CN107858432A - A kind of kit and its application that PIK3CA mutation are detected by digital pcr - Google Patents

Abstract

The invention provides a kind of kit that PIK3CA mutation are detected by digital pcr, the digital pcr reagent includes the primer and probe of the Design for polymorphism in the mutational site of the E545K and H1047R according to PIK3CA genes；The nucleotide sequence of the E545K of PIK3CA genes primer such as SEQ ID NO:Shown in 12, the probe such as SEQ ID NO:Shown in 3；The nucleotide sequence of the H1047R of PIK3CA genes primer such as SEQ ID NO:Shown in 45, the probe such as SEQ ID NO:Shown in 6；The present invention is by designing specific mutant primer and probe sequence, optimize the concentration and formula of each reagent of each component in kit, the kit finally given is efficiently succinct, with higher sensitivity and specificity, operation is simple, time-consuming short, as a result accurate, prognosis and guiding treatment to cancer have positive role.

Description

A kind of kit and its application that PIK3CA mutation are detected by digital pcr

Technical field

The present invention relates to biological technical field, more particularly to a kind of kit that PIK3CA mutation are detected by digital pcr And its application.

Background technology

Tumor individual therapy has become the trend of modern medicine development.Clinical research confirmation, suffered from by detecting tumour In person's sample the gene mutation of biomarker come predict curative effect of medication and evaluation prognosis, instruct clinical individualization treat, can Curative effect is improved, mitigates adverse reaction, promotes the reasonable utilization of medical resource.

Breast cancer is a kind of very common cancer types in women, while breast cancer includes a variety of heterogeneous classes Type, different subtype can be divided into according to different histology and characterization of molecules.Phosphoinositide is frequently found in patient with breast cancer's body The exception of 3- kinases (PI3K)/AKT signal paths, wherein PIK3CA mutation are most commonly seen.PIK3CA is most common in breast cancer One of mutator, studies have found that this gene is undergone mutation to a variety of different types of human breast cancers with related Property.PIK3CA gene code phosphatidylinositol-3-kinase p110 α catalytic subunits, there is 20 extrons, human normal brain, lung, There is expression in the tissue such as mammary gland, stomach and intestine, uterine neck, ovary, have regulation and control body cell propagation, survival, dead, differentiation etc. important Physiological function.The mutation of the gene can be betided in the kinds cancers such as breast cancer, colorectal cancer and lung cancer, wherein in liver cancer 36%th, mutation rate is 26% in breast cancer, mutation rate is 25% in colorectal cancer, mutation rate is 2% in lung cancer, and it is mutated 80% ~90% is gathered in the 9th extron and the 20th extron of the gene.

Many researchs find that the possibility of the tumor patient pathology complete incidence graph of PIK3CA mutation is relatively low, progression free survival phase It is shorter.The Notes of Key Data of some preclinical phases, PIK3CA mutation may make tumour produce and support trastuzumab, handkerchief trastuzumab It is anti-.It is related to treatment validity and prognosis to detect PIK3CA mutation, has positive role to guiding treatment.

At present in terms of genetic test, mainly using target sequence capture and high throughput sequencing technologies, and biology letter is combined Credit analysis is ceased, the genetic mutation information of target area is obtained, is then verified using the methods of Sanger, QPCR, find out cause Ospc gene is mutated.This method can disposably detect many tumor-related genes, understand massive tumor medicine, comprehensive, system, The relation of tumour medicine and gene is understood exactly；But this method cost is high, cycle length, all trouble are not particularly suited for Person, and verified the methods of subsequently still need Sanger, QPCR.

Therefore, a kind of kit of new digital pcr detection PIK3CA mutation is researched and developed, accurately and efficiently detects PIK3CA Mutation, be significant and market value.

The content of the invention

In view of the shortcomings of the prior art and actual demand, the present invention provide one kind and dashed forward by digital pcr detection PIK3CA The kit of change and its application, by designing specific mutant primer and probe sequence, optimize each component in kit and respectively try The concentration and formula of agent, the kit finally given is efficiently succinct, has higher sensitivity and specificity, simple to operate easy OK, time-consuming short, as a result accurate, prognosis and guiding treatment to cancer have positive role.

To use following technical scheme up to this purpose, the present invention：

On the one hand, the present invention provides a kind of kit that PIK3CA mutation are detected by digital pcr；

The kit includes digital pcr reagent；

The polymorphism that the digital pcr reagent includes the mutational site of the E545K and H1047R according to PIK3CA genes is set The primer and probe of meter.

The nucleotide sequence of the E545K of PIK3CA genes primer such as SEQ ID NO:Shown in 1-2, the core of the probe Acid sequence such as SEQ ID NO:Shown in 3.

The SEQ ID NO:1 is ACGAGATCCTCTCTCTGAAATCACTA；

The SEQ ID NO:2 be CATGCTGAGATCAGCCAAATTCAG；

Nucleotide sequence (the SEQ ID NO of the probe A:3) it is CTATGGAGTCACAGGTAAG.

Preferably, the probe A also includes 5 ' terminal modified fluorophors and the quenching group at 3 ' ends.

The modification group be FAM, VIC, HEX in any one, preferably FAM.

The quenching group be BHQ1, BHQ2 or MGB in any one, preferably MGB.

The nucleotide sequence of the H1047R of PIK3CA genes primer such as SEQ ID NO:Shown in 4-5, the probe is such as SEQ ID NO:Shown in 6.

The SEQ ID NO:4 be TGAAACAAATGAATGATGCACG；

The SEQ ID NO:5 be CAGTGCAGTGTGGAATCCAGAGT；

Nucleotide sequence (the SEQ ID NO of the probe B:6) it is ATGGATTGGATCTTCCACACA.

Preferably, the probe B also includes 5 ' terminal modified fluorophors and the quenching group at 3 ' ends.

The modification group be FAM, VIC or HEX in any one, preferably FAM.

The quenching group be BHQ1, BHQ2 or MGB in any one, preferably MGB.

For inventor in sequencing experimentation for a long time, the mutation of PIK3CA genes and the relation of body are summarized in fully research, With reference to the exploration to advanced sequencing technologies, detected using mutation of the digital pcr to PIK3CA, it is specific prominent by designing Become primer and probe sequence, optimize the concentration and formula of each reagent of each component in kit, the kit finally given is efficiently simple It is clean, there are higher sensitivity and specificity, operation is simple, time-consuming short, as a result accurate.

Droplet type digital pcr (ddPCR) is one kind of digital pcr technology, and ddPCR systems are by the reaction containing nucleic acid molecules System is divided into up to ten thousand nano level droplets, wherein each droplet is free of or is mutated containing one to several with target gene DNA fragmentation, after PCR is expanded, fluoroscopic examination is carried out to each droplet one by one, therefore there is high sensitivity, can be used to examine Survey the tumour dissociative DNA that content is extremely low in blood.

Preferably, the digital pcr reagent also includes the primer and probe of the conserved regions design according to PIK3CA genes.

Preferably, the nucleotide sequence of the primer of the conserved region of the PIK3CA genes such as SEQ ID NO:It is described shown in 7-8 Probe such as SEQ ID NO:Shown in 9.

The SEQ ID NO:7 be GCTTGCAATAGGTGTGCGTC；

The SEQ ID NO:8 be CATCTCCCAAACATCCCTCAC；

Nucleotide sequence (the SEQ ID NO of the probe C:9) it is CACTGAACAAGTTGG.

Preferably, the probe C also includes 5 ' terminal modified fluorophors and the quenching group at 3 ' ends.

The modification group be FAM, VIC or HEX in any one, preferably HEX.

The quenching group be BHQ1, BHQ2 or MGB in any one, preferably MGB.

Preferably, the digital pcr kit includes 2 × ddPCR buffer solutions.

Preferably, the concentration of the primer is 0.2-1 μM, such as can be 0.2 μM, 0.5 μM, 0.8 μM or 1 μM.

Preferably, the concentration of the probe is 0.1-0.5 μM, such as can be 0.1 μM, 0.3 μM, 0.4 μM or 0.5 μM.

Preferably, the kit also includes DNA extraction agents.

Preferably, the DNA extraction agents include erythrocyte cracked liquid, nucleus lysate, EDTA, Proteinase K, saturation Phenol, chloroform and ethanol.

Lymphocyte in human peripheral is the material for extracting genomic DNA most convenient.DNA is and albumen in nucleus The form that matter forms compound is present, therefore must remove protein therein in extraction process, and SDS can be by cell membrane, core Film is destroyed, and histone is separated from DNA molecular, the nucleic acid on nucleoprotein is dissociated.EDTA middle DNase capable of inhibiting cell live Property.Proteinase K can be used for vitellophag nuclear membrane and nuclear protein matter, and RNase removes the RNA in nucleic acid.Phenol chlorine is used again Imitative extracting can further make protein denaturation and be separated with nucleic acid, then be precipitated through absolute ethyl alcohol, can finally obtain purer DNA。

Preferably, the concentration of the Proteinase K is 18-22mg/mL, such as can be 18mg/mL, 19mg/mL, 20mg/ ML, 21mg/mL or 22mg/mL, preferably 20mg/mL.

Preferably, the erythrocyte cracked liquid includes NH₄Cl、KHCO₃And EDTA.

Preferably, the nucleus lysate includes pH 8.2 Tris-HCl, NaCl and EDTA.

Preferably, the NH₄Cl concentration is 0.15-0.20M, for example, can be 0.15M, 0.155M, 0.18M or 0.20M, preferably 0.155M.

Preferably, the KHCO of the erythrocyte cracked liquid₃Concentration be 0.01-0.02M, such as can be 0.01M, 0.015M or 0.02M, preferably 0.01M.

Preferably, the EDTA of erythrocyte cracked liquid concentration is 0.1-0.2M, for example, can be 0.1M, 0.15M or 0.2M, preferably 0.13M.

Preferably, the Tris-HCl of nucleus lysate concentration is 0.01-0.02M, for example, can be 0.01M, 0.015M or 0.02M, preferably 0.01M.

Preferably, the NaCl of nucleus lysate concentration is 0.3-0.5M, for example, can be 0.3M, 0.4M or 0.5M, preferably 0.4M.

Preferably, the EDTA of nucleus lysate concentration is 0.005-0.01M, for example, can be 0.005M, 0.008M or 0.01M, preferably 0.008M.

Second aspect, the present invention provide a kind of method using the detection PIK3CA mutation of kit as described in relation to the first aspect, Comprise the following steps：

(1) DNA is extracted：Peripheral blood DNA is extracted using the DNA extraction agents；

(2) droplet is prepared：The DNA that step (1) extracts is mixed with digital pcr reagent, is put into drop generator and prepares Droplet；

(3) PCR is expanded：Enter performing PCR amplification according to setting program after droplet sealer prepared by step (2)；

(4) droplet detects：Step (3) reacted PCR plate is transferred in droplet analyzer and carries out fluoroscopic examination, and is made Concentration calculating is carried out with software.

Preferably, the DNA concentration of step (1) described extraction >=30ng/ μ L.

The reaction system of the PCR：9 μ L DNA about 100ng and 11 μ L probe primers, the mixed liquor of ddPCR buffer solutions.

Preferably, the condition of the PCR amplifications is：95 DEG C of denaturation 5min, subsequent 95 DEG C of denaturation 15sec, 60 DEG C are annealed 30sec, carry out 40 circulations, last 98 DEG C of extensions 10min.

As optimization technique method, a kind of method using kit detection PIK3CA mutation described in first aspect, specifically Step includes as follows：

(1) DNA is extracted：Peripheral blood DNA is extracted using DNA extraction agents, obtains concentration >=30ng/ μ L DNA；

(2) droplet is prepared：By step (1) extract DNA mixed with ddPCR reagents, be put into drop generator prepare it is micro- Drop；

(3) PCR is expanded：According to 95 DEG C of denaturation 5min, subsequent 95 DEG C of denaturation after droplet sealer prepared by step (2) 15sec, 60 DEG C of annealing 30sec, carries out 40 circulations；The step of last 98 DEG C of extensions 10min, enters performing PCR amplification；

(4) droplet detects：Step (3) reacted PCR plate is transferred in droplet analyzer and carries out fluoroscopic examination, and is made Concentration calculating is carried out with software.

The third aspect, the present invention provide a kind of kit as described in relation to the first aspect and are used to detect PIK3CA mutation.

Compared with prior art, the present invention has the advantages that：

(1) kit provided by the invention is related to spy using the method detection PIK3C of digital pcr mutation for mutation The primer and probe of opposite sex optimization, and it is aided with the quality inspection probe of conserved region, DNA is extracted in kit formula and concentration are adjusted, The higher DNA of extracting concentration, facilitates subsequent detection, and the kit finally given is efficiently succinct, has higher sensitivity and spy The opposite sex.

(2) kit of the invention optimizes the testing process of digital pcr, dashed forward in the process for detecting PIK3CA mutation Change average abundance is higher, and the degree of accuracy reaches 100%, and operation is simple, takes short, as a result accurate, prognosis and guidance to cancer Treatment has positive role.

Brief description of the drawings

Fig. 1 is the detection droplet number result figure in the PIK3CA gene H1047R mutational sites of the embodiment of the present invention 3.Wherein The mutation that Fig. 1 (A) is H1047R calculates, and Fig. 1 (B) is PIK3CA gene counts, Dark grey：Dissociative DNA droplet number without amplification, Blueness：Saltant type dissociative DNA droplet number, green：Quality Control dissociative DNA droplet number；

Fig. 2 is the detection droplet number result figure in the PIK3CA gene E545K mutational sites of the embodiment of the present invention 3.Wherein, Fig. 2 (A) is that E545K mutation calculate, and Fig. 2 (B) is PIK3CA gene counts, Dark grey：Dissociative DNA droplet number without amplification, it is blue Color：Saltant type dissociative DNA droplet number, green：Quality Control dissociative DNA droplet number.

Embodiment

Further to illustrate the technological means and its effect of the invention taken, below in conjunction with accompanying drawing and by specific real Mode is applied to further illustrate technical scheme, but the present invention is not limited in scope of embodiments.

Embodiment 1 assembles kit

By probe A, probe B, probe C, 6 primers and 2 × ddPCR buffer solutions composition digital pcr reagent with include it is red Cell pyrolysis liquid, nucleus lysate, EDTA, 20mg/mL Proteinase K, saturated phenol, the DNA extraction agents of chloroform and ethanol It is assembled into kit；

Including：SEQ ID NO:1 is ACGAGATCCTCTCTCTGAAATCACTA primer；

SEQ ID NO:2 be CATGCTGAGATCAGCCAAATTCAG primer；

Probe A：FAM-FAM-CTATGGAGTCACAGGTAAG-MGB；

SEQ ID NO:4 be TGAAACAAATGAATGATGCACG primer；

SEQ ID NO:5 be CAGTGCAGTGTGGAATCCAGAGT primer；

Probe B：FAM-ATGGATTGGATCTTCCACACA-MGB；

SEQ ID NO:7 be GCTTGCAATAGGTGTGCGTC primer；

SEQ ID NO:8 be CATCTCCCAAACATCCCTCAC primer；

Probe C：HEX-CACTGAACAAGTTGG-MGB.

The concentration of the primer is 0.2-1 μM, and the concentration of the probe is 0.1-0.5 μM；

Wherein, the erythrocyte cracked liquid includes 0.155M NH₄Cl, 0.01M KHCO₃With 0.13M EDTA；

The nucleus lysate includes 0.01M pH 8.2 Tris-HCl, 0.4M NaCl and 0.008M EDTA.

Embodiment 2 extracts DNA

DNA method for extracting is as follows：

(1) 40mL 1 × erythrocyte cracked liquid targeted drug related to the PI3K paths such as PI3K inhibitor are employed is taken to control The 4-6mL EDTA anticoagulation cirumferential bloods of the human patients with cancer for the treatment of mix in 50mL centrifuge tubes, until solution went clear, 4 DEG C 2000rpm is centrifuged 10 minutes, is carefully removed supernatant, is added 3mL1 × nucleus lysate and 25 μ L Proteinase Ks to be shaken in centrifuge tube Swing to even, add 300 μ L 20%SDS, shake up to there is clear viscous shape, 37 DEG C digest more than 6 hours；

(2) plus 6mL saturated phenols are in 15mL centrifuge tubes, digestive juice added into this centrifuge tube, jog mixes, 4 DEG C of 2000rpm Centrifugation 10 minutes, then add isometric phenol/chloroform (each 3mL) that supernatant carefully is moved into this centrifuge tube, mixed to another 15mL centrifuge tubes Even, 4 DEG C of 2000rpm are centrifuged 10 minutes；

(3) plus 6mL chloroforms are in 15mL centrifuge tubes, and supernatant carefully is moved into this centrifuge tube, mix, 4 DEG C of 2000rpm centrifugations 10 minutes；Add another 15mL centrifuge tubes of 10mL absolute ethyl alcohols, careful supernatant moves to this centrifuge tube and shaken up, and sees white flock DNA, uses The TIP for cutting tip suctions out DNA, after 12000rpm is centrifuged 20 minutes, with 70% ethanol wash it is secondary (500 μ L for the first time, second Secondary 300 μ L, 12000rpm centrifuge 10min), drying at room temperature 5 minutes, then DNA is dissolved in 200 μ L1 × TE, room-temperature dissolution mistake At night, then ultraviolet survey OD values, are the DNA extracts that 20-100 μ L and DNA concentration are more than 30ng/ μ L so as to obtain volume.

Embodiment 3

DdPCR reactions steps are as follows：

Configure ddPCR reaction systems：9 μ LDNA about 100ng to be measured are taken, are drawn respectively from 11 μ L for the probe of different mutation Thing and buffer solution mixing；

Droplet is prepared, occurs to add the above-mentioned PCR reaction solutions of 20 μ L in hole corresponding on card in DG8TM droplets, 70 μ L are micro- Special oil occurs for drop, covers droplet and card sealing gasket occurs, be put into QX200 drop generators and reacted.It is micro- by what is handled well Drop is slowly transferred on 96 orifice plates, and 96 orifice plates are placed on heat-sealing instrument, is covered heat-sealing film and is carried out sealer；

PCR is expanded：The droplet PCR amplification programs prepared are subjected to purpose fragment amplification, PCR reaction conditions are：95 DEG C denaturation 5min, it is subsequent 95 DEG C denaturation 15sec, 60 DEG C annealing 30sec, carry out 40 circulation, it is last 98 DEG C extension 10min, 4 DEG C Preserve；

Droplet detects：After PCR reactions terminate, PCR plate is transferred to QX200 droplet analyzers (Bio-Rad Laboratories USA) on, fluoroscopic examination is carried out to all samples hole；

Interpretation of result：Concentration calculating is carried out using QuantaSoftTM softwares, Quality Control has amplification (in HEX fluorescence signals area There is droplet distribution in domain) on the premise of the amplification (having droplet distribution in FAM fluorescence signals region) of saltant type fragment be present, then judge The gene has mutation, altogether detect 20 patients peripheral blood sample, as a result as shown in Figure 1, Figure 2, shown in Tables 1 and 2；

The PIK3CA gene E545K site mutation testing results of table 1

Patient	Abundance	Patient	Abundance	Patient	Abundance	Patient	Abundance
								A	0	F	5.6	K	1.5	P	2.3
B	3.6	G	1.8	L	0	Q	2.1
								C	4.3	H	3.2	M	0	R	0
D	6.7	I	0	N	3.2	S	3.4
								E	2.8	J	3.4	O	2.6	T	1.5

As shown in Table 1, it is positive sample that PIK3CA genes E545K site mutations, which have detected wherein 15,20 samples, 5 For negative sample, the average abundance of detection is 3.2, the degree of accuracy 100%.

The PIK3CA gene H1047R site mutations of table 2 detect

Patient	Abundance	Patient	Abundance	Patient	Abundance	Patient	Abundance
								A	1.8	F	2.6	K	1.4	P	9.1
B	0	G	0	L	2.4	Q	0
								C	3.2	H	4.1	M	3.6	R	7.2
D	0	I	0	N	5.3	S	8.1
								E	4.5	J	4.3	O	2.1	T	9.2

As shown in Table 2, it is positive sample that PIK3CA genes H1047R site mutations, which have detected wherein 15,20 samples, 5 Example is negative sample, and the average abundance of detection is 4.6, the degree of accuracy 100%.

In summary, kit provided by the invention, by designing specific mutant primer and probe sequence, optimization examination The concentration and formula of each reagent of each component in agent box, DNA extract concentrations >=30ng/ μ L, the kit finally given are efficiently simple It is clean, there are higher sensitivity and specificity, operation is simple, and time-consuming short, as a result accurate, the degree of accuracy reaches 100%, to cancer Prognosis and guiding treatment have positive role.

Applicant states that the present invention illustrates the method detailed of the present invention, but not office of the invention by above-described embodiment It is limited to above-mentioned method detailed, that is, does not mean that the present invention has to rely on above-mentioned method detailed and could implemented.Art Technical staff it will be clearly understood that any improvement in the present invention, equivalence replacement and auxiliary element to each raw material of product of the present invention Addition, selection of concrete mode etc., within the scope of all falling within protection scope of the present invention and disclosing.

Sequence table

<110>Tianjin train of thought medical test Co., Ltd

<120>A kind of kit and its application that PIK3CA mutation are detected by digital pcr

<130> 2017

<141> 2017-12-11

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 26

<212> DNA

<213>Artificial synthesized ()

<400> 1

acgagatcct ctctctgaaa tcacta 26

<210> 2

<211> 24

<212> DNA

<213>Artificial synthesized ()

<400> 2

catgctgaga tcagccaaat tcag 24

<210> 3

<211> 19

<212> DNA

<213>If probes' ()

<400> 3

ctatggagtc acaggtaag 19

<210> 4

<211> 22

<212> DNA

<213>Artificial synthesized ()

<400> 4

tgaaacaaat gaatgatgca cg 22

<210> 5

<211> 23

<212> DNA

<213>Artificial synthesized ()

<400> 5

cagtgcagtg tggaatccag agt 23

<210> 6

<211> 21

<212> DNA

<213>Artificial synthesized ()

<400> 6

atggattgga tcttccacac a 21

<210> 7

<211> 20

<212> DNA

<213>Artificial synthesized ()

<400> 7

gcttgcaata ggtgtgcgtc 20

<210> 8

<211> 21

<212> DNA

<213>Artificial synthesized ()

<400> 8

catctcccaa acatccctca c 21

<210> 9

<211> 15

<212> DNA

<213>Artificial synthesized ()

<400> 9

cactgaacaa gttgg 15

Claims (10)

1. a kind of kit that PIK3CA mutation are detected by digital pcr, it is characterised in that the kit includes digital pcr Reagent, the digital pcr reagent include the Design for polymorphism in the mutational site of the E545K and H1047R according to PIK3CA genes Primer and probe；

The nucleotide sequence of the E545K of PIK3CA genes primer such as SEQ ID NO:Shown in 1-2, the nucleic acid of the probe A Sequence such as SEQ ID NO:Shown in 3；

The nucleotide sequence of the H1047R of PIK3CA genes primer such as SEQ ID NO:Shown in 4-5, the probe B such as SEQ ID NO:Shown in 6.

2. kit according to claim 1, it is characterised in that it is terminal modified glimmering that the probe A and probe B also include 5 ' Light group and the quenching group at 3 ' ends；

Preferably, the modification group be FAM, VIC, HEX in any one, preferably FAM；

Preferably, the quenching group be BHQ1, BHQ2 or MGB in any one, preferably MGB；

Preferably, the digital pcr reagent also includes the primer and probe C of the conserved regions design according to PIK3CA genes；

Preferably, the nucleotide sequence of the primer of the conserved region of the PIK3CA genes such as SEQ ID NO:Shown in 7-8, the probe C such as SEQ ID NO:Shown in 9；

Preferably, the probe C also includes 5 ' terminal modified fluorophors and the quenching group at 3 ' ends；

Preferably, the modification group be FAM, VIC or HEX in any one, preferably HEX；

Preferably, the quenching group be BHQ1, BHQ2 or MGB in any one, preferably MGB；

Preferably, the digital pcr kit includes 2 × ddPCR buffer solutions.

3. kit according to claim 1 or 2, it is characterised in that the concentration of the primer is 0.2-1 μM；

Preferably, the concentration of the probe is 0.1-0.5 μM.

4. according to the kit any one of claim 1-3, it is characterised in that the kit also includes DNA and extracted Reagent；

Preferably, the DNA extraction agents include erythrocyte cracked liquid, nucleus lysate, EDTA, Proteinase K, saturated phenol, Chloroform and ethanol.

5. kit according to claim 4, it is characterised in that the erythrocyte cracked liquid includes NH₄Cl、KHCO₃With EDTA；

Preferably, the nucleus lysate includes pH 8.2 Tris-HCl, NaCl and EDTA.

6. kit according to claim 5, it is characterised in that the NH₄Cl concentration is 0.15-0.20M, further Preferably 0.155M；

Preferably, the KHCO of the erythrocyte cracked liquid₃Concentration be 0.01-0.02M, more preferably 0.01M；

Preferably, the EDTA of erythrocyte cracked liquid concentration is 0.1-0.2mM, more preferably 0.13M；

Preferably, the Tris-HCl of nucleus lysate concentration is 0.01-0.02M, more preferably 0.01M；

Preferably, the NaCl of nucleus lysate concentration is 0.3-0.5M, more preferably 0.4M；

Preferably, the EDTA of nucleus lysate concentration is 0.005-0.01mM, more preferably 0.008M；

Preferably, the concentration of the Proteinase K is 18-22mg/mL, more preferably 20mg/mL.

A kind of 7. method using the kit detection PIK3CA mutation as described in claim 1-6, it is characterised in that including such as Lower step：

(1) DNA is extracted：Peripheral blood DNA is extracted using the DNA extraction agents；

(2) droplet is prepared：The DNA that step (1) extracts is mixed with digital pcr reagent, is put into drop generator and prepares droplet；

(3) PCR is expanded：Enter performing PCR amplification according to setting program after droplet sealer prepared by step (2)；

(4) droplet detects：Step (3) reacted PCR plate is transferred in droplet analyzer and carries out fluoroscopic examination, and using soft Part carries out concentration calculating.

8. according to the method for claim 7, it is characterised in that the DNA concentration of step (1) described extraction >=30ng/ μ L；

Preferably, the condition of the PCR amplifications is：95 DEG C of denaturation 5min, subsequent 95 DEG C of denaturation 15se, 60 DEG C of annealing 30sec, enter 40 circulations of row, last 98 DEG C of extensions 10min.

9. the method according to claim 7 or 8, it is characterised in that specific steps include as follows：

(1) DNA is extracted：Peripheral blood DNA is extracted using DNA extraction agents, obtains concentration >=30ng/ μ L DNA；

(2) droplet is prepared：The DNA that step (1) extracts is mixed with ddPCR reagents, is put into drop generator and prepares droplet；

(3) PCR is expanded：According to 95 DEG C of denaturation 5min, subsequent 95 DEG C of denaturation 15sec, 60 after droplet sealer prepared by step (2) DEG C annealing 30sec, carry out 40 circulation；The step of last 98 DEG C of extensions 10min, enters performing PCR amplification；

(4) droplet detects：Step (3) reacted PCR plate is transferred in droplet analyzer and carries out fluoroscopic examination, and using soft Part carries out concentration calculating.

10. one kind kit as any one of claim 1-6 is used to detect PIK3CA mutation.