CN107937587B - Specific PCR detection method for transgenic soybean dsABS strain - Google Patents

Abstract

The invention belongs to the technical field of transgenic food detection, and particularly relates to a detection method for a dsABS strain of transgenic soybeans. The method comprises the steps of designing primers Primer-F and Primer-R, extracting DNA of a soybean sample to be detected, carrying out PCR amplification, carrying out electrophoresis detection, judging and the like. The method aims at the development and design of the dsABS strain of the transgenic soybean, can detect the dsABS strain of the transgenic soybean with the mass proportion not less than 0.05 percent as long as the sample to be detected contains the dsABS strain of the transgenic soybean with the mass proportion not less than 0.05 percent, shows higher sensitivity, has the advantages of strong specificity, high sensitivity, accurate and reliable detection result and the like in general, can lay a good methodological foundation for the planting monitoring, variety detection and the like of the dsABS strain of the transgenic soybean, and has better practical value.

Description

Specific PCR detection method for transgenic soybean dsABS strain

Technical Field

The invention belongs to the technical field of transgenic food detection, and particularly relates to a detection method for a dsABS strain of transgenic soybeans.

Background

When the qualitative detection of the components of the transgenic plants and the processed products thereof is carried out, the methods can be classified into a screening detection method, a gene specificity detection method, a strain specificity detection method and the like according to the detection specificity. Wherein the strain-specific detection is achieved by detecting the junction region sequence of the insertion vector and the plant genome. Because each transgenic plant strain has a specific exogenous insertion vector and a connecting region sequence of a plant genome, the strain specificity has higher specificity and accuracy and is most suitable for detecting transgenic products.

According to the national standard of "detection of transgenic plants and their product components", the strain specificity detection method usually has a certain requirement on the products amplified by the specificity PCR reaction, namely: the length is 120-300 bp, the amplified band is single, and the method can be used for displaying results by various instruments. Only if the requirements are met, the requirements of rapidness, accuracy and specificity of detection can be better met, and the kit can be more conveniently applied to the component detection of transgenic products.

For the transgenic soybean dsABS line, the line was obtained by ohio state university and tropical agraceae of chinaA new strain of soybean developed by institute of tropical biotechnology nuclear technology of academy. The strain is non-transgenic soybean (Glycine max) The cultivar Throne is a receptor, and a hairpin structure containing the conserved sequences of the genes of the alfalfa mosaic virus, the bean pod spot virus and the soybean mosaic virus replicase is introduced by an agrobacterium-mediated method, so that the strain has excellent capacity of resisting the alfalfa mosaic virus, the bean pod spot virus and the soybean mosaic virus simultaneously. The strain is currently being used in further testing, popularization and planting stages within a certain range. However, a better detection method aiming at the strain is not established in the prior art, and a better specific PCR detection method aiming at the dsABS strain of the transgenic soybean is established, so that the method has very important technical significance and application value for effectively popularizing, planting and monitoring the transgenic strain in the future.

Disclosure of Invention

The application mainly aims to provide a specific PCR detection method for a transgenic soybean dsABS strain, thereby laying a foundation for accurate and effective detection of the strain.

The technical scheme provided by the application is detailed as follows.

The pair of PCR primers for detecting the transgenic soybean dsABS strain is designed according to the 3' end of a transformation vector of the transgenic soybean dsABS and a flanking soybean sequence (the flanking soybean sequence is shown as SEQ ID NO. 1), and comprises Primer-F and Primer-R, the Primer sequence is shown as SEQ ID NO. 2-3, and the primers specifically comprise:

Primer-F ：5'-GAGAGGCGGTTTGCGTATTGGCTA-3'，

Primer-R ：5'-ACACTGTTCGCTCGCACTTATCTACT-3'。

a specific PCR detection method for a transgenic soybean dsABS strain specifically comprises the following steps:

(1) extracting DNA of a soybean sample to be detected; specifically, for example, the following are adopted: various methods for extracting DNA from plant materials, such as the CTAB method, the guanidinium isothiocyanate method, and the guanidinium hydrochloride method;

(2) performing PCR amplification by using the designed primers Primer-F and Primer-R and the DNA extracted in the step (1) as a template;

during PCR amplification, a 25. mu.L amplification system was designed as follows:

10 XPCR buffer, 2.5. mu.L,

dNTPs mixed solution, 2. mu.L,

Primer-F, 10. mu. mol/L, 1.0. mu.L;

Primer-R, 10. mu. mol/L, 1.0. mu.L;

EasyTaq enzyme, 5U/. mu.L, 0.2. mu.L;

25mg/L and 2.0 mu L of the DNA template extracted in the step (1);

adding double distilled water to 25 mu L;

the PCR amplification conditions were: 94 ℃ for 5 min; 94 ℃, 20s, 58 ℃, 20s, 72 ℃, 50s, 35 cycles; 72 ℃ for 2 min;

(3) performing electrophoresis detection on the PCR amplification product in the step (2), and determining the strain specificity of the soybean sample to be detected according to whether the expected specific fragment can be amplified, wherein the judgment standard is as follows:

if the size of the PCR amplified fragment is consistent with that of the expected specific fragment, the sample to be detected contains the transgenic soybean dsABS; if no specific amplified fragment exists or the size of the amplified fragment is inconsistent with the expected specific fragment, the sample to be detected does not contain the transgenic soybean dsABS;

the specific fragment sequence comprises 320bp, as shown in SEQ ID NO.4, and specifically comprises:

GAGAGGCGGTTTGCGTATTGGCTAGAGCAATTCGGCGTTAATTCAGTACATTAAAAACGTCCGCAATGTGTTATTAAGTTGTCTAAGCGTCAATTTGTTTACACCACAAGAAGGAAATATCACAACAAAAAAGGCAACAAGAAAAAAAAATGCAATACCACGTTAATCCAGATTGCTAATTAAATCTGAATGAGACATACAAAGCAAAACCAAGGTGATAAATCTGAACAAGACATCTAATACCTTAATCTATGTTCCACTCTTTGTCGTTAAAGGCACCATTCGCAGTGGTATAGTAGATAAGTGCGAGCGAACAGTGT。

after the preliminary qualitative detection is carried out by using the specific PCR detection method for the dsABS strain of the transgenic soybean provided by the application by taking the conventional soybean, the dsABS of the transgenic soybean, Mon89788, CV127, A5547-127, CTST-3-2 and other transgenic plants (rape GT73, rice TT51, corn Mon810, corn Bt176 and the like) as materials to be detected, the PCR amplification result shows that a band (320bp) with the size of a target fragment is obtained only by amplification in the dsABS genome of the transgenic soybean, and the band with the size of the target fragment is not obtained by amplification in the other transgenic plants, the conventional soybean and other genomes. Further sequencing analysis shows that the sequence obtained by amplification in the dsABS genome of the transgenic soybean to be detected is consistent with the sequence of the target amplification fragment. The result shows that the specific qualitative PCR detection method for the dsABS strain of the transgenic soybean, which is established by the application, has stronger specificity.

Taking the transgenic soybean dsABS strains with the mass ratios of 1%, 0.5%, 0.1% and 0.05% in a sample to be detected as examples, the detection limit of the specific PCR detection method for the transgenic soybean dsABS strains provided by the application is further detected and judged, and the result shows that the detection limit of the method is 0.05%, namely, the method can be detected as long as the sample to be detected contains the transgenic soybean dsABS strains with the mass ratio of not less than 0.05%, and has higher sensitivity.

In general, the method has the advantages of strong specificity, high sensitivity, accurate and reliable detection result and the like, can lay a good methodological foundation for planting monitoring, variety detection and the like of the dsABS strain of the transgenic soybean, and has good practical value.

Drawings

FIG. 1 shows the result of electrophoresis of the PCR amplified product, wherein: 1-3 are transgenic soybean dsABS, 4 is blank control, and M is 2000 DNA marker;

FIG. 2 is a method specific (accuracy) assay, wherein: m is 2000 DNA marker, 1 is blank control, and 2-6 are respectively sample 1, sample 2, sample 3, sample 4 and sample 5;

FIG. 3 shows the results of the detection limit (sensitivity) of the method, wherein: m is 2000 DNA marker, 1 is blank control, and 2-5 are samples with the copy number of the dsABS DNA of the transgenic soybean of 20000, 2000, 200, 20 and 2 respectively.

Detailed Description

The present application is further illustrated by the following examples. Before describing the specific embodiments, a brief description will be given of the following embodiments in relation to some of the background matters of the biological materials, the reagents, the experimental equipments, etc.

Biological material:

conventional soybean, is non-transgenic soybean (Glycine max) Cultivar Throne;

transgenic rice TT51, transgenic corn Mon810 and Bt176, transgenic soybean Mon89788, CV127, A5547-127 and CTST-3-2 are all common transgenic plants for research or transgenic plant varieties for foreign planting;

transgenic soybean dsABS, applicant was one of the line developers, thus retaining this material;

the related primers and sequencing are provided and completed by Shanghai bioengineering technology service company Limited;

experimental reagent:

reagents such as 10 XPCR buffer solution for PCR amplification, dNTPs mixed solution, EasyTaq enzyme and the like are purchased from Takara Shuzo (Dalian) Co., Ltd;

the plant DNA separation kit, the plasmid extraction kit and the glue recovery kit are purchased from the whole gold biotechnology limited company;

experimental equipment:

arktik multifunctional PCR instrument, american siemer feishel.

Example 1

The present example is briefly described below with respect to the PCR amplification process of the specific fragment sequence of the transgenic soybean dsABS strain.

Specifically, the following operations can be referred to for extracting DNA as a template for PCR amplification:

(1) taking about 100 mg dsABS transgenic soybean seed powder which is fully ground by adding liquid nitrogen

Putting the mixture into a centrifuge tube (pre-heated GP1 is added with mercaptoethanol, the final concentration of the mercaptoethanol is 0.1 percent) which is pre-filled with 700 mu L of 65 ℃ pre-heated buffer solution GP1, quickly reversing and uniformly mixing, then carrying out water bath on the centrifuge tube at 65 ℃ for 20 min, and reversing the centrifuge tube in the water bath process to mix samples for a plurality of times;

(2) adding 700 mu L of chloroform into the centrifuge tube in the step (1), fully and uniformly mixing, and centrifuging at 12000 rpm for 5 min;

then the upper aqueous phase is carefully transferred into a new centrifuge tube, 700 mu L of buffer solution GP2 is added, and the mixture is fully and evenly mixed;

(3) transferring the uniformly mixed liquid in the step (2) into an adsorption column CB3, centrifuging at 12000 rpm for 30 sec, and discarding waste liquid;

adding 500 μ L buffer GD (anhydrous ethanol is added before use) into adsorption column CB3, centrifuging at 12000 rpm for 30 sec, pouring off waste liquid, and placing adsorption column CB3 into a collection tube;

(4) adding 600 μ L of rinsing solution PW (anhydrous ethanol is added before use) into adsorption column CB3, centrifuging at 12000 rpm for 30 sec, pouring off waste liquid, and placing adsorption column CB3 into a collection tube; repeating the steps once;

(5) centrifuging an adsorption column CB3 in the collecting pipe at 12000 rpm for 2min, and pouring out waste liquid; placing the adsorption column CB3 at room temperature for several minutes to thoroughly dry the residual rinsing liquid in the adsorption material;

and finally, transferring the adsorption column CB3 into a clean centrifugal tube, suspending and dripping about 200 mu L of elution buffer TE into the middle part of the adsorption film, standing at room temperature for about 5min, centrifuging at 12000 rpm for 2min, and collecting the solution into the centrifugal tube to obtain the extracted DNA.

Taking 5 microliter of the extracted DNA solution, carrying out 0.8% agarose gel electrophoresis, and judging the quality of the DNA according to the brightness and the banding pattern; meanwhile, the concentration and purity of the DNA are determined by the Nirodop so as to judge whether the DNA is suitable to be used as a template for subsequent PCR amplification.

And (3) integrating the electrophoresis result, the concentration result and the purity result, wherein the DNA extracted by adopting the steps is suitable to be used as a template for subsequent PCR amplification.

(II) designing primers and carrying out PCR amplification

Designing primers Primer-F and Primer-R for PCR amplification according to a sequence (shown as SEQ ID NO.1, the sequence is a sequence of 663bp of a transformation vector 3' end and a flanking soybean sequence of the transgenic soybean dsABS, wherein the sequence is a vector sequence (shown as 269 bp) from an initial position to 269bp (inclusive), and the sequence is a soybean genome sequence (shown as 394 bp) from 270bp base to the end 663bp, the Primer sequence is shown as SEQ ID NO. 2-3, and specifically comprises the following steps:

Primer-F ：5'-GAGAGGCGGTTTGCGTATTGGCTA-3'，

Primer-R ：5'-ACACTGTTCGCTCGCACTTATCTACT-3'。

during PCR amplification, a 25. mu.L amplification system was designed as follows:

10 XPCR buffer, 2.5. mu.L,

dNTPs mixed solution, 2. mu.L,

Primer-F, 10. mu. mol/L, 1.0. mu.L;

Primer-R, 10. mu. mol/L, 1.0. mu.L;

EasyTaq enzyme, 5U/. mu.L, 0.2. mu.L;

25mg/L and 2.0 mu L of the DNA template extracted in the step (1);

adding double distilled water to 25 mu L;

the PCR amplification conditions were: 94 ℃ for 5 min; 94 ℃, 20s, 58 ℃, 20s, 72 ℃, 50s, 35 cycles; 72 deg.C, 2 min.

(III) analysis of results

And (5) performing electrophoresis on the PCR amplification product in the step (II), wherein the result is shown in FIG. 1. Further sequencing analysis shows that the size of the specific fragment sequence obtained by amplification by using the primer is 320bp, the sequence is a connection region sequence of an exogenous insertion vector and a soybean genome, and the specific sequence is shown as SEQ ID NO.4 (in the sequence, the sequence from the initial position to 109bp (inclusive) is a vector sequence (total 109 bp), and the base sequence from 110bp to the end 320bp is a soybean genome sequence (total 211 bp)).

Example 2

Based on example 1, in order to further test and evaluate the accuracy and sensitivity of the PCR detection method for the dsABS line specificity of transgenic soybean provided by the present application, the inventors performed further experiments, and the related experiments are briefly described as follows.

Accuracy test

Preparing DNA samples by adopting different sample raw materials respectively, wherein the specific sample raw materials are designed as follows:

sample 1: conventional soybeans;

sample 2: transgenic rice TT 51;

sample 3: transgenic corn Mon810 and Bt176 with the content of 50 percent (mass ratio) respectively, and uniformly mixing to obtain 1 sample;

sample 4: transgenic soybean Mon89788, CV127, A5547-127 and CTST-3-2, the contents of which are respectively 25 percent (mass ratio), are uniformly mixed to be used as 1 sample;

sample 5: transgenic soybean dsABS.

The primer pairs of example 1 and the amplification system of reference example 1 were used to perform PCR amplification using DNA samples extracted from the different samples as templates, and the results of electrophoresis detection of the PCR amplification products are shown in FIG. 2.

Analysis can show that the transgenic soybean dsABS sample only has a band (320bp) with the same size as the target fragment, and the other sample genomes have no fragments with the similar size as the target fragment. Further sequencing analysis also confirmed this result. The result shows that when the specific primers Primer-F and Primer-R are adopted for PCR amplification detection verification, the obtained PCR amplification product has high specificity for detecting and judging whether the transgenic soybean dsABS strain is the transgenic soybean dsABS strain, and the accuracy of the result can be better ensured.

Sensitivity test detection

In order to detect the sensitivity of the specific PCR detection method for the dsABS strain of the transgenic soybean provided by the application, firstly, DNA template samples for detection are prepared as follows:

a series of dsABS positive DNA samples (prepared by using dsABS of transgenic soybean in reference example 1) and corresponding non-transgenic soybean receptor DNA were mixed at different mass ratios to prepare samples containing 50%, 5%, 0.5%, 0.05%, 0.005% of dsABS transgenic soybean, and DNA was extracted. Then, PCR amplification was performed using primers Primer-F and Primer-R with reference to the PCR reaction system of example 1. The number of dsABS positive DNA copies in the DNA samples taken was 20000, 2000, 200, 20 and 2, respectively, and the results of electrophoretic detection analysis of the PCR amplification products are shown in FIG. 3.

The analysis result shows that: the target fragment of 320bp could be efficiently amplified in the template samples with DNA copy numbers of 20000, 2000, 200 and 20, respectively, whereas the target fragment could not be amplified in the template sample with DNA copy number of 2 and the reaction system. The result shows that the detection limit of the detection method provided by the invention is 20 copies, namely, the detection method can effectively detect the transgenic soybean dsABS strain with the mass ratio of not less than 0.05% in a sample to be detected, and has higher sensitivity.

SEQUENCE LISTING

<110> research institute of tropical biotechnology of Chinese tropical academy of agricultural sciences

<120> specific PCR detection method for transgenic soybean dsABS strain

<130> none

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 663

<212> DNA

<213> Glycine max

<400> 1

tcacaattcc acacaacata cgagccggaa gcataaagtg taaagcctgg ggtgcctaat 60

gagtgagcta actcacatta attgcgttgc gctcactgcc cgctttccag tcgggaaacc 120

tgtcgtgcca gctgcattaa tgaatcggcc aacgcgcggg gagaggcggt ttgcgtattg 180

gctagagcaa ttcggcgtta attcagtaca ttaaaaacgt ccgcaatgtg ttattaagtt 240

gtctaagcgt caatttgttt acaccacaag aaggaaatat cacaacaaaa aaggcaacaa 300

gaaaaaaaaa tgcaatacca cgttaatcca gattgctaat taaatctgaa tgagacatac 360

aaagcaaaac caaggtgata aatctgaaca agacatctaa taccttaatc tatgttccac 420

tctttgtcgt taaaggcacc attcgcagtg gtatagtaga taagtgcgag cgaacagtgt 480

tccacccatc tcacaacaca ccaccgactt catggctaaa gacatcgtcc gagtacaaaa 540

ttgagctatt gaatatacaa tctagaatat agacacaaac tctttcttac ggaataatta 600

atccggaatt attcaaacat aattttagat taagtaatct ggagtacaag ttgtatcctg 660

gat 663

<210> 2

<211> 24

<212> DNA

<213> Artificial design

<400> 2

gagaggcggt ttgcgtattg gcta 24

<210> 3

<211> 26

<212> DNA

<213> Artificial design

<400> 3

acactgttcg ctcgcactta tctact 26

<210> 4

<211> 320

<212> DNA

<213> Glycine max

<400> 4

gagaggcggt ttgcgtattg gctagagcaa ttcggcgtta attcagtaca ttaaaaacgt 60

ccgcaatgtg ttattaagtt gtctaagcgt caatttgttt acaccacaag aaggaaatat 120

cacaacaaaa aaggcaacaa gaaaaaaaaa tgcaatacca cgttaatcca gattgctaat 180

taaatctgaa tgagacatac aaagcaaaac caaggtgata aatctgaaca agacatctaa 240

taccttaatc tatgttccac tctttgtcgt taaaggcacc attcgcagtg gtatagtaga 300

taagtgcgag cgaacagtgt 320

Claims (4)

1. A pair of PCR primers for detecting a transgenic soybean dsABS strain is characterized by comprising Primer-F and Primer-R, wherein the Primer sequences are shown as SEQ ID NO. 2-3, and specifically comprise:

Primer-F ：5'-GAGAGGCGGTTTGCGTATTGGCTA-3'，

Primer-R ：5'-ACACTGTTCGCTCGCACTTATCTACT-3'。

2. the specific PCR detection method for the dsABS strain of the transgenic soybeans by using the PCR primer for detecting the dsABS strain of the transgenic soybeans, disclosed by claim 1, is characterized by specifically comprising the following steps of:

(1) extracting DNA of a soybean sample to be detected;

(2) performing PCR amplification by using the primers Primer-F and Primer-R and the DNA extracted in the step (1) as a template;

(3) performing electrophoresis detection on the PCR amplification product in the step (2), determining the strain specificity of the soybean sample to be detected according to whether an expected specific fragment can be obtained by amplification, wherein the judgment standard is as follows:

if the size of the PCR amplified fragment is consistent with that of the expected specific fragment, the sample to be detected contains the transgenic soybean dsABS; if no specific amplified fragment exists or the size of the amplified fragment is inconsistent with that of the expected specific fragment, the sample to be detected does not contain the transgenic soybean dsABS;

the specific fragment sequence comprises 320bp, as shown in SEQ ID NO.4, and specifically comprises:

GAGAGGCGGTTTGCGTATTGGCTAGAGCAATTCGGCGTTAATTCAGTACATTAAAAACGTCCGCAATGTGTTATTAAGTTGTCTAAGCGTCAATTTGTTTACACCACAAGAAGGAAATATCACAACAAAAAAGGCAACAAGAAAAAAAAATGCAATACCACGTTAATCCAGATTGCTAATTAAATCTGAATGAGACATACAAAGCAAAACCAAGGTGATAAATCTGAACAAGACATCTAATACCTTAATCTATGTTCCACTCTTTGTCGTTAAAGGCACCATTCGCAGTGGTATAGTAGATAAGTGCGAGCGAACAGTGT。

3. the specific PCR detection method for the dsABS strain of transgenic soybean as claimed in claim 2, wherein in the step (1), the DNA of the soybean sample to be detected is extracted, and specifically a CTAB method, a guanidinium isothiocyanate method or a guanidinium hydrochloride method is adopted.

4. The specific PCR detection method for the dsABS line of transgenic soybean as claimed in claim 2, wherein in the step (2), during PCR amplification, a 25 μ L amplification system is designed as follows:

10 XPCR buffer, 2.5. mu.L,

dNTPs mixed solution, 2. mu.L,

Primer-F, 10. mu. mol/L, 1.0. mu.L;

Primer-R, 10. mu. mol/L, 1.0. mu.L;

EasyTaq enzyme, 5U/. mu.L, 0.2. mu.L;

25mg/L and 2.0 mu L of the DNA template extracted in the step (1);

adding double distilled water to 25 mu L;

the PCR amplification conditions were: 94 ℃ for 5 min; 94 ℃, 20s, 58 ℃, 20s, 72 ℃, 50s, 35 cycles; 72 deg.C, 2 min.

Images