CN102010473A - Recombinant oxyntomodulin (OXM) fusion protein, and preparation and application thereof - Google Patents

Recombinant oxyntomodulin (OXM) fusion protein, and preparation and application thereof Download PDF

Info

Publication number
CN102010473A
CN102010473A CN2010105382254A CN201010538225A CN102010473A CN 102010473 A CN102010473 A CN 102010473A CN 2010105382254 A CN2010105382254 A CN 2010105382254A CN 201010538225 A CN201010538225 A CN 201010538225A CN 102010473 A CN102010473 A CN 102010473A
Authority
CN
China
Prior art keywords
oxm
fusion rotein
oxyntomodulin
fragment
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN2010105382254A
Other languages
Chinese (zh)
Inventor
曹鹏
夏志南
高健
蔡雪婷
卢悟广
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to CN2010105382254A priority Critical patent/CN102010473A/en
Publication of CN102010473A publication Critical patent/CN102010473A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575—Hormones
    • C07K14/605—Glucagons
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/30—Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto

Abstract

The invention relates to long-acting and stable oxyntomodulin (OXM). An Fc segment of human immunoglobulin G and the human OXM form fusion protein through a connecting peptide. A method for preparing the fusion protein comprises the following steps of: preparing the human OXM and an Fc segment gene of the human immunoglobulin respectively, and connecting the human OXM and the Fc segment gene of the human immunoglobulin to construct connecting segment-containing recombinant expression vectors; and transforming host cells by using the recombinant expression vectors, culturing the host cells and recovering from cell culture and purifying the host cells to obtain the recombinant fusion protein. The fusion protein can be used for preparing medicaments for treating metabolic diseases such as diabetes and obesity.

Description

Reorganization oxyntomodulin fusion rotein and preparation and application
Technical field
The present invention relates to make up a kind of long-acting stable oxyntomodulin, and be used for the treatment of the purposes of metabolic trouble such as diabetes and obesity.
Background technology
Human body appetite and energy metabolism regulation and control are mainly regulated gastrointestinal hormone ` such as hormone and vagus nerve and are waited jointly and regulate by pancreas islet such as hypothalamus, brain stem nucleus tractus solitaril, Regular Insulin, adiponectin, leptin, metabolism of fat signaling molecule, stomach somatropin, glucagon-like peptide, gastrin.Hypothalamus, medulla oblongata nucleus tractus solitaril excretory hormone and neurotransmitter and metabolism of fat signaling molecule all need to play a role by neural system and blood circulation, need work by nervus centralis at these slimming medicines of regulating path, influence surface is big, and side effect is serious.Have only gastrointestinal hormone ` to directly act on gi tract, modulation of appetite and energy metabolism more.Therefore, at the slimming medicine target spot limitation of gastrointestinal hormone `, side effect is little.
(Oxyntomodulin OXM) is a kind of small peptide hormone of enteric epithelium L-emiocytosis to oxyntomodulin.Have a large amount of OXM to distribute at people's Di, in the rodent gi tract, from the duodenum to the ileum, the concentration of OXM increases gradually, reduces gradually after the caecum.Enteric epithelium secretion oxyntomodulin is regulated by nutrition and energy metabolism, and the OXM level begins to raise after taking food back 5-10 minute, peaks after 30 minutes.Certain rule is round the clock arranged in vivo, and early morning, secretion level was low, evening the secretion level height.OXM is made up of 37 amino acid.
Derive from the variation of OXM among some stomach and intestine and the coeliac disease patients serum for the understanding of OXM.It is found that at some gastrointestinal tract disease such as tropical malabsorption, under the pathological situations such as jejunal bypass, the horizontal noticeable change of OXM, its slimming effect attracts much attention.Early-stage Study result shows that also OXM is effective slimming medicine, long-term central and on every side property ground to reducing the weight increase of rat with OXM.Vein can be reduced experimenter's ingestion of food with the OXM that is higher than physiological level.Find in the research around scheduling to last such as Dhilfows that give the overweight or obese subjects with OXM voluntarily, its intake significantly is less than the physiological saline control group, and lose weight also significantly faster than control group, this effect around research process in continue to keep.OXM can slow down the emptying of nutritive substance in the stomach.Have the minimizing food absorption, depress appetite and mobilization fat, minimizing energy are taken in, and increase energy expenditure, make energy metabolism be in the negative balance state, thus slimming function.
Rodent intracerebroventricular or subcutaneous injection oxyntomodulin can reduce food absorption and body weight, reduce fat.The Britain research personnel report that subcutaneous injection OXM can lose weight effectively and reduce fatty tissue on " diabetes " magazine.The researchist has carried out a double-blind study to 26 overweight or fat volunteers.The experimenter is specified in whenever 30 minutes before the meal subcutaneous injection OXM or salt solution at random, requires them to keep the physical activity of normal diet and conventional levels simultaneously during studying.The treatment group 2.3kg that lost weight, control group 0.5kg.The treatment group shows that leptin level reduces, and adiponectin increases, and reduces consistent with fatty tissue.Experimenter's calorie intake also significantly reduces.Begin one's study and reduced 170kcal, 250kcal when having meal at last when having meal.In the perception of food preference, do not change.OXM is mainly by three approach modulation of appetite and energy intake.The one, directly act on gi tract glucagon-like peptide-l (GLP-l) acceptor, act on vagus nerve, modulation of appetite suppresses the absorption of sugar and fat.The 2nd, the secretion of downward modulation stomach growth hormone, depress appetite.Studies show that subcutaneous injection OXM can make the stomach growth hormone in the rodent blood descend 20%, and the mankind can drop to 44%.The 3rd, by the thyroxinic synthesis secretion of Tiroidina pathway stimulation, increase energy expenditure, mobilize steatolysis.Now think that OXM works by the GLP-1 acceptor more.Find that in the mouse experiment that the GLP-1 receptor knockout removes the apocleisis effect of OXM disappears.
OXM has the very short transformation period, can be by the rapid inactivation of the DPP IV of cell surface (DP-IV), however the body weight effect of DP-IV inhibitor in clinical is placed in the middle, shows that the OXM that may need to have children outside the state plan the reason level realizes the fat-reducing of human body.Therefore, oxyntomodulin has shown the potentiality as the treatment means of metabolic trouble such as diabetes and obesity, but, because the body internal stability of OXM is poor, so need exploitation can be administered for the long-acting OXM of treatment metabolic trouble such as diabetes and obesity safely and effectively.
The Fc structural domain of antibody comprises at least two CH structural domains of each chain usually, and its dimerization forms the Fc structural domain.The Fc structural domain is responsible for providing the antibody mediated effect function, comprises decision antibody half life and distribution complement-fixing in vivo and in conjunction with the ability of cell surface Fc acceptor.The character of Fc structural domain makes it be called useful therapeutical agent.Many researchs have been blended in the Fc structural domain other non-antibody protein, receptor protein for example, and Yi Naxipu for example also can be with Fc structural domain syzygy with the reagent that makes a search, and it helps proteic detection and purifying the Fc label.The human IgG immunoglobulin (Ig) is intravital main antibody, and it the intravital transformation period is about 20 days the people, and its stability is because the Fc fragment of IgG can combine with newborn Fc acceptor (FcRn), avoids IgG to enter in the lysosome and is degraded.Therefore, the Fc fragment of IgG is used to connect and compose fusion rotein with activated protein, with the transformation period in the body that improves activated protein, reaches long lasting purpose.IgG can play the cell killing effect by the complement binding site activating complement on the Fc fragment.According to the length of hinge area and the difference of Fc fragment aminoacid sequence, human IgG is divided into 4 hypotypes, and wherein IgG Fc γ 2 has lower inducing cytotoxic effect, and IgG Fc γ 1 is the strongest.The building mode of IgG fusion rotein is that the segmental N end of the Fc of IgG (Hinge-CH2-CH3) fragment or CH (CH1-Hinge-CH2-CH3) is linked to each other with the C end of activated protein mostly, with the influence of avoiding construction of fusion protein to cause the activated protein biological activity.In addition, if activated protein is brought into play its biological activity with the form of homodimer, the intermolecular disulfide bond that the cysteine of Fc γ fragment and hinge area constitutes can strengthen and the dimeric formation of stable fusion rotein.Human leukocyte function antigen 3 (LFA-3) for example, Tumor Necrosis Factor Receptors II (TNFRII), interleukin 12s (IL-12) etc., these fusion roteins obviously prolong the transformation period of cytokine in experimentation on animals when keeping the cytokine biological function.In addition, the fusion rotein of IgG can obtain the high efficient and convenient purifying by Protein A affinity chromatography.Although therefore a lot of cytokines and the fusion rotein of IgG also are in the preliminary stage of research, owing to its high efficiency, long half time and purifying easily characteristics caused concern widely.
Summary of the invention
In order to overcome the deficiencies in the prior art, the present invention has strengthened the body internal stability of OXM polypeptide and has prolonged the transformation period, and provide this fusion rotein to be used for the treatment of the method for metabolic trouble such as diabetes and obesity by making up OXM and human IgG Fc fusion rotein.
One aspect of the present invention provides a kind of reorganization oxyntomodulin fusion rotein OXM-Fc, the fusion rotein that it is made of by a connection peptides Fc fragment and people's oxyntomodulin of immunoglobulin G while.
Wherein, the peptide that links between OXM and the Fc is selected most importantly, and OXM connects Fc and OXM with formation fusion rotein, OXM connection peptides-Fc or Fc-connection peptides-OXM by connection peptides.Connection peptides can be (G 4S) 3-10, connection peptides length is 2-100 amino acid preferably, is more preferably 5-50 amino acid, most preferably is 14-30 amino acid.Connection peptides length can be as short as Fc the steric hindrance that OXM forms is kept minimum, for example (G 4S) 1-2Connection peptides helps OXM and its receptors bind.
Said fusion rotein OXM-Fc can be the polypeptide that comprises aminoacid sequence shown in the SEQ ID NO:5, or its fragment homologue, analogue or derivative.In an embodiment preferred, OXM-Fc is made up of aminoacid sequence shown in the SEQ ID NO:5.
Another aspect of the present invention provides a kind of polynucleotide molecule of the reorganization OXM-Fc fusion rotein of encoding, and it is be selected from following nucleotide sequences a kind of:
1) nucleotide sequence of SEQ ID NO:6;
2) nucleotide sequence identical with nucleotide sequence shown in the SEQ ID NO:6 at least 70%;
3) under rigorous hybridization conditions can with the nucleotide sequence of SEQ ID NO:6 or its complementary polynucleotide molecule hybridization;
4) protein of the coding aminoacid sequence identical with SEQ ID NO:5, but because of the degeneracy of genetic code different nucleotide sequence on sequence.
The said fusion rotein OXM-Fc of the present invention can prepare by the following method:
(1) make the Fc fragment gene of people's oxyntomodulin and immunoglobulin G respectively,
(2) connect people's oxyntomodulin and Fc gene;
(3) make up the recombinant expression vector that contains above-mentioned (2) junction fragment;
(4) with the recombinant expression vector transformed host cell that obtains in above-mentioned (3),
(5) cultivate host cell, recovery and purifying obtain recombination fusion protein from cell culture then.
The recombinant expression vector that contains the polynucleotide of the present invention of encoding is provided in the aforesaid method, by this recombinant expression vector transformed host cells, and by the new clone of this host cell institute deutero-.In a preferred embodiment, the invention provides a kind of recombinant eukaryon expression vector pOXM-Fc that comprises polynucleotide molecule of the present invention, and the host cell pOXM-Fc/CHO that contains this recombinant expression vector.
Above-mentioned steps (5) specifically is use the recombinant expression vector transformed host cells being suitable under the condition of this fusion rotein cultivating, and from cell culture the step of recovery and this recombination fusion protein of purifying.In a preferred embodiment, host cell is through cell cultures, centrifugal after, supernatant liquor is used affinity chromatography and sieve chromatography purifying respectively.In a preferred embodiment, affinity chromatography is a ProteinA sepharose FF affinity column, and molecular sieve is Superdex 200 PREP grad posts.
The present invention further provides and contain the pharmaceutical composition of OXM-Fc fusion rotein of the present invention as activeconstituents and pharmaceutically acceptable carrier, and the purposes of this pharmaceutical composition in the medicine of treatment internal secretion relative disease, comprise diabetes and obesity etc.
The OXM-Fc fusion rotein of mentioning herein is the homology polypeptide, homology polypeptide herein is meant, polypeptide had the aminoacid sequence of OXM-Fc fusion rotein originally, but wherein one or more amino-acid residues are by the conservative replacement of different amino-acid residues, and resulting polypeptide can be used for implementing the present invention.It is known in the art when conserved amino acid replaces.Cause such replacement principle to comprise, described replacement rule such as MD by Dayholf.In particular, the conserved amino acid replacement occurs in the amino acid family that is associated with its acidity, polarity or side chain size.
The method of producing and operating polynucleotide molecule disclosed herein is well known by persons skilled in the art, and can finish according to the recombinant technology of describing.The expression vector that can be used for expressing OXM-Fc fusion rotein sequence of the present invention is known in the art, comprising the recombinant phage dna that contains the specific coding sequence, plasmid DNA and cosmid DNA expression vector, the typical prokaryotic expression plasmid that can contain polynucleotide molecule of the present invention through processing comprises PUC8, PUC9, PBR322 and PBR329, the pET serial carrier, PQE50 or the like, the typical carrier for expression of eukaryon that can contain polynucleotide molecule of the present invention through processing comprises moulting hormone induction type mammalian expression system, based on the expression system of bringing up the cell virus promoter-enhancer with based on baculovirus expression system.
Can be used for implementing host cell of the present invention can be eucaryon or prokaryotic cell prokaryocyte.Such host cell comprises and singly is not limited to microorganism, for example use recombinant phage dna, the bacterium that plasmid DNA or cosmid DNA carrier transform, the perhaps yeast that transforms with recombinant vectors, or zooblast, as insect cell with recombinant viral vector such as baculovirus infection, or with the mammalian cell of recombinant viral vector such as adenovirus or vaccinia virus infection etc.For example, can use coli strain, as the BL21 bacterial strain.Eukaryotic cell comprises yeast cell, but also can effectively utilize mouse, mammalian cell such as hamster, ox, monkey or human cell line.The eukaryotic host cell that can be used for expressing recombinant protein of the present invention comprises CHO, and HEK293, NIH-3T3 cell etc.
The pharmaceutical composition that contains recombinant fusion protein of the present invention can be used for the treatment of internal secretion relative disease, especially in fat-reducing and diabetes field.
It will be understood by those skilled in the art that pharmaceutical composition of the present invention is applicable to various administering modes, oral administration for example, percutaneous dosing, intravenously administrable, intramuscular administration, topical, nose administration etc.According to the administering mode that is adopted, recombinant protein medicine composition of the present invention can be made various suitable formulations, wherein comprise the polypeptide of the present invention and at least a pharmaceutically acceptable pharmaceutical carrier of at least a effective dose.
The example of appropriate dosage forms is a tablet, capsule, and sugar coated tablet, granula, oral liquid and syrup, the ointment and the medicine that are used for skin surface paste aerosol, nasal spray, and the sterile solution that can be used for injecting.
The pharmaceutical composition that contains recombinant protein of the present invention can be made solution or lyophilized powder to be used for parenteral admin, section's adding appropriate solvent or other pharmaceutically useful carriers reconfigure powder before use, liquid formulations generally is damping fluid, isotonic solution and the aqueous solution.
Also comprise in the formulation by other conventional components, as sanitas, stablizer, tensio-active agent, damping fluid, the salt of adjusting osmotic pressure, emulsifying agent, sweetener, tinting material, seasonings etc.The stablizer optimization citric acid sodium that drug regimen species of the present invention use, glycine, N.F,USP MANNITOL, ganglioside etc.The injection liquid drugs injection or the preferred prescription of freeze-dried powder that contain pharmaceutical composition of the present invention comprise, Roxm-Fc, NaCl 4mg, vitriol 3.02mg, glycine 10mg or N.F,USP MANNITOL 15mg, water for injection 0.5ml.
The consumption of pharmaceutical composition peptide species of the present invention can another in a big way in the change, those skilled in the art can be according to some factors always as the kind according to disease, the degree that is in a bad way, patient body weight, formulation, factors such as route of administration are determined easily.
Advantage of the present invention:
1) when molecule number is identical, compares, have similar biologic activity with natural OXM;
2) demonstrate the transformation period and the stability of significant prolongation in for experiment at the medicine of medicine;
3) the Fc fragment of selecting IgG is avoided the generation of side effect as merging fragment;
4) expression amount height, good stability is easy to amplify and produces, and cost is low.
After 100 generations of engineering cell strain continuous passage of the present invention, still can express the OXM-Fc fusion rotein by stably excreting, cultivate, with the expression amount in the ELISA method detection supernatant by the suspension culture mode, add up data inferior surplus in the of 50, expression amount is all at 400-1000mg/L.Aspect purifying, because fusion rotein content height in cells and supernatant, and the affinity chromatography step in the purifying process has very high purification efficiency, every milliliter of gel can be easy to amplify and produce in conjunction with the albumen of 50mg.
Description of drawings
Fig. 1: the building process that shows recombinant plasmid pOXM-Fc.
Fig. 2: the enzyme that shows recombinant plasmid pOXM-Fc is cut qualification result (1% agrose electrophoresis), and wherein swimming lane M is a molecular weight standard, and 1, represent number clone respectively.
Fig. 3: proteic electrophoretogram (12%SDS-PAGE) behind the demonstration purifying, wherein swimming lane M is a protein molecular weight standard, swimming lane S is the sample behind the purifying.
Fig. 4: OXM-Fc albumen is injected pharmacokinetics result behind the male C57 mouse in abdominal cavity single administration mode.
Fig. 5: OXM-Fc albumen is to the influence of obesity mice body weight, *=p＜0.001 and control group are relatively.
Fig. 6: OXM-Fc albumen is to the influence of obesity mice food intake (FI), *=p＜0.05 and control group are relatively.
Fig. 7: OXM-Fc albumen is to the influence of obesity mice sugar tolerance
Fig. 8: OXM-Fc albumen to the obesity mice oral glucose after the influence that discharges of Regular Insulin, *=p＜0.05 and control group are relatively.
Embodiment
The acquisition of embodiment 1:OXM goal gene and human IgG1 Fc fragment gene
According to the OXM gene order, its aminoacid sequence is SEQ ID NO:1, and gene order is SEQ ID NO:2, delivers gene Synesis Company and synthesizes.According to human IgG1 Fc gene order, with the total RNA of normal people's lymphocyte is template, RT-PCR amplification IgG1 Fc fragment, reaction conditions is as follows: the RT-PCR reaction mixture, reacts by following condition: reverse transcription reaction after 30 minutes 50 ℃ of sex change: 94 ℃ of sex change 30 seconds; Annealed 30 seconds for 55 ℃; 68 ℃ were extended 1 minute, and reacted 10 circulations.PCR reaction: 94 ℃ of sex change 30 seconds; Annealed 30 seconds for 60 ℃; 68 ℃ were extended 1 minute, and reacted 25 circulations.68 ℃ were extended 12 minutes more then.After reaction was finished, 1% agarose gel electrophoresis detected the RT-PCR product.As shown in Figure 1, we have obtained estimating the dna fragmentation (about 600bp) of size.Through order-checking, its aminoacid sequence is SEQ ID NO:3, and gene order is SEQ ID NO:4.
Embodiment 2: construction of recombinant plasmid
The structure of carrier as shown in Figure 1, by of the gene order amalgamation of over-lap round pcr with OXM and Fc; Utilize the primer extension round pcr, mouse Ig κ signal peptide is connected the aminoterminal of OXM-Fc sequence by three PCR; Again goal gene and pcDNA3.0 plasmid being carried out enzyme with Hind III and EcoR V restriction endonuclease respectively cuts; Enzyme is cut product connect, with the plasmid called after pcDNA3.0/OXM-Fc that builds with the T4 ligase enzyme.Specifically:
1.1 according to OXM and human IgG1 Fc (hinge+ CH2+ CH3) the following primer of cDNA sequences Design:
POXM1:5’CATGGCGAGGGCACCTTCACCTC?3’
POXM2:?5’? CAGGTGTGGGTCTTGTCAGAGGACTTGGGC3’
PFc1:?5’ GTCCTCTGACAAGACCCACACCTG?3’
PFc2:?5’? CGCGGATCCTCACTTGCCGGGGCTCAGGGACAG3’
Wherein POXM2 and PFc1 italicized item are complementary region, and PFc2 contains the restriction enzyme site by EcoRV.Utilize overlapping extension splicing to synthesize OXM-Fc.
1.2 according to mouse IgG κ chain and the following primer of OXM-Fc sequences Design:
P1：CCCAAGCTTGCCACC ATGGGCTGGTCCTGCATCATCCTGTTTCTGG
P2：ATCATCCTGTTTCTGGTGGCTACCGCCACCGGAGT
P3：CTACCGCCACCGGAGTGCATTCTGACAAGACCCACACCTGTC
Utilize after the primer extension technology composite signal peptide, change the pcDNA3.0 carrier for expression of eukaryon over to after cutting with signal peptide OXM-Fc combination and with the sequence enzyme that obtains by the lap splice technology, it is Fig. 2 that enzyme is cut qualification result, expression plasmid called after pcDNA3.0/OXM-Fc.
Embodiment 3:CHO stably express strain (CHO-OXM cell) screening and evaluation
1) gets pOXM-Fc plasmid among the embodiment 2 of a large amount of preparations of 10ug, utilize liposome Lipofectin2000 transfection CHO cell.Ratio in 1:5 goes down to posterity two days later, adds the G418 screening of 0.4 mg/ml, and visible clone formed in 10 days.Digest the mono-clonal that 50 edges obviously separate, cell state is good at random and be inoculated in 24 orifice plates cultivations (first round screening).
2) get in the cultivation after three days and please detect the Expression of Fusion Protein situation with ELISA, therefrom select 15 clones of expression male and be inoculated in 24 orifice plates (second takes turns screening) and 6 orifice plates (be used for protecting and plant) respectively, cultivate after 4 days, get supernatant and detect the Expression of Fusion Protein situation, therefrom choose and express higher 4 clone: A5-3, B2-3, B2-5, one step of C1-4 and screen with limiting dilution assay with ELISA.
3) inoculate (5 cells/well/200ul) (the third round screening) of 96 orifice plates respectively, treat that cell covers with back (after about 13 days), go culture supernatant to detect the Expression of Fusion Protein situation with ELISA, B2-3, B2-5, C1-4 are the clone of homogeneous, picking is expressed 6 higher clone's inoculation 24 orifice plates, each parallel 2 hole respectively.After treating that cell covers with, wherein a hole is used for protecting kind, and 6 orifice plates are inoculated in another hole.After treating that the interior cell of 6 orifice plates covers with, extract genomic dna and total RNA, identify the segmental situation that exists of genomic insertion that is integrated into, insert segmental transcribing (promptly expressing) situation with the RT-PCR evaluation with PCR.The result shows that B2-3, B2-5, C1-4 are correct clone.
4) get B4-3(C3 respectively), A6-4(B4), C1-5(D8) inoculation 96 orifice plates (1 cells/well/200ul) (four-wheel screening), treat that cell covers with back (after about 15 days), get to cultivate and please detect the Expression of Fusion Protein situation with ELISA, three clones are the clone of homogeneous, with wherein expressing the highest amplification respectively, protecting and plant, carry out next step expression and purifying.After pOXM-Fc transforms Chinese hamster ovary celI, with the cell called after CHO-OXM cell of stably express.
Embodiment 4 preparation OXM-Fc fusion roteins
Large scale culturing CHO- OXMCell, supernatant liquor is regulated pH to 7.3 with the NaOH of 1M after centrifugal, adsorb in order to 10mM PB (pH7.3) equilibrated rProteinA-Sepharose F.F. (Parmacia) affinity column, again with same damping fluid washing affinity column to the OD value of 280nm less than 0.01.Citrate buffer solution with 0.05～0.1M washes fusion rotein, collects elution peak and uses 200 mM Na immediately 2HPO 4Regulate PH to 7.0.After the sample concentration, last molecular sieve Superdex 200 prep grade posts are used 20 mM PBS in advance, and (contain 150mM NaCL, pH7.2) damping fluid balance is with sample purifying on the sample after concentrating.Protein electrophoresis collection of illustrative plates behind the purifying is seen Fig. 3, and purity can reach more than 98%.
Embodiment 5: preparation is the injection/freeze-dried of active ingredient with OXM-Fc
Prescription: OXM-Fc 100mg
NaCL 8g
Na 2HPO4·12H2O 5.16g
NaH 2PO4·2H2O 0.874g
Glycine 15g
N.F,USP MANNITOL 30g
Water for injection 1000ml
PH value 7.2
Be distributed into injection water injection or freeze-drying that 0.5ml/ props up after the sterile filtration, make freeze-dried powder.
The pharmacokinetics of embodiment 6:OXM-Fc abdominal injection (IP) single administration in male C57 mouse body
Experimental technique
1) laboratory animal: 66 of cleaning level healthy male C57 mouse in 10 age in week, body weight (21.69 scholar 1.39) is provided by the SLAC of Shanghai Chinese Academy of Sciences Experimental Animal Center.Mouse adaptability is fed l week before the experiment, freely drinks water, and the feed normal diet has no adverse reaction, takes food, drinks water and movable normal person includes experiment in.The animal rearing laboratory meets GB cleaning level, space 50M 2, interior lighting is controlled at the 12h/12h light dark period rhythm and pace of moving things.23 ℃ of average indoor temperatures, relative humidity 50%-60%.
2) animal grouping and experimental design: claim the mouse body weight before the experiment, be divided into 2 groups at random by body weight, 33 every group, 3 of each time points.Each is organized mouse and handles as follows: OXM group: 0.16mg/kg; OXM-Fc group: 5mg/kg.The OXM or the OXM-Fc of an IP injected dose of every injected in mice.Get blood in administration 0.08,0.5,1,6,24,48,72,96,168,240 and 336hr posterior orbit vein.Blood sample solidifies for 4 ℃, 3500 x g low-temperature centrifugation 10min separation of serum, and every mouse blood sample of each time point is to be measured in-20 ℃ of maintenances.
3) pharmacokinetics is measured: adopt OXM-Fc concentration in each medication of ELISA kit measurement, each time point mice serum, obtain Plasma Concentration-time curve and main pharmacokinetic parameter.Wrap by elisa plate with OXM monoclonal antibody 10 μ g/ml.Measure the concentration of OAP standard protein liquid with the Bradford method.With the OAP standard substance with antibody diluent doubling dilution to 1000,500,250,125,62.5,30ng/ml, 100 μ l/ holes.Formulate typical curve with this value that records, get the serum sample that a particular point in time adopts and make 1:10 with antibody diluent, 1:100,1:1000, the 1:5000 dilution adds 100 μ l/ holes, and 37 ℃ of water baths are hatched 1 h.Wash 5 times with washing lotion, every all over 3 min, whenever wash one time and pat dry with the towel parcel afterwards.The anti-mouse IgG(Cell Signaling that adds the HRP mark of 1:5000 antibody diluent dilution afterwards), 37 ℃ of water baths are hatched 1 h.Wash plate 5 times by aforementioned schemes.Add 100 μ l/ hole substrate solutions afterwards, 37 ℃ of water baths are hatched 20～30 min, add reaction terminating liquid 20 μ l/ holes.Measure OD492nm in multi-functional microplate reader.
4) statistical procedures: all data are handled with the SPSS11.5 of statistical software with mean scholar standard deviation (x soil S) expression.According to survey OXM, OXM-Fc Plasma Concentration-time data is got the mean of 3 mouse Plasma Concentrations of each time point, carries out curve fitting and calculates main pharmacokinetic parameter with DAS software.It is remarkable that P＜0.05 is considered as significant difference, and P＜0.001 is the significant difference highly significant.
To be OXM-Fc albumen inject pharmacokinetics result behind the male C57 mouse in abdominal cavity single administration mode for Fig. 4 and table 1,
?
Show that the OXM-Fc fusion rotein has longer transformation period and lower clearance rate than OXM, the transformation period of OXM is 1hr, and clearance rate is 60hr, and the transformation period of OXM-Fc fusion rotein can reach more than the 90hr, and clearance rate but has only about 1hr.
Embodiment 7: fusion rotein comprises in the intravital effect of obesity mice measures OXM-Fc albumen to the mouse body weight, food intake, fasting plasma glucose, the acute effect of oral glucose tolerance and serum insulin
Experimental technique
1) laboratory animal: 81 of cleaning level male older obesity mices in 18-19 age in week, body weight (45.9 scholar 1.85) is provided by the SLAC of Shanghai Chinese Academy of Sciences Experimental Animal Center.Mouse freely drinks water, 60% high fat diet.The animal rearing laboratory meets GB cleaning level, space 50M 2, interior lighting is controlled at the 12h/12h light dark period rhythm and pace of moving things.23 ℃ of average indoor temperatures, relative humidity 50%-60%.
2) animal grouping and experimental design: claim the mouse body weight before the experiment, be divided into 9 groups at random by body weight, 9 every group.Each is organized mouse and handles as follows: blank group (physiological saline group, 1 time/day), and OXM organizes (60ug/kg, 1 time/day), and PBS VH organizes (PBS/CMF is the proteic solvent of OXM-Fc, 2 times/week), and OXM-Fc organizes (3mg/kg, 2 times/week).The mouse overnight fasting, administration the next morning, an abdominal injection dosage of every injected in mice organize medicine.Recover food behind the administration 30min, survey body weight weekly twice.Carry out OGTT after 15 days, survey again behind the fasting 5hr.
3) mouse body weight and food intake flow measurement: measure administration 1,2,5,8, the body weight of mouse after 12 and 14 days.Measure first day, first week and the food intake in second week, the food residual content of ld 8:00 in morning deducts back ld/7d with the residual content of time before adopting, obtain every cage mouse day or all food intakes, be accurate to behind the radix point one.
4) fasting plasma glucose is measured: get blood from mouse tail vein or socket of the eye vein, use micro-blood glucose meter to detect.
5) carbohydrate tolerance test: by oral glucose tolerance test (oral glucose tolerance test, OGTT) assessment.After 15 days, fasting 5 hours behind the 2g/kg glucose oral administration gavage 0,15,30,60 minutes, detects blood sugar (micro-blood glucose meter) from conscious mouse tail vein extracting blood sample respectively.
6) insulin release test: the blood sample among the OGTT is used for measuring serum insulin.After conscious mouse tail vein is collected blood sample, place EDTA to add and swash tire release enzyme inhibitors---but the test tube of skin enzyme is measured Regular Insulin.4 ℃, centrifugal 12 minutes of 3000rpm gets serum and is stored in-80 ℃, and is to be analyzed.With the plain ELISA kit measurement of mouse islets Regular Insulin, operation to specifications.
7) statistical procedures: all data are handled with the SPSS11.5 of statistical software with mean scholar standard deviation (x soil S) expression, and multi-group data is analyzed with ANOVA, and The data T check between two groups is if heterogeneity of variance adopts non-ginseng statistical test.It is remarkable that P＜0.05 is considered as significant difference, and P＜0.001 is the significant difference highly significant.
Experimental result:
What 1) Fig. 5 showed is the influence of OXM-Fc albumen to the obesity mice body weight.It is about 3% that OXM group (60ug/kg, 1 time/day) has been lost weight mouse, and OXM-Fc group (3mg/kg, 2 times/week) then makes mouse lose weight about 23%.
What 2) Fig. 6 showed is the influence of OXM-Fc albumen to obesity mice food intake (FI).After OXM handled, the mouse food ration obviously descended, and injected first day, and the OXM group has only reduced by 31% food intake, and the OXM-Fc group has reduced about 80% with respect to the PBS control group.In second week, food intake begins to increase, and near control group.
What 3) Fig. 7 showed is the influence of OXM-Fc albumen to the obesity mice sugar tolerance.OGTT analyzes and shows that OXM-Fc albumen can significantly improve the sugar tolerance of obesity mice, but OXM-Fc albumen does not have the OXM effect obvious.
Fig. 8 shows be OXM-Fc albumen to the obesity mice oral glucose after the influence that discharges of Regular Insulin.After the OGTT test, get serum and survey insulin release, data presentation OXM-Fc albumen not only can strengthen the sugar tolerance of mouse, can also reduce insulin release.

Claims (9)

1. a recombinant human oxyntomodulin fusion rotein is characterized in that, the fusion rotein that it is made of by a connection peptides Fc fragment and people's oxyntomodulin of immunoglobulin G while.
2. as right 1 described recombinant human oxyntomodulin fusion rotein, it is characterized in that described people's oxyntomodulin connects and composes fusion rotein by a connection peptides and Fc fragment, described connection peptides is (G 4S) 3-10
3. fusion rotein as claimed in claim 1 is characterized in that it being the polypeptide of aminoacid sequence shown in the SEQ ID NO:5, or its fragment, homologue, analogue or derivative.
4. polynucleotide molecule of claim 1 fusion rotein of encoding is characterized in that it is be selected from following nucleotide sequences a kind of:
1) nucleotide sequence of SEQ ID NO:6;
2) nucleotide sequence identical with nucleotide sequence shown in the SEQ ID NO:6 at least 70%;
3) under rigorous hybridization conditions can with the nucleotide sequence of SEQ ID NO:6 or its complementary polynucleotide molecule hybridization;
4) protein of the coding aminoacid sequence identical with SEQ ID NO:5, but because of the degeneracy of genetic code different nucleotide sequence on sequence.
5. prepare the method for the described fusion rotein of claim 1, may further comprise the steps:
(1) make people's oxyntomodulin and immunoglobulin Fc fragment gene respectively,
(2) connect people's oxyntomodulin and Fc gene;
(3) make up the recombinant expression vector that contains above-mentioned (2) junction fragment;
(4) with the recombinant expression vector transformed host cell that obtains in above-mentioned (3),
(5) cultivate host cell, recovery and purifying obtain recombination fusion protein from cell culture then.
6. method according to claim 5 is characterized in that: host cell is through cell cultures, centrifugal after, supernatant liquor is used affinity chromatography and sieve chromatography purifying respectively.
7. method according to claim 6 is characterized in that: what use in the affinity chromatography is Protein A sepharose FF affinity column; What use in the molecular sieve is superdex 200 Prep grade posts.
8. pharmaceutical composition is characterized in that: this pharmaceutical composition is made up of fusion rotein and pharmaceutically acceptable carrier as the claim 1 of activeconstituents.
9. the application of the described fusion rotein of claim 1 in preparation treatment of obesity, diabetes medicament.
CN2010105382254A 2010-11-10 2010-11-10 Recombinant oxyntomodulin (OXM) fusion protein, and preparation and application thereof Pending CN102010473A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN2010105382254A CN102010473A (en) 2010-11-10 2010-11-10 Recombinant oxyntomodulin (OXM) fusion protein, and preparation and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN2010105382254A CN102010473A (en) 2010-11-10 2010-11-10 Recombinant oxyntomodulin (OXM) fusion protein, and preparation and application thereof

Publications (1)

Publication Number Publication Date
CN102010473A true CN102010473A (en) 2011-04-13

Family

ID=43840818

Family Applications (1)

Application Number Title Priority Date Filing Date
CN2010105382254A Pending CN102010473A (en) 2010-11-10 2010-11-10 Recombinant oxyntomodulin (OXM) fusion protein, and preparation and application thereof

Country Status (1)

Country Link
CN (1) CN102010473A (en)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102994547A (en) * 2011-09-08 2013-03-27 哈药集团技术中心 Recombinant human erythropoietin-CTP fusion protein production process and application
KR20140058387A (en) * 2012-11-06 2014-05-14 한미약품 주식회사 Liquid formulation of protein conjugate comprising the oxyntomodulin and an immunoglobulin fragment
WO2014073845A1 (en) 2012-11-06 2014-05-15 Hanmi Pharm. Co., Ltd. A composition for treating diabetes or diabesity comprising oxyntomodulin analog
JP2014518209A (en) * 2011-06-17 2014-07-28 ハンミ サイエンス カンパニー リミテッド Conjugate containing oxyntomodulin and immunoglobulin fragment and use thereof
US9522946B2 (en) 2011-06-10 2016-12-20 Hanmi Science Co., Ltd. Oxyntomodulin derivatives and pharmaceutical composition for treating obesity comprising the same
CN106279424A (en) * 2015-05-20 2017-01-04 深圳翰宇药业股份有限公司 A kind of human parathyroid hormone PTH (1-34) fusion protein and application thereof
US9901621B2 (en) 2012-07-25 2018-02-27 Hanmi Pharm. Co., Ltd. Composition for treating hyperlipidemia comprising oxyntomodulin derivative
CN109206523A (en) * 2018-08-27 2019-01-15 沣潮医药科技（上海）有限公司 TIGIT immunoadhesin, Preparation method and use
US10233230B2 (en) 2014-09-16 2019-03-19 Hanmi Pharm. Co., Ltd. Use of a long acting GLP-1/glucagon receptor dual agonist for the treatment of non-alcoholic fatty liver disease
US10513550B2 (en) 2014-12-30 2019-12-24 Hanmi Pharm Co., Ltd Glucagon derivatives
WO2022042329A1 (en) * 2020-08-25 2022-03-03 沣潮医药科技（上海）有限公司 Application of tigit immunoadhesin in regulating tumor immunity and regulating angiogenesis products

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101098712A (en) * 2004-11-10 2008-01-02 杜门蒂斯有限公司 Domantis ltd (gb)
WO2009121804A1 (en) * 2008-03-31 2009-10-08 Glaxo Group Limited Drug fusions and conjugates

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101098712A (en) * 2004-11-10 2008-01-02 杜门蒂斯有限公司 Domantis ltd (gb)
WO2009121804A1 (en) * 2008-03-31 2009-10-08 Glaxo Group Limited Drug fusions and conjugates

Cited By (41)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10442848B2 (en) 2011-06-10 2019-10-15 Hanmi Science Co., Ltd. Oxyntomodulin derivatives and pharmaceutical composition for treating obesity comprising the same
US9527898B2 (en) 2011-06-10 2016-12-27 Hanmi Science Co., Ltd. Oxyntomodulin derivatives and pharmaceutical composition for treating obesity comprising the same
US9522946B2 (en) 2011-06-10 2016-12-20 Hanmi Science Co., Ltd. Oxyntomodulin derivatives and pharmaceutical composition for treating obesity comprising the same
US9765131B2 (en) 2011-06-10 2017-09-19 Hanmi Science Co., Ltd. Oxyntomodulin derivatives and pharmaceutical composition for treating obesity comprising the same
JP2014518209A (en) * 2011-06-17 2014-07-28 ハンミ サイエンス カンパニー リミテッド Conjugate containing oxyntomodulin and immunoglobulin fragment and use thereof
US11872283B2 (en) 2011-06-17 2024-01-16 Hanmi Science Co., Ltd Conjugate comprising oxyntomodulin and an immunoglobulin fragment, and use thereof
US10363320B2 (en) 2011-06-17 2019-07-30 Hanmi Science Co., Ltd. Conjugate comprising oxyntomodulin and an immunoglobulin fragment, and use thereof
JP2017071609A (en) * 2011-06-17 2017-04-13 ハンミ サイエンス カンパニー リミテッド Conjugate comprising oxyntomodulin and immunoglobulin fragment, and use thereof
US9731031B2 (en) 2011-06-17 2017-08-15 Hanmi Science Co., Ltd. Conjugate comprising oxyntomodulin and an immunoglobulin fragment, and use thereof
CN102994547B (en) * 2011-09-08 2015-05-13 哈药集团技术中心 Recombinant human erythropoietin-CTP fusion protein production process and application
CN102994547A (en) * 2011-09-08 2013-03-27 哈药集团技术中心 Recombinant human erythropoietin-CTP fusion protein production process and application
US10493132B2 (en) 2012-07-25 2019-12-03 Hanmi Pharm. Co., Ltd. Composition for treating hyperlipidemia comprising oxyntomodulin derivative
US9901621B2 (en) 2012-07-25 2018-02-27 Hanmi Pharm. Co., Ltd. Composition for treating hyperlipidemia comprising oxyntomodulin derivative
EP2916860B1 (en) * 2012-11-06 2020-03-11 Hanmi Pharm. Co., Ltd. A composition for treating diabetes comprising oxyntomodulin analog
US11071785B2 (en) 2012-11-06 2021-07-27 Hanmi Pharm. Co., Ltd. Liquid formulation of long-lasting protein conjugate comprising the oxyntomodulin and an immunoglobulin Fc region
TWI602583B (en) * 2012-11-06 2017-10-21 韓美藥品股份有限公司 Liquid formulation of protein conjugate comprising the oxyntomodulin and an immunoglobulin fragment
US9724420B2 (en) 2012-11-06 2017-08-08 Hanmi Pharm. Co., Ltd. Liquid formulation of protein conjugate comprising an oxyntomodulin derivative covalently linked to a non-peptidyl polymer to an immunoglobulin FC region
CN104884045B (en) * 2012-11-06 2018-06-15 韩美药品株式会社 The liquid preparation of protein conjugate including oxyntomodulin and immunoglobulin fragment
JP2018162298A (en) * 2012-11-06 2018-10-18 ハンミ ファーマシューティカル カンパニー リミテッド Compositions comprising oxyntomodulin analogs for treating diabetes or diabesity
KR20140058387A (en) * 2012-11-06 2014-05-14 한미약품 주식회사 Liquid formulation of protein conjugate comprising the oxyntomodulin and an immunoglobulin fragment
KR102434280B1 (en) 2012-11-06 2022-08-23 한미약품 주식회사 Liquid formulation of protein conjugate comprising the oxyntomodulin and an immunoglobulin fragment
US10279041B2 (en) 2012-11-06 2019-05-07 Hanmi Pharm Co. Ltd. Liquid formulation of long-lasting protein conjugate comprising the oxyntomodulin and an immunoglobulin fragment
AU2020200626B2 (en) * 2012-11-06 2022-02-10 Hanmi Pharm. Co., Ltd Liquid Formulation Of Protein Conjugate Comprising The Oxyntomodulin And An Immunoglobulin Fragment
EA039082B1 (en) * 2012-11-06 2021-12-01 Ханми Фарм. Ко., Лтд. Liquid formulation of protein conjugate comprising oxyntomodulin and an immunoglobulin fragment
EP2916819A4 (en) * 2012-11-06 2016-08-17 Hanmi Pharm Ind Co Ltd Liquid formulation of protein conjugate comprising the oxyntomodulin and an immunoglobulin fragment
AU2017279583B2 (en) * 2012-11-06 2019-11-21 Hanmi Pharm. Co., Ltd Liquid Formulation Of Protein Conjugate Comprising The Oxyntomodulin And An Immunoglobulin Fragment
CN104918632A (en) * 2012-11-06 2015-09-16 韩美药品株式会社 A composition for treating diabetes or diabesity comprising oxyntomodulin analog
KR20210125453A (en) * 2012-11-06 2021-10-18 한미약품 주식회사 Liquid formulation of protein conjugate comprising the oxyntomodulin and an immunoglobulin fragment
US10550168B2 (en) 2012-11-06 2020-02-04 Hanmi Pharm. Co., Ltd. Composition for treating diabetes or diabesity comprising oxyntomodulin analog
EP3610856A1 (en) * 2012-11-06 2020-02-19 Hanmi Pharm. Co., Ltd. Liquid formulation of protein conjugate comprising the oxyntomodulin and an immunoglobulin fragment
WO2014073845A1 (en) 2012-11-06 2014-05-15 Hanmi Pharm. Co., Ltd. A composition for treating diabetes or diabesity comprising oxyntomodulin analog
EP3679944A1 (en) * 2012-11-06 2020-07-15 Hanmi Pharm. Co., Ltd. A composition for treating diabetes comprising oxyntomodulin analog
AU2013342321B2 (en) * 2012-11-06 2017-09-28 Hanmi Pharm. Co., Ltd. Liquid formulation of protein conjugate comprising the oxyntomodulin and an immunoglobulin fragment
KR102311517B1 (en) * 2012-11-06 2021-10-14 한미약품 주식회사 Liquid formulation of protein conjugate comprising the oxyntomodulin and an immunoglobulin fragment
US10435459B2 (en) 2014-09-16 2019-10-08 Hanmi Pharm. Co., Ltd. Use of a long acting GLP-1/glucagon receptor dual agonist for the treatment of non-alcoholic fatty liver disease
US10233230B2 (en) 2014-09-16 2019-03-19 Hanmi Pharm. Co., Ltd. Use of a long acting GLP-1/glucagon receptor dual agonist for the treatment of non-alcoholic fatty liver disease
US10513550B2 (en) 2014-12-30 2019-12-24 Hanmi Pharm Co., Ltd Glucagon derivatives
US11254724B2 (en) 2014-12-30 2022-02-22 Hanmi Pharm. Co., Ltd. Glucagon derivatives
CN106279424A (en) * 2015-05-20 2017-01-04 深圳翰宇药业股份有限公司 A kind of human parathyroid hormone PTH (1-34) fusion protein and application thereof
CN109206523A (en) * 2018-08-27 2019-01-15 沣潮医药科技（上海）有限公司 TIGIT immunoadhesin, Preparation method and use
WO2022042329A1 (en) * 2020-08-25 2022-03-03 沣潮医药科技（上海）有限公司 Application of tigit immunoadhesin in regulating tumor immunity and regulating angiogenesis products

Similar Documents

Publication Publication Date Title
CN102010473A (en) Recombinant oxyntomodulin (OXM) fusion protein, and preparation and application thereof
US20170088598A1 (en) Long-acting oxyntomodulin variants and methods of producing same
JP6153930B2 (en) Sustained growth hormone and method for producing the same
US8304386B2 (en) Long-acting growth hormone and methods of producing same
US11197915B2 (en) Long-acting polypeptides and methods of producing and administering same
CN107286248B (en) High-glycosylation human growth hormone (HGH) fusion protein and preparation method thereof and purposes
US20200131242A1 (en) Methods of treatment with long-acting hormone
CN105189562A (en) Il-15 heterogeneous dimer protein and uses thereof
CN103079586B (en) Use of G-CSF dimer in the treatment of neutropenia
CN1341121A (en) Expression and export of anti-obesity proteins as Fc fusion proteins
CN103118699B (en) Use of interleukin-22 in treating viral hepatitis
CN107074967A (en) Interleukin-22/IL-2R alpha fusion protein and application method
CN101967196A (en) Interferon fusion protein, preparation thereof and application thereof
CN1935846A (en) Fusion protein for treating diabetes, and its preparing method and use
CN103930447A (en) Method for preparing physiologically active polypeptide complex
CN113265007B (en) Fusion protein for treating metabolic diseases and preparation method and application thereof
BR112020017256A2 (en) AGONIST COMPOUNDS OF GROWTH DIFFERENTIATION FACTOR 15 AND METHODS OF USING THE SAME
CN110256575A (en) A kind of long-acting recombinant human growth hormone fusion protein and its engineering cell
CN106046176A (en) High-activity long-acting blood-glucose-reducing fusion protein, preparation method and medicinal application thereof
CN106279430B (en) Analog fusions of Exendin 4 and its production and use
TWI777407B (en) Long-acting polypeptides and methods of producing and administering same
CN110172103A (en) GLP-1 analog-Fc fusion protein and its preparation method and application
CN105884901B (en) Tool persistently controls recombination human serum albumin/glicentin class peptide fusion protein of blood-sugar content function
CN100535006C (en) Analog of GLP-1
CN103193881A (en) Hypoglycemic polypeptide derivative for oral medication and use thereof

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C02 Deemed withdrawal of patent application after publication (patent law 2001)
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20110413