WO2023040426A1 - Formula of probiotics and metabolites thereof for alleviating metabolic syndromes, and use thereof - Google Patents

Abstract

Provided are a formula of probiotics and metabolites thereof for alleviating metabolic syndromes, and the use thereof. The formula comprises Lactobacillus reuteri PLBK®1, Lactobacillus reuteri PLBK®2, Lactobacillus gasseri PLBK ®3, Lactobacillus acidophilus PLBK®4 and Bifdobacterium lactis PLBK®5, or fermentation cultures thereof, or metabolites thereof. The use refers to the use of the above-mentioned formula of probiotics in the preparation of a product for alleviating metabolic syndromes, and alleviating the metabolic syndromes is to reduce fat accumulation, promote lipolysis, improve insulin sensitivity and/or alleviate fatty liver.

Description

Formulas and applications of probiotics and their metabolites for alleviating metabolic syndrome Technical field:

The invention belongs to the field of microorganisms, and in particular relates to formulas and applications of probiotics and their metabolites (postbiotics) for alleviating metabolic syndrome.

Background technique:

The occurrence and development of metabolic syndrome, such as: obesity, diabetes, (non-alcoholic fatty liver) seriously threaten human health, and bring heavy economic burden and medical pressure to the country and family. At present, diet and exercise intervention are effective means of prevention and early intervention for the treatment of metabolic syndrome, but it is difficult for most people to adhere to this means, and there are problems of long cycle and rapid rebound. Taking drugs to reduce appetite and clinical surgery to lose weight have strong side effects. Studies have found that the occurrence and development of metabolic syndrome are often accompanied by intestinal flora disorders and systemic glucose and lipid metabolism homeostasis problems. Microecological preparations represented by probiotics and synbiotics can improve the intestinal flora microenvironment after intervention , promote defecation and assist in improving the systemic glucose and lipid and energy metabolism homeostasis; it mainly regulates the host system's glucose and lipid metabolism homeostasis through the host absorbing the metabolites secreted by probiotics. Probiotics and their metabolite mixture (also known as postbiotics) are obtained by using the patented probiotic strains screened in the previous stage and the optimized fermentation process. Through 16S sequencing, whole genome sequencing and phylogenetic tree construction, the strains we isolated are different from the strains found so far. Metabolomics identified the metabolites of five strains, and found and identified the components of their metabolites to inhibit fat synthesis and promote fat breakdown. role. The main data provided by the present invention support that the administration of probiotics and their metabolites can significantly promote the beige coloring of white fat, and significantly improve and alleviate the course of metabolic syndrome.

Invention content:

The object of the present invention is to provide probiotics and their metabolites (postbiotics) formulations and applications thereof that can inhibit fat accumulation, promote fat decomposition, improve insulin sensitivity, alleviate fatty liver, and are expected to be applied to alleviate metabolic syndrome.

The first purpose of the present invention is to provide a probiotic formula that can inhibit fat accumulation, promote fat decomposition, improve insulin sensitivity, alleviate fatty liver, and is expected to be applied to relieve metabolic syndrome. The probiotic formula is Royces Lactobacillus reuteri

Lactobacillus reuteri

Lactobacillus gasseri

Lactobacillus acidophilus

Bifidobacterium lactis

One or more of them, it and/or their fermentation culture, or, it or their metabolites;

Described Lactobacillus reuteri (Lactobacillus reuteri)

It was deposited in Guangdong Microbial Culture Collection Center (GDMCC) on October 24, 2019, address: 5th Floor, Building 59, Compound, No. 100 Xianlie Middle Road, Guangzhou City, postcode: 510070, and deposit number: GDMCC No: 60828.

Described Lactobacillus reuteri (Lactobacillus reuteri)

It was deposited in Guangdong Microbial Culture Collection Center (GDMCC) on October 24, 2019, address: 5th Floor, Building 59, Compound, No. 100 Xianlie Middle Road, Guangzhou City, postcode: 510070, and deposit number: GDMCC No: 60829.

The Lactobacillus gasseri (Lactobacillusgasseri)

It was deposited in Guangdong Microbial Culture Collection Center (GDMCC) on October 24, 2019, address: 5th Floor, Building 59, Compound, No. 100 Xianlie Middle Road, Guangzhou City, postcode: 510070, and deposit number: GDMCC No: 60830.

The acidophilus lactobacillus (Lactobacillus acidophilus)

It was deposited in Guangdong Microbial Culture Collection Center (GDMCC) on October 24, 2019, address: 5th Floor, Building 59, Compound, No. 100 Xianlie Middle Road, Guangzhou City, postcode: 510070, and deposit number: GDMCC No: 60831.

The lactobacillus (Bifdobacterium lactis)

It was deposited in Guangdong Microbial Culture Collection Center (GDMCC) on October 24, 2019, address: 5th Floor, Building 59, Compound, No. 100 Xianlie Middle Road, Guangzhou City, postcode: 510070, and deposit number: GDMCC No: 60832.

The second object of the present invention is to provide the application of the above-mentioned probiotic formula in the preparation of products for alleviating metabolic syndrome.

Preferably, the relief of metabolic syndrome is reducing fat accumulation, promoting lipolysis, improving insulin sensitivity and/or alleviating fatty liver.

Preferably, the product may be food, health product or medicine for alleviating metabolic syndrome.

Further preferably, the probiotic formula is Lactobacillus reuteri (Lactobacillus reuteri)

Lactobacillus reuteri

Lactobacillus gasseri

Lactobacillus acidophilus

Bifidobacterium lactis

A mixture of bacterial fluid or metabolites, the bacterial content of which is above 10 ^{^9} cfu/ml. Further preferred is 10 ^{^9} cfu/ml.

Preferably, in the mixture, Lactobacillus reuteri (Lactobacillus reuteri)

Lactobacillus reuteri

Lactobacillus gasseri

Lactobacillus acidophilus

Bifidobacterium lactis

The quantity ratio is 0.75:0.75:1:1.5:1.

The invention belongs to the technical field of microbes, and specifically relates to the core components of five self-isolated, identified and patent-preserved probiotics and their fermentation metabolites (postbiotics) and their application in alleviating metabolic syndrome. It also discloses the application mechanism of the probiotics and their fermentation metabolites (postbiotics) in promoting the decomposition of white fat. The application of this invention can inhibit fat accumulation, promote fat decomposition, improve insulin sensitivity, relieve fatty liver, and is expected to be applied to metabolism Syndrome prevention and treatment.

Lactobacillus reuteri

It was deposited in Guangdong Microbial Culture Collection Center (GDMCC) on October 24, 2019, address: 5th Floor, Building 59, Compound, No. 100 Xianlie Middle Road, Guangzhou City, postcode: 510070, and deposit number: GDMCC No: 60828.

Lactobacillus reuteri

It was deposited in Guangdong Microbial Culture Collection Center (GDMCC) on October 24, 2019, address: 5th Floor, Building 59, Compound, No. 100 Xianlie Middle Road, Guangzhou City, postcode: 510070, and deposit number: GDMCC No: 60829.

Lactobacillus gasseri

It was deposited in Guangdong Microbial Culture Collection Center (GDMCC) on October 24, 2019, address: 5th Floor, Building 59, Compound, No. 100 Xianlie Middle Road, Guangzhou City, postcode: 510070, and deposit number: GDMCC No: 60830.

Lactobacillus acidophilus

It was deposited in Guangdong Microbial Culture Collection Center (GDMCC) on October 24, 2019, address: 5th Floor, Building 59, Compound, No. 100 Xianlie Middle Road, Guangzhou City, postcode: 510070, and deposit number: GDMCC No: 60831.

Bifidobacterium lactis

It was deposited in Guangdong Microbial Culture Collection Center (GDMCC) on October 24, 2019, address: 5th Floor, Building 59, Compound, No. 100 Xianlie Middle Road, Guangzhou City, postcode: 510070, and deposit number: GDMCC No: 60832.

Description of drawings:

Figure 1 is Lactobacillus reuteri

Whole-genome sequencing strain gene circular function map;

Figure 2 is Lactobacillus reuteri

Whole-genome sequencing strain gene circular function map;

Figure 3 is Lactobacillus gasseri (Lactobacillusgasseri)

Whole-genome sequencing strain gene circular function map;

Figure 4 is Lactobacillus acidophilus

Whole-genome sequencing strain gene circular function map;

Figure 5 is the bifidobacterium lactis (Bifdobacterium lactis)

Whole-genome sequencing strain gene circular function map;

Fig. 6 is (A) Lactobacillus reuteri (Lactobacillus reuteri

) evolution map, (B) Lactobacillus gasseri (Lactobacil lus gasseri

) evolution map, (C) Lactobacillus acidophilus

) evolution map, (D) Bifidobacterium lactis

) evolution map;

Fig. 7 is a figure for identification of fermentation metabolites of 5 strains of probiotic bacteria;

Fig. 8 is a figure for identification of fermentation metabolites of 5 purified probiotic strains;

Figure 9 is the mouse's anus temperature (A), the mouse's glucose tolerance (GTT, B), the mouse feces suspension time (C) and the mouse body weight growth (D) graph; Figure 10 is the probiotics and their metabolites Intervention-promoted improvements in metabolic phenotypes;

Figure 11 is a graph showing the improvement of probiotics and their metabolites in the treatment of metabolic syndrome;

Figure 12 is a graph showing the occurrence and development of probiotics and their metabolites to prevent the occurrence and development of metabolic syndrome.

Detailed ways:

The following examples are further illustrations of the present invention, rather than limitation of the present invention, and the protection scope of the present invention is not limited to the following specific examples.

Example 1:

1. Experimental method

1. Probiotic strain category and patent preservation number

The present invention obtains 5 strains of probiotics through screening and separation, through 16S sequencing (16S full-length amplification primer, 16S_Forw: AGAGTTTGATCCTGGCTCAG, 16S_Rev: GGTTACCTTGTTACGACTT), whole genome sequencing circular functional map (extracting strain fermentation sludge nucleic acid, building a library Carry out next-generation sequencing, the sequencing platform is Ilumina Hiseq X10) and phylogenetic tree construction, and obtain Lactobacillus reuteri (Lactobacillus reuteri)

Lactobacillus reuteri

Lactobacillus gasseri (Lactoba cillus gasseri)

Lactobacillus acidophilus

Bifidobacterium lactis

Genome information, the specific information is as follows:

Lactobacillus reuteri

It was deposited in Guangdong Microbial Culture Collection Center (GDMCC) on October 24, 2019, address: 5th Floor, Building 59, Compound, No. 100 Xianlie Middle Road, Guangzhou City, postcode: 510070, and deposit number: GDMCC No: 60828. The nucleotide sequence of its 16s rDNA is shown in SEQ ID NO.1, the gene circular function map of the whole genome sequencing strain is shown in Figure 1, and the evolution map is shown in Figure 6.

Lactobacillus reuteri

It was deposited in Guangdong Microbial Culture Collection Center (GDMCC) on October 24, 2019, address: 5th Floor, Building 59, Compound, No. 100 Xianlie Middle Road, Guangzhou City, postcode: 510070, and deposit number: GDMCC No: 60829. The nucleotide sequence of its 16s rDNA is shown in SEQ ID NO.2, the gene circular function map of the whole genome sequencing strain is shown in Figure 2, and the evolution map is shown in Figure 6.

Lactobacillus gasseri

It was deposited in Guangdong Microbial Culture Collection Center (GDMCC) on October 24, 2019, address: 5th Floor, Building 59, Compound, No. 100 Xianlie Middle Road, Guangzhou City, postcode: 510070, and deposit number: GDMCC No: 60830. The nucleotide sequence of its 16s rDNA is shown in SEQ ID NO.3, the gene circular function map of the whole genome sequencing strain is shown in Figure 3, and the evolution map is shown in Figure 6.

Lactobacillus acidophilus

It was deposited in Guangdong Microbial Culture Collection Center (GDMCC) on October 24, 2019, address: 5th Floor, Building 59, Compound, No. 100 Xianlie Middle Road, Guangzhou City, postcode: 510070, and deposit number: GDMCC No: 60831. The nucleotide sequence of its 16s rDNA is shown in SEQ ID NO.4, the gene circular function map of the whole genome sequencing strain is shown in Figure 4, and the evolution map is shown in Figure 6.

Bifidobacterium lactis

It was deposited in Guangdong Microbial Culture Collection Center (GDMCC) on October 24, 2019, address: 5th Floor, Building 59, Compound, No. 100 Xianlie Middle Road, Guangzhou City, postcode: 510070, and deposit number: GDMCC No: 60832. The nucleotide sequence of its 16s rDNA is shown in SEQ ID NO.5, the gene circular function map of the whole genome sequencing strain is shown in Figure 5, and the evolution map is shown in Figure 6.

2. Fermentation medium:

Lactobacillus, including but not limited to Lactobacillus reuteri, Lactobacillus gasseri and Lactobacillus acidophilus using optimized MRS medium: peptone (10g/L), beef extract powder (8g/L), yeast extract powder (4g /L), glucose (20g/L), dipotassium hydrogen phosphate (2g/L), diamine hydrogen citrate (2g/L), sodium acetate (5g/L), magnesium sulfate (0.2g/L), sulfuric acid Manganese (0.04g/L), the solvent is water, and the specific preparation method is to mix the components uniformly, and sterilize for subsequent use.

Bifidobacteria use optimized bifidobacterium medium: peptone (15g/L), glucose (20g/L), yeast extract powder (2g/L), soluble starch (0.5g/L), sodium chloride (5g/L L), L-cysteine (0.5g/L), tomato extract powder (5g/L), liver extract powder (2g/L), the solvent is water, and the specific preparation method is to mix the ingredients evenly and sterilize spare.

3. Fermentation and preparation process of probiotics: Inoculate Lactobacillus or Bifidobacterium into 5ml sterilized MRS liquid medium or Bifidobacterium liquid medium respectively, and enrich the bacteria by anaerobic culture for 24 hours, then inoculate 5ml of the bacterial liquid, Transfer to 1 L medium for anaerobic fermentation and amplification for 48 hours. After the fermentation, the bacteria sludge was collected by centrifugation, and the supernatant bacteria liquid was filtered through a 0.22 μm filter membrane to obtain the filtered supernatant for later use. After counting the cfu of probiotics by plating, resuspend the sludge with the filtered supernatant to obtain 10 ^{^9} cfu/ml single-strain bacterial liquid, and then mix the 5 single-strain bacterial liquids according to the volume ratio

The ratio of mixed to obtain a mixed probiotic bacteria liquid, for the following experiments.

4. Preparation process of probiotic metabolites: strain fermentation broth, centrifugation, and supernatant filtration (0.22 μm) to obtain the fermentation metabolites of each strain, and then mix the fermentation metabolites of five strains in equal proportions by volume to obtain a mixed Fermentation metabolites of probiotics, stored at 4°C.

5. Purification process of probiotic metabolites:

A. Pour the probiotic fermentation supernatant obtained by filtering 500ml of 0.22μm filter membrane into the separatory funnel, and then pour 500ml of ethyl acetate into it;

B. Shake the separatory funnel horizontally for 2 minutes to fully mix the two liquids;

C. Transfer the separating funnel to a fume hood, and let it stand at room temperature for 5 minutes to make the liquid fully stratified;

D. Repeat step B and step D three to four times. At this time, it can be observed that the upper liquid is yellowish brown and transparent, and the lower liquid is brown. (the upper strata liquid is the oil phase: the substance soluble in ethyl acetate in the supernatant; the lower floor liquid is the water phase: the substance insoluble in ethyl acetate in the supernatant).

E. Place a 500ml triangular flask at the lower mouth of the separatory funnel to hold the lower liquid;

F. Open the upper piston of the separatory funnel to keep the air pressure inside and outside the funnel consistent, and then unscrew the lower piston of the separatory funnel to discharge the lower liquid into the triangular flask. At this time, a small amount of upper liquid can also be discharged into the triangular flask to eliminate the interference at the liquid stratification.

G. After the discharge is completed, close the lower piston. The lower liquid is poured from the upper port into the rotary bottle;

H. Connect the rotary bottle to the rotary evaporator, soak 1/4 body of the rotary bottle in the water bath, adjust the value of the water bath of the rotary evaporator to 45°C, and turn on the main switch of the rotary evaporator.

I. When the liquid in the spinner bottle is evaporated to no longer decrease, turn off the main switch and take down the spinner bottle; add 2-3ml of ethyl acetate into the spinner bottle, mix well, and pipette the The liquid is transferred to the sample bottle;

J. Connect the sample bottle to the rotary evaporator, soak 1/4 body of the sample bottle in the water bath, adjust the value of the water bath of the rotary evaporator to 45°C, and turn on the main switch of the rotary evaporator.

K. When the liquid in the sample bottle is evaporated to no longer decrease, turn off the main switch and take off the sample bottle. At this time, the liquid in the bottle is the substance initially extracted from the supernatant of 500ml bacterial liquid. Concentrated metabolites (aqueous phase) of each probiotic bacteria were thus obtained.

6. Probiotics and their metabolites intervention experimental model after a healthy model: 14-week-old C57BL/6J mice on a regular diet (rodent chow, Beijing Keaoxieli Feed, 2012, maintenance feed for rats and mice), after 12 weeks of regular diet feeding, Intervention of mixed probiotic bacteria liquid for 12 weeks, set up an experimental group (mixed probiotics group postbiotics) and a control group of pure water, mixed probiotic bacteria liquid and pure water were added to mice drinking bottles, free to drink, every The weight gain of the mice was monitored weekly, glucose tolerance (GTT) and insulin tolerance (ITT) were detected after the intervention, beige-like changes in white fat were evaluated by immunohistochemistry, and fat accumulation in the liver was detected by oil red staining.

7. Functional comparison of single and mixed strains of metabolic syndrome: 14-week-old C57BL/6J mice were fed a 60% high-fat diet (HFD, D12492, Research Diets, Inc., Brunswick, NJ) for 24 weeks, during which a single strain Bacterial liquid and mixed probiotic bacterial liquid were intervened for 24 weeks, and 6 experimental groups (Lactobacillus reuteri

Lactobacillus reuteri

Lactobacillus gasseri

Lactobacillus acidophilus

Bifidobacterium lactis

and mixed probiotics group postbiotics) and a control group (MRS, the same dose of MRS medium), the probiotic single-strain bacterial liquid, mixed probiotic bacterial liquid and MRS medium were added to the drinking water bottle of the mice, and they drank freely. The weight gain of the mice was monitored weekly, and the temperature of the anus of the mice, glucose tolerance, and suspension time of the mouse feces were detected after the intervention.

8. Experimental model of probiotics and their metabolites for the treatment of metabolic syndrome: 14-week-old C57BL/6J mice 60% high-fat diet (HFD, D12492, Research Diets, Inc., Brunswick, NJ) modeling (12 weeks) , starting from the 13th week, intervene the mixed probiotics solution for 12 weeks, set up an experimental group (mixed probiotics group postbiotics) and a control group of pure water, add the mixed probiotics solution and pure water to the mouse drinking bottle respectively In the middle, drink freely, monitor the weight gain of the mice every week, detect glucose tolerance (GTT) and insulin tolerance (ITT) after the intervention, immunohistochemical evaluation of beige-like changes in white fat, and oil red staining to detect liver fat accumulation.

9. Probiotics and their metabolites prevention experimental model of metabolic syndrome: 14-week-old C57BL/6J mice 60% high-fat diet (HFD, D12492, Research Diets, Inc., Brunswick, NJ) at the same time, mixed probiotics The bacteria solution was intervened for 24 weeks, and an experimental group (postbiotics mixed probiotics group) and a control group (30% glucose Glucose were added to the MRS medium) were set up, and 30% glucose was added to the mixed probiotics solution and MRS medium. % Glucose Glucose was added to the drinking water bottle of the mice, and they drank freely, and the weight gain of the mice was monitored every week. Glucose tolerance (GTT) and insulin tolerance (ITT) were detected after the intervention, and the beige-colored change of white fat was evaluated by immunohistochemistry. Red staining was used to detect fat accumulation in the liver.

10. Glucose tolerance test (GTT)

A. Weigh and calculate the amount of glucose injection. After the mice were weighed, the glucose injection volume of each mouse was calculated according to 2 mg/g body weight. In order to facilitate the identification of mice, mark the base or tip of the tail of the mice with a marker pen after weighing.

B. Basal blood glucose determination. After wiping the tail of the mouse with sterile alcohol cotton, a small section of the tail was cut to measure the baseline blood glucose level (0 minute), and the first drop of blood was discarded.

C, glucose injection. Start timing immediately after intraperitoneal injection of glucose solution, and measure blood glucose levels at 15 minutes, 30 minutes, 60 minutes, 90 minutes, and 120 minutes after injection. The measurement method is to reopen the tail wound, discard the first drop of blood, and measure the second. Drop blood sugar level.

D. Measure the blood sugar levels of other mice at each time point after the glucose injection in turn, and make records.

11. Insulin tolerance test (ITT):

A. Weigh and calculate the amount of glucose injection. After the mice were weighed, the insulin injection volume of each mouse was calculated according to 2 mg/g body weight. In order to facilitate the identification of mice, mark the base or tip of the tail of the mice with a marker pen after weighing.

B. Basal blood glucose determination. After wiping the tail of the mice with sterile alcohol cotton, a small section of the tail was cut to measure the baseline blood glucose level (0 minute).

C, insulin injection. Start timing immediately after intraperitoneal injection of glucose solution, and measure blood glucose levels at 15 minutes, 30 minutes, 60 minutes, 90 minutes, and 120 minutes after injection. The measurement method is to reopen the tail wound, discard the first drop of blood, and measure the second. Drop blood sugar level. Pay attention to the mental state of the mice at all times, and inject glucose into the mice immediately if the mice are not in a good state.

12. Oil red O staining of frozen sections of liver tissue:

A. Take the liver frozen section (6 μm) out of the -80°C refrigerator, and place it at room temperature for 1 hour to dry the slide;

B. Separate the tissue sections with a water-blocking pen;

C. Tissue fixation: fix the slices with 1% PFA at room temperature for 30 minutes;

D. Wash the tissue piece three times with PBS, 5 minutes each time;

E. Staining: Use diluted Oil Red dye and stain at room temperature for 1 hour (add 600 μl of undiluted Oil Red O staining solution to 400 μl of distilled water, and use it after filtering through a 0.45 μm filter membrane);

F. Discard the staining solution, and then wash the tissue section with PBS for 3 times;

G. Stain the nucleus: stain with hematoxylin for 2 minutes;

H. Seal the slide with glycerin gelatin and observe under the microscope.

13. Tissue HE staining: After dewaxing and hydration, soak the slice in hematoxylin for 2 minutes; prepare an empty staining box, fill it with tap water, and wash it 3-5 times until it is colorless. Immediately after that, use 0.3% hydrochloric acid alcohol to decompose, rinse quickly for 3 seconds. Finally, refill the empty staining box with tap water, lift up and down, dilute hydrochloric acid alcohol, and terminate the reaction.

2. Experimental results

The identification results of fermentation metabolites of 1 and 5 probiotic strains are shown in Figure 7. After 5 strains of probiotics were fermented, they were filtered through a 0.22 μM filter membrane to obtain the fermentation supernatant, and the MRS medium was used as a blank control for LC-MS/MS mass spectrometry analysis. The metabolites, metabolite components and contents were compared with the MRS blank For comparison, the metabolites produced by the fermentation of probiotics were obtained.

2. The identification of the fermentation metabolites of the five purified probiotic strains is shown in Figure 8. After fermentation, 5 strains of probiotics were concentrated through 0.22 μM ethyl acetate filtration, and the metabolites in the lower layer (aqueous phase) were collected and evaporated to dryness by low-temperature concentration to obtain 1000x concentrated metabolites, which were analyzed by LC-MS/MS mass spectrometry The metabolites, metabolite components and contents were compared with the MRS blank control to obtain the metabolites produced by the fermentation of probiotics.

3. As shown in Figure 9, the columns in Figure 9A, 9B and 9C are from left to right: HFD+MRS, HFD+Postbiotics, HFD+Lactobacillus reuteri

HFD+Lactobacillus reuteri

HFD+Lactobacillus gasseri

HFD+Lactobacillus acidophilus

HFD+Bifdobacterium lactis

C57BL6/J mice were fed with 60% HFD while intervening with mixed strains and their metabolites (Postbiotics). We detected the anal temperature of the mice (Figure 9A), the glucose tolerance of the mice (GTT, Figure 9B), and the mice Feces suspension time (Figure 9C) and mouse weight growth (Figure 9D), the results showed that the basal metabolic rate of the mice intervened by the mixed strain and its metabolites was significantly higher than that of any single strain, and its glucose tolerance was also significantly better than that of a single strain The results of the strain and feces suspension experiments showed that the fat absorption efficiency of the mice intervened by the mixed strains and their metabolites was the lowest, and a large amount of fat remained in the feces, so the suspension time was the longest. It can be seen from the above that the mixed strain and its metabolites are superior to a single strain in activating the body's energy metabolism and enhancing the body's resistance to metabolic disorders caused by a 60% high-fat diet (HFD).

4. As seen in Figure 10 (in all histograms in Figure 10, the left side of each group of 2 columns is NCD+H ₂ O, and the right side is NCD+Postbiotics), the mice are free to eat NCD feed (normal diet group ) and pure water for 12 weeks, the obese mice were then intervened with postbiotics (mixed probiotics). After 12 weeks of postbiotic intervention, the body weight of the mice increased slowly and the body size was small (Fig. 10A.C). The ratio of the liver and white adipose tissue to the body weight of the mice decreased, proving that postbiotics can reduce the accumulation of lipids in the body ( FIG. 10B ). Postbiotic intervention can promote insulin sensitivity in healthy mice (Fig. 10D-E). By HE staining, after the intervention of postbiotics, the area of oil bubbles in brown and white adipose tissue was significantly reduced, indicating that postbiotics promoted the thermogenesis of adipose tissue (Fig. 10F). At the same time, the levels of serum total cholesterol, low-density lipoprotein cholesterol and alanine aminotransferase were significantly lower than those of the control group, and the content of high-density lipoprotein cholesterol was significantly higher than that of the control group, proving that postbiotics can further improve blood lipids (Figure 10H). The mRNA and protein levels of brown adipose tissue and white adipose tissue also showed a relative increase in the expression of some thermogenic markers (Fig. can increase. It can be seen from the above that the intervention of probiotics and their metabolites promotes the improvement of metabolic phenotype in healthy diet mice.

5. As shown in Figure 11 (all the histograms in Figure 11, each group of 2 columns has HFD+H ₂ O on the left, and HFD+Postbiotics on the right), the mice had free access to HFD feed and pure water for 12 After a week, the body weight of the mice was different, which proved that the diet-induced obese mice were successfully modeled. In order to prove whether postbiotics can control the body weight of high-fat diet-induced obese mice and improve glucose and lipid metabolism, successful obese mice have been constructed for 12 weeks by using postbiotics. After 12 weeks of post-biotic intervention, compared with the control group, the mice in the experimental group gained slower weight and were smaller (Fig. 11A, C). The ratio of the liver and three types of adipose tissue (brown fat, white fat and inguinal fat) to the body weight of the mice decreased, proving that postbiotics can reduce the accumulation of lipids in the body (Fig. 11B). The improved high-fat diet after postbiotic intervention induced insulin resistance in obese mice, and blood glucose could be reduced to a level similar to that of normal mice (Fig. 11D-E). A high-fat diet exacerbated lipid accumulation in the liver, brown and white adipose tissue of mice. After the intervention of postbiotics, the lipid accumulation in liver and adipose tissue was improved, and the area of oil bubbles in white adipose tissue was significantly reduced and returned to normal state (Fig. 11F-G). The expression of thermogenic markers peroxisome proliferator-activated receptor gamma costimulator (Ppargc1α) and uncoupling protein 1 (Ucp1) in white adipose tissue of high-fat diet-induced obese mice was significantly increased after intervention of epibiotics ( Figure 11H). At the same time, the serum levels of total triglycerides, total cholesterol, low-density lipoprotein cholesterol and alanine aminotransferase levels were significantly reduced, proving that postbiotics can improve blood lipid disorders caused by high-fat diets (Fig. 11I). The mRNA and protein levels of brown adipose tissue and white adipose tissue also showed a relative increase in the expression of some thermogenic markers (Fig. can increase. It can be seen from the above that 60% high-fat diet induces the construction of metabolic syndrome, and the intervention of probiotics and their metabolites treats metabolic syndrome.

6. As shown in Figure 12 (all histograms in Figure 12, the left side of each group of 2 columns is HFD+30% Glucose+MRS, and the right side is HFD+Postbiotics (metabolites)), in order to prove whether the postbiotic It can inhibit the weight gain of potentially obese mice and maintain the stability of energy metabolism in the body. Another animal model is designed, that is, wild-type C57BL/6J mice are free to eat HFD feed while intervening mice with postbiotics (potential obesity model) , the control group utilizes the MRS broth medium with a sugar content of 30% (it is found by the test kit that the sugar content in the bacterial liquid after the bacteria are fermented in the MRS broth medium is 30% of the original MRS broth medium). The experimental results showed that the postbiotic-intervened mice gained slower weight gain and were smaller than the control mice, and no obvious fatty liver was found (Fig. 12A.C). The ratio of white fat and inguinal fat to the body weight of the mice decreased, proving that postbiotics can reduce the accumulation of lipids in the body ( FIG. 12B ). The possible reason why this phenomenon is not seen in brown adipose tissue and liver tissue is that the body weight of the mice after the intervention of epibiotics is low, and the weight of brown adipose tissue and liver tissue does not increase significantly, but the result is reduced after the comparison. Postbiotic intervention can improve the insulin resistance of potentially obese mice, and can reduce the blood glucose of potentially obese mice to a level similar to that of normal mice (Fig. 12D-E). It was found by HE staining that the area of oil bubbles in the brown adipose tissue and white adipose tissue in the control group was significantly increased, while the area of oil bubbles in the adipose tissue was reduced after the postbiotic treatment (Fig. 12F-G). For the oil red O staining of frozen sections of liver tissue, it can be observed that the oil red staining in the experimental group is significantly less than that in the control group, and there is no phenomenon of mutual fusion of lipid droplets. And it can be found that postbiotics can reduce the accumulation of lipid in the liver tissue through the area stained with oil red ( FIG. 12G ). The blood lipid profile also showed a trend of improvement (Fig. 12H). Increased expression of some thermogenic markers was also seen at the mRNA and protein levels in brown adipose tissue (Fig. 12I-J). In white adipose tissue, the expression of some thermogenic markers was only seen at the mRNA level. (Fig. 12K-L). It can be seen from the above that while 60% high-fat diet induces metabolic syndrome, the intervention of probiotics and their metabolites prevents the occurrence and development of metabolic syndrome.

Claims (10)

1. A kind of probiotic formula for alleviating metabolic syndrome, it is characterized in that, described probiotic formula is Lactobacillus reuteri (Lactobacillus reuteri)

   

   Lactobacillus reuteri

   

   Lactobacillus gasseri

   

   

   Lactobacillus acidophilus

   

   and Bifidobacterium lactis

   

   or their fermented cultures, or their metabolites;

   Described Lactobacillus reuteri (Lactobacillus reuteri)

   

   Deposit number: GDMCC No: 60828;

   Described Lactobacillus reuteri (Lactobacillus reuteri)

   

   Deposit number: GDMCC No: 60829;

   The Lactobacillus gasseri (Lactobacillus gasseri)

   

   Deposit number: GDMCC No: 60830;

   The acidophilus lactobacillus (Lactobacillus acidophilus)

   

   Deposit number: GDMCC No: 60831;

   The lactobacillus (Bifdobacterium lactis)

   

   Deposit number: GDMCC No: 60832.
2. The probiotic formula according to claim 1, characterized in that, the probiotic formula is Lactobacillus reuteri (Lactobacillus reuteri)

   

   Lactobacillus reuteri

   

   Lactobacillus gasseri

   

   

   Lactobacillus acidophilus

   

   Bifidobacterium lactis

   

   Mixture of bacterial fluid and/or metabolites.
3. The probiotic formula according to claim 2, characterized in that the bacteria content in the mixture is more than 10 ^{^9} cfu/ml.
4. The probiotic formula according to claim 2 or 3, characterized in that, in the mixture, Lactobacillus reuteri (Lactobacillus reuteri)

   

   Lactobacillus reuteri

   

   Lactobacillus gasseri

   

   

   Lactobacillus acidophilus

   

   Bifidobacterium lactis

   

   The quantity ratio is 0.75:0.75:1:1.5:1.
5. The application of the probiotic formula described in claim 1 in the preparation of products for alleviating metabolic syndrome.
6. The application according to claim 5, characterized in that the relief of metabolic syndrome is to reduce fat accumulation, promote lipolysis, improve insulin sensitivity and/or relieve fatty liver.
7. The application according to claim 5 or 6, characterized in that the product is food, health product or medicine for alleviating metabolic syndrome.
8. application according to claim 5, is characterized in that, described probiotic formula is Lactobacillus reuteri (Lactobacillus reuteri)

   

   Lactobacillus reuteri

   

   Lactobacillus gasseri

   

   Lactobacillus acidophilus

   

   Bifidobacterium lactis

   

   Mixture of bacterial fluid and/or metabolites.
9. The application according to claim 8, characterized in that, in the probiotic formula, Lactobacillus reuteri (Lactobacillus reuteri)

   

   Lactobacillus reuteri

   

   Lactobacillus gasseri

   

   Lactobacillus acidophilus

   

   Bifidobacterium lactis

   

   The quantity ratio is 0.75:0.75:1:1.5:1.
10. The application according to claim 8 or 9, characterized in that, the bacterial content of the probiotic formula is more than 10 ^{^9} cfu/ml.

Images