CN107858361B

CN107858361B - Candida glycerinogenes heat shock protein gene CgHsp10 and application thereof

Info

Publication number: CN107858361B
Application number: CN201711313908.8A
Authority: CN
Inventors: 诸葛斌; 孙祥祥; 杨飞; 陆信曜; 宗红; 宋健
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2017-12-12
Filing date: 2017-12-12
Publication date: 2020-02-18
Anticipated expiration: 2037-12-12
Also published as: CN107858361A

Abstract

The invention belongs to the field of yeast genetic engineering, and discloses a heat shock protein gene CgHsp10 derived from Candida glycerinogenes CCTCC M93018, wherein the gene is overexpressed in Saccharomyces cerevisiae, so that the heat tolerance of S. The nucleotide sequence of the DNA sequence has similarity of more than 75 percent, more preferably more than 85 percent, and more preferably more than 95 percent with the DNA sequence shown in the sequence table SEQ ID NO.1 and has the same function with the DNA sequence shown in the sequence table SEQ ID NO. 1; most preferably, the DNA sequence is shown in a sequence table SEQ ID NO. 1. The invention plays an important role in improving the heat tolerance of the S.cerevisiae by utilizing a gene engineering technology.

Description

Candida glycerinogenes heat shock protein gene CgHsp10 and application thereof

Technical Field

The invention relates to a candida glycerinogenes CCTCC M93018 gene CgHsp10 and application thereof, and belongs to the technical field of genetic engineering, wherein the gene CgHsp10 is over-expressed in S.cerevisiae to improve the tolerance of S.cerevisiae to heat stress.

Background

The heat resistance of the industrial yeast strain is improved, the use of cooling water and energy consumption can be effectively reduced, the production cost is reduced, and the contamination probability can be effectively reduced. In order to improve the heat resistance of yeast cells, the traditional methods of high-temperature domestication, natural breeding, mutation breeding and the like of breeding technology play an important role, but the defects of instability, non-directionality and the like are obvious. The modern genetic engineering technology directionally transforms the strain to improve the heat resistance of the strain and plays an important role. The regulation of heat shock response in yeast is mainly carried out at an expression level and a transcription level, and the achievement of biological heat resistance has close positive correlation with the synthesis of heat shock protein. Heat shock proteins are a superfamily found in all organisms such as archaea, bacteria and eukaryotes. It can be used as molecular chaperone, can combine partial denatured protein, can assist the degradation of denatured protein, and can also prevent the irreversible aggregation of protein caused by various environmental stresses, and can help cell adapt to external pressure environment. The over-expression of heat shock proteins can protect microorganisms from damage to cells by external high temperature stress. The genetic backgrounds of different yeasts are different, homologous gene sequences have certain difference in quality in the over-expression process, a universal heat-resistant gene is obtained by screening from a heat-resistant yeast strain, the heat resistance of the gene can be improved by over-expressing the gene in other yeasts, and the screening of the universal heat-resistant gene has important significance for modifying the heat resistance of the yeasts.

Disclosure of Invention

The invention aims to provide a C.glycerinogenes CCTCC M93018 heat shock protein gene CgHsp10 and application thereof.

In order to achieve the purpose, the invention adopts the technical scheme that:

the present invention first screens and obtains a thermotolerant gene, which is named as CgHsp10 gene by the applicant, and increases the thermotolerance of yeast by overexpression in s.

The CgHsp10 gene with heat resistance derived from C.glycerinogenes CCTCC M93018 is obtained by screening a genome expression library, comparing sequences, analyzing structures and cloning.

The amino acid sequence of the gene CgHsp10 has more than 90 percent of similarity with the amino acid sequence shown in the sequence table SEQ ID NO.4, preferably more than 95 percent, more preferably more than 98 percent and has the same function with the amino acid sequence shown in the sequence table SEQ ID NO. 4.

A DNA sequence of gene CgHsp10, preferably the DNA sequence has similarity of more than 75%, more preferably more than 85%, more preferably more than 95% with the DNA sequence shown in the sequence table SEQ ID NO.1 and has the same function with the DNA sequence shown in the sequence table SEQ ID NO. 1; most preferably, the DNA sequence is shown in a sequence table SEQ ID NO. 1.

The specific upstream primer CgHsp10F (SEQ ID NO.2) and the downstream primer CgHsp10R (SEQ ID NO.3) for cloning the CgHsp10 gene have the nucleotide sequences shown as follows (see sequence tables SEQ ID NO.2 and SEQ ID NO. 3):

the applicant has established a method for increasing s.cerevisiae thermotolerance using CgHsp10 gene, comprising the steps of:

1) designing a primer of claim 2, cloning a gene CgHsp10 with heat resistance from a C.glycerinogenes CCTCC M93018 genome, wherein the nucleotide sequence of the gene is shown as a sequence table SEQ ID NO. 1;

2) constructing a CgHsp10 gene overexpression vector, and transforming the vector into S.cerevisiae;

3) identifying the recombinant S.cerevisiae in the step 2) by adopting a genome PCR detection method;

4) and further analyzing and identifying the heat resistance of the recombinant S.cerevisiae by the growth of a 42 ℃ gradient dilution dot plate, the survival rate statistics after high-temperature heat shock (70 ℃) and the growth condition analysis under the culture of a 42 ℃ liquid culture medium.

Use of the gene of claims 1-4 for improving heat resistance of yeast.

Use of the primer according to claim 2 for improving heat resistance of yeast.

Overexpression of the gene CgHsp10 in the S.cerevisiae can improve the survival rate and the growth capacity of the S.cerevisiae under the high-temperature condition, and further improve the tolerance of the S.cerevisiae to heat stress.

The invention has the following beneficial effects: the C.glycerinogenes CCTCC M93018 gene CgHsp10 is used for improving the tolerance to heat stress, and the gene CgHsp10 is over-expressed in S.cerevisiae, so that the survival rate of the S.cerevisiae under the heat shock condition can be improved, and the heat tolerance of the S.cerevisiae is improved.

Drawings

Fig. 1 is a graph of recombinant s.cerevisiae over expressing c.glycerinogenes CCTCC M93018 gene CgHsp10 grown on plates at 42 ℃ gradient dilutions, experiments were repeated three more times.

FIG. 2 is a statistical result of the survival rate of recombinant S.cerevisiae after high temperature heat shock (70 ℃) of CgHsp10 overexpressing C.glycerinogenes CCTCC M93018 gene, and the experiment is repeated for more than three times.

In fig. 3: panel a is the growth of recombinant s.cerevisiae overexpressing the c.glycerinogenes CCTCC M93018 gene CgHsp10 in culture at 42 ℃. Panel B is the survival of recombinant s.cerevisiae during culture at 42 ℃. The experiments were repeated three more times.

Detailed Description

The following examples serve to illustrate the invention.

Examples

1. Glycerinogenes CCTCC M93018 gene CgHsp10

The inventor selects a recombinant strain with improved heat resistance according to C.glycerinogenes CCTCC M93018 expression genome library transformation S.cerevisiae, extracts yeast plasmids (the yeast plasmid extraction kit is purchased from BBI company), and sequences nucleotide sequences (the sequencing is completed by Shanghai bioengineering company Limited) to obtain a large amount of potential heat-resistant related nucleotide sequences. Obtaining a complete open reading frame of the gene by nucleotide sequence and amino acid sequence Alignment (completed by analysis software such as Basic Local Alignment Search Tool, ClustalX2 and the like) and structural analysis (completed by software such as TMHMM-2.0, Swiss-model and the like), and amplifying the fragment by the following reaction system (50 mu.l): mu.l Prime STAR Max Premix (2X), 15pmol primer, 150ng template, double distilled water to 50. mu.l (primers synthesized by Shanghai Bioengineering Co., Ltd., the remainder purchased from TaKaRa), and the amplification reaction conditions were as follows: 10s at 98 ℃; 55 ℃,15 s, 72 ℃, 1kb/min, 30 cycles. And after the electrophoresis of the amplification product is finished, using a UNIQ-10 column type DNA gel recovery kit (Shanghai Bioengineering Co., Ltd.) to carry out gel cutting recovery. Recovery procedure following kit instructions: cutting target segment with blade, placing into 1.5ml centrifuge tube, adding binding buffer solution, heating in 55 deg.C water bath for 10min, and mixing once every 2 min; transferring the glue after being completely melted to a UNIQ-10 column sleeved in a collecting tube, and standing for 2min at room temperature; centrifuging at 8,000rpm for 1 min; the waste liquid in the collecting pipe is poured off, 500 mul of flushing liquid is added, the mixture is centrifuged at 8,000rpm for 1min at room temperature, and the step is repeated once; pouring the waste liquid in the collecting pipe, putting the UNIQ-10 column into the same collecting pipe, and centrifuging at 12,000rpm for 15 sec; putting the UNIQ-10 column into a new centrifuge tube of 1.5ml, dripping 50 μ l of double distilled water into the center of the column membrane, and standing at room temperature for 3 min; centrifuging at 12,000rpm for 1min to obtain recovered liquidA DNA fragment. And (2) connecting the recovered target fragment with a pYX212 expression vector after double enzyme digestion, finishing the connection work by using T4 ligase (purchased from TaKaRa company) according to the instruction of a specification, converting the connection product into escherichia coli, collecting thalli on a flat plate, extracting plasmids (a plasmid extraction kit is purchased from Shanghai Bioengineering Co., Ltd.), and converting the plasmids into saccharomyces cerevisiae: the transformation method adopts a lithium acetate transformation method. The method comprises the following steps: inoculating Cerevisiae into YEPD liquid culture medium, culturing at 30 deg.C in shake flask (200r/min) when OD is reached₆₀₀After the value reached 3-4, the cells were collected by centrifugation and washed 2 times with sterile double distilled water. Resuspending in transformation system: mu.l 50% PEG3350, 36. mu.l 1mol/l LiAC, 20. mu.l 5mg/ml protamine DNA (boiled for 10min before use), 20. mu.l plasmid, make up sterile double distilled water to 360. mu.l. After mixing well, heat shock at 42 ℃ for 60min, collect the thalli by centrifugation, resuspend and culture in 1ml YEPD liquid medium for 2 hours (30 ℃, 200 r/min). Centrifuging to collect thalli, washing for 1 time by using sterile double distilled water, adding 100 mu l of double distilled water, uniformly mixing, coating a uracil-deficient culture medium plate to obtain recombinant S.cerevisiae, and performing survival rate statistical analysis after high-temperature heat shock to obtain the heat shock protein gene CgHsp 10.

2. Culturing an S.cerevisiae recombinant strain overexpressing a heat shock protein gene CgHsp10 in a YEPD liquid culture medium at 30 ℃ and 200r/min for 12 hours, (1) inoculating 2% of the recombinant strain into a uracil-deficient liquid culture medium, performing shake flask culture at 30 ℃ and 42 ℃ and 200r/min respectively, and determining the high-temperature growth condition and the survival rate (the number of living cells at 42 ℃ per the number of living cells at 30 ℃) of the recombinant S.cerevisiae; (2) dilution of OD₆₀₀To 1, by 10^-1,10^-2,10^-3,10^-4,10^-5Gradient dilution, dot plate culture (YEPD solid medium at 42 ℃); (3) the cells were harvested, heat-shocked at 70 ℃ for 30min, and the cell viability (number of viable cells after heat shock/number of viable cells before heat shock) was determined.

Example 2 demonstrates that overexpression of the c. glycerinogenes CCTCC M93018 gene CgHsp10 in s. cerevisiae can improve the heat tolerance of s. cerevisiae while improving its growth ability at 42 ℃.

The above description is only a basic description of the present invention, and any equivalent changes made according to the technical solution of the present invention should fall within the protection scope of the present invention.

Sequence listing

<110> university of south of the Yangtze river

<120> Candida glabrogens heat shock protein gene CgHsp10 and application thereof

<130>2017.12.4

<141>2017-12-12

<160>4

<170>SIPOSequenceListing 1.0

<210>1

<211>309

<212>DNA

<213> Glycerol-producing Candida (Candida glycerinogenes)

<400>1

atgtctttca tcaagtctgc caagtccatt cttccaactc ttgacagggt tctcgttcaa 60

agaatcaagg ttcctcaaca aacctcttcc ggtatctata ttccagaaca aaacttacca 120

aagaacaacg ttgccaccgt tattgcagtc ggtcctggct tcaagactgc agagggcaaa 180

ctaattgagc ctaccttgaa tgccggcgac aaggtgctca ttcctcaaca cggcggtacc 240

ccagtcaccg ttgagaagga cgaattttta ctcttcagag atgctgatat tcttgccaag 300

atcaatgaa 309

<210>2

<211>28

<212>DNA

<213> Glycerol-producing Candida (Candida glycerinogenes)

<400>2

ggaattcatg tctttcatca agtctgcc 28

<210>3

<211>35

<212>DNA

<213> Glycerol-producing Candida (Candida glycerinogenes)

<400>3

cccaagcttt cattcattga tcttggcaag aatat 35

<210>4

<211>103

<212>PRT

<213> Glycerol-producing Candida (Candida glycerinogenes)

<400>4

Met Ser Phe Ile Lys Ser Ala Lys Ser Ile Leu Pro Thr Leu Asp Arg

1 5 10 15

Val Leu Val Gln Arg Ile Lys Val Pro Gln Gln Thr Ser Ser Gly Ile

20 25 30

Tyr Ile Pro Glu Gln Asn Leu Pro Lys Asn Asn Val Ala Thr Val Ile

35 40 45

Ala Val Gly Pro Gly Phe Lys Thr Ala Glu Gly Lys Leu Ile Glu Pro

50 55 60

Thr Leu Asn Ala Gly Asp Lys Val Leu Ile Pro Gln His Gly Gly Thr

65 70 75 80

Pro Val Thr Val Glu Lys Asp Glu Phe Leu Leu Phe Arg Asp Ala Asp

85 90 95

Ile Leu Ala Lys Ile Asn Glu

100

Claims

1. A method for improving heat tolerance of Saccharomyces cerevisiae (Saccharomyces cerevisiae) using CgHsp10 gene, comprising the steps of:

1) designing a primer, cloning CgHsp10 gene from Candida glycerinogenes CCTCC M93018 genome, wherein the nucleotide sequence of the CgHsp10 gene is shown as SEQ ID NO.1,

the primers comprise an upstream primer CgHsp10F and a downstream primer CgHsp10R, and the nucleotide sequences of the primers are shown as follows:

CgHsp10F：GGAATTCATGTCTTTCATCAAGTCTGCC

CgHsp10R：CCCAAGCTTTCATTCATTGATCTTGGCAAGAATAT；

2) constructing a CgHsp10 gene overexpression vector, and transforming the vector into saccharomyces cerevisiae;

3) identifying the recombinant saccharomyces cerevisiae in the step 2) by adopting a genome PCR detection method;

4) and further analyzing and identifying the heat resistance of the recombinant saccharomyces cerevisiae through the growth of a 42 ℃ gradient dilution dot plate, the survival rate statistics after heat shock at 70 ℃ and the growth condition analysis under the culture of a 42 ℃ liquid culture medium.

The application of CgHsp10 gene in improving the heat tolerance of Saccharomyces cerevisiae is characterized in that the nucleotide sequence of the CgHsp10 gene is shown as SEQ ID NO. 1.