyme inhibitor, beta-blocker or cyclooxygenase-2 inhibitors etc..
Further, the cyclooxygenase-2 inhibitors include Indomethacin etc..Further, the aldosterone antagonist class
Medicine includes antisterone, triamterene etc..Further, the prostaglandin enzymatic synthesis inhibitor include brufen, Ah
Take charge of woods etc..Further, the angiotensin converting enzyme inhibitors include captopril, enalapril etc..
Further, the Bartter syndromes include classic Bartter syndromes and Gitelman syndromes.
Further, the composition improves the protein expression level of classic Bartter syndromes related gene.
Further, the composition improves the expression of ClC-Kb albumen.
Further, the composition improves the ClC-Kb protein mutations entrained by classic Bartter syndrome patients
The expression of body F283del.
Salt as term used herein " pharmaceutically acceptable salt " expression, in rational medical judgment scope
Interior, they are suitable for contacting with human body and lower animal tissue, without unsuitable toxicity, irritation, allergy etc., with
Rational interests/Hazard ratio matches." pharmaceutically acceptable salt " represents any non-toxic salts of the compounds of this invention VX-809
Or ester salt, once recipient is administered, it can directly or indirectly provide the compounds of this invention or the metabolism production of its inhibitory activity
Thing or residue.
Pharmaceutically acceptable salt is well known in the art.For example, S.M.Berge etc. is in J.Pharmaceutical
Sciences, is described in detail pharmaceutically acceptable salt in 1977,66,1-19, is referenced herein by reference.Chemical combination of the present invention
The pharmaceutically acceptable salt of thing includes derived from suitable inorganic and organic acid and alkali those.It is pharmaceutically acceptable nontoxic
Property acid-addition salts example be with inorganic acid or organic acid generation amino salt, inorganic acid for example hydrochloric acid, hydrobromic acid, phosphoric acid,
Sulfuric acid and perchloric acid, organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, butanedioic acid or malonic acid, or utilize
Other methods used in this area, such as the salt that ion exchange is formed.Other pharmaceutically acceptable salts include adipate, algae
Hydrochlorate, ascorbate, aspartate, benzene sulfonate, benzoate, disulfate, borate, butyrate, camphor hydrochlorate,
Camsilate, citrate, cyclopentane propionate, digluconate, lauryl sulfate, esilate, formates, richness
Horse hydrochlorate, glucoheptose salt, glycerophosphate, gluconate, Hemisulphate, enanthate, caproate, hydriodate, 2- hydroxyl second
Sulfonate, Lactobionate, lactate, laruate, lauryl sulfate, malate, maleate, malonate, first sulphur
Hydrochlorate, 2- naphthalene sulfonates, nicotinate, nitrate, oleate, oxalates, palmitate, pamoate, pectate, persulfuric acid
Salt, 3- phenylpropionic acids salt, phosphate, picrate, Pivalate, propionate, stearate, succinate, sulfate, winestone
Hydrochlorate, rhodanate, p- toluene fulfonate, undecanoate, valerate etc..From salt derived from appropriate alkali include alkali metal,
Alkaline-earth metal, ammonium and N+(C1-4Alkyl)4Salt.The present invention is also covered by any nitrogenous base of alkalescence of compound as disclosed in the present invention
The quaternization of group.Water-soluble oily or dispersible production in water or oil can be obtained by this kind of quaternization
Thing.Representative alkali or alkaline earth metal salt includes sodium, lithium, potassium, calcium, magnesium etc..When appropriate when, other are pharmaceutically acceptable
Salt include nontoxic ammonium salt, quaternary ammonium salt and amine cation salt, generated using counter ion counterionsl gegenions, such as halide, hydroxide, carboxylic
Hydrochlorate, sulfate, phosphate, nitrate, low-grade alkane sulfonate and arylsulphonate.
Composition additionally comprises pharmaceutically acceptable carrier, and as heretofore described, it includes being suitable for required
Any and all solvent, diluent or other liquid excipients of particular dosage form, scattered or suspension aids, surfactant, etc.
Penetration enhancer, thickening or emulsifying agent, preservative, solid binder, lubricant etc..Remington：The Science and
Practice of Pharmacy, 21stedition, 2005, ed.D.B.Troy, Lippincott Williams＆
Wilkins, Philadelphia, and Encyclopedia of Pharmaceutical Technology, eds,
J.Swarbrick and J.C.Boylan, 1988-1999, Marcel Dekker, New York, disclose for matching somebody with somebody pharmacy
The various carriers of acceptable composition and the known technology for its preparation on.Except any conventional carrier medium and this hair
Beyond bright compound is incompatible, such as produces any worthless biological effect or pharmacy is interacting at harmful way
Any other component of upper acceptable composition, its use are covered within the scope of the invention.Potentially act as and pharmaceutically may be used
Some examples of the material of the carrier of receiving include but not limited to ion-exchanger aluminium oxide aluminum stearate lecithin haemocyanin
Matter, such as seralbumin buffer substance, such as phosphate glycine sorbic acid or potassium sorbate saturated vegetable fatty acid are inclined
Glyceride mixture water salt or electrolyte, such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salt colloid
Silica magnesium trisilicate polyvinylpyrrolidone polyacrylate wax class polyethylene-polypropylene oxide-block polymer wool
Lipolysaccharide class, such as lactose, dextrose and saccharose starch, such as cornstarch and farina cellulose and its derivates, example
, such as can such as the bassora gum malt gelatin talcum excipient that sodium carboxymethylcellulose, ethyl cellulose and cellulose acetate crush
Can fat and suppository wax oil class, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil glycol,
Such as propane diols or polyethylene glycol esters, such as ethyl oleate and ethyl laurate agar buffer, such as magnesium hydroxide and hydrogen
The pyrogen-free water isotonic saline solution Ringer's solution ethanol phosphate buffer solution of aluminium oxide alginic acid and other are nontoxic compatible
Lubricant, such as NaLS and magnesium stearate be according to the judgement of formulation scientist, in the composition there may also be
Toner, releasing agent, coating agent, sweetener, flavor enhancement and spices, preservative and antioxidant.
The pharmaceutically acceptable composition that the present invention refers to can take orally people and other animals, rectum, parenteral, brain
In pond, in intravaginal, peritonaeum, local (by pulvis, ointment or drops), cheek, by mouth with or nasal spray etc. in a manner of be administered,
This depends on the seriousness for treating infection.In some embodiments, the compounds of this invention can be given by oral or parenteral
Medicine, dosage level are daily about 0.01mg/kg to about 50mg/kg, preferably from about 1mg/kg to about 25mg/kg subject's weight,
Once or several times a day, with the required therapeutic effect of acquisition.
Beneficial effects of the present invention：
The present invention provides a kind of new application of VX-809, VX-809 answering in treatment Bartter syndrome medicines are prepared
With, it is intended that for treatment Bartter syndromes, especially treat classic Bartter syndromes and a kind of new thinking is provided, expand
Treat the prospect of Bartter syndromes.Also carried for the especially classic Bartter syndrome patients of Bartter syndrome patients
For a kind of new medicament selection.Present invention demonstrates that VX-809 compounds can significantly improve classic Bartter syndrome patients
The expression of ClC-Kb protein mutants F283del entrained by (especially infant), there is provided compound VX-809 is making
New application in classic Bartter syndromes medicine of the standby treatment caused by ClC-Kb protein mutants F283del.The present invention
Experiment shows：VX-809 can increase the memebrane protein expression of ClC-Kb protein mutants F283del, improve the structure of mutant protein
As stability, so as to improve processing and transport maturation protein to cell surface, realize and classic Bartter syndromes are controlled
Treat.
Brief description of the drawings
In order to illustrate more clearly about the embodiment of the present invention or technical scheme of the prior art, below will be to embodiment or existing
There is attached drawing needed in technology description to be briefly described, it should be apparent that, drawings in the following description are only this
Some embodiments of invention, for those of ordinary skill in the art, without creative efforts, can be with
Other attached drawings are obtained according to these attached drawings.
The external HEK293 cells of Fig. 1 are overexpressed wild type ClC-KbWTAnd saltant type ClC-KbF283delRecombinant expression carrier
Expression compares.KZ in figure：Control.
Fig. 2 handles the detection of the film expression of wild type and F283del saltant types ClC-Kb in HEK293 cells with VX-809
As a result；A~B represents the film table of wild type and F283del saltant types ClC-Kb in various concentrations VX-809 processing HEK293 cells
The testing result reached；C~D is represented with wild type and F283del saltant types ClC- in 15umol VX-809 processing HEK293 cells
The testing result of Kb film expressions in different time points.
Embodiment
Below in conjunction with the attached drawing in the embodiment of the present invention, the technical solution in the embodiment of the present invention is carried out clear, complete
Site preparation describes, it is clear that described embodiment is only part of the embodiment of the present invention, instead of all the embodiments.It is based on
Embodiment in the present invention, those of ordinary skill in the art's all other embodiments obtained, belong to what the present invention protected
Scope.
Experiment reagent and material：
(1) cell：Human embryonic kidney cells (HEK293 cells) are provided by Shanghai life science institute.
(2) medicine：VX-809 is purchased from MCE companies of the U.S..
(3) recombinant expression carrier is built：Wild type expression vector pcDNA-3.1-CLCNKB-3xFlag is excellent precious raw by Changsha
Thing synthesis structure.Site-directed mutagenesis kit Mut Express II Fast Mutagenesis Kit V2, PCR amplification kit
LAmp DNA Polymerase, Competent cell DH5 α are purchased from Nanjing Nuo Weizan companies.
(4) cell culture and transfection：DMEM, FBS, 0.25%Trypsin-EDTA (1 ×), 1 × PBS, Penicillin-
Streptomycin Liquid (Gibco, the U.S.)；DMSO (Sigma, the U.S.)；Polyjet.
(5)Western-blot：Tris-base, SDS, glycine (Sinopharm Chemical Reagent Co., Ltd.)；Methanol,
Tween-20 (900,000,000 chemical reagent Co., Ltd of Shanghai, Shanghai)；RIPA lysates (strong), protease inhibitors (PMSF), BCA
Protein quantification kit, PAGE gel configuration kit, 5 × Loading Buffer (the green skies, Shanghai)；Memebrane protein and
Plasmosin extracts kit (Kai Ji, Nanjing)；Albumen Maker-PageRuler-Prestained Protein Ladder
(Thermo, the U.S.)；The anti-Flag monoclonal antibodies 1 in mouse source:3000 (Sigma, the U.S.)；The anti-Na in rabbit source+-K+- ATPase monoclonals
Antibody 1:3000 (Abcam, the U.S.)；Horseradish peroxidase (HRP) mark goat anti-rabbit igg, horseradish peroxidase (HRP)
Mark goat anti-mouse IgG (Zhong Shan Golden Bridge, Beijing)；Western Blot nitrite ions (Millipore, USA)；Skim milk
(BD, the U.S.).
In order to facilitate understand the present invention above-mentioned technical proposal, below by way of in specifically used mode to the present invention technology
Scheme is described in detail.
The bioinformatic analysis of CLCNKB gene mutations F283del
C.848_850delTCT (p.F283del) causes 283 phenylalanine (Phe) nothings to CLCNKB deletion mutants
Method encodes, which is located at transmembrane, and mutation may influence the chloride channel structure of ClC-Kb.Meanwhile protein
Conservative Analysis (http://consurf.tau.ac.il/) show that the 283rd isoleucine is highly conserved amino acid.
Embodiment 1
1、ClC-KbF283delIt is mutated construction of recombinant plasmid
(1) design of F283del point mutation primers is as follows：F:TCTTTTTTGTGGCGCTGGGGGGTCTCTGTGGCA R:
CCAGCGCCACAAAAAAGATCTCAGGCAGGTCGAAGG
(2) using fresh extractor wild plasmid DNA as template, target plasmid amplification is carried out, system and reaction condition are as follows：
PCR reaction conditions：
(3) amplified production Dpnl digests, and system is as follows：
After gently piping and druming mixes, 37 DEG C of constant temperature 2h are placed in.
(4) agarose gel electrophoresis：0.375g agar Icing Sugar is taken to add microwave stove heat in 0.5 × tbe buffer liquids of 25ml
It is completely dissolved to agarose, is cooled to about 50 DEG C, after adding the slow mixings of 2 μ l GelStain, is poured into plastic tank, treat 30min
Completely after solidification, extract comb, be put into electrophoresis tank, add appropriate 0.5 × tbe buffer liquid, take Dpn1 digest after product after PCR
Sample-adding is into sample well after adding appropriate 10 × loading buffer, adjusting voltage 120V progress electrophoresis, sample after about 30min
Behind electrophoresis to upper 2/3 position of glue, power off, electrophoresis result is observed under ultraviolet transilluminator.
(5) glue reclaim purifies：The gel-tape of 6.0kb PCR product fragments is cut under ultraviolet light, with Omega Gel
Extraction Kit carry out glue reclaim, and to specifications, 20 μ l of glue reclaim, recycling step is as follows：
A. 1.5ml centrifuge tube weight is weighed up in advance, glue is cut and is put into 1.5ml centrifuge tubes, weigh, by glue weight 1g/ml ratios
Example adds xp2buffer；
B.55 DEG C water-bath 7min, until glue melts completely, during which overturns mixing for several times, takes out vortex centrifugal pipe 3min；
C. pillar is sleeved in 2ml collecting pipes, sol solution is added in column, 10000g room temperatures centrifugation 1min, abandons liquid；
D. 300 μ l xp2buffer, 10000g room temperatures centrifugation 1min is added, abandons liquid；
E. 700 μ l spw wash buffer, 10000g room temperatures centrifugation 1min is added, liquid is abandoned, is repeated once；
f.>13000g room temperatures sky is from pillar 2min, dry pillar；
G. pillar is put into new 1.5ml centrifuge tubes, is added 20 μ l Elution buffer to pillar center, is stood
2min, 10000g room temperature centrifuge 1min, elute DNA, after complete concentration and purity to be detected, are stored in -20 DEG C.
(6) recombining reaction system：
Piping and druming mixes and (avoids producing bubble), is immediately placed on after 37 DEG C of reaction 30min in ice-water bath and cools down 5min.
(7) convert：
A. above-mentioned 20 μ l of connection product are taken to be added to 200 μ l competent cell DH5 α, ice bath 30min after mixing, 42 DEG C of water
Bathe heat shock 90s, ice bath 3min；
B. mixture is all added in the LB fluid nutrient mediums of 900 μ l antibiotic-frees, 37 DEG C of 200rpm shake bacterium
60min；
C. take each 50 μ l of IPTG of the X-gal and 25mg/ml of 50mg/ml mix after even spread contain 50mg/L cards that be mould
On the LB solid medium tablets of element, just putting 60min for 37 DEG C and fully absorbing to liquid；
D. after the centrifugations of the bacterium solution 12000rpm/s after bacterium 1min will be shaken, supernatant is abandoned, with 100 μ l of nonreactive LB fluid nutrient mediums weights
Be uniformly coated on after outstanding it is above-mentioned it is ready containing kanamycins, X-gal, IPTG LB solid medium tablets on；
E.37 after DEG C just putting culture medium until bacterium solution absorbs completely, 37 DEG C of inversion overnight incubations；
(8) screening and identification of recombinant plasmid pcDNA-3.1-CLCNKB-3xFlag
A. each sample is each from the solid medium tablet with monoclonal selects 5 white colonies at random, is seeded in
1ml contains in 50mg/ml kanamycins LB fluid nutrient mediums, and 37 DEG C, 200rpm shakes bacterium and stays overnight；
B. every part of bacterium solution takes 500 μ l to send Hua Da Gene science company to be sequenced, and remainder is placed on 4 DEG C of preservations, waits sequencing result；
C. select the correct bacterium solution of sequencing and be transferred in the LB fluid nutrient mediums of the new kalamycin resistances of 5ml 37 DEG C,
200rpm shakes bacterium and stays overnight, and adds sterile glycerol to packing after 15% and is stored in -80 DEG C.
2nd, external HEK293 cells are overexpressed wild type ClC-KbWTAnd saltant type ClC-KbF283delRecombinant expression carrier
After recovery HEK293 cells, inoculation 2 × 105A cell is into 6 porocyte culture plates, 37 DEG C, 5%CO2Under the conditions of train
When supporting cell to density close to 60%, use plasma-free DMEM medium instead and carry out plasmid transfection.Recommend to operate according to transfection reagent
Flow, takes 100 μ l DMEM and 7.5 μ l Polyjet transfection reagents to mix, then takes 100 μ l DMEM culture mediums and 2.5 μ g unloaded
PcDNA-3.1-3xFlag plasmids, wild type ClC-KbWTAnd saltant type ClC-KbF283delRecombinant expression carrier mixes respectively, will
Above-mentioned two pipes mixture is incubated 15 minutes under room temperature after mixing.200 μ l mixtures are added into each culture hole, 37 DEG C,
5%CO2Under the conditions of culture 4 it is small when after, replace complete medium (DMEM containing 10%FBS).37 DEG C, 5%CO2After cultivating 48h,
Give and collect the follow-up Western Blot experiments of cell progress.Each hole cell is collected, after extracting epicyte protein, is passed through
Western Blot detect the protein expression of ClC-Kb, it turns out that F283del saltant type ClC-Kb protein expressions are compared with wild type
It is decreased obviously (see Fig. 1).
3rd, the wild type ClC-Kb that VX-809 is overexpressed external HEK293 cellsWTAnd saltant type ClC-KbF283delShadow
Ring
Drug concentration gradient is set：Transfect 24 it is small when after, discard complete medium (DMEM containing 10%FBS), use 2ml instead
Plasma-free DMEM medium, is often separately added into 0,1 μ l, 2 μ l, 3 μ l, 10 μm of ol VX-809 mother liquors of 4 μ l, 8 μ l, make every in hole
Hole medicine final concentration is respectively 0,5 μm of ol, 10 μm of ol, 15 μm of ol, 20 μm of ol, 40 μm of ol.37 DEG C are placed in, 5%CO2Under the conditions of train
Support 24 it is small when after terminate culture, collect cell and carry out follow-up Western Blot detections.Experimental result is shown.VX-809 can be shown
The film expression of wild type and F283del saltant types ClC-Kb in increase HEK293 cells are write, in concentration gradient dependence (see figure
2A,B)。
Medicine time gradient is set：Discard complete medium after transfection 0,12h, 24h, 36h, 48h respectively per hole and (contain
The DMEM of 10%FBS), use 2ml plasma-free DMEM mediums instead, add 4 μ l VX-809 mother liquors, make final concentration of 15 μ of medicine
Mol, is respectively 0,12h, 24h, 36h, 48h per hole drug treating time, and when transfection 48 is small, latter termination is cultivated, and is collected
Cell carries out follow-up Western Blot detections.Experimental result shows that VX-809 can dramatically increase wild type in HEK293 cells
The expression of ClC-Kb, and be in time gradient dependence (see Fig. 2 C, D).
Basic principle, main feature and the advantages of the present invention of the present invention has been shown and described above.The technology of the industry
Personnel are it should be appreciated that the present invention is not limited to the above embodiments, and the above embodiments and description only describe this
The principle of invention, various changes and modifications of the present invention are possible without departing from the spirit and scope of the present invention, these changes
Change and improvement all fall within the protetion scope of the claimed invention.The claimed scope of the invention by appended claims and its
Equivalent defines.
Claims (10)
1. a kind of compound VX-809 or its pharmaceutically acceptable salt answering in treatment Bartter syndrome medicines are prepared
With, it is characterised in that the structural formula of the compound VX-809 is as follows：
2. application according to claim 1, it is characterised in that it is comprehensive that the Bartter syndromes include classic Bartter
Simulator sickness and Gitelman syndromes.
3. application according to claim 2, it is characterised in that the VX-809 or its pharmaceutically acceptable salt improve warp
The protein expression level of typical Bartter syndromes related gene.
4. application according to claim 2, it is characterised in that the VX-809 or its pharmaceutically acceptable salt improve
The expression of ClC-Kb albumen.
5. application according to claim 2, it is characterised in that the VX-809 or its pharmaceutically acceptable salt improve warp
The expression of ClC-Kb protein mutants F283del entrained by typical Bartter syndrome patients.
6. a kind of composition is preparing the application in treating Bartter syndrome medicines, it is characterised in that the composition includes
Compound VX-809 or its pharmaceutically acceptable salt, and its pharmaceutically acceptable carrier；The compound VX-809's
Structural formula is as follows：
7. application according to claim 6, it is characterised in that the composition further include aldosterone antagonist class medicine,
Prostaglandin enzymatic synthesis inhibitor, angiotensin converting enzyme inhibitors, beta-blocker or cyclooxygenase-2 inhibitors.
8. application according to claim 6, it is characterised in that it is comprehensive that the Bartter syndromes include classic Bartter
Simulator sickness and Gitelman syndromes.
9. application according to claim 8, it is characterised in that the composition improves classic Bartter syndromes phase
The protein expression level of correlation gene.
10. application according to claim 8, it is characterised in that the composition improves classic Bartter syndromes and suffers from
The expression of ClC-Kb protein mutants F283del entrained by person.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711319868.8A CN107982260A (en) | 2017-12-12 | 2017-12-12 | VX-809 is preparing the application in treating Bartter syndrome medicines |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711319868.8A CN107982260A (en) | 2017-12-12 | 2017-12-12 | VX-809 is preparing the application in treating Bartter syndrome medicines |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107982260A true CN107982260A (en) | 2018-05-04 |
Family
ID=62035975
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711319868.8A Pending CN107982260A (en) | 2017-12-12 | 2017-12-12 | VX-809 is preparing the application in treating Bartter syndrome medicines |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107982260A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110507640A (en) * | 2019-07-19 | 2019-11-29 | 南京市儿童医院 | Application of the 4-phenylbutyrate sodium salt in preparation treatment I type Bartter syndrome drug |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102665715A (en) * | 2009-10-22 | 2012-09-12 | 沃泰克斯药物股份有限公司 | Compositions for treatment of cystic fibrosis and other chronic diseases |
| CN102917692A (en) * | 2010-04-07 | 2013-02-06 | 弗特克斯药品有限公司 | Pharmaceutical compositions of 3-(6-(1-(2,2-difluorobenzo[d][1,3]dioxol-5-yl) cyclopropanecarboxamido)-3-methylpyriodin-2-yl)benzoic acid and administration thereof |
| CN102933206A (en) * | 2010-04-07 | 2013-02-13 | 弗特克斯药品有限公司 | Solid forms of 3-(6-(1-(2,2-difluorobenzo[d][1,3]dioxol-5-yl) cyclopropanecarboxamido)-3-methylpyridin-2-yl)benzoic acid |
| US20170304287A1 (en) * | 2016-04-25 | 2017-10-26 | Druggability Technologies Ip Holdco Limited | Pharmaceutical combination composition comprising complex formulations of ivacaftor and lumacaftor and their salts and derivatives, process for their preparation thereof and pharmaceutical compositions containing them |
-
2017
- 2017-12-12 CN CN201711319868.8A patent/CN107982260A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102665715A (en) * | 2009-10-22 | 2012-09-12 | 沃泰克斯药物股份有限公司 | Compositions for treatment of cystic fibrosis and other chronic diseases |
| CN102917692A (en) * | 2010-04-07 | 2013-02-06 | 弗特克斯药品有限公司 | Pharmaceutical compositions of 3-(6-(1-(2,2-difluorobenzo[d][1,3]dioxol-5-yl) cyclopropanecarboxamido)-3-methylpyriodin-2-yl)benzoic acid and administration thereof |
| CN102933206A (en) * | 2010-04-07 | 2013-02-13 | 弗特克斯药品有限公司 | Solid forms of 3-(6-(1-(2,2-difluorobenzo[d][1,3]dioxol-5-yl) cyclopropanecarboxamido)-3-methylpyridin-2-yl)benzoic acid |
| US20170304287A1 (en) * | 2016-04-25 | 2017-10-26 | Druggability Technologies Ip Holdco Limited | Pharmaceutical combination composition comprising complex formulations of ivacaftor and lumacaftor and their salts and derivatives, process for their preparation thereof and pharmaceutical compositions containing them |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110507640A (en) * | 2019-07-19 | 2019-11-29 | 南京市儿童医院 | Application of the 4-phenylbutyrate sodium salt in preparation treatment I type Bartter syndrome drug |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hashimoto et al. | Phencyclidine-induced cognitive deficits in mice are improved by subsequent subchronic administration of the glycine transporter-1 inhibitor NFPS and D-serine | |
| Bell et al. | Effects of dibutyryl cyclic adenosine 3′, 5′-monophosphate and parathyroid extract on calcium and phosphorus metabolism in hypoparathyroidism and pseudohypoparathyroidism | |
| WO2023040426A1 (en) | Formula of probiotics and metabolites thereof for alleviating metabolic syndromes, and use thereof | |
| Batlle et al. | Hyperkalemic forms of renal tubular acidosis: clinical and pathophysiological aspects | |
| CN105358172A (en) | Secretagogues derived from oxalobacter formigenes | |
| BRPI0714155A2 (en) | use of a dissociated glucocorticoid receptor agonist (digra), a prodrug thereof, or a pharmaceutically acceptable salt thereof | |
| WO2023173899A1 (en) | Bacillus coagulans for ameliorating constipation and application thereof | |
| JP2022088410A (en) | Asprosin, fast-induced glucogenic protein hormone | |
| CN107982260A (en) | VX-809 is preparing the application in treating Bartter syndrome medicines | |
| Wu et al. | Effect and mechanism of ShiZhiFang on uric acid metabolism in hyperuricemic rats | |
| WO2006118212A1 (en) | Agent for preventing and treating pancreatitis | |
| CN107661481B (en) | Medicament for treating tinnitus and application thereof | |
| WO2023155936A2 (en) | New use of zwitterionic capsular polysaccharide and/or modified zwitterionic capsular polysaccharide of bacteroides fragilis | |
| WO2024016996A1 (en) | Use of naphthoquine phosphate in preparation of medicament for treating autoimmune diseases | |
| Chung et al. | Estrogenic effects of a Kampo formula, Tokishakuyakusan, in parous ovariectomized rats | |
| CN107812003A (en) | VX 809 is preparing the application in treating progressive progressive familial intrahepatic cholestasis medicine | |
| Omodamiro et al. | Evaluation of anti-inflammatory and diuretic effects of ethanol leaf extract of piper guineense on wistar albino rats | |
| TW201701890A (en) | Yeast extract having vasorelaxing effect | |
| Penkova et al. | Serotonin-producing cells in human gastric mucosa-immunohistochemical and electron microscopic study | |
| Dromgoole et al. | Availability of salicylate from salsalate and aspirin | |
| CN103417565B (en) | The application of depolymerization glycosaminoglycan extracted from sea cucumber in preparation control thrombotic diseases medicine | |
| Geng et al. | Establishment and evaluation of a mouse model of affective disorder combined with atherosclerosis. | |
| Zeng et al. | Mechanism of the diuretic activity of Descurainia sophia seed | |
| CN113009127B (en) | Application of biosensor combined protein immune response method in detecting schizandrin A treating oligospermia signal path | |
| CN108888652A (en) | A kind of renal lobe beggarweed alcohol extract and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180504 |