CN107858410A - Simple efficiently real-time GMO detection method and its application - Google Patents
Simple efficiently real-time GMO detection method and its application Download PDFInfo
- Publication number
- CN107858410A CN107858410A CN201711384863.3A CN201711384863A CN107858410A CN 107858410 A CN107858410 A CN 107858410A CN 201711384863 A CN201711384863 A CN 201711384863A CN 107858410 A CN107858410 A CN 107858410A
- Authority
- CN
- China
- Prior art keywords
- detection method
- extraction
- transgenosis
- nucleic acid
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of simple efficiently real-time GMO detection method and its application, GMO detection method includes tissue treatment, takes the appropriate amount of sample of the tissue of agriculture and animal husbandry plant or animal successively, grinds homogenate；Nucleic acid extraction, nucleic acid extraction is carried out using paramagnetic particle method；Target dna captures, denaturation treatment is carried out to the nucleic acid that extraction obtains, then using specificity, purpose foreign gene and/or transgenosis universal component the design transgenosis capture extraction chip generally turned for transgenic field, then target gene is carried out to capture extraction and enrichment；Single-molecule sequencing, the hereditary information of detection sample is obtained with nanometer pore single-molecule sequence measurement；Interpretation of result.GMO detection method provided by the invention, the detection of transgenic product simply can be efficiently realized in real time, whole process is completed with " fool " pattern of full-automation, so as to realizing that non-professional general practitioners/consumer can also realize the detection of transgenic product.
Description
Technical field
The present invention relates to biological technical field, and in particular to it is a kind of it is simple efficiently in real time GMO detection method and
It is applied.
Background technology
Transgenic product is by inserting specific foreign gene or genetic fragment through non-fertilization methods in cell DNA, to obtain
Certain good character animal and plant or microorganism made of product.Transgenic product, which has become, in recent years enjoys social pass
The focus of note, therefore the Testing and appraisal of transgenic product is also further important, to protect the right to know of consumer and right to choose.
Detection of GMOs method can be divided into qualitative detection and quantitatively detect two classes.Qualitative checking method can detect sample
Whether product contain transgene component and contain which kind of transgene component；Quantitative detecting method, which can be then detected in sample, turns base
Because of component content.It can be divided into two classes according to the different detection methods of detection target：One kind is that the PCR based on nucleic acid (DNA) is detected
Method, another kind of is the protein detection method based on exogenous proteins target.
Qualitative PCR detection based on nucleic acid (DNA) can be divided into examination method according to specific difference, gene specific is examined
Survey method, species specific detection method, transformation event specific assay etc..Examination method detection sample in whether containing transgenosis into
Point, by being detected the universal component (including promoter, terminator and marker gene) in transgenic product to determine to produce
Whether product are transgenosis.Most common universal component has CaMV35S promoters, NOS terminator and reporter gene NPT- II.Gene
Which kind of gene contained in specific assay detection sample, it is known that what the foreign gene being transferred to is.Species specificity is examined
Which kind of biology is survey method detect sample composition from by detecting the distinctive internal standard gene of species, such as detects that soybean is distinctive interior
Mark gene lectin genes show containing soybean component, detect that the distinctive zein genes of corn then show containing corn composition.
Whether contain specific transformed variety composition in transformation event specific assay detection sample.This method is according to foreign gene
The uniqueness of insertion point, identify which kind of strain is transformant belong to by the flanking sequence for detecting foreign gene.
Real-Time Fluorescent Quantitative PCR Technique is the quantitative detection GMOs means based on nucleic acid (DNA).This method is in PCR
Fluorophor is added in reaction system, whole PCR processes are monitored in real time using fluorescence signal accumulation, finally by standard curve to not
Know that template carries out quantitative analysis.The gm content in sample can be accurately quantified by this method.
Main method based on protein detection is enzyme linked immunosorbent assay (ELISA), and this method is by antigen and resisted
The immunologic evaluation technology that physical efficiency is specifically bound.In recent years, scientists based on ELISA method by specific protein
Bai Kangti is smeared on a support, establishes band detection (Strip Test) quick determination method.Band detection is also known as laterally
Stream is examined or test paper is examined, and is the most frequently used method of current detection transgenic product, by test paper directly with the target egg in sample
White matter antigen contact produces reaction, can carry out semi-quantitative analysis to transgenic product.Using this method detection process without specially
Door instrument, it is economical convenient, but an important limitation of this class testing is that not all transgenosis is all encoded into one individually
Target protein.Therefore, test paper test is not useful to all commercialization transgenic product.Test paper test simultaneously is to through too high
Temperature or the transgenic product of chemical treatment processing do not apply to yet, such as soybean protein isolate, lecithin etc..Because these albumen are sent out
Changing property causes specific binding site to destroy.Because the protein of converted products is easier to degrade than DNA, therefore, based on albumen
Test paper test be not suitable for detection by processing transgenic product, and based on DNA PCR detection method suitable for polytype turn
Gene prod.In addition test paper test sensitiveness is not so good as PCR detection method.For example, test paper generally exists to the test scope of transgenosis
0.1%~1%, and PCR (DNA) method of testing is more sensitive, the DNA content minimum 0.01% of detection.But it is current based on
DNA PCR detection method is required to expand into performing PCR, and complicated and cost is higher；Therefore, it is also desirable to develop a kind of easy, real
When, it is inexpensive, with " fool " pattern be achievable GMO detection method by layman.
The content of the invention
For in the prior art the defects of, present invention aims at provide a kind of simple efficiently transgenic product inspection in real time
Method and its application are surveyed, simply can efficiently realize the detection of transgenic product in real time, whole process is with the " stupid of full-automation
Melon " pattern is completed, so as to realizing that non-professional general practitioners/consumer can also realize the detection of transgenic product.
To achieve the above object, technical scheme provided by the invention is：
The invention provides a kind of simple efficiently real-time GMO detection method, method includes at tissue successively
The step of reason, nucleic acid extraction, target dna capture, single-molecule sequencing and interpretation of result.
Preferably, tissue treatment specifically includes：The appropriate amount of sample of the tissue of agriculture and animal husbandry plant or animal is taken, grinds homogenate.
Preferably, nucleic acid extraction specifically includes：Nucleic acid extraction is carried out using paramagnetic particle method, utilizes the specificity of magnetic bead and nucleic acid
Nucleic acid is obtained with reference to extraction.
Preferably, target dna capture specifically includes：Denaturation treatment is carried out to the nucleic acid that extraction obtains, then using special
Property, purpose foreign gene and/or transgenosis universal component the design transgenosis capture generally turned for transgenic field is extracted
Chip, then target gene is carried out to capture extraction and enrichment.
Preferably, transgenosis capture extraction chip is purpose foreign gene and/or transgenosis universal element used by
Part and the principle of probe hybridization matching are designed and are prepared.
Preferably, the universal purpose foreign gene turned of the transgenic field include but is not limited to Bt anti insect genes,
One or more in Cry1A genes, Antiglyphosate gene；The transgenosis universal component includes but is not limited to promoter, end
The only one or more in son and marker gene.
Preferably, single-molecule sequencing specifically includes：Using nanometer pore single-molecule sequence measurement, the target gene of capture is entered
Row sequencing, obtain the hereditary information of detection sample.
Preferably, interpretation of result specifically includes：The hereditary information obtained is subjected to analysis checking, determine whether for
Transgenosis.
Also protection of the invention is simple, and efficiently GMO detection method is tested to the product progress transgenosis true and false in real time
Application in card.
Preferably, product is selected from agro-ecology, using medicine of the agro-ecology as the food of raw material and using agro-ecology as raw material
One or more in thing；One or more of the agro-ecology in crops, livestock and poultry and aquatic biological.
Simple GMO detection method set forth in the present invention is based on forth generation nanometer pore single-molecule sequence measurement, can
With simple, efficient, automation, the hereditary information for obtaining individual in real time.Forth generation nanometer pore single-molecule sequence measurement is with Britain
The MinION sequencing technologies of Oxford Nanopore Technologies companies are representative.Its general principle is to work as DNA molecular
, can be to being had an impact by the electric current of nano-pore or its composition base is from a biological nano hole when passing through.Different points
Son by when on caused by electric current influence there is diacritic difference, utilize this species diversity can identification gene in base (to)
Put in order.When nanometer pore single-molecule sequence measurement is to DNA sequencing, without DNA is marked, expand without performing PCR is entered
Increase, independent sequencing of the real-time implementation to each DNA molecular.
Simple GMO detection method set forth in the present invention combines the qualitative PCR for being currently based on nucleic acid (DNA)
Detect the specific detections such as examination method, gene specific detection method, species specific detection method, transformation event specific assay
Method.This method can be by carrying out to the universal component (including promoter, terminator and marker gene) in transgenic product
Detect to determine whether product is transgenosis；It can detect and which kind of foreign gene contained in sample；Can be by detecting species spy
Some internal standard gene detection sample compositions are from which kind of biology；It can also be passed through according to the uniqueness of foreign gene insertion point
Which kind of strain is the flanking sequence identification transformant of detection foreign gene belong to.
Using simple GMO detection method, the outturn sample tissue to be identified is handled first, then
Utilize the nucleic acid extracted the methods of paramagnetic particle method in sample.The DNA denaturation extracted is carried for single-stranded rear captured with transgenosis afterwards
Probe hybridization on coring piece combines.If contain the universal component in foreign gene and/or transgenic product in sample DNA
(including promoter, terminator and marker gene), the then probe for just having sample dna fragment to be captured with transgenosis on extraction chip are miscellaneous
Knot is closed.After washing removes sample DNA, transgenosis is captured to the DNA fragmentation combined hybridizing with probe on extraction chip and eluted
Subsequently into being sequenced in nanometer pore single-molecule sequencing device.By can further be detected to analyzing and identifying for sequencing data result
Obtain in sample and which kind of foreign gene contained；Sample composition is detected from which kind of biology；Which kind of strain is identification transformant belong to.If
If not containing transgene component in sample DNA, hybridize without the probe on sample dna fragment and transgenosis capture extraction chip
With reference to.After then washing removes sample DNA, the DNA pieces combined with probe hybridization will not be had by being captured in transgenosis on extraction chip
Section is eluted into nanometer pore single-molecule sequencing device, therefore will not have data-signal generation.
Simple GMO detection method set forth in the present invention mainly for but to be not limited to ordinary consumer etc. non-specially
Detection demand of the industry personnel to transgenic product.Transgenic product has become the focus for enjoying social concerns in recent years, for
Transgenic product consumer, which should possess the right to know of right to know and right to choose and consumer and right to choose, must obtain effectively
Defend protection.Simple GMO detection method set forth in the present invention is mainly used in but is not limited to pesticide herd product, food
Deng producing and selling and consumer field, it is intended to enable the laymans such as non-professional ordinary consumer simply, conveniently, in real time
The detection to transgenic product, right to know and right to choose of the protection consumer to transgenic product are realized with " fool " pattern in ground.
Method set forth in the present invention realizes that simple, real-time, " fool " pattern detection is to be based on turning to transgenic product
Gene trap extracts capture enrichment of the chip technology to turned purpose foreign gene and/or transgenosis universal component, Yi Ji
The sequencing of four generation nanometer pore single-molecules carries out the result that sequence verification is combined to the inhereditary material for being enriched with extraction.By to current
The purpose foreign gene determined which existing gene and be used for transgenic product of domestic and international transgenic technology, and transgenosis
Which the universal component (including promoter, terminator and marker gene) of product has.Then by these purpose foreign genes and/or
Universal component captures extraction probe as transgenosis and is used for prepare transgenosis capture extraction chip (separately having patent protection).Therefore institute
The transgenosis capture extraction chip of preparation can be used as a kind of wide spectrum, general-purpose genetic extraction chip to be applied to involved by all probes
And animals and plants genetically modified organism Testing and appraisal.
During using the inventive method, processing detection individual sample tissue and nucleic acid is extracted first, captured afterwards with transgenosis
Extract chip hybridization and combine capture target dna.Finally results of hybridization is eluted and carries out single-molecule sequencing, if can be sequenced
Data then show that detecting individual of sample belongs to transgenic product, while are detected by that can be obtained to sequencing data interpretation of result
Sample in which kind of foreign gene contained, from which kind of biology, belong to the information such as which kind of strain.If there is no base sequence signal
Produce the foreign gene and/or universal component for then showing that detected individual is identified without transgenosis capture extraction chip.
Technical scheme provided by the invention, there is following beneficial effect：(1) simple inheritance information set forth in the present invention
The method of acquisition is to be based on forth generation nanometer pore single-molecule sequence measurement, can be simple, efficient, real-time, inexpensive, by amateur people
Member with " fool " pattern be can be achieved transgenic product detection, while had concurrently based on nucleic acid (DNA) qualitative PCR detection with
The advantages of band based on protein detection detects；(2) method provided by the invention is that the transgenosis based on nucleic acid (DNA) is examined
Survey, therefore method is the same with the PCR transgenic detection methods based on DNA, suitable for polytype transgenic product；The party simultaneously
Method have the band detection based on protein detection without specialized equipment, it is economical convenient the advantages that, turn avoid band detection
It is required that the transgenosis detected must all be encoded into a single target protein, all commercialization transgenosis productions are can apply to
Product.
The additional aspect and advantage of the present invention will be set forth in part in the description, and will partly become from the following description
Obtain substantially, or recognized by the practice of the present invention.
Brief description of the drawings
Fig. 1 is the schematic diagram of the simple efficiently real-time GMO detection method in the embodiment of the present invention；
Fig. 2 be in the embodiment of the present invention using simple efficiently GMO detection method detection in real time product whether be
Transgene method schematic diagram.
Embodiment
Below in conjunction with the accompanying drawing in the embodiment of the present invention, the technical scheme in the embodiment of the present invention is carried out clear, complete
Site preparation describes.The following examples are only intended to illustrate the technical solution of the present invention more clearly, therefore is intended only as example, without
It can be limited the scope of the invention with this.Experimental method in following embodiments, it is conventional side unless otherwise specified
Method.Test material used, is to be commercially available from routine biochemistry reagent shop unless otherwise specified in following embodiments.
Quantitative test in following examples, it is respectively provided with and repeats to test three times, data is to repeat the average value or average value of experiment three times
± standard deviation.
As shown in figure 1, the present invention provides a kind of simple efficiently real-time GMO detection method, successively including tissue
It is the step of processing, nucleic acid extraction, target dna capture, single-molecule sequencing and interpretation of result, specific as follows.
Tissue treatment：The appropriate amount of sample of the tissue of agriculture and animal husbandry plant or animal is taken, quickly grinds homogenate.
Nucleic acid extraction：Nucleic acid extraction is carried out using paramagnetic particle method, obtained using the specific binding extraction of magnetic bead and nucleic acid high
The nucleic acid of purity, high concentration.
Target dna captures：Denaturation treatment is carried out to the nucleic acid that extraction obtains, then using specificity, led for transgenosis
Purpose foreign gene (one included but is not limited in Bt anti insect genes, Cry1A genes, Antiglyphosate gene that domain generally turns
Kind is a variety of) and/or transgenosis universal component (one kind or more included but is not limited in promoter, terminator and marker gene
Kind), the principle that matching is hybridized according to used purpose foreign gene and/or transgenosis universal component and probe carries out transgenosis
Capture extraction chip design and preparation, then extraction chip is captured using transgenosis target gene is carried out to capture extraction and enrichment.
Single-molecule sequencing：Using nanometer pore single-molecule sequence measurement, the target gene of capture is sequenced, detected
The hereditary information of sample.
Interpretation of result：The hereditary information obtained is subjected to analysis checking, determined whether as transgenosis.
With reference to specific embodiment to it is provided by the invention it is simple efficiently in real time GMO detection method make into
One step explanation.
Embodiment one
The present embodiment provides a kind of simple efficiently real-time GMO detection method, comprises the following steps.
Tissue treatment：Product A and product B appropriate amount of sample are taken respectively, quickly grind homogenate.
Nucleic acid extraction：Paramagnetic particle method is respectively adopted and carries out nucleic acid extraction, is obtained using the specific binding extraction of magnetic bead and nucleic acid
Obtain high-purity, the nucleic acid of high concentration.
Target dna captures：Denaturation treatment is carried out to the nucleic acid that extraction obtains respectively, then using specificity, for turning base
Because of the purpose foreign gene Q genes that field generally turns, the principle that matching is hybridized according to Q genes and probe carries out transgenosis capture
Extract chip design and prepare, then extraction chip is captured using transgenosis target gene is carried out to capture extraction and enrichment.
Wherein, Q gene orders are SEQ ID NO in sequence table:The 1 base code sequence represented (only shows one here
DNA is single-stranded).
SEQ ID NO:1：ACAGGGGTGTTATGATGGAGTTTTAGCT.
SEQ ID NO in the sequence information of the specific capture probe designed for the sequence information of Q genes such as sequence table:
Shown in 2.
SEQ ID NO:2：TGTCCCCACAATACTACCTCAAAATCGA.
Single-molecule sequencing：Nanometer pore single-molecule sequence measurement is utilized respectively, the target gene of capture is sequenced, is obtained
Detect the hereditary information of sample.
Interpretation of result：The hereditary information obtained is subjected to analysis checking respectively, determined whether as transgenosis.
Analysis method：If detection sample contains foreign gene Q genes, can be with designed probe molecule base complementrity
Hybridization combines, and is enriched in so as to captured on chip；It is eluted to again afterwards in nanometer pore single-molecule sequencing and obtains sequence information, table
Bright detection sample belongs to transgenic product.If detection sample does not contain foreign gene Q genes, then can not be with designed probe
Molecule is incorporated on genetic chip, so as to then be washed away in the nanometer pore single-molecule that will not enter next step sequencing；Cause
Result obtained by this is exactly that no base sequence signal produces, and shows that detecting sample individual is not belonging to transgenic product.
Analysis result is shown：SEQ ID NO in product A sequence information such as sequence table:Shown in 3 (one is only shown here
DNA is single-stranded), it is known that contain transgenosis Q genes in product A.
SEQ ID NO:3：TGTGTGTTCCACAGGGGTGTTATGATGGAGTTTTAGCTGAATTAGAATCCTCTGGTG。
SEQ ID NO in product B sequence information such as sequence table:(only show that a DNA is single-stranded here) shown in 4, it is known that
Transgenosis Q genes are not contained in product B.
SEQ ID NO:4：TGTGTGTTCCACGTTGTGCATCAACCATTCAGGAAGGAGAATTAGAATCCTCTGGTG。
Embodiment two
The present embodiment provides one kind and uses simple efficient GMO detection method in real time set forth in the present invention, in fact
The detection of existing transgenic pest-resistant rice.
Tissue treatment：Extensive No. 1 rice of insect-proof rice China to be measured is taken respectively or containing extensive No. 1 rice of China, quickly grind homogenate.
Nucleic acid extraction：Paramagnetic particle method is respectively adopted and carries out nucleic acid extraction, is obtained using the specific binding extraction of magnetic bead and nucleic acid
Obtain high-purity, the nucleic acid of high concentration.
Target dna captures：Denaturation treatment is carried out to the nucleic acid that extraction obtains respectively, then using specificity, melted according to Bt
Mould assembly insecticidal protein gene Cry1Ac/Cry1Ab and probe hybridization matching principle carry out transgenosis capture extraction chip design and
Prepare, then extraction chip is captured using transgenosis target gene is carried out to capture extraction and enrichment.
Single-molecule sequencing：Results of hybridization is eluted respectively, using nanometer pore single-molecule sequence measurement, the mesh obtained to capture
Mark gene is sequenced, and obtains the hereditary information of detection sample.
Interpretation of result：The hereditary information obtained is subjected to analysis checking respectively, determined whether as transgenosis.
Analysis method：If detection sample contains foreign gene Bt pattern of fusion insecticidal protein gene Cry1Ac/Cry1Ab, just
It can hybridize with designed probe molecule base complementrity and combine, be enriched in so as to captured on chip；It is eluted to nanometer again afterwards
Sequence information is obtained in the single-molecule sequencing of hole, shows that detecting sample belongs to transgenic product.If detection sample does not contain external source
Gene Bt pattern of fusion insecticidal protein gene Cry1Ac/Cry1Ab, then it can not be incorporated in genetic chip with designed probe molecule
On, so as to then be washed away in the nanometer pore single-molecule that will not enter next step sequencing；Therefore resulting result is exactly
There is no the generation of base sequence signal, show that detecting sample individual is not belonging to transgenic product.
Analysis result is shown：Insect-proof rice extensive No. 1 rice of China and contain in extensive No. 1 rice of China foreign gene Bt pattern of fusion
Insecticidal protein gene Cry1Ac/Cry1Ab genes, illustrate extensive No. 1 rice of China and all contain trans Bt gene containing extensive No. 1 rice of China
Composition, it is trans Bt gene product.
Need the term explained as follows.Gene：It is the DNA fragmentation for carrying all hereditary information of bion, is control life
Thing individual likely differs from the basic genetic unit of the characters such as form, physiology, biochemistry and the behavior of other biological individual.
Genetic chip (also known as DNA chip, biochip)：Refer to anchor at the high-density DNA microarray on carrier.Specifically
Ground say be exactly using the target gene of known array or oligonucleotide fragment as nucleic acid probe in an orderly manner, high-density array glass,
On the carriers such as silicon, referred to as genetic chip.Genetic chip is now mainly used in genetic test purpose, by the sample DNA molecule of mark with
Nucleic acid probe on chip is hybridized and obtains sample molecule by detecting the hybridization signal intensities of each probe molecule
Quantity and sequence information.Sample-probe hybridization matching used by the transgenosis capture extraction chip illustrated in the present invention
The principle of gene detecting chip of the principle with routinely applying is identical but is used for the capture of target gene enrichment.
Promoter (Promoter)：It is a part of gene, the deoxidation core that gene is transcribed can be made by being one section
Ribosomal ribonucleic acid (DNA) sequence.Promoter can be recognized by RNA polymerase, and start to transcribe.In ribonucleic acid (RNA) synthesis, open
Mover with the transcription factor interaction for determining transcription beginning, can control the initial time and expression journey of gene expression (transcription)
Degree, so as to determine the activity of gene, then cell is controlled to start to produce any protein.
Terminator (Terminator)：In transcription, there is provided the DNA sequence dna of transcription stop signals, on rna level
Stem-ring structure is formed to work by the terminator sequence of transcription out.
Marker gene：It is a kind of gene of known function or known array, specific marker can be played a part of.In base
For on engineering significance, it is the vital signs of recombinant DNA carrier, commonly used to examine conversion success or not.Determine in gene
For in the meaning of position, it is the instrument for entering line flag to target gene, commonly used to positioning of the testing goal gene in cell.
It should be noted that unless otherwise indicated, technical term or scientific terminology used in this application should be this hair
The ordinary meaning that bright one of ordinary skill in the art are understood.Unless specifically stated otherwise, otherwise illustrate in these embodiments
Part and relative step, numerical expression and the numerical value of step are not limit the scope of the invention.It is illustrated and described herein
In all examples, unless otherwise prescribed, any occurrence should be construed as merely exemplary, not as limitation, because
This, other examples of exemplary embodiment can have different values.
In the description of the invention, it is to be understood that term " first ", " second " are only used for describing purpose, and can not
It is interpreted as indicating or implies relative importance or imply the quantity of the technical characteristic indicated by indicating.Thus, define " the
One ", one or more this feature can be expressed or be implicitly included to the feature of " second ".In the description of the invention,
" multiple " are meant that two or more, unless otherwise specifically defined.
Finally it should be noted that：Various embodiments above is merely illustrative of the technical solution of the present invention, rather than its limitations；To the greatest extent
The present invention is described in detail with reference to foregoing embodiments for pipe, it will be understood by those within the art that：Its according to
The technical scheme described in foregoing embodiments can so be modified, either which part or all technical characteristic are entered
Row equivalent substitution；And these modifications or replacement, the essence of appropriate technical solution is departed from various embodiments of the present invention technology
The scope of scheme, it all should cover among protection scope of the present invention.
SEQUENCE LISTING
<110>Luan Tu, Chi Hai
<120>Simple efficiently real-time GMO detection method and its application
<130> 3
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 28
<212> DNA
<213>Artificial sequence
<400> 1
acaggggtgt tatgatggag ttttagct 28
<210> 2
<211> 28
<212> DNA
<213>Artificial sequence
<400> 2
tgtccccaca atactacctc aaaatcga 28
<210> 3
<211> 57
<212> DNA
<213>Artificial sequence
<400> 3
tgtgtgttcc acaggggtgt tatgatggag ttttagctga attagaatcc tctggtg 57
<210> 4
<211> 57
<212> DNA
<213>Artificial sequence
<400> 4
tgtgtgttcc acgttgtgca tcaaccattc aggaaggaga attagaatcc tctggtg 57
Claims (10)
- A kind of 1. simple efficiently real-time GMO detection method, it is characterised in that：Methods described includes the step of tissue treatment, nucleic acid extraction, target dna capture, single-molecule sequencing and interpretation of result successively.
- 2. simple efficiently real-time GMO detection method according to claim 1, it is characterised in that the tissue Processing specifically includes：The appropriate amount of sample of the tissue of agriculture and animal husbandry plant or animal is taken, grinds homogenate.
- 3. simple efficiently real-time GMO detection method according to claim 1, it is characterised in that the nucleic acid Extraction specifically includes：Nucleic acid extraction is carried out using paramagnetic particle method, nucleic acid is obtained using the specific binding extraction of magnetic bead and nucleic acid.
- 4. simple efficiently real-time GMO detection method according to claim 1, it is characterised in that the target DNA captures specifically include：Denaturation treatment is carried out to the nucleic acid that extraction obtains, then using specificity, the purpose generally turned for transgenic field Foreign gene and/or transgenosis universal component design transgenosis capture extraction chip, then to target gene carry out capture extraction and Enrichment.
- 5. simple efficiently real-time GMO detection method according to claim 4, it is characterised in that：The transgenosis capture extraction chip is purpose foreign gene and/or transgenosis universal component and probe used by The principle of hybridization matching is designed and is prepared.
- 6. simple efficiently real-time GMO detection method according to claim 4, it is characterised in that：The purpose foreign gene that the transgenic field generally turns includes but is not limited to Bt anti insect genes, Cry1A genes, anti-grass One or more of the sweet phosphino- because in；The one or more that the transgenosis universal component includes but is not limited in promoter, terminator and marker gene.
- 7. simple efficiently real-time GMO detection method according to claim 1, it is characterised in that described single point Son sequencing specifically includes：Using nanometer pore single-molecule sequence measurement, the target gene of capture is sequenced, obtains the hereditary information of detection sample.
- 8. simple efficiently real-time GMO detection method according to claim 1, it is characterised in that the result Analysis specifically includes：The hereditary information obtained is subjected to analysis checking, determined whether as transgenosis.
- 9. the simple efficiently real-time GMO detection method described in claim any one of 1-8 is carrying out turning base to product Because of the application in authenticity verification.
- 10. application according to claim 9, it is characterised in that：The product is selected from agro-ecology, using agro-ecology as the food of raw material and using agro-ecology as one in the medicine of raw material Kind is a variety of；One or more of the agro-ecology in crops, livestock and poultry and aquatic biological.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711384863.3A CN107858410A (en) | 2017-12-20 | 2017-12-20 | Simple efficiently real-time GMO detection method and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711384863.3A CN107858410A (en) | 2017-12-20 | 2017-12-20 | Simple efficiently real-time GMO detection method and its application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107858410A true CN107858410A (en) | 2018-03-30 |
Family
ID=61706662
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711384863.3A Pending CN107858410A (en) | 2017-12-20 | 2017-12-20 | Simple efficiently real-time GMO detection method and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107858410A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110600079A (en) * | 2019-08-12 | 2019-12-20 | 中国水稻研究所 | Transgene identification method and identification device |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE10003763A1 (en) * | 2000-01-28 | 2001-08-09 | Bjoern Michael Seidel | Detecting nucleic acid from genetically modified organisms, useful particularly for analysis of foods, based on hybridization of fragments to array of reference sequences |
| CN101864489A (en) * | 2010-06-09 | 2010-10-20 | 北京大学 | Method for gathering foreign DNA in transgenosis product |
-
2017
- 2017-12-20 CN CN201711384863.3A patent/CN107858410A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE10003763A1 (en) * | 2000-01-28 | 2001-08-09 | Bjoern Michael Seidel | Detecting nucleic acid from genetically modified organisms, useful particularly for analysis of foods, based on hybridization of fragments to array of reference sequences |
| CN101864489A (en) * | 2010-06-09 | 2010-10-20 | 北京大学 | Method for gathering foreign DNA in transgenosis product |
Non-Patent Citations (5)
| Title |
|---|
| ARNE HOLST-JENSEN1等: "Application of whole genome shotgun sequencing for detection", 《ANAL BIOANAL CHEM》 * |
| MARIE-ALICE FRAITURE等: "An integrated strategy combining DNA walking and NGS to detect GMOs", 《FOOD CHEMISTRY》 * |
| MARIE-ALICE FRAITURE等: "Current and New Approaches in GMO Detection:", 《REVIEW ARTICLE》 * |
| MARIE-ALICE FRAITURE等: "How Can We Better Detect", 《TRENDS IN BIOTECHNOLOGY》 * |
| 张璟等: "《甘肃文化出版社》", 31 August 2017 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110600079A (en) * | 2019-08-12 | 2019-12-20 | 中国水稻研究所 | Transgene identification method and identification device |
| CN110600079B (en) * | 2019-08-12 | 2021-12-10 | 中国水稻研究所 | Transgene identification method and identification device |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101501217B (en) | The authentication method of soybean disease resistance quantitative trait locus and its composition | |
| CN105177150B (en) | A kind of the multiple PCR primer system and detection method of quick detection pig sheep ox animal derived materials | |
| CN102876805A (en) | Primer system for PCR (polymerase chain reaction) identification for deer, pig, cow, sheep, horse, donkey, rabbit and chicken | |
| CN106811541A (en) | Primer, probe and kit for field quick detection pasteurella multocida | |
| CN108300767A (en) | A kind of analysis method of nucleic acid complex amplifying nucleic acid section interaction | |
| CN109517925A (en) | Flax SSR molecular marker and its application | |
| CN109295179B (en) | Method for screening wheat with different zinc content and iron content and special kit thereof | |
| CN106282417B (en) | A kind of quick multi-fluorescence immunoassay primer, kit and method for distinguishing CAV, MDV, REV, IBDV | |
| CN108034659A (en) | A kind of ssDNA aptamers and its vibrio alginolyticus quickly detection in application | |
| CN110229846B (en) | Universal positive standard plasmid for screening transgenic rice and construction method thereof | |
| CN105624289B (en) | Primer sets and its application utilize the method for primer sets progress germplasm resource for cotton analysis of genetic diversity | |
| CN107858410A (en) | Simple efficiently real-time GMO detection method and its application | |
| CN105297141A (en) | Micro-array chip detection method for 10 on-melon diseases and used chip probe | |
| CN106011313B (en) | A kind of the multi-fluorescence immunoassay method and reagent of quick differentiation ILTV, IBV, MG and MS | |
| CN110669767B (en) | Pseudomonas syringae pea pathogenic nucleic acid aptamer and application thereof | |
| CN106164292A (en) | Use SOMAmer by the method for microorganism in detection method based on fluorescence detection sample | |
| KR101448119B1 (en) | Composition for discrimination of mixing meat containing specific primer set for CytB gene | |
| CN101666805A (en) | Method for preparing specific protein detection chip | |
| CN106319091B (en) | The multi-fluorescence immunoassay method and kit of a kind of quick differentiation canine distemper virus, canine parvovirus and rabies viruses | |
| CN106086241B (en) | A kind of primer, kit and the method for the multi-fluorescence immunoassay of 4 kinds of fowl respiratory pathogens of quick differentiation | |
| CN109097488A (en) | For synchronizing nucleic acid, method and the kit of five kinds of dog diarrhea virus of detection and identification | |
| CN107937404A (en) | A kind of aptamer and its application in identification, detection vibrio alginolyticus | |
| CN107794262A (en) | The ribosomal RNA sequences of mulberry tree Alternaria alternata caused occurrence and its application | |
| JPWO2004097015A1 (en) | Array in which substances immobilized on support are arranged by adding chromosome order or sequence position information, manufacturing method thereof, analysis system using array, and use thereof | |
| CN111218520A (en) | Transgenic soybean GTS-40-3-2 strain EFIRM detection probe and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20190203 Address after: 311215 6th Floor, Building A, Xiaoshan Science and Technology City, Hangzhou City, Zhejiang Province Applicant after: Luan Tu Address before: 310000 Sixth Floor of Building A, Xiaoshan Science and Technology City, Hangzhou City, Zhejiang Province Applicant before: Luan Tu Applicant before: Chi Hai |
|
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180330 |