CN107661481B - Medicament for treating tinnitus and application thereof - Google Patents

Medicament for treating tinnitus and application thereof Download PDF

Info

Publication number
CN107661481B
CN107661481B CN201711160103.4A CN201711160103A CN107661481B CN 107661481 B CN107661481 B CN 107661481B CN 201711160103 A CN201711160103 A CN 201711160103A CN 107661481 B CN107661481 B CN 107661481B
Authority
CN
China
Prior art keywords
parts
tinnitus
group
root
medicine
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201711160103.4A
Other languages
Chinese (zh)
Other versions
CN107661481A (en
Inventor
孙勤国
江波
吕琨
罗蒙
郭乃燕
徐鸿婕
杨倩
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Wuhan Third Hospital
Original Assignee
Wuhan Third Hospital
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Wuhan Third Hospital filed Critical Wuhan Third Hospital
Priority to CN201711160103.4A priority Critical patent/CN107661481B/en
Publication of CN107661481A publication Critical patent/CN107661481A/en
Application granted granted Critical
Publication of CN107661481B publication Critical patent/CN107661481B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/80Scrophulariaceae (Figwort family)
    • A61K36/804Rehmannia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K33/00Medicinal preparations containing inorganic active ingredients
    • A61K33/24Heavy metals; Compounds thereof
    • A61K33/26Iron; Compounds thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/56Materials from animals other than mammals
    • A61K35/63Arthropods
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/25Araliaceae (Ginseng family), e.g. ivy, aralia, schefflera or tetrapanax
    • A61K36/258Panax (ginseng)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/39Convolvulaceae (Morning-glory family), e.g. bindweed
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/40Cornaceae (Dogwood family)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/43Cuscutaceae (Dodder family), e.g. Cuscuta epithymum or greater dodder
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/48Fabaceae or Leguminosae (Pea or Legume family); Caesalpiniaceae; Mimosaceae; Papilionaceae
    • A61K36/488Pueraria (kudzu)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/53Lamiaceae or Labiatae (Mint family), e.g. thyme, rosemary or lavender
    • A61K36/537Salvia (sage)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/60Moraceae (Mulberry family), e.g. breadfruit or fig
    • A61K36/605Morus (mulberry)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/69Polygalaceae (Milkwort family)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/85Verbenaceae (Verbena family)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/88Liliopsida (monocotyledons)
    • A61K36/884Alismataceae (Water-plantain family)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/88Liliopsida (monocotyledons)
    • A61K36/888Araceae (Arum family), e.g. caladium, calla lily or skunk cabbage
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/88Liliopsida (monocotyledons)
    • A61K36/906Zingiberaceae (Ginger family)
    • A61K36/9066Curcuma, e.g. common turmeric, East Indian arrowroot or mango ginger

Landscapes

  • Health & Medical Sciences (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Epidemiology (AREA)
  • Alternative & Traditional Medicine (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Medical Informatics (AREA)
  • Botany (AREA)
  • Biotechnology (AREA)
  • Engineering & Computer Science (AREA)
  • Inorganic Chemistry (AREA)
  • Insects & Arthropods (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The invention discloses a medicament for treating tinnitus, a preparation method and application thereof. The medicine is composed of the following raw materials in parts by weight: 10-20 parts of prepared rehmannia root, 10-20 parts of dogwood, 10-20 parts of mulberry fruit, 10-20 parts of dodder, 10-20 parts of turmeric root-tuber, 1-10 parts of polygala root, 5-15 parts of alisma orientale, 10-20 parts of grassleaf sweelflag rhizome, 10-20 parts of kudzuvine root, 5-15 parts of salvia miltiorrhiza, 10-20 parts of pseudo-ginseng, 20-40 parts of magnetite, 5-15 parts of chastetree fruit and 1-10 parts of cicada slou. Tinnitus rat cochlear SGN expression was increased in 5-HT1B and decreased in 5-HT 2C. It may generate antagonistic effect, thus balancing the suppression and excitation state of auditory system, and the subjective sound, i.e. the tinnitus is weakened or disappeared, which may become the experimental basis for relieving the tinnitus.

Description

Medicament for treating tinnitus and application thereof
Technical Field
The invention relates to the technical field of traditional Chinese medicines, in particular to a medicine for treating tinnitus and a preparation method and application thereof.
Background
With the increasing living environment and mental stress caused by the rapid development of modern society, tinnitus, deafness and vertigo are called as three major symptoms of the otology department and need to be solved urgently. In particular, tinnitus, which is a subjective symptom that gradually causes irritability, anxiety and depression, and anxiety in turn causes patients to become more sensitive to tinnitus, thus causing a vicious circle, is at issue, and the treatment of tinnitus, in which abnormal release of some neurotransmitters causes nerve spontaneous discharge activity, which is erroneously translated by the auditory center as a sound, has become a focus of research. Glutamate is the most important excitatory amino acid in the mammalian brain, and the NMDA receptor is the most prominent one of the glutamate receptors, of which the overexpression of the NMDA receptor subtypes 1, 2A and 2B has been increasingly shown to be involved in tinnitus development.
Tinnitus refers to the subjective perception of sound by an individual without external cues. The current prevailing view of pathogenesis is that the pathogenesis is originated from cochlea and formed in the center, and the central plasticity change causes tinnitus as the research focus. The plastic change of the central nervous system, namely the abnormal activity of the corresponding neuronal synapses of the central nervous system in the process of generating adaptive change to the adverse stimulation activity, finally causes the change of the synaptic ultrastructure of the cerebral auditory cortex and the functional recombination, and the phenomena of excessive release or redistribution of some neurotransmitter receptors are found in a rat tinnitus model, wherein the NMDA (N-methyl-D-aspartate) receptors including subtypes are interesting, and researches show that the NMDA receptors are expressed in the rat cochlear Spiral Ganglion Neurons (SGN), but the comprehensive analysis and quantitative expression of the NMDA receptor subtypes are few at present. 5-HT, also known as serotonin, is found as a neurotransmitter primarily in the pineal gland and hypothalamus. Plays an important role in a plurality of physiological functions of the body, including pain sense, sleep, body temperature and the like. 5-HT is an excitatory neurotransmitter, can promote arterial vasoconstriction and platelet aggregation, plays an important role in the pathogenesis of depression, and the depression and tinnitus are in mutual progressive relation, and although the neuron cell body of serotonin is positioned outside the auditory system, the nerve fiber terminal of the serotonin is widely positioned in most auditory nuclei of the central nervous system, such as a hypothalamus, a cochlear nucleus, an upper olive complex and the like, and plays a main role in regulating sound. Various 5-HT receptor subtypes, including 5-HT1B, 2C, have been shown to exist on cochlear helical ganglion neurons (SGNs). The most widely studied at present is the influence of the 5-HT1A receptor on the auditory pathway, while the 5-HT1B and 2C are rarely mentioned. Tinnitus refers to a sound which is subjectively present in the ear of a patient without external sound or electrical stimulation, and about 17% of the tinnitus experienced in European and American countries is reported in the literature to be more than 5 minutes, and 2% -5% of tinnitus of patients seriously affects life and work. In China, 10% of people experience tinnitus, 5% seek treatment, 2% affect life, and 0.5% are especially disabled due to severe tinnitus. With the increasing living environment and working pressure caused by the rapid development of modern society, tinnitus, deafness and vertigo are called as three major symptoms of the otology department and need to be solved urgently. Classical theory of traditional Chinese medicine and modern experimental research both tell us that tinnitus is closely related to kidney deficiency. Therefore, the study on the material basis of the tinnitus and the kidney deficiency has great significance for the modern research of the traditional Chinese medicine that the kidney opens into the ear. The trace elements are involved in important life activities of human body, especially the pathogenesis of nervous system diseases. In the research, a rat tinnitus model is established, and changes of contents of calcium, iron, phosphorus, cortisol, dopamine, cAMP, cGMP and the like in tinnitus rat blood are detected by adopting peripheral blood detection and an enzyme-linked immunosorbent assay. Thereby providing a relevant material basis for treating tinnitus by a prescription for tonifying kidney, promoting blood circulation, reducing phlegm and inducing resuscitation.
Disclosure of Invention
A large amount of clinical research work is carried out in the early stage, and the medicine provided by the invention is combined with the Yifeng acupoint to effectively relieve senile nervous tinnitus patients, so that the pathological pathogenesis theory of tinnitus patients centering on 'deficiency and stasis' is preliminarily established.
The medicine provided by the invention is combined with acupuncture on the nebula wind acupoint to effectively relieve senile nervous tinnitus patients, and the pathological pathogenesis theory of tinnitus patients with 'deficiency and stasis' as the center is preliminarily established.
The technical scheme adopted by the invention is as follows:
the invention relates to a medicament for treating tinnitus, which is prepared from the following raw materials in parts by weight: 10-20 parts of prepared rehmannia root, 10-20 parts of dogwood, 10-20 parts of mulberry fruit, 10-20 parts of dodder, 10-20 parts of turmeric root-tuber, 1-10 parts of polygala root, 5-15 parts of alisma orientale, 10-20 parts of grassleaf sweelflag rhizome, 10-20 parts of kudzuvine root, 5-15 parts of salvia miltiorrhiza, 10-20 parts of pseudo-ginseng, 20-40 parts of magnetite, 5-15 parts of chastetree fruit and 1-10 parts of cicada slou.
Preferably: the medicine of the invention is composed of the following raw materials by weight: prepared rehmannia root 15, dogwood 12, mulberry 12, dodder 12, curcuma aromatica 15, polygala tenuifolia 6, alisma 10, grassleaf sweelflag rhizome 12, kudzuvine root 12, salvia miltiorrhiza 10, pseudo-ginseng 12, magnetite 30, chastetree fruit 10 and cicada slough 6.
The medicine can be used for preparing a medicine for treating tinnitus, and the dosage form of the medicine is decoction, tablets, pills, capsules, oral liquid, injection, patches or soft extract.
The method for preparing the medicine of the invention is to prepare decoction by soaking, decocting, filtering and concentrating.
The invention has the following positive effects:
the medicine takes the prepared rehmannia root as a monarch drug, and has the effects of nourishing yin and blood, tonifying kidney and replenishing essence; the ministerial drugs comprise dogwood for tonifying liver and kidney, mulberry for nourishing yin and blood, and dodder for nourishing liver and kidney and replenishing essence; radix curcumae is used for assisting in promoting qi circulation and relieving depression, cooling blood and removing blood stasis, polygala root is used for soothing nerves and promoting intelligence, eliminating phlegm and reducing swelling, and rhizoma alismatis is used together with prepared rehmannia root for purging kidney turbidity; the rhizoma acori graminei can resolve phlegm and induce resuscitation; eliminating dampness and promoting qi circulation; the kudzuvine root, the salvia miltiorrhiza and the pseudo-ginseng have the functions of promoting blood circulation, removing blood stasis and dredging collaterals; magnetitum has effects of suppressing hyperactive liver, subsiding yang, invigorating kidney, nourishing yin, improving hearing and improving eyesight; the fructus viticis and the periostracum cicadae are used for dispelling wind and clearing heat, and the nature of dispelling wind and heat is adopted, so that the medicines are supplemented without stagnation. The medicines are combined to play the roles of tonifying kidney, activating blood circulation, eliminating phlegm and inducing resuscitation. The etiology of tinnitus is related to ischemia, anoxia, microcirculation disturbance of inner ear, and from the non-auditory system, it is related to emotion, memory and emotion, especially negative symptoms. The medicines all have the function of improving tinnitus from the modern pharmacology perspective. The prepared rehmannia root and the rhizoma alismatis can obviously inhibit activation of GM induced hair cell regional apoptosis enzymes Caspase-3 and Caspase-9 and up-regulate a BcL2/Bax protein expression ratio, thereby relieving hair cell apoptosis. The pueraria flavonid can expand blood vessels of brain and inner ear, regulate hair cell metabolism, and the dogwood polysaccharide can promote the recovery of various blood cells by improving the hematopoiesis of bone marrow. Rhizoma Acori Graminei, periostracum Cicadae, and Magnetitum all have effects of inhibiting central nervous system, relieving convulsion, and resisting convulsion. The acorus gramineus plays a role in oil and water decoction, the GABA content in the center can be possibly increased, Glu and 5-HT are reduced, the anxiolytic effect is achieved, alcohol extracts and water extracts of periostracum cicada can prolong the incubation period of convulsions of mice and prolong the death time of the mice with the convulsions, a large amount of iron elements are contained in the magnetite, cell membranes of cochlea parts can be overoxidized due to low iron, auditory nerve injury is caused, the tanshinone compounds and the panax notoginseng are saponins, and the volatile oil of the fructus viticis has the effects of resisting oxidation and improving microcirculation, so that the blood circulation and oxygen content of inner ears are increased, and the occurrence of tinnitus is reduced.
Tinnitus rat cochlear SGN expression was increased in 5-HT1B and decreased in 5-HT 2C. It may generate antagonistic effect, thus balancing the suppression and excitation state of auditory system, and the subjective sound, i.e. the tinnitus is weakened or disappeared, which may become the experimental basis for relieving the tinnitus. The NMDA receptor subtype 1, 2A and 2B sodium salicylate groups of each group are obviously reduced, the spontaneous discharge activity of nerves can be inhibited, and the overactivity of auditory cortex is weakened, so that the inhibition and excitation states of the auditory system are balanced, and the acoustic tinnitus is weakened or disappeared as a subjective sound, and the acoustic stimulation is possibly used as an experimental basis for relieving the tinnitus.
The experiment also finds that the tinnitus rat has reduced content of elements calcium and iron in blood, increased content of phosphorus, reduced levels of dopamine and plasma cortisol in blood, reduced cAMP, increased cGMP and reduced ratio of cAMP/cGMP. The kidney-tonifying, blood-activating, phlegm-reducing and resuscitation-inducing prescription can possibly increase the levels of calcium, iron, dopamine and cortisol hormones in blood, increase cAMP, reduce cGMP, improve kidney-yang deficiency and relieve tinnitus. Thereby providing partial hematology data support for the hematology related examination and improvement of tinnitus patients.
Drawings
FIG. 1 groups of cochlear spiral neurons 5-HT1B expression (DAB 400X)
Normal group B model group C carbamazepine group 5mg/kg D drug of the invention 7.5g/kg (low dose group) E drug of the invention 15g/kg (medium dose group) F drug of the invention 30g/kg (high dose group).
FIG. 2 sets of cochlear spiral neurons 5-HT2C (DAB 400X)
a normal group b model group c carbamazepine group 5mg/kg d drug of the present invention 7.5g/kg (low dose group) e drug of the present invention 15g/kg (medium dose group) f drug of the present invention 30g/kg (high dose group).
Figure 3 gel electrophoresis picture of each group of NMDARNR1, 2A, 2B protein.
Detailed Description
The following examples are further detailed descriptions of the present invention.
Example 1
The invention relates to a medicament for treating tinnitus, which is prepared from the following raw materials in parts by weight: 10 parts of prepared rehmannia root, 20 parts of dogwood fruit, 10 parts of mulberry fruit, 20 parts of dodder, 10 parts of turmeric root-tuber, 10 parts of polygala root, 10 parts of oriental waterplantain rhizome, 20 parts of grassleaf sweelflag rhizome, 10 parts of kudzuvine root, 15 parts of red-rooted salvia root, 10 parts of pseudo-ginseng, 40 parts of magnetite, 5 parts of chastetree fruit and 10 parts.
Example 2
The invention relates to a medicament for treating tinnitus, which is prepared from the following raw materials in parts by weight: prepared rehmannia root 20, dogwood 10, mulberry 20, dodder 10, curcuma aromatica 20, polygala root 6, alisma orientale 15, grassleaf sweelflag rhizome 10, kudzuvine root 20, salvia miltiorrhiza 6, pseudo-ginseng 20, magnetite 20, fructus viticis 15 and cicada slough 6.
Example 3
The invention relates to a medicament for treating tinnitus, which is prepared from the following raw materials in parts by weight: prepared rehmannia root 15, dogwood 12, mulberry 12, dodder 12, curcuma aromatica 15, polygala tenuifolia 6, alisma 10, grassleaf sweelflag rhizome 12, kudzuvine root 12, salvia miltiorrhiza 10, pseudo-ginseng 12, magnetite 30, chastetree fruit 10 and cicada slough 6.
EXAMPLE 4 Effect of the drug of the present invention on tinnitus rat cochlear ganglion neuron 5-HT1B, 2C
Test drugs the drug of the present invention is composed of prepared rehmannia root 15g, cornus officinalis 12g, mulberry fruit 12g, dodder seed 12g, curcuma aromatica 15g, polygala root 6g, alisma orientale 10g, grassleaf sweelflag rhizome 12g, kudzuvine root 12g, salvia miltiorrhiza 10g, notoginseng 12g, magnetite 30g, chastetree fruit 10g, cicada slough 6 g. The medicines are purchased in a traditional Chinese medicine room of a same-kernel hospital, and are soaked, decocted, filtered and concentrated by a traditional Chinese medicine method to prepare a decoction, wherein the low, medium and high dosage groups of the traditional Chinese medicine correspond to the crude drug quantity of 7.5g/kg, 15g/kg and 30g/kg, the carbamazepine tablet is vacuum-packaged and refrigerated at low temperature for standby, the carbamazepine tablet (Shanghai, China, West Sanxiong pharmaceutical industry Co., Ltd.), the sodium salicylate injection (sigma Co., Ltd.) and the normal saline injection (Sichuan Kelun pharmaceutical industry Co., Ltd.)
Animal healthy SPF grade male SD rats 60, 250(± 50) g in body weight, provided by experimental animal research center in north huo, license no: SCXK 2015-0018, raised in a sound insulation animal house with sound of each frequency less than 25dB (spl), the room temperature is about 20 ℃, and the relative humidity is 50% -60%.
The reagent HTR1B Antibody (Proteitech, cat # 22189-1-AP); SR-2C (Q437) polychlonability (biothorld, cat # BS 2766); biotinylated goat anti-rabbit lgG (Tujie organism, cat # BA 1003); DAB color development kit (doctor De biology, good number AR1022)
The method comprises the following steps of adaptively feeding in a sound-proof chamber for 1 week, keeping water for 2 days, starting to perform classical 'background noise stopping-drinking water reducing' conditioned reflex when the weight of the rat is reduced to 80% of the original weight, and randomly dividing 60 rats into six groups: the normal group is respectively provided with 2ml of normal saline for intragastric administration and intraperitoneal injection, the other groups are respectively provided with 10% of sodium salicylate solution for intraperitoneal injection according to 350mg/kg 3 hours before conditioned reflex training, the model group is provided with 2ml of normal saline for intragastric administration, the traditional Chinese medicine low-medium high dose group is provided with 1ml/100g of the weight of a rat for intragastric administration, the carbamazepine group is provided with 5mg/kg of normal saline for intragastric administration once a day, 2ml of normal saline is provided each time and is carried out in the same time period, the whole administration process lasts for 8 weeks, and water is only supplied within 30 minutes of a conditioning training period and after successful modeling during the molding period without fasting. Rats were placed in a sound-proof chamber (department of otorhinolaryngology, university of Hospital's college of Hospital, university of Huazhong science and technology, provided with a hearing test instrument using evoked potential instrument, speaker (Tucker-Davis-Technologies, USA), external speaker (Philips, China) power amplifier (TOMO, China)) with background white noise 70dB, noise software was a consecutive whitense, a sound level meter (TES-1351B, Taiwan Shi) pair, each rat was trained once a day for 30 minutes, the condition stimulation during training was a background white noise stop, occurred at 5, 10, 15, 20, 25 minutes of training, each time lasted for 1 minute, and when the background noise stopped, the animals licked water, i.e., given a 48V shock from the mouth of drinking water (220V to 24V,36V,48V AC-DC transformer (provided by Shanghai Tian percept), switched on-off control current (provided by Qing-eight-on appliance)), combining the unconditional stimulation of electric shock with the conditional stimulation of noise stop to form a 'background noise stop-drinking water reduction or stop' conditional reflex, shooting by a DV camera in the whole process, processing by related software, and recording the accumulated water licking time of each animal within 1min before and after the background white noise is closed. Recording water licking time 1min before closing background noise as A, recording water licking time 1min after closing background noise as B, reflecting the establishment of animal conditioned reflex by using water licking inhibition rate R/(A + B), wherein the R value of a rat is stabilized at about 0.5 before training, and the conditioned reflex is not established yet by the animal; after training, the R value gradually decreases, and when the R value is less than 0.2, the rat conditioned reflex is successfully established. And in the conditioned reflex extinction period (namely, no electric shock is carried out after the sound stops), if the R value is gradually returned to 0.5, the reflex extinction time of the model group and the blank group is different, and the molding is successful.
Taking materials, successfully molding, then administering to 8 weeks, taking materials 3 hours after last administration, operating the whole process on ice, performing intraperitoneal injection anesthesia on 10% chloral hydrate (5ml/kg), cutting off the head, taking the brain, putting bilateral temporal bones into PBS (phosphate buffer solution), opening an auditory bulb under a body microscope to remove a bony cochlea part, separating tissues such as a spiral ligament, a blood vessel vein, a basement membrane and the like, separating a spiral tube from a spiral shaft, and obtaining a tissue block of SGN (SGN).
The immunohistochemical method detects that the expression paraffin sections of 5-HT1B and 2C in the cochlea SGN are placed in a drying box with the temperature of 60 ℃ for preheating for 10 minutes, dewaxing is carried out for 5-10 minutes, the cochlea SGN is washed for 3-5 times by distilled water, residual ethanol is washed away, microwave antigen restoration is carried out after endogenous peroxidase is inactivated, the sections are soaked in Tris-EDTA antigen restoration liquid with the concentration of 0.01M and the pH value of 9.0, the sections are heated to boiling by medium fire in a microwave oven, the sections are kept for 2 minutes by low fire, and then the sections are heated for 5 minutes by low fire. And sealing after natural cooling, dripping 50 mu L of appropriately diluted primary antibody on each section, incubating for 2 hours at 37 ℃, washing for 3 minutes by 3 times by using PBS, incubating secondary antibody, dripping 50 biotin-labeled goat anti-mouse IgG working solution on each section, and incubating for 30 minutes at 37 ℃. PBS wash 3 minutes × 3 times. Incubating SABC, preparing DAB developing solution, preparing the DAB developing solution according to the specification of a DAB developing kit (AR1022) purchased from Boshide, preparing the prepared DAB developing solution in advance, and developing at room temperature. Counterstaining, mounting, observing under microscope and taking pictures.
Statistical method
Statistical analysis was performed using SPSS 22.0 statistical software. Normally distributed metric data and
Figure GDA0002402901530000102
represents; the measurement data of normal distribution are compared in pairs by adopting independent sample t test, p<0.05 is statistically different.
Of 60 mice in the experiment, 10 mice were blank control groups, 44 mice were successfully molded, and the molding success rate was 88%. Compared with the normal saline group, the extinction period of the water sample sodium group is obviously reduced, see table 1(t is-20.42, P is less than 0.01), which shows that rats are likely to confuse the tinnitus caused by sodium salicylate with the background sound, so that the rats drink more actively than the normal saline group after the background sound disappears in the extinction period, fear of a silent environment is eliminated more quickly, the extinction period of other groups is reduced compared with the normal saline group, and the difference has statistical significance (P is less than 0.01), thereby proving that the model building is successful.
TABLE 1 comparison of mean regressions for groups of rats
Figure GDA0002402901530000101
Figure GDA0002402901530000111
Represents P <0.05 compared with normal saline group
In each group (fig. 1, fig. 2), the spiral neurons showed a clear brown positive signal in the cytosol, indicating that 5-HT1B and 2C receptors were present in cochlear spiral ganglion neurons, 5-HT1B was significantly reduced in the sodium salicylate group compared to the saline group (fig. 1), 5-HT1B was significantly expressed in the traditional Chinese medicine group, especially the traditional Chinese medicine group, compared to the sodium salicylate group, whereas 5-HT2C was significantly increased in the sodium salicylate group compared to the saline group (fig. 2), and 5-HT2C was significantly reduced in the traditional Chinese medicine group, especially the traditional Chinese medicine group, compared to the sodium salicylate group. The amount group was significantly reduced.
The experiment shows that the 5-HT1B expression of the sodium salicylate group is obviously reduced compared with that of the normal saline group, the 5-HT2C is obviously increased, the 5-HT1B expression of each group of the formula for tonifying the kidney, promoting the blood circulation, reducing the phlegm and inducing resuscitation is increased, and the 5-HT2C is reduced. It may generate antagonistic effect, thus balancing the suppression and excitation state of auditory system, and the subjective sound, i.e. the tinnitus is weakened or disappeared, which may become the experimental basis for relieving the tinnitus.
Example 5 Effect of the drug of the present invention on NMDA receptor subtypes 1, 2A, 2B of cochlear ganglion neurons of tinnitus rat
Experimental animals healthy SPF-grade male SD rats 60, 250(± 50) g in body weight, provided by experimental animals research center in north huo, license no: SCXK 2015-0018, which is raised in a sound insulation animal house with sound of each frequency less than 25dB spl (sound pressure level), the room temperature is about 20 ℃, and the relative humidity is 50% -60%.
The medicine comprises 15g of prepared rehmannia root, 12g of dogwood fruit, 12g of mulberry fruit, 12g of dodder, 15g of turmeric root-tuber, 6g of polygala root, 10g of oriental waterplantain rhizome, 12g of grassleaf sweelflag rhizome, 12g of kudzuvine root, 10g of salvia miltiorrhiza, 12g of pseudo-ginseng, 30g of magnet, 10g of chastetree fruit and 6g of cicada slough. The medicines are purchased from a traditional Chinese medicine room in the same-kernel hospital, and are soaked, decocted, filtered and concentrated by a traditional Chinese medicine method to prepare a decoction. Wherein the low, medium and high dosage groups of the traditional Chinese medicine are equivalent to the crude drug amount of 7.5g/kg, 15g/kg and 30g/kg, the carbamazepine tablet (Shanghai, Zhongxi, Sanxiong, pharmaceutical industry Co., Ltd.), the sodium salicylate injection (sigma Co., Ltd.) and the normal saline injection (Sichuan Konlen, pharmaceutical industry Co., Ltd.).
Adaptively feeding in a molding sound-proof chamber for 1 week, stopping water for 2 days, and performing classical 'background noise stopping-drinking water reducing' conditioned reflex when the body weight is reduced to 80% of the original body weight[6]Reference to Jiaming brightness[7]The molding improvement scheme is as follows: the rats were placed in a sound-proof room (otorhinolaryngology department of college of medicine of university of science and technology of Huazhong providing hearing test instruments with 70dB background white noise using evoked potential instrument, speaker (Tucker-Davis-Technologies, USA), external speaker (Philips, China) power amplifier (TOMO, China)) with noise software asconsecutive white noise, calibrated by a sound level meter (TES-1351B, Taiwan Shi), each rat was trained once a day for a period of 30 minutes, the conditional stimulation during training was a background white noise stop, occurring at 5, 10, 15, 20, 25 minutes of training, respectively, each for 1 minute, when the background noise stops, the animals lick water, namely, a 48V electric shock is given from a drinking water mouth (220V is changed into a 24V,36V and 48V alternating current-direct current transformer (provided by Shanghai weather sensation) and a time control switch control current (provided by a Leqing eight-switch electric appliance)), so that the unconditional stimulation of the electric shock and the conditional stimulation of the noise stop are combined to form a conditioned reflex of 'background noise stop-drinking water reduction or stop', and the accumulated water licking time of each animal within 1min before and after the background white noise is closed is shot by a DV camera in the whole process and is recorded after the treatment of relevant software. Recording water licking time 1min before closing background noise as A, recording water licking time 1min after closing background noise as B, reflecting the establishment of animal conditioned reflex by using water licking inhibition rate R/(A + B), wherein the R value of a rat is stabilized at about 0.5 before training, and the conditioned reflex is not established yet by the animal; after training, the R value gradually decreases, and when the R value is less than 0.2, the rat conditioned reflex is successfully established. And in the conditioned reflex extinction period (namely, no electric shock is carried out after the sound stops), if the R value is gradually returned to 0.5, the reflex extinction time of the model group and the blank group is different, and the molding is successful.
Animals were grouped and dosed 60 rats were randomly divided into six groups: normal saline group, sodium salicylate group, Chinese medicinal formula (formula for invigorating kidney, promoting blood circulation, eliminating phlegm and inducing resuscitation), low, medium and high dosage groups, and carbamazepine group, wherein each group contains 10 drugs. The normal group is respectively administrated with 2mL of physiological saline for intragastric administration and intraperitoneal injection, the other groups are respectively administrated with 10% sodium salicylate solution 3 hours before the conditioned reflex training and are intraperitoneally injected according to 350mg/kg, the model group is administrated with 2mL of physiological saline for intragastric administration, the traditional Chinese medicine low-dosage and medium-dosage group is administrated with 1mL/100g of the weight of a rat, the carbamazepine group is administrated with 5mg/kg of physiological saline for intragastric administration once a day, 2mL is administrated every time, the whole administration process lasts for 8 weeks, and water is only supplied within 30 minutes of the conditioned training period and after the molding is successful during the molding period without fasting.
Taking materials 3 hours after the last administration, operating the whole process on ice, performing intraperitoneal injection anesthesia on 10% chloral hydrate (5ml/kg), cutting off the head, taking the bilateral temporal bones, putting the bilateral temporal bones into PBS (phosphate buffer solution), opening the auditory bulb under a body microscope to remove the bony cochlea part, separating tissues such as the spiral ligament, the blood vessel vein, the basement membrane and the like, separating the spiral tube from the spiral shaft, and obtaining the SGN tissue block.
Detection index and method
Real-Time fluorescent quantitative PCR detection of NMDA receptor subtype 1, 2A, 2B expression in cochlear SGN 50mg of tissue was taken and placed in 1.5ml RNase-free centrifuge tube, Trizol (Invitrogen Life technologies) total RNA was extracted, fluorescent quantitative PCR was performed according to the Kit instructions (One Step SYBR "Primescript" PLUS RT-PCR Kit, cat No. RR096A of TAKARA), reaction solution was prepared on ice according to the instructions, Real Time One Step RT-PCR was performed using a LightCycler Real Time PCR amplification instrument: reverse transcription reaction: 42 ℃, 5min → 95 ℃, 10sec, PCR amplification reaction (40 cycles): 95 ℃, 5sec → 60 ℃, 20sec, melting curve analysis: 60 ℃ C. → 95 ℃ C., and the temperature rises 1 ℃ every 20 seconds. Primer design was synthesized by Invitrogen Biotechnology Co., LTD, China, with ddH added as a synthesis list2O, to prepare a 2.5 μ M solution. NMNARNR1 upstream primer: 5'GCACCACTGACCATCAACAATG3' (22 bpm);
a downstream primer: 5'ATCTTCCTCCTCCTCCTCACTG3' (22 bpm).
NR2A upstream primer: 5'AGGGATGAAGGCTGTAAACTGG3' (22 bpm);
a downstream primer: 5' GATGAAGGTGATGAGGCTGAGG3 (22 bpm).
NR2B upstream primer: 5'GGCTGGAAGGGACGAAGG3' (18 bpm);
a downstream primer: 5'GATGAAGGTGATGAGGCTGAGG3' (22 bpm).
GAPDH upstream primer: 5'CCTTCATTGACCTCCACTAC3' (20bpm)
A downstream primer: 5'GTTGTCATACTTCTCATGGTTC3' (21bp) the results were processed using Δ Δ CT: CT (target gene, experimental sample) -CT (internal standard gene, experimental sample), B-CT (target gene, control sample) -CT (internal standard gene, control sample) K-a-B, expression multiple 2-K
The expression of NMDARNR1, 2A and 2B in cochlea SGN is detected by a Western Blot method, ice bath is carried out for 30 minutes, a pipette is repeatedly blown to ensure that cells are completely lysed, then 12000r is carried out for 5 minutes, supernatant is collected, and a proper amount of BCA working solution is prepared by adding 50 volumes of BCA reagent A and 1 volume of BCA reagent B (50:1) to determine the protein concentration, and the mixture is fully mixed. The total protein loading amount is 40 mu g, constant pressure electrophoresis is carried out according to a concentrated gel of 80V and a separation gel of 120V until bromophenol blue just comes out, the membrane is rotated according to a constant current of 150mA, the rotated membrane is sealed for 1h by 5% of skimmed milk (0.5% of TBST) on a decolouring shaker at room temperature, a primary antibody (5% of skimmed milk dissolved by TBST) is diluted, the membrane is kept overnight at 4 ℃, washed three times by a TBST decolouring shaker at room temperature, 5 minutes each time, a secondary antibody is diluted by 10000 times, incubated for 30min at room temperature, washed four times by a TBST decolouring shaker at room temperature, and 5min each time. And uniformly dripping two reagents of ECL chemiluminescence kit A and B on the protein surface of the membrane, keeping for 1-2min, removing residual liquid, plastically packaging the preservative film, placing the preservative film into a gel imager for exposure imaging, detecting the gray value of each strip by using a Quantity One software processing system, and comparing the expression of each group of NMDA receptor subtypes 1, 2A and 2B relative to GAPDH.
Statistical methods statistical analysis was performed using SPSS 22.0 statistical software. Normally distributed metric data and
Figure GDA0002402901530000151
mean values of groups were compared between groups using One-Way analysis of variance and LSD-T test, Welch analysis for variance irregularities, and multiple comparisons for Dunnett' T3. With P<A difference of 0.05 is statistically significant.
Of 60 rats in this experiment, 10 rats were blank control groups, 44 rats were successfully molded, and the molding success rate was 88%. Compared with the normal saline group, the extinction period of the water sample sodium group is obviously reduced, see table 2, which shows that rats are likely to confuse tinnitus caused by sodium salicylate with background sound, so that water is more actively drunk after background sound disappears in the extinction period than the normal saline group, fear of a silent environment is eliminated more quickly, extinction periods of other groups are reduced compared with the normal saline group, and differences have statistical significance (P <0.05), thereby proving that molding is successful. Wherein, the sodium salicylate group and the western medicine group have statistical significance (P is less than 0.05) compared with other groups, and the traditional Chinese medicine groups have no statistical significance and have statistical significance compared with other groups. (P <0.05)
TABLE 2 comparison of mean regressions for groups of rats
Figure GDA0002402901530000161
① P is less than 0.05, compared with sodium salicylate, ② P is less than 0.05, compared with ③ P is less than 0.05, compared with normal saline, ④ P is less than 0.05, compared with ⑤ P is less than 0.05, compared with ⑥ P is less than 0.05, compared with western medicine
The amplification curves of each group of the NMDA receptor subtype 1, 2A and 2B mRNA expression in the cochlea SGN are typical inverted S curves, and the expression is complete, namely the RT-PCR sensitivity is high. NMDA receptor subtype 1, 2A, 2B expression was statistically significant between groups (F-743.5, P < 0.001; F-644.97, P < 0.001; F-20.94, P-0.023). Further analysis shows that the NMDA receptor subtypes 1, 2A and 2B in the sodium salicylate group are obviously higher than the differences of the normal saline group and have statistical significance (P <0.001, P <0.001 and P ═ 0.029), wherein each group of NMDANR1 has statistical significance (P <0.05), each group of NMDANR2A has no statistical significance except for the medium-high dose group and the medium-low dose group (P <0.05), each group of the sodium salicylate group and the traditional Chinese medicine high dose group in NMDANR2B has statistical significance (P <0.05) compared with the other groups, and the other groups have no statistical significance.
NMDA receptor subtype 1, 2A, 2B expression in cochlear SGN is shown in fig. 3, and NMDA receptor subtype 1, 2A, 2B receptor protein expression is statistically significant in each group (F: 49.85, P < 0.001; F: 22.19, P <0.001 and F: 106.93, P < 0.001). The expression of NMDA receptor subtypes 1, 2A and 2B in the sodium salicylate group is obviously increased compared with that in the normal saline group, and the differences have statistical significance (P <0.001, P ═ 0.002, P ═ 0.027). In addition, the normal saline group in the NMDANR1(105KD) has no statistical significance except for the traditional Chinese medicine low dose group, and has statistical significance (P <0.05), the traditional Chinese medicine low dose group and the traditional Chinese medicine medium dose group have no statistical significance except for the western medicine group, and the other groups have statistical significance (P <0.05), the traditional Chinese medicine high dose group has statistical significance except for the traditional Chinese medicine low dose group (P <0.05), the normal saline group in the NMDAN2A (165KD) has no statistical significance except for the traditional Chinese medicine low dose group, and has statistical significance except for the other groups (P <0.05), the traditional Chinese medicine low dose group has statistical significance with the sodium salicylate group and the traditional Chinese medicine high dose group (P <0.05), and the other groups have no statistical significance. The traditional Chinese medicine dosage group and the western medicine group have no statistical significance. The normal saline group in NMDANR2B (166KD) has statistical significance (P is less than 0.05) with the sodium salicylate group and the traditional Chinese medicine high dose group, and the others have no statistical significance. The low and medium dosage groups of the traditional Chinese medicine have significance with the sodium salicylate group, and no statistical significance is found in other groups (P is less than 0.05), the medium and medium dosage groups have statistical significance with the normal saline group and the sodium salicylate group (P is less than 0.05), and no statistical significance is found in other groups.
The experiment shows that the expressions of NMDA receptor subtypes 1, 2A and 2B of the sodium salicylate group are obviously increased compared with the expressions of the normal saline group, the NMDA receptor subtypes 1, 2A and 2B of the sodium salicylate group of the medicine are obviously reduced, the spontaneous discharge activity of nerves can be inhibited, the overactivity of auditory cortex is weakened, and therefore the suppression and excitation states of the auditory system are balanced, the tinnitus serving as subjective sound is weakened or disappeared, and the medicine can be an experimental basis for relieving the tinnitus. However, the content of samples in the experiment is less, diversification is lacked, and the mechanism ways of the formula for tonifying kidney, activating blood, reducing phlegm and inducing resuscitation on the tinnitus rat are various, further discussion is needed, and an effective theoretical way is provided for clinic.
Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that changes, modifications, substitutions and alterations can be made in these embodiments without departing from the principles and spirit of the invention, the scope of which is defined in the appended claims and their equivalents.

Claims (3)

1. A medicine for treating tinnitus is characterized in that: the medicine is composed of the following raw materials in parts by weight: 10-20 parts of prepared rehmannia root, 10-20 parts of dogwood, 10-20 parts of mulberry fruit, 10-20 parts of dodder, 10-20 parts of turmeric root-tuber, 1-10 parts of polygala root, 5-15 parts of alisma orientale, 10-20 parts of grassleaf sweelflag rhizome, 10-20 parts of kudzuvine root, 5-15 parts of salvia miltiorrhiza, 10-20 parts of pseudo-ginseng, 20-40 parts of magnetite, 5-15 parts of chastetree fruit and 1-10 parts of cicada slou.
2. The medicament for the treatment of tinnitus as defined in claim 1 wherein: the medicine is composed of the following raw materials in parts by weight: prepared rehmannia root 15, dogwood 12, mulberry 12, dodder 12, curcuma aromatica 15, polygala tenuifolia 6, alisma 10, grassleaf sweelflag rhizome 12, kudzuvine root 12, salvia miltiorrhiza 10, pseudo-ginseng 12, magnet 30, vitex rotundifolia 10 and cicada slough 6.
3. Use of a medicament according to claim 1 or 2 for the manufacture of a medicament for the treatment of tinnitus.
CN201711160103.4A 2017-11-20 2017-11-20 Medicament for treating tinnitus and application thereof Expired - Fee Related CN107661481B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201711160103.4A CN107661481B (en) 2017-11-20 2017-11-20 Medicament for treating tinnitus and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201711160103.4A CN107661481B (en) 2017-11-20 2017-11-20 Medicament for treating tinnitus and application thereof

Publications (2)

Publication Number Publication Date
CN107661481A CN107661481A (en) 2018-02-06
CN107661481B true CN107661481B (en) 2020-06-05

Family

ID=61145305

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201711160103.4A Expired - Fee Related CN107661481B (en) 2017-11-20 2017-11-20 Medicament for treating tinnitus and application thereof

Country Status (1)

Country Link
CN (1) CN107661481B (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108465079B (en) * 2018-04-16 2021-03-12 韩祖成 Traditional Chinese medicine composition for treating tinnitus and preparation method
CN108939078A (en) * 2018-07-30 2018-12-07 郑州兰茜生物工程有限公司 It is a kind of with treatment tinnitus and the preparation of ear healthcare function and preparation method thereof
CN108685754A (en) * 2018-07-30 2018-10-23 郑州兰茜生物工程有限公司 A kind of auristilla for the ear function that relaxes for tinnitus and with strong ear

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104623322A (en) * 2013-11-07 2015-05-20 申怀金 Traditional Chinese medicine used for treating deafness and tinnitus
CN105878661A (en) * 2014-12-26 2016-08-24 王�华 Traditional Chinese medicine for treating tinnitus

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104623322A (en) * 2013-11-07 2015-05-20 申怀金 Traditional Chinese medicine used for treating deafness and tinnitus
CN105878661A (en) * 2014-12-26 2016-08-24 王�华 Traditional Chinese medicine for treating tinnitus

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
耳鸣汤配合针刺治疗耳鸣52例临床观察;谭丽等;《新中医》;20111105;第43卷(第11期);57-58 *
补肾活血化痰汤联合针刺治疗老年性神经性耳鸣的临床观察;祁青等;《湖北中医杂志》;20131210;第35卷(第12期);40-41 *

Also Published As

Publication number Publication date
CN107661481A (en) 2018-02-06

Similar Documents

Publication Publication Date Title
JP2011037738A (en) Preventive and therapeutic agent for deafness or ear noises
CN107661481B (en) Medicament for treating tinnitus and application thereof
Hao et al. Gut dysbiosis induces the development of depression-like behavior through abnormal synapse pruning in microglia-mediated by complement C3
CN105920476A (en) Traditional Chinese medicine composition for prophylaxis and treatment of Alzheimer disease and preparation method thereof
Tian et al. An in vitro screening method for probiotics with antidepressant-like effect using the enterochromaffin cell model
CN115873753B (en) Lactobacillus plantarum L5 with functions of relieving essential tremor and sleep disorder and application thereof
Zhang et al. Far-infrared therapy based on graphene ameliorates high-fat diet-induced anxiety-like behavior in obese mice via alleviating intestinal barrier damage and neuroinflammation
Kitaoka et al. Fermented ginseng improves the first-night effect in humans
WO2009070924A1 (en) Pharmaceutical compositions with a mechanism of multi-target receptor retroaction for treating depression
CN102671007B (en) Medicament for treating senile dementia and preparation method thereof
JP5856725B2 (en) Pharmaceutical composition for treating or preventing depression
US20170258862A1 (en) Compositions for the treatment of age related disorders
Asalgoo et al. The effect of saffron aqueous extract and crocin on PTSD rat models: The focus on learning and spatial memory
CN105079629B (en) It is a kind of to be used to prevent Chinese medicine composition of Alzheimer disease and its preparation method and application
Zhou et al. Liangxue Tongyu prescription alleviates brain damage in acute intracerebral hemorrhage rats by regulating intestinal mucosal barrier function
US20150050364A1 (en) Composition for treating or preventing tinnitus
WO2024119622A1 (en) Use of mulberry extract in preparation of drug for preventing and/or treating hepatobiliary diseases
CN107233382B (en) Application of traditional Chinese medicine composition in preparing medicine or health care product for preventing or treating AD
CN118715016A (en) Application of Morinda officinalis oligosaccharide and its composition in preventing or treating depression
Zhou et al. Cang-ai volatile oil alleviates nasal inflammation via Th1/Th2 cell imbalance regulation in a rat model of ovalbumin-induced allergic rhinitis
CN109432362A (en) A kind of natural composition and preparation method thereof for treating depression
KR102226052B1 (en) A anti-stress, anxiolytic and anti-depressant formula comprising L-theanine and bee pollen
CN115998793B (en) Baoyuan decoction for improving learning and memory ability of organism and preparation method thereof
Huang et al. Inhibition of CXCR4: A perspective on miracle fruit seed for Alzheimer's disease treatment
CN109908309A (en) A kind of Chinese medicine composition that treating Schizophrenia, preparation method and application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20200605

Termination date: 20211120