CN106608915A - GLP-1(7-37) polypeptide analog - Google Patents

Abstract

The present invention relates to a new GLP-1(7-37) analog, which has mutated A8S and mutated V33R, wherein the polypeptide analog has high biological activity and long biological half-life after the modification. The present invention further relates to a fatty acid modifier containing the new GLP-1(7-37) analog and applications of the fatty acid modifier in diabetes treatment.

Description

GLP-1 (7-37) polypeptide analog

Technical field

The present invention relates to the treatment of type-II diabetes.More particularly it relates to GLP-1 (7-37) polypeptide analogs and institute State the fatty acid modifying thing of polypeptide analog, the preparation method of these trims, and containing these trims in hypoglycemic drug Purposes.

Background technology

Diabetes are a kind of carbohydrate metabolism disturbance diseases caused by many factors such as h and Es, have been become after tumor, heart and brain The 3rd major disease of human health and life security is threatened after angiopathy.Diabetes itself not necessarily work the mischief, but Long-term blood glucose increases, and big blood vessel, blood capillary are damaged and jeopardize the heart, brain, kidney, peripheral nerve, eyes, foot etc., defend according to the world Raw tissue statistics, diabetic complication is up to kind more than 100, is to be currently known a kind of most disease of complication.Because glycosuria is died of illness It is that caused by cardiovascular and cerebrovascular vessel, 10% is caused by nephropathy that the person of dying has more than half.Because diabetes amputation is ND 10～20 times. Diabetes are treated for this and then prevents its complication it is critical that social problem.

Diabetes can be divided into several types due to ill mechanism difference.Wherein the overwhelming majority belongs to type-II diabetes (about 90%), main If because of overweight and lacking caused by body movement.There is insulin resistant and hypoinsulinism type ii diabetes patient more Two aspects are abnormal, islet beta-cell apoptosis often occur in the middle and advanced stage of morbidity.At present, the work of the oral antidiabetic drug of Clinical practice Mostly strengthen insulin sensitivity with mechanism, or promote insulin secretion with stabilizing blood sugar, cannot solve β apoptosis this A difficult problem.And GLP-1 and the like medicines promote beta Cell of islet point due to β apoptosis are slowed down, promoting its regeneration The effect changed and breed so as to become the research emphasis for the treatment of type ii diabetes.

GLP-1 is the most strong intestinal peptide hormone of the promoting insulin secretion having found, it by with GLP-1 receptors (GLP-1R) With reference to playing a role.GLP-1 is combined after GLP-1R, cyclic adenosine monophosphate (cAMP) and mitogen-activated protein in active cell film Kinases (MAPK) path.The GLP-1 coupled receptors Gs of islets of langerhans maturation β cells, adenosine acyl cyclase produces cAMP, The latter cooperates with stimulation insulin synthesis and secretion with glucose, stimulates insulin gene transcription and proinsulin biosynthesiss, can drop Low Glucagon concentrations and glucagon suppression secretion, strengthen sensitivity of the cell to insulin, stimulate insulin-dependent Glycogen synthesis, reduce post-prandial glycemia concentration；By activated protein kinase, phosphatidylinositol3 3 kinase (PI3K), MAPK passages, The expression of albumen and induction anti-apoptotic proteins Bcl-2 and Bcl-xL before apoptosis is adjusted, to slow down β apoptosis, promotes its regeneration, Beta Cell of islet is promoted to break up and breed.

GLP-l induce various biological effect, for example irritate insulin secretion, glucagon suppression secretion, suppress gastric emptying, Stomach motion or bowel movement and inducing weight is suppressed to mitigate.GLP-l is noteworthy characterized by and irritates insulin secretion and related without hypoglycemia Danger.GLP-l (1-37a.a) activity is very low, and GLP-l (7-37a.a) and GLP-l (7-36) both natural deposit Truncated peptide be rapidly cleared in humans in vivo, and with extremely short Half-life in vivo, which has limited the effectiveness of GLP-l treatments. Known endogenic two peptidyls enzyme 4 (DPP4) makes circulation by cutting GLP-l peptide N-terminal histidine and alanine residue GLP-l peptides inactivation.Therefore produce that a kind of physiological action is similar with GLP-1 but the GLP-1 analog that can not be degraded quickly into For the focus of research.

GLP-1 medicines granted in the market mainly have the Exenatide-4 isolated from Eremiatis argi saliva, and using fat The people source GLP-1 analog of acid, antibody Fc section or serum albumin modification.With the fat of Novo Nordisk Co., Ltd in these products The Arg34Lys26-(N-EPSILON-(N-ALPHA-Palmitoyl-L-GAMMA-glutamyl))-GLP-1[7-37] of fat acid modification is most effective in terms of drop hemoglobin glycosylation and drop body weight and side effect is less.But its deficiency aspect It is that Half-life in vivo only has 13 hours, needs administration daily.And analyzed according to newest structural information, GLP-1 fatty acid modifyings Although substantially increasing its Half-life in vivo afterwards, because fatty acid hinders itself and receptor binding, its biological activity is caused to reduce, Metering is the dozens to one hundred times of other products.Its medication cost is this considerably increases, medicine side effect risk is increased.Therefore Develop similar or be better than Arg34Lys26-(N-EPSILON-(N-ALPHA-Palmitoyl-L-GAMMA-glutamyl))-GLP-1[7-37] drug effect, but the half-life greatly increases, and biologic activity is higher, the lower medicine of dosage, has The huge market demand and the market competitiveness.

The content of the invention

The present invention relates to a kind of new GLP-1 (7-37) polypeptide analog (calling GLP-1M (7-37) in the following text), the polypeptide analog The aminoacid sequence of GLP-1M protein compares with native sequences, and it has mutation A8S and V33R.There can also be G16E simultaneously And/or A24E mutation.

The invention further relates to a kind of SUMO-GLP-1M (7-37) fused protein, and encode the SUMO-GLP-1M (7-37) The polynucleotide sequence gene of fused protein, the carrier comprising these polynucleotide sequence genes, including the host cell of carrier, And by the GLP-1M protein of these polynucleotide sequence gene translations expression, by the GLP-1M protein as mainly into The hypoglycemic medicine for dividing.

First aspect present invention provides a kind of multinuclear of coding SUMO-GLP-1M (7-37) fused protein of end count numeral optimization Nucleotide sequence gene.

Second aspect present invention provides a kind of expression vector of structure, and it includes the volume of the end count numeral optimization of first aspect present invention The polynucleotide sequence gene of code SUMO-GLP-1M (7-37) fused protein.The carrier is adapted to drive allogeneic dna sequence DNA in antibacterial Middle accurate translation HPV L1 protein.In one embodiment, the preferred pET24 (+) of the expression vector.

A third aspect of the present invention provides a kind of engineering bacteria cell of structure, polynucleotide of the cell comprising first aspect present invention Sequence gene, or the expression vector of second aspect.Described engineering bacteria host cell is escherichia coli, in one embodiment, Preferred BL21 (DE3) cell strain of the host cell.

Fourth aspect present invention provides more a variety of SUMO-GLP-1M (7-37) polynucleotide sequence gene expressions by codon optimization GLP-1M protein aminoacid sequence.

Fifth aspect present invention provides the GLP-1 analog that a kind of GLP-1M protein is formed Jing after fatty acid modifying.

Sixth aspect present invention provides a kind of Pharmaceutical composition, and it includes GLP-1M fatty acid modifyings thing of the present invention, the combination Pharmaceutically useful pharmaceutical formulation is further included in thing.

In one embodiment, present invention also offers a kind of include GLP-1M or GLP-1M fatty acid modifyings of the present invention The pharmaceutical preparation of thing, also comprising acceptable carrier or excipient in pharmacy, a specific example can be for the pharmaceutical preparation GLP-1M fatty acid modifying things are such as included, 1.4mg/ml disodium hydrogen phosphates, 5.5mg/ml phenol, 180mM ethanol Propylene Glycol is used Mixture (mol ratio 1:4), pH=7.9 prepares final finished, -80 degree or 4 degree of preservations.

On the other hand, the present invention provides a kind of method of acquisition HPV L1 pentamers, and it is included in expression end count code in expression system The HPV L1 protein of son optimization, then carries out purification process by the cracking supernatant containing the protein.Concrete grammar includes：

A. the expression plasmid of design synthesis is transformed in BL21 (DE3) and builds engineering bacteria cell, expressed in engineering bacteria cell SUMO-GLP-1M fused proteins, are collected by centrifugation thalline.

B. smudge cellses, continuous flow centrifugation deepens texture filtering layer method and obtains supernatant.

C. purpose fusion protein is captured using affine method.

D. SUMO proteases excision SUMO labels are added, the GLP-1M polypeptides of preliminary purification are obtained.

E. desired polypeptides are further purified using hydrophobic chromatography method of purification.

F. desired polypeptides are obtained using isoelectric point precipitation, adjusting pH11.0～12.5 with NaOH solution makes solution clarification, precipitation all molten Solution, according to polypeptide and fatty acid optimum mole ratio 1:1.5-1:5 add fatty acid, react 15-120 minutes under the conditions of 15 degree.Add NaOH to final concentration 10-50mM, 4-15 degree reacts GLP-1M after being modified for 1 hour.

G. using hydrophobic chromatography and reverse method of purification purification purpose modified polypeptide.

H. desired polypeptides are obtained using isoelectric point precipitation

I. 1.4mg/ml disodium hydrogen phosphates, 5.5mg/ml phenol, 180mM ethanol propylene glycol mixture (mol ratios 1 are used:4), pH=7.9 Prepare final finished, -80 degree or 4 degree of preservations.

Preparation GLP-1M methods of the present invention, wherein the GLP-1M protein and native protein ratio have mutation A8S and V33R.There can also be G16E and/or A24E mutation simultaneously.

Preparation GLP-1M methods of the present invention, wherein the GLP-1M protein is close through escherichia expression system DNA The GLP-1M genes of numeral optimization.

Preparation GLP-1M methods of the present invention, wherein the prokaryotic host cell is selected from, but not limited to, XA90, GI698, ER2566, BL21 (DE3), B834 (DE3), BLR (DE3).It is preferred that BL21 (DE3).

Preparation GLP-1M methods of the present invention, wherein the expression condition is：Under 20～37 DEG C of temperature conditionss, abduction delivering 3～20 hours.In a specific embodiment preferably under 30 DEG C of temperature conditionss, abduction delivering 10 hours.

On the other hand, present invention also offers application of the compositionss of GLP-1M in treatment type-II diabetes.

According to the present invention, the medicine of the present invention can adopt the acceptable form of patient, including but not limited to injection or nasal-cavity administration, Optimizing injection.

Beneficial effect：

As a result of amino acid mutation and brand-new fatty acid modifying technique, the Half-life in vivo of GLP-1M analog compares in mouse Arg34Lys26-(N-EPSILON-(N-ALPHA-Palmitoyl-L-GAMMA-glutamyl))-GLP-1[7-37] increased 6-8 times.Experiment on mice under same dose shows, when GLP-1M analog drug effect is than Arg34Lys26-(N-EPSILON-(N-ALPHA-Palmitoyl-L-GAMMA-glutamyl))-GLP-1[7-37] drug effect Between it is longer.The analog must greatly facilitate patient's medication after succeeding in developing.

The polypeptide of brand-new design has higher biologic activity.Unmodified new GLP-1 has more than natural GLP-1 (7-37) Good In vitro biological activity.GLP-1M Billys after modification are drawn in the peptide body of Shandong, external activity is higher.Because new GLP-1 is similar to Thing is similar with Arg34Lys26-(N-EPSILON-(N-ALPHA-Palmitoyl-L-GAMMA-glutamyl))-GLP-1[7-37] production cost, and the analog must substantially reduce patient's medication cost after succeeding in developing.

Figure of description

Fig. 1 is electrophoresis detection SUMO-GLP-1M protein expression profile.

Fig. 2 is reverse purity detecting figure after GLP-1M (A8S/V33R) modifications.

Fig. 3 is reverse purity detecting figure after GLP-1M (A8S/V33R/G16E/A24E) modifications.

Fig. 4 is that medicine stimulates different sugar concentration lower level of insulin secretion to affect figure.

Fig. 5 behaviours GLP-1R genes rotaring redyeing 293 cell cAMP variation diagrams Jing after variable concentrations tested material and Arg34Lys26-(N-EPSILON-(N-ALPHA-Palmitoyl-L-GAMMA-glutamyl))-GLP-1[7-37] stimulation.

Fig. 6-8 be different pharmaceutical to carbohydrate tolerance different time Test Drawing, Fig. 6 compared broken line graph for first day between blood glucose value group, Fig. 7 compared broken line graph, Fig. 8 for second day between blood glucose value group. compare broken line graph between the 3rd day blood glucose value group.

Fig. 9 is blood concentration-time curve after Arg34Lys26-(N-EPSILON-(N-ALPHA-Palmitoyl-L-GAMMA-glutamyl))-GLP-1[7-37] and tested material subcutaneous administrations

Specific embodiment

Embodiment l：The design of the GLP-1M genes of codon optimization, synthesis builds with expression plasmid

The codon optimization design of its polynucleotide sequence is carried out using software according to the protein sequence of design, in its multinuclear after optimization 5 ends of nucleotide sequence add the necessary sequence between promoter and rbs sequences, rbs sequences, rbs to express password with starting The sequences such as the intervening sequence of sub- ATG, the codon of ATG and six histidine.By the synthesis of above-mentioned sequence commission Shanghai JaRa company, And synthetic gene is inserted between BamH1/SalI expression plasmid structure is completed in expression vector pET24 (+).It is related to sequence such as Under

Protein sequence GLP-1M (A8S/V33R)

H SEGTFTSDVS SYLEGQAAKE FIAWLRRGRG

Expression SUMO-GLP-1M (A8S/V33R) fusion protein synthetic polyribonucleotidess sequence

ATTTTGTTTAACTTTAATAAGGAGATATACCATGCATCACCATCATCACCACATGTCGGA CTCAGAAGTCAATCAAGAAGCTAAGCCAGAGGTCAAGCCAGAAGTCAAGCCTGAGACTCACATCAA TTTAAAGGTGTCCGATGGATCTTCAGAGATCTTCTTCAAGATCAAAAAGACCACTCCTTTAAGAAGGC TGATGGAAGCGTTCGCTAAAAGACAGGGTAAGGAAATGGACTCCTTAAGATTCTTGTACGACGGTATT AGAATCCAAGCTGATCAGACCCCTGAAGATTTGGACATGGAGGATAACGATATTATTGAGGCTCACAG AGAACAGATTGGTGGACACTCGGAAGGTACCTTCACCTCTGACGTTTCTTCTTACCTGGAAGGTCAG GCGGCCAAAGAATTCATCGCTTGGCTGCGTCGTGGTCGTGGTTAATAATAA

Protein sequence GLP-1M (A8S/V33R/G16E/A24E)

H SEGTFTSDVS SYLEEQAAKE FIEWLRRGRG

Expression SUMO-GLP-1M (A8S/V33R/G16E/A24E) fusion protein synthetic polyribonucleotidess sequence

ATTTTGTTTAACTTTAATAAGGAGATATACCATGCATCACCATCATCACCACATGTCGGA CTCAGAAGTCAATCAAGAAGCTAAGCCAGAGGTCAAGCCAGAAGTCAAGCCTGAGACTCACATCAA TTTAAAGGTGTCCGATGGATCTTCAGAGATCTTCTTCAAGATCAAAAAGACCACTCCTTTAAGAAGGC TGATGGAAGCGTTCGCTAAAAGACAGGGTAAGGAAATGGACTCCTTAAGATTCTTGTACGACGGTATT AGAATCCAAGCTGATCAGACCCCTGAAGATTTGGACATGGAGGATAACGATATTATTGAGGCTCACAG AGAACAGATTGGTGGACACTCGGAAGGTACCTTCACCTCTGACGTTTCTTCTTACCTGGAAGAACAG GCGGCCAAAGAATTCATCGAATGGCTGCGTCGTGGTCGTGGTTAATAATAA

Embodiment 2：SUMO-GLP-1M (A8S/V33R) and SUMO-GLP-1M (A8S/V33R/G16E/A24E) protein expression

The correct recombinant vector of sequencing result is converted into e. coli bl21 (DE3) (E.coli) host cell, and as expression The engineering bacteria of recombinant protein carries out the expression of SUMO-GLP-1M albumen.Recombinant base is 2 × YT culture medium (10g/L Tryptone；5g/L yeast powders；10g/L NaCl).Thalline list speckle of the picking containing recombiant plasmid is cultivated in 2 × YT of 10ml In base, 230 revs/min (rpm), 37 DEG C of shaken cultivation are overnight.Switching 5ml overnight bacterium in 500ml2 × YT liquid cultures In base, when 37 DEG C of concussion and cultivate to recombination engineerings grow to OD600nm ≈ 0.4～1, the IPTG for adding final concentration 0.2mM is lured Lead, the expression of 16h recombinant proteins is carried out under conditions of 30 DEG C.As a result Fig. 1 is seen

Embodiment 3：Purification after peptide purification, fatty acid modifying and modification

Cell is collected and broken：Fermentation culture medium is centrifuged, supernatant is abandoned, bacterial sediment is harvested, is weighed；Using bufferA (pH 8.0,50mM PB, 500mM NaCl) washing precipitation, being then resuspended in buffer A carries out ultrasound wave and breaks It is broken, subsequently broken bacterium solution is centrifuged (16000rpm, 30min, 4 DEG C) by high speed centrifuge, collect supernatant.

Affinity chromatograph and enzyme action：Load Ni affinity chromatography medium 10ml in affinity column, chromatographic column is balanced with buffer A, then Loading, is washed till with Buffer L after finishing and is flowed out without protein, affine to finish.With the Buffer A of imidazoles containing 300mM eluting receipts Collection SUMO-GLP-1M fused proteins.In mass ratio 1:100 addition SUMO protease 4 spend night enzyme action fusion protein.

Hydrophobic purification and isoelectric precipitation：Hydrophobic chromatography is balanced using Buffer B (pH 8.0,50mM PB, 0.3M ammonium sulfate) Post.Sample after enzyme action is added into loading after final concentration 0.3M ammonium sulfate, with BufferC (20mM NaH2PO4,0.7M NaCl) pouring Wash chromatographic column.With 20mM ethanol elution desired polypeptides.PH to 4.5-5.0 overnight precipitation desired polypeptides are adjusted with HCl.

Fatty acid modifying：Polypeptide after being precipitated is centrifuged.0.5M NaOH are dropwise instilled with liquid-transfering gun, pH11.0～12.5 are adjusted, Adjust pH and all dissolved as terminal using observing solution clarification, precipitation.The ratio of 2 μ l triethylamines is added according to every milliliter of aqueous solution Example adds triethylamine, adds the volume ratio of 1.5ml acetonitriles to add acetonitrile according to every milliliter of aqueous solution.Reactant liquor is moved to into 15 DEG C of water In bath, 1M acetic acid is dropwise instilled with liquid-transfering gun under rotor stirring, adjust pH to 10.5～11.0.According to polypeptide and fatty acid most Good mol ratio 1:3 calculate fatty acid consumption, are directly poured in polypeptide solution with electronic balance weighing fatty acid powder solid and control water-bath Temperature stirring reaction half an hour.Reaction adds the 0.5M NaOH (to final concentration 0.1M NaOH) of cumulative volume 25% after terminating, soon Fast stirring and evenly mixing.Reactant liquor is put in 15 DEG C of water-baths and stands 1 hour after mixing, and 1M vinegar acid for adjusting pH is instilled extremely with liquid-transfering gun 7.4～7.6 terminating reactions.

Reverse purification：With the reverse purification columns of 40% acetonitrile balance C18.Loading C18 is reverse after samples with water dilutes 2 times after modifying With polypeptide after the modification of 40%-80% acetonitriles linear gradient elution after purification column.Collect sample C18 and reversely analyze post detection, as a result See Fig. 2-3.

Embodiment 4 stimulates insulin secretion experiment

Raw 3～4 weeks SD rats are taken out, 75% ethanol disinfection, aseptic taking-up pancreas removes the outer nethike embrane of pancreas, after fatty tissue, 4 DEG C of Hanks liquid of Jing are rinsed 2 times, add the collagen type v enzyme of the 0.5mg/ml of 2～3 times of volumes, are mixed, 37 DEG C of water-bath shakes Swing 6～8min of digestion.Muddy to digesting, supernatant is drawn in natural sedimentation, and with 4 DEG C of Hanks liquid digestion is terminated, and repeats above Digestion step, until digestion is complete, collects the Digestive system of each time, and 1000rpm centrifugation 5min abandon supernatant, and cell is resuspended In the T75 bottles of the RPMI1640 culture medium containing 10% hyclone, the CO2 gas incubator of 37 DEG C of 5%CO2-95% air Middle culture.Cell culture forms cell monolayer to 3d, and with 37 DEG C of the RPMI1640 of sugar-free serum-free 1h are incubated, then Use high sugar (16.8mM) pastille of low sugar (2.8mM) instead respectively or without 37 DEG C of incubation 1h of drug solns, collect supernatant, use ELISA detects insulin concentration.As a result Fig. 4 is seen.

Embodiment 5

293 cell strains of expression human glucagon-like-peptide-1 receptor (GLP-1R) gene are constructed, by the HEK after transfection 293/GLP-1R cells in being inoculated in 12 orifice plates, are put into 37 DEG C, 5%CO2 according to 2 × 105, every hole cells/well (1ml/ holes) 6-8h is incubated in incubator, after cell attachment, respectively in every hole add final concentration 0.1pM, 1pM, 10pM, 100pM, The Arg34Lys26-(N-EPSILON-(N-ALPHA-Palmitoyl-L-GAMMA-glutamyl))-GLP-1[7-37] of 1000pM and 10000pM, GLP-1M (A8S/V33K/G16E/A24E) and GLP-1M (A8S/V33R) (1ml/ Hole), continue to cultivate 24h, detect cAMP contents using test kit.As a result stimulation of the recombinant cell strain through tested material is shown Afterwards, the cAMP contents in its cell are significantly raised, and the EC50 values of tested material GLP-1M (A8S/V33K/G16E/A24E) are approximately profit The 1/4 of Shandong peptide is drawn, the EC50 values of tested material GLP-1M (A8S/V33R) are approximately the 1/3 (EC50 of Arg34Lys26-(N-EPSILON-(N-ALPHA-Palmitoyl-L-GAMMA-glutamyl))-GLP-1[7-37] of Arg34Lys26-(N-EPSILON-(N-ALPHA-Palmitoyl-L-GAMMA-glutamyl))-GLP-1[7-37] Value 81.8pM, EC50 values 21.6pM of GLP-1M (A8S/V33K/G16E/A24E), the EC50 of GLP-1M (A8S/V33R) Value 27.7pM).

The carbohydrate tolerance of embodiment 6. is tested

Select 4 week old ICR male mice 40, be randomly divided into 4 groups, the Arg34Lys26-(N-EPSILON-(N-ALPHA-Palmitoyl-L-GAMMA-glutamyl))-GLP-1[7-37] of experimental group difference gavage 0.1mg/kg and 2 of 0.05mg/kg different tested materials, gavage together with blank group 25% G/W 5g/kg after half an hour.2h after gavage, 6h, 12h, 24h, 48h, 72h detect tail vein sugared content, and second day and the 3rd day same time point gavage glucose and examine Survey blood glucose value.As a result show, first day Arg34Lys26-(N-EPSILON-(N-ALPHA-Palmitoyl-L-GAMMA-glutamyl))-GLP-1[7-37] group and two tested material blood glucose values are significantly lower than blank group, second day profit Drawing Shandong peptide group blood glucose value has been substantially equal to blank group and tested group is still significantly lower than blank group, and the 3rd day Arg34Lys26-(N-EPSILON-(N-ALPHA-Palmitoyl-L-GAMMA-glutamyl))-GLP-1[7-37] is lived without blood sugar lowering Property, two tested group of blood glucose values have been raised but still less than blank control group group.As a result Fig. 6-8 is seen.

Embodiment 7.SD Mus pharmacokinetic

Male SD rat 30 is selected, 3 groups are randomly divided into, respectively the Arg34Lys26-(N-EPSILON-(N-ALPHA-Palmitoyl-L-GAMMA-glutamyl))-GLP-1[7-37] and 0.05mg/kg of single subcutaneous injection 0.1mg/kg 2 different tested materials【GLP-1M(A8S/V33K/G16E/A24E)/GLP-1M(A8S/V33R)】, before administration with administration after Different time points are taken a blood sample, and separate serum, and with GLP-1 test kits the content of Arg34Lys26-(N-EPSILON-(N-ALPHA-Palmitoyl-L-GAMMA-glutamyl))-GLP-1[7-37] and tested material in serum is detected.As a result table Bright, the biological half-life of two tested materials is obviously prolonged compared with Arg34Lys26-(N-EPSILON-(N-ALPHA-Palmitoyl-L-GAMMA-glutamyl))-GLP-1[7-37], and GLP-1M (A8S/V33R) reaches 26h, GLP-1M (A8S/V33K/G16E/A24E) reaches 28h (Arg34Lys26-(N-EPSILON-(N-ALPHA-Palmitoyl-L-GAMMA-glutamyl))-GLP-1[7-37] biology half-life phase 4h).GLP-1M (A8S/V33R)/profit The relative bioavailability for drawing Shandong peptide is the Relative biological profit of 2163%, GLP-1M (A8S/V33K/G16E/A24E)/Arg34Lys26-(N-EPSILON-(N-ALPHA-Palmitoyl-L-GAMMA-glutamyl))-GLP-1[7-37] Expenditure is 1833%.As a result Fig. 9 is seen.

Claims (10)

1.GLP-1M (7-37) polypeptide, the polypeptide has the aminoacid sequence that below formula is represented：

Protein sequence GLP-1M (A8S/V33R/G16E/A24E)

H SEGTFTX₈DVS SYLEX₁₆QAAKE FIX₂₄WLX₃₃RGRG, wherein：

X₈For S,

X₁₆For G or E,

X₂₄For A or E,

X₃₃For R.

2. polypeptide according to claim 1, wherein,

X₈For S,

X₁₆For G,

X₂₄For A,

X₃₃For R.

3. polypeptide according to claim 1, wherein,

X₈For S,

X₁₆For E,

X₂₄For E,

X₃₃For R.

4. the fatty acid conjugate for combining to form comprising polypeptide described in any one claim in claim 1-3 and long-chain fatty acid.

5. fusion protein, the fusion protein includes polypeptide described in any one claim in claim 1-3, and with the polypeptide With reference to another albumen or polypeptide.

6. the fusion protein described in claim 5, another polypeptide or albumen are selected from antibody Fc section or albumin albumen.

7.SUMO-GLP-1M (7-37) fusion protein, the fusion protein is comprising described in any one claim in claim 1-3 Polypeptide.

8. detached polynucleotide, the polynucleotide are used to encode SUMO-GLP-1M described in claim 7 (7-37) fusion protein.

9. the expression vector comprising polynucleotide described in claim 8, and the host comprising the expression vector.

10. any one polypeptide is preventing and/or is treating the utilization in diabetes medicament in claim 1-3.