CN107880110A - GLP 1 (7 37) polypeptide analog - Google Patents

GLP 1 (7 37) polypeptide analog Download PDF

Info

Publication number
CN107880110A
CN107880110A CN201610857663.4A CN201610857663A CN107880110A CN 107880110 A CN107880110 A CN 107880110A CN 201610857663 A CN201610857663 A CN 201610857663A CN 107880110 A CN107880110 A CN 107880110A
Authority
CN
China
Prior art keywords
glp
polypeptide
fusion protein
protein
sumo
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201610857663.4A
Other languages
Chinese (zh)
Inventor
许峥
李峰
张华�
吴玲
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Yizhuang International Protein Pharmaceutical Technology Co Ltd
Original Assignee
Beijing Yizhuang International Protein Pharmaceutical Technology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Yizhuang International Protein Pharmaceutical Technology Co Ltd filed Critical Beijing Yizhuang International Protein Pharmaceutical Technology Co Ltd
Priority to CN201610857663.4A priority Critical patent/CN107880110A/en
Publication of CN107880110A publication Critical patent/CN107880110A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575—Hormones
    • C07K14/605—Glucagons
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/30—Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/31—Fusion polypeptide fusions, other than Fc, for prolonged plasma life, e.g. albumin

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Toxicology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Endocrinology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The present invention relates to a kind of new GLP 1 (7 37) analog, GLP 1 (7 37) analog has mutation A8S and V33R.After polypeptide analog is improved, there is higher bioactivity and longer biological half-life.The invention further relates to the fatty acid modifying thing comprising described new GLP 1 (7 37) analog and its utilization in diabetes are treated.

Description

GLP-1 (7-37) polypeptide analog
Technical field
The present invention relates to the treatment of type-II diabetes.More particularly it relates to GLP-1 (7-37) polypeptide analog And the fatty acid modifying thing of the polypeptide analog, the preparation method of these trims, and containing these trims in hypoglycemic agent Purposes in thing.
Background technology
Diabetes are a kind of carbohydrate metabolism disturbance diseases as caused by many factors such as h and E, have been turned into after swollen The 3rd major disease of human health and life security is threatened after knurl, cardiovascular and cerebrovascular disease.Diabetes are not necessarily made in itself Into harm, but long-term blood glucose increases, and big blood vessel, capilary are damaged and jeopardize the heart, brain, kidney, peripheral nerve, eyes, foot etc., according to generation Boundary's health organization statistics, diabetic complication are up to kind more than 100, are to be currently known a kind of most disease of complication.Because of glycosuria Caused by sick died has more than half to be cardiovascular and cerebrovascular, caused by 10% is nephropathy.Because diabetes amputation is the 10 of non-diabetic ~20 times.It is vital social concern that diabetes are treated for this and then prevent its complication.
Diabetes can be divided into several types due to ill mechanism difference.Wherein the overwhelming majority belongs to type-II diabetes (about 90%), mainly caused by overweight and shortage body movement.Insulin resistance and pancreas islet be present more in type 2 diabetes patient The plain aspect of hyposecretion two is abnormal, islet beta-cell apoptosis often occurs in the middle and advanced stage of morbidity.At present, Clinical practice is oral The mechanism of action of antidiabetic drug is mostly to strengthen insulin sensitivity, or promotes insulin secretion that it is thin can not to solve β with stabilizing blood sugar This problem of born of the same parents' apoptosis.And GLP-1 and the like medicines promote pancreas islet due to β Apoptosis is slowed down, promoting its regeneration β cell differentiations and the effect bred, become the research emphasis for the treatment of type ii diabetes.
GLP-1 is the most strong intestines peptide hormone of the promoting insulin secretion having found, it by with GLP-1 acceptors (GLP-1R) combine and play a role.After GLP-1 combinations GLP-1R, cyclic adenosine monophosphate (cAMP) and mitogen activation in active cell film Protein kinase (MAPK) path.The GLP-1 coupled receptors Gs of pancreas islet maturation β cells, adenosine acyl cyclase, cAMP is produced, The latter cooperates with glucose stimulates insulin synthesis and secretion, stimulates insulin gene transcription and proinsulin biosynthesis, can Reduce Glucagon concentrations and glucagon suppression secretion, enhancing cell to the sensitiveness of insulin, stimulate insulin according to Rely property Glycogen synthesis, reduce postprandial blood sugar concentration；Led to by activated protein kinase, phosphatidylinositol3 3 kinase (PI3K), MAPK Road, the expression of albumen and induction anti-apoptotic proteins Bcl-2 and Bcl-xL before apoptosis are adjusted, to slow down β Apoptosis, promotes it again It is raw, promote beta Cell of islet to break up and breed.
GLP-l induces various biological effect, such as irritates insulin secretion, glucagon suppression secretion, suppresses stomach Emptying, suppress stomach motion or bowel movement and inducing weight mitigation.GLP-l, which is noteworthy characterized by, irritates insulin secretion and without low blood Sugared related danger.GLP-l (1-37a.a) activity is very low, and both are natural by GLP-l (7-37a.a) and GLP-l (7-36) Existing truncated peptide is rapidly cleared in humans in vivo, and has half-life period inside extremely short, and which has limited the effective of GLP-l treatments Property.Known endogenic two peptidyls enzyme 4 (DPP4) makes circulation by cutting GLP-l peptide N-terminal histidines and alanine residue GLP-l peptides inactivation.Therefore produce that a kind of physiological action is similar with GLP-1 but the GLP-1 analogs that can not be degraded quickly into For the focus of research.
Granted GLP-1 medicines mainly have the Exenatide-4 isolated from lizard saliva in the market, and adopt With aliphatic acid, the people source GLP-1 analogs of antibody Fc section or seralbumin modification.With Novo Nordisk Co., Ltd in these products Fatty acid modifying Liraglutide drop hemoglobin glycosylation and drop body weight in terms of most effective and side effect it is less.But it is not Foot aspect is that Half-life in vivo only has 13 hours, it is necessary to daily administration.And analyzed according to newest structural information, GLP-1 fat Although substantially increasing its Half-life in vivo after acid modification, combined because aliphatic acid hinders it with acceptor, cause its biology Activity reduces, and metering is the dozens to one hundred times of other products.This considerably increases its cost of taking medicine, medicine side effect is added Risk.Therefore develop similar or be better than Liraglutide drug effect, but half-life period greatly increases, and biological activity is higher, and dosage is more Low medicine, there is the huge market demand and the market competitiveness.
The content of the invention
The present invention relates to a kind of new GLP-1 (7-37) polypeptide analog (calling GLP-1M (7-37) in the following text), the polypeptide Like thing GLP-1M protein amino acid sequence compared with native sequences, its have mutation A8S and V33R.Can also have simultaneously G16E and/or A24E mutation.
The invention further relates to a kind of SUMO-GLP-1M (7-37) fused protein, and the coding SUMO-GLP-1M The polynucleotide sequence gene of (7-37) fused protein, carrier including carrier comprising these polynucleotide sequence genes Host cell, and the GLP-1M protein expressed by these polynucleotide sequence gene translations, are made by the GLP-1M protein For the hypoglycemic medicine of main component.
First aspect present invention provides a kind of coding SUMO-GLP-1M (7-37) fused protein through codon optimization Polynucleotide sequence gene.
Second aspect of the present invention provides a kind of expression vector of structure, and it includes the excellent through codon of first aspect present invention The polynucleotide sequence gene of coding SUMO-GLP-1M (7-37) fused protein of change.The carrier is adapted to drive allogeneic dna sequence DNA The accurate translation HPV L1 protein in bacterium.In one embodiment, the preferred pET24 (+) of the expression vector.
The third aspect of the present invention provides a kind of engineering bacteria cell of structure, and the cell includes the more of first aspect present invention Nucleotide sequence gene, or the expression vector of second aspect.Described engineering bacteria host cell is Escherichia coli, in an implementation In scheme, the preferred BL21 of host cell (DE3) cell line.
Fourth aspect present invention provides more a variety of SUMO-GLP-1M (7-37) polynucleotide sequence bases by codon optimization Because of the amino acid sequence of the GLP-1M protein of expression.
Fifth aspect present invention provides the GLP-1 analogs that a kind of GLP-1M protein is formed after fatty acid modifying.
Sixth aspect present invention provides a kind of Pharmaceutical composition, and it includes GLP-1M fatty acid modifyings thing of the present invention, institute State and pharmaceutically useful pharmaceutical formulation is further included in composition.
In one embodiment, present invention also offers one kind to include GLP-1M or GLP-1M aliphatic acid of the present invention The pharmaceutical preparation of trim, the pharmaceutical preparation is also comprising acceptable carrier or excipient in pharmacy, a specific example Can be such as comprising GLP-1M fatty acid modifying things, with 1.4mg/ml disodium hydrogen phosphates, 5.5mg/ml phenol, 180mM ethanol third Diol mixture (mol ratio 1:4), pH=7.9 prepares final finished, -80 degree or 4 degree of preservations.
On the other hand, the present invention provides a kind of method of acquisition HPV L1 pentamers, and it, which is included in expression system, expresses HPV L1 protein through codon optimization, the cracking supernatant containing the protein is then subjected to purification process.Specific method Including：
A. the expression plasmid for designing synthesis is transformed into structure engineering bacteria cell in BL21 (DE3), in engineering bacteria cell SUMO-GLP-1M fused proteins are expressed, thalline is collected by centrifugation.
B. smudge cells, continuous flow centrifugation deepen texture filtering layer method and obtain supernatant.
C. using affine method capture purpose fusion protein.
D. SUMO proteases excision SUMO labels are added, obtain the GLP-1M polypeptides of preliminary purification.
E. desired polypeptides are further purified using hydrophobic chromatography method of purification.
F. desired polypeptides are obtained using isoelectric point precipitation, clarify solution with NaOH solution regulation pH11.0~12.5, Precipitation all dissolvings, according to polypeptide and aliphatic acid optimum mole ratio 1:1.5-1:5 add aliphatic acid, are reacted under the conditions of 15 degree 15-120 minutes.Add NaOH to final concentration 10-50mM, GLP-1M after the reaction of 4-15 degree is modified for 1 hour.
G. using hydrophobic chromatography and reverse method of purification purifying purpose modified polypeptide.
H. desired polypeptides are obtained using isoelectric point precipitation
I. 1.4mg/ml disodium hydrogen phosphates, 5.5mg/ml phenol, 180mM ethanol propylene glycol mixture (mol ratio 1 are used:4), PH=7.9 prepares final finished, -80 degree or 4 degree of preservations.
Preparation GLP-1M methods of the present invention, wherein the GLP-1M protein has mutation with native protein ratio A8S and V33R.There can also be G16E and/or A24E mutation simultaneously.
Preparation GLP-1M methods of the present invention, wherein the GLP-1M protein is by escherichia expression system The GLP-1M genes of DNA codon optimizations.
Preparation GLP-1M methods of the present invention, wherein the prokaryotic host cell is selected from, but not limited to, XA90, GI698, ER2566, BL21 (DE3), B834 (DE3), BLR (DE3).It is preferred that BL21 (DE3).
Preparation GLP-1M methods of the present invention, wherein the expression condition is：Under 20~37 DEG C of temperature conditionss, induction Expression 3~20 hours.In a specific embodiment preferably under 30 DEG C of temperature conditionss, induced expression 10 hours.
On the other hand, the application present invention also offers GLP-1M composition in type-II diabetes are treated.
According to the present invention, medicine of the invention can use the acceptable form of patient, including but not limited to injection or nasal cavity Administration, optimizing injection.
Beneficial effect：
As a result of amino acid mutation and brand-new fatty acid modifying technique, half-life period is old inside GLP-1M analogs In mouse 6-8 times is added than Liraglutide.Experiment on mice under same dose shows that GLP-1M analogs drug effect compares Liraglutide Efficacy time is longer.The analog must greatly facilitate patient's medication after succeeding in developing.
The polypeptide of brand-new design has higher biological activity.Unmodified new GLP-1 has than natural GLP-1 (7-37) There is more preferable In vitro biological activity.GLP-1M Billys after modification are drawn in the peptide body of Shandong, external activity is higher.Due to new GLP-1 Analog is similar with Liraglutide production cost, and the analog must substantially reduce patient's medication cost after succeeding in developing.
Figure of description
Fig. 1 is electrophoresis detection SUMO-GLP-1M protein expression profiles.
Fig. 2 is reverse purity detecting figure after GLP-1M (A8S/V33R) modifications.
Fig. 3 is reverse purity detecting figure after GLP-1M (A8S/V33R/G16E/A24E) modifications.
Fig. 4 is that medicine stimulates different sugar concentration lower level of insulin secretion to influence figure.
Fig. 5 behaviours GLP-1R genes rotaring redyeing 293 cell cAMP after various concentrations tested material and Liraglutide stimulate changes Figure.
Fig. 6-8 is different pharmaceutical to sugar tolerance in the Test Drawing of different time, and Fig. 6 is to compare folding between blood glucose value group in first day Line chart, Fig. 7 are to compare line chart between blood glucose value group in second day, and Fig. 8 compare line chart on the 3rd day between blood glucose value group.
Fig. 9 is blood concentration-time curve after Liraglutide and tested material subcutaneous administrations
Specific embodiment
Embodiment l：The design of the GLP-1M genes of codon optimization, synthesis are built with expression plasmid
According to the protein sequence of design using software carry out its polynucleotide sequence codon optimization design, after optimization The necessary sequence that 5 ends of its polynucleotide sequence are added between promoter and rbs sequences, rbs sequences, rbs express with starting The sequence such as codon ATG intervening sequence, the codon of ATG and six histidine.Above-mentioned sequence is entrusted into Shanghai JaRa company Synthesis, and synthetic gene is inserted between BamH1/SalI expression plasmid structure is completed in expression vector pET24 (+).It is related to Sequence is as follows
Protein sequence GLP-1M (A8S/V33R)
H SEGTFTSDVS SYLEGQAAKE FIAWLRRGRG
Express SUMO-GLP-1M (A8S/V33R) fusion protein synthetic polyribonucleotides sequence
ATTTTGTTTAACTTTAATAAGGAGATATACCATGCATCACCATCATCACCACATGTCGGACTCAGAAGT CAATCAAGAAGCTAAGCCAGAGGTCAAGCCAGAAGTCAAGCCTGAGACTCACATCAATTTAAAGGTGTCCGATGGAT CTTCAGAGATCTTCTTCAAGATCAAAAAGACCACTCCTTTAAGAAGGCTGATGGAAGCGTTCGCTAAAAGACAGGGT AAGGAAATGGACTCCTTAAGATTCTTGTACGACGGTATTAGAATCCAAGCTGATCAGACCCCTGAAGATTTGGACAT GGAGGATAACGATATTATTGAGGCTCACAGAGAACAGATTGGTGGACACTCGGAAGGTACCTTCACCTCTGACGTTT CTTCTTACCTGGAAGGTCAGGCGGCCAAAGAATTCATCGCTTGGCTGCGTCGTGGTCGTGGTTAATAATAA
Protein sequence GLP-1M (A8S/V33R/G16E/A24E)
H SEGTFTSDVS SYLEEQAAKE FIEWLRRGRG
Express SUMO-GLP-1M (A8S/V33R/G16E/A24E) fusion protein synthetic polyribonucleotides sequence
ATTTTGTTTAACTTTAATAAGGAGATATACCATGCATCACCATCATCACCACATGTCGGACTCAGAAGT CAATCAAGAAGCTAAGCCAGAGGTCAAGCCAGAAGTCAAGCCTGAGACTCACATCAATTTAAAGGTGTCCGATGGAT CTTCAGAGATCTTCTTCAAGATCAAAAAGACCACTCCTTTAAGAAGGCTGATGGAAGCGTTCGCTAAAAGACAGGGT AAGGAAATGGACTCCTTAAGATTCTTGTACGACGGTATTAGAATCCAAGCTGATCAGACCCCTGAAGATTTGGACAT GGAGGATAACGATATTATTGAGGCTCACAGAGAACAGATTGGTGGACACTCGGAAGGTACCTTCACCTCTGACGTTT CTTCTTACCTGGAAGAACAGGCGGCCAAAGAATTCATCGAATGGCTGCGTCGTGGTCGTGGTTAATAATAA
Embodiment 2：SUMO-GLP-1M (A8S/V33R) and SUMO-GLP-1M (A8S/V33R/G16E/A24E) albumen table Reach
The correct recombinant vector of sequencing result is converted into e. coli bl21 (DE3) (E.coli) host cell, and conduct The engineering bacteria for expressing recombinant protein carries out the expression of SUMO-GLP-1M albumen.Recombinant base is 2 × YT culture mediums (10g/L tryptones；5g/L dusty yeasts；10g/L NaCl).Thalline list spot of the picking containing recombinant plasmid is in 2 × YT of 10ml In culture medium, 230 revs/min (rpm), 37 DEG C of shaken cultivations are stayed overnight.The 5ml that transfers stays overnight bacterium in 500ml2 × YT fluid nutrient mediums In, when 37 DEG C of concussion and cultivate to recombination engineerings grow to OD600nm ≈ 0.4~1, final concentration 0.2mM IPTG inductions are added, The expression of 16h recombinant proteins is carried out under conditions of 30 DEG C.As a result Fig. 1 is seen
Embodiment 3：Purified after peptide purification, fatty acid modifying and modification
Cell is collected and crushed：Fermentation culture medium is centrifuged, abandons supernatant, bacterial sediment is harvested, weighs；Use BufferA (pH 8.0,50mM PB, 500mM NaCl) washing precipitations, are then resuspended in buffer A and carry out ultrasonic wave It is broken, then broken bacterium solution is centrifuged (16000rpm, 30min, 4 DEG C) by supercentrifuge, collects supernatant.
Affinity chromatography and digestion：Load Ni affinity chromatography medium 10ml in affinity column, chromatographic column is balanced with buffer A, so Loading afterwards, after no protein be washed till with Buffer L flowed out, it is affine to finish.Eluted and received with the Buffer of imidazoles containing 300mM A Collect SUMO-GLP-1M fused proteins.In mass ratio 1:100 addition SUMO protease 4 spend night digestion fusion protein.
Hydrophobic purifying and isoelectric precipitation：Balanced using Buffer B (pH 8.0,50mM PB, 0.3M ammonium sulfate) hydrophobic Chromatographic column.By after digestion sample add final concentration 0.3M ammonium sulfate after loading, with BufferC (20mM NaH2PO4,0.7M NaCl chromatographic column) is eluted.With 20mM ethanol elution desired polypeptides.PH is adjusted to 4.5-5.0 overnight precipitation desired polypeptides with HCl.
Fatty acid modifying：Polypeptide after centrifugation is precipitated.Instill 0.5M NaOH dropwise with liquid-transfering gun, regulation pH11.0~ All dissolving is used as terminal to observe solution clarification, precipitation by 12.5, regulation pH.2 μ l triethylamines are added according to every milliliter of aqueous solution Ratio add triethylamine, the volume ratio that 1.5ml acetonitriles are added according to every milliliter of aqueous solution adds acetonitrile.Reaction solution is moved to 15 In DEG C water-bath, instill 1M acetic acid dropwise with liquid-transfering gun under rotor stirring, adjust pH to 10.5~11.0.According to polypeptide and aliphatic acid Optimum mole ratio 1:3 calculate aliphatic acid dosage, are directly poured into polypeptide solution and controlled with electronic balance weighing aliphatic acid powder solid Bath temperature stirring reaction half an hour.Reaction adds the 0.5M NaOH of cumulative volume 25% (to final concentration 0.1M after terminating NaOH), quickly stir and evenly mix.Reaction solution is put into 15 DEG C of water-baths and stands 1 hour after mixing, and instilling 1M acetic acid with liquid-transfering gun is adjusted PH is to 7.4~7.6 terminating reactions.
Reversely purifying：The reverse purification columns of C18 are balanced with 40% acetonitrile.Loading C18 after samples with water dilutes 2 times after modifying With polypeptide after the modification of 40%-80% acetonitriles linear gradient elution after reverse purification column.Sample is collected to be examined with the reverse analytical columns of C18 Survey, as a result see Fig. 2-3.
Embodiment 4 stimulates insulin secretion experiment
Raw 3~4 weeks SD rats are taken out, 75% ethanol disinfection, sterile taking-up pancreas, remove the outer nethike embrane of pancreas, adipose tissue Afterwards, rinsed 2 times through 4 DEG C of Hanks liquid, add the 0.5mg/ml of 2~3 times of volumes collagen type v enzyme, mixed, 37 DEG C of water-bath concussions Digest 6~8min.Muddy to digestion, supernatant is drawn in natural sedimentation, and digestion is terminated with 4 DEG C of Hanks liquid, repeats digestion step above Suddenly, until digestion is complete, the digestive juice of each time is collected, 1000rpm centrifugation 5min, supernatant is abandoned, cell is resuspended in containing 10% tire In the T75 bottles of the culture mediums of RPMI 1640 of cow's serum, cultivated in the CO2gas incubator of 37 DEG C of 5%CO2-95% air.Carefully Born of the same parents are cultivated to 3d, form cell monolayer, are incubated 1h with 1,640 37 DEG C of the RPMI of sugar-free serum-free, then use low sugar instead respectively (2.8mM) high sugared (16.8mM) drug containing or without 37 DEG C of incubation 1h of drug solns, collects supernatant, insulin concentration is detected with ELISA. As a result Fig. 4 are seen
Embodiment 5
293 cell lines of expression human glucagon-like-peptide-1 acceptor (GLP-1R) gene are constructed, after transfection HEK293/GLP-1R cells are inoculated in 12 orifice plates according to every 2 × 105 cells/wells in hole (1ml/ holes), are put into 37 DEG C, and 5% Be incubated 6-8h in CO2 incubators, after cell attachment, added respectively in every hole final concentration 0.1pM, 1pM, 10pM, 100pM, 1000pM and 10000pM Liraglutide, GLP-1M (A8S/V33K/G16E/A24E) and GLP-1M (A8S/V33R) (1ml/ Hole), continue to cultivate 24h, cAMP contents are detected using kit.As a result stimulation of the recombinant cell strain Jing Guo tested material is shown Afterwards, the cAMP contents in its cell are significantly raised, and tested material GLP-1M (A8S/V33K/G16E/A24E) EC50 values are approximately profit The 1/4 of Shandong peptide is drawn, tested material GLP-1M (A8S/V33R) EC50 values are approximately 1/3 (the EC50 values of Liraglutide of Liraglutide 81.8pM, GLP-1M (A8S/V33K/G16E/A24E) EC50 values 21.6pM, GLP-1M (A8S/V33R) EC50 values 27.7pM)。
The sugar tolerance of embodiment 6. is tested
Select 4 week old ICR male mices 40, be randomly divided into 4 groups, experimental group difference gavage 0.1mg/kg Liraglutide and 0.05mg/kg 2 different tested materials, 25% G/W 5g/kg is gavaged with blank group after half an hour together.After gavage 2h, 6h, 12h, 24h, 48h, 72h detect tail vein sugared content, and second day and the 3rd day same time point gavage glucose simultaneously Detect blood glucose value.As a result show, first day Liraglutide group and two tested material blood glucose values are significantly lower than blank group, second day Liraglutide group blood glucose value has been substantially equal to blank group and tested group is still significantly lower than blank group, and the 3rd day Liraglutide is without drop blood Sugared activity, two tested group of blood glucose values have raised but have still been less than blank control group group.As a result Fig. 6-8 is seen.
Embodiment 7.SD mouse pharmacokinetics
Select male SD rat 30, be randomly divided into 3 groups, respectively single subcutaneous injection 0.1mg/kg Liraglutide and 0.05mg/kg 2 different tested materials【GLP-1M(A8S/V33K/G16E/A24E)/GLP-1M(A8S/V33R)】, it is being administered Different time points are taken a blood sample after preceding and administration, separate serum, and containing for Liraglutide and tested material in serum is detected with GLP-1 kits Amount.As a result showing, the biological half-life of two tested materials is obviously prolonged compared with Liraglutide, and GLP-1M (A8S/V33R) reaches 26h, GLP-1M (A8S/V33K/G16E/A24E) reaches 28h (Liraglutide biology phase half-life period 4h).GLP-1M (A8S/V33R)/profit The relative bioavailability for drawing Shandong peptide is the Relative biological of 2163%, GLP-1M (A8S/V33K/G16E/A24E)/Liraglutide Availability is 1833%.As a result Fig. 9 is seen.

Claims (10)

1.GLP-1M (7-37) polypeptide, the polypeptide have the amino acid sequence that below formula represents：
Protein sequence GLP-1M (A8S/V33R/G16E/A24E)
H SEGTFTX8DVS SYLEX16QAAKE FIX24WLX33RGRG, wherein：
X8For S,
X16For G or E,
X24For A or E,
X33For R.
2. polypeptide according to claim 1, wherein,
X8For S,
X16For G,
X24For A,
X33For R.
3. polypeptide according to claim 1, wherein,
X8For S,
X16For E,
X24For E,
X33For R.
4. it is coupled comprising polypeptide described in any one claim in claim 1-3 and the aliphatic acid that long chain fatty acids combine to form Thing.
5. fusion protein, the fusion protein includes polypeptide described in any one claim in claim 1-3, and with it is described Another albumen or polypeptide that polypeptide combines.
6. the fusion protein described in claim 5, another more peptide or proteins are selected from antibody Fc section or albumin albumen.
7.SUMO-GLP-1M (7-37) fusion protein, the fusion protein include any one claim institute in claim 1-3 State polypeptide.
8. the polynucleotides of separation, the polynucleotides are used to encode SUMO-GLP-1M described in claim 7 (7-37) fusion eggs In vain.
9. including the expression vector of polynucleotides described in claim 8, and include the host of the expression vector.
10. utilization of any one polypeptide in preventing and/or treating diabetes medicament in claim 1-3.
CN201610857663.4A 2016-09-27 2016-09-27 GLP 1 (7 37) polypeptide analog Pending CN107880110A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610857663.4A CN107880110A (en) 2016-09-27 2016-09-27 GLP 1 (7 37) polypeptide analog

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610857663.4A CN107880110A (en) 2016-09-27 2016-09-27 GLP 1 (7 37) polypeptide analog

Publications (1)

Publication Number Publication Date
CN107880110A true CN107880110A (en) 2018-04-06

Family

ID=61769318

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610857663.4A Pending CN107880110A (en) 2016-09-27 2016-09-27 GLP 1 (7 37) polypeptide analog

Country Status (1)

Country Link
CN (1) CN107880110A (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106608915A (en) * 2015-10-26 2017-05-03 北京凯因科技股份有限公司 GLP-1(7-37) polypeptide analog

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106608915A (en) * 2015-10-26 2017-05-03 北京凯因科技股份有限公司 GLP-1(7-37) polypeptide analog

Similar Documents

Publication Publication Date Title
CN109879970A (en) A kind of fusion protein and its method for preparing Liraglutide intermediate polypeptide
CN106220724A (en) Human fibroblastic growth factor 21 recombiant protein and its preparation method and application
CN104080473A (en) Therapeutic agents comprising insulin amino acid sequences
CN105025919A (en) Therapeutic agents, compositions, and methods for glycemic control
CN113265007B (en) Fusion protein for treating metabolic diseases and preparation method and application thereof
CN106432509B (en) A kind of 21 fusion protein of recombinant human fibroblast growth factor and its preparation method and application for treating metabolic disease
CN105367664B (en) Activate GLP-1 receptor and the preparation of the fusion protein of the difunctional effect of Amylin receptor and application thereof
Mikiewicz et al. Soluble insulin analogs combining rapid-and long-acting hypoglycemic properties–From an efficient E. coli expression system to a pharmaceutical formulation
CN106397607A (en) Recombinant human fibroblast growth factor 21 fusion protein and application thereof in preparation of medicine for treating metabolic diseases
CN102010473A (en) Recombinant oxyntomodulin (OXM) fusion protein, and preparation and application thereof
CN111793126A (en) Preparation method of GLP-1 analogue polypeptide and application thereof in type II diabetes
CN112584853A (en) Structure of novel insulin aspart and method for preparing insulin aspart
CN106608915A (en) GLP-1(7-37) polypeptide analog
US20030166062A1 (en) Methods and compositions for production of recombinant peptides
Allen et al. Recent advances and near future of insulin production and therapy
CN113105561B (en) Preparation method and application of double-target fusion protein
CN105254763A (en) Recombinant insulin secretion promoter fusion protein and its preparation method and use
CN106432511A (en) GLP-1 analogue-Fc fusion protein and preparation method and application thereof
CN113880954A (en) Recombinant human growth hormone and construction method and application thereof
WO2023030444A1 (en) Glp-1/gip dual-targeted polypeptide and fusion protein and applications thereof
CN110092825A (en) A method of Liraglutide intermediate polypeptide is prepared using genetic recombination
CN107880110A (en) GLP 1 (7 37) polypeptide analog
CN101698681B (en) Chimeric polypeptide with dual-targeting function and applications thereof
CN102093475B (en) Analogue of glucagon like peptide-1
CN102712690B (en) The analogue of long-acting Exendin 4

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
WD01 Invention patent application deemed withdrawn after publication
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20180406