CN107858362B - Candida glycerinogenes heat shock protein gene CgYDJ1 and application thereof - Google Patents

Abstract

The invention belongs to the field of yeast genetic engineering, and discloses a heat shock protein gene CgYDJ1 derived from Candida glycerinogenes CCTCC M93018, wherein the gene is overexpressed in Saccharomyces cerevisiae, so that the heat tolerance of S. The nucleotide sequence of the DNA sequence has similarity of more than 75 percent, more preferably more than 85 percent, and more preferably more than 95 percent with the DNA sequence shown in the sequence table SEQ ID NO.1 and has the same function with the DNA sequence shown in the sequence table SEQ ID NO. 1; most preferably, the DNA sequence is shown in a sequence table SEQ ID NO. 1. The invention plays an important role in improving the heat tolerance of the S.cerevisiae by utilizing a gene engineering technology.

Description

Candida glycerinogenes heat shock protein gene CgYDJ1 and application thereof

Technical Field

The invention relates to a candida glycerinogenes CCTCC M93018 gene CgYDJ1 and application thereof, and belongs to the technical field of genetic engineering, wherein the gene CgYDJ1 is overexpressed in S.cerevisiae to improve the tolerance of the S.cerevisiae to heat stress.

Background

The heat resistance of the industrial yeast strain is improved, the use of cooling water and energy consumption can be effectively reduced, the production cost is reduced, and the contamination probability can be effectively reduced. In order to improve the heat resistance of yeast cells, the traditional methods of high-temperature domestication, natural breeding, mutation breeding and the like of breeding technology play an important role, but the defects of instability, non-directionality and the like are obvious. The modern genetic engineering technology directionally transforms the strain to improve the heat resistance of the strain and plays an important role. The regulation of heat shock response in yeast is mainly carried out at an expression level and a transcription level, and the achievement of biological heat resistance has close positive correlation with the synthesis of heat shock protein. Heat shock proteins are a superfamily found in all organisms such as archaea, bacteria and eukaryotes. It can be used as molecular chaperone, can combine partial denatured protein, can assist the degradation of denatured protein, and can also prevent the irreversible aggregation of protein caused by various environmental stresses, and can help cell adapt to external pressure environment. The over-expression of heat shock proteins can protect microorganisms from damage to cells by external high temperature stress. The genetic backgrounds of different yeasts are different, homologous gene sequences have certain difference in quality in the over-expression process, a universal heat-resistant gene is obtained by screening from a heat-resistant yeast strain, the heat resistance of the gene can be improved by over-expressing the gene in other yeasts, and the screening of the universal heat-resistant gene has important significance for modifying the heat resistance of the yeasts.

Disclosure of Invention

The invention aims to provide a C.glycerinogenes CCTCC M93018 heat shock protein gene CgYDJ1 and application thereof.

In order to achieve the purpose, the invention adopts the technical scheme that:

the present invention first screens and obtains a thermotolerant gene, which the applicant named CgYDJ1 gene, and increases the thermotolerance of yeast by overexpression in s.

The CgYDJ1 gene with heat resistance and derived from C.glycerinogenes CCTCC M93018 is obtained by screening a genome expression library, comparing sequences, analyzing a structure and cloning.

The amino acid sequence of the gene CgYDJ1 has similarity of more than 90%, preferably more than 95%, more preferably more than 98% with the amino acid sequence shown in the sequence table SEQ ID NO.4 and has the same function with the amino acid sequence shown in the sequence table SEQ ID NO. 4.

A DNA sequence of gene CgYDJ1, preferably the DNA sequence has similarity of more than 75%, more preferably more than 85%, more preferably more than 95% with the DNA sequence shown in the sequence table SEQ ID NO.1 and has the same function with the DNA sequence shown in the sequence table SEQ ID NO. 1; most preferably, the DNA sequence is shown in a sequence table SEQ ID NO. 1.

The specific upstream primer CgYDJ1F (SEQ ID NO.2) and the specific downstream primer CgYDJ1R (SEQ ID NO.3) for cloning the CgYDJ1 gene have the nucleotide sequences shown as follows (see sequence tables SEQ ID NO.2 and SEQ ID NO. 3):

the applicant has established a method for improving s.cerevisiae thermotolerance using CgYDJ1 gene, comprising the steps of:

1) designing a primer of claim 2, cloning a gene CgYDJ1 with heat resistance from a C.glycerinogenes CCTCC M93018 genome, wherein the nucleotide sequence of the gene CgYDJ1 is shown in a sequence table SEQ ID NO. 1;

2) constructing a CgYDJ1 gene over-expression vector, and transforming the vector into S.cerevisiae;

3) identifying the recombinant S.cerevisiae in the step 2) by adopting a genome PCR detection method;

4) and further analyzing and identifying the heat resistance of the recombinant S.cerevisiae by the growth of a 42 ℃ gradient dilution dot plate, the survival rate statistics after high-temperature heat shock (70 ℃) and the growth condition analysis under the culture of a 42 ℃ liquid culture medium.

Use of the gene of claims 1-4 for improving heat resistance of yeast.

Use of the primer according to claim 2 for improving heat resistance of yeast.

Overexpression of the gene CgYDJ1 in the S.cerevisiae can improve the survival rate and the growth capacity of the S.cerevisiae under the high-temperature condition, and further improve the tolerance of the S.cerevisiae to heat stress.

The invention has the following beneficial effects: the C.glycerinogenes CCTCC M93018 gene CgYDJ1 is used for improving the tolerance to heat stress, and the gene CgYDJ1 is over-expressed in the S.cerevisiae, so that the survival rate of the S.cerevisiae under the heat shock condition can be improved, and the heat tolerance of the S.cerevisiae is improved.

Drawings

Fig. 1 is a recombinant S overexpressing c. glycerides CCTCC M93018 gene CgYDJ 1.

The growth of the plates was performed by gradient dilution of cerevisiae at 42 ℃ and the experiment was repeated three more times.

Fig. 2 is a recombinant S overexpressing c. glycerides CCTCC M93018 gene CgYDJ 1.

The survival rate statistics result of the cerevisiae after high temperature heat shock (70 ℃) is repeated for more than three times.

In fig. 3: panel a is the growth of recombinant s.cerevisiae overexpressing c.glycerinogenes CCTCC M93018 gene CgYDJ1 in 42 ℃ culture. Panel B is the survival of recombinant s.cerevisiae during culture at 42 ℃. The experiments were repeated three more times.

Detailed Description

The following examples serve to illustrate the invention.

Examples

1. Glycerinogenes CCTCC M93018 gene CgYDJ1

The inventor selects a recombinant strain with improved heat resistance according to C.glycerinogenes CCTCC M93018 expression genome library transformation S.cerevisiae, extracts yeast plasmids (the yeast plasmid extraction kit is purchased from BBI company), and sequences nucleotide sequences (the sequencing is completed by Shanghai bioengineering company Limited) to obtain a large amount of potential heat-resistant related nucleotide sequences. Obtaining a complete open reading frame of the gene by nucleotide sequence and amino acid sequence Alignment (completed by analysis software such as Basic Local Alignment Search Tool, ClustalX2 and the like) and structural analysis (completed by software such as TMHMM-2.0, Swiss-model and the like), and amplifying the fragment by the following reaction system (50 mu.l): mu.l Prime STAR Max Premix (2X), 15pmol primer, 150ng template, double distilled water to 50. mu.l (primers synthesized by Shanghai Bioengineering Co., Ltd., the remainder purchased from TaKaRa), and the amplification reaction conditions were as follows: 10s at 98 ℃; 55 ℃,15 s, 72 ℃, 1kb/min, 30 cycles. And after the electrophoresis of the amplification product is finished, using a UNIQ-10 column type DNA gel recovery kit (Shanghai Bioengineering Co., Ltd.) to carry out gel cutting recovery. Recovery procedure following kit instructions: cutting target segment with blade, placing into 1.5ml centrifuge tube, adding binding buffer solution, heating in 55 deg.C water bath for 10min, and mixing once every 2 min; transferring the glue after being completely melted to a UNIQ-10 column sleeved in a collecting tube, and standing for 2min at room temperature; centrifuging at 8,000rpm for 1 min; the waste liquid in the collecting pipe is poured off, 500 mul of flushing liquid is added, the mixture is centrifuged at 8,000rpm for 1min at room temperature, and the step is repeated once; pouring off waste liquid in the collecting pipe, and putting the UNIQ-10 column into the same collection pipeIn a tube, centrifuge at 12,000rpm for 15 sec; putting the UNIQ-10 column into a new centrifuge tube of 1.5ml, dripping 50 μ l of double distilled water into the center of the column membrane, and standing at room temperature for 3 min; centrifuging at 12,000rpm for 1min, and obtaining the recovered DNA fragment as the liquid in the centrifuge tube. And (2) connecting the recovered target fragment with a pYX212 expression vector after double enzyme digestion, finishing the connection work by using T4 ligase (purchased from TaKaRa company) according to the instruction of a specification, converting the connection product into escherichia coli, collecting thalli on a flat plate, extracting plasmids (a plasmid extraction kit is purchased from Shanghai Bioengineering Co., Ltd.), and converting the plasmids into saccharomyces cerevisiae: the transformation method adopts a lithium acetate transformation method. The method comprises the following steps: inoculating Cerevisiae into YEPD liquid culture medium, culturing at 30 deg.C in shake flask (200r/min) when OD is reached₆₀₀After the value reached 3-4, the cells were collected by centrifugation and washed 2 times with sterile double distilled water. Resuspending in transformation system: mu.l 50% PEG3350, 36. mu.l 1mol/l LiAC, 20. mu.l 5mg/ml protamine DNA (boiled for 10min before use), 20. mu.l plasmid, make up sterile double distilled water to 360. mu.l. After mixing well, heat shock at 42 ℃ for 60min, collect the thalli by centrifugation, resuspend and culture in 1ml YEPD liquid medium for 2 hours (30 ℃, 200 r/min). Centrifuging to collect thalli, washing for 1 time with sterile double distilled water, adding 100 μ l of double distilled water, uniformly mixing, coating a uracil-deficient culture medium plate to obtain recombinant S.cerevisiae, and performing survival rate statistical analysis after high-temperature heat shock to obtain the heat shock protein gene CgYDJ 1.

2. Culturing a S.cerevisiae recombinant strain overexpressing a heat shock protein gene CgYDJ1 in a YEPD liquid culture medium at 30 ℃ and 200r/min for 12 hours, (1) inoculating the recombinant strain into a uracil-deficient liquid culture medium at an inoculum size of 2%, performing shake-flask culture at 30 ℃ and 42 ℃ and at 200r/min respectively, and determining the high-temperature growth condition and the survival rate (the number of living cells at 42 ℃ per the number of living cells at 30 ℃); (2) dilution of OD₆₀₀To 1, by 10^-1,10^-2,10^-3,10^-4,10^-5Gradient dilution, dot plate culture (YEPD solid medium at 42 ℃); (3) the cells were harvested, heat-shocked at 70 ℃ for 30min, and the cell viability (number of viable cells after heat shock/number of viable cells before heat shock) was determined.

Example 2 demonstrates that overexpression of the c. glycerinogenes CCTCC M93018 gene CgYDJ1 in s. cerevisiae can improve the heat tolerance of s. cerevisiae and at the same time improve its growth capacity at 42 ℃.

The above description is only a basic description of the present invention, and any equivalent changes made according to the technical solution of the present invention should fall within the protection scope of the present invention.

Sequence listing

<110> university of south of the Yangtze river

<120> Candida glabrogens heat shock protein gene CgYDJ1 and application thereof

<130>2017.12.8

<141>2017-12-12

<160>4

<170>SIPOSequenceListing 1.0

<210>1

<211>1224

<212>DNA

<213> Glycerol-producing Candida (Candida glycerinogenes)

<400>1

atggttgcag acactaaatt atatgacatc ttaggagttt ctccagatgc tacagaacaa 60

caattgaaga aggcgtacag actaggtgca cttaaatatc acccggataa gaatccatcg 120

ccagaagctg ctgaaaagtt caaagaaatg accggtgctt atgaaattct cagtgatcct 180

gaaaagaggg agctatacga tcaatatggt gagcaaggat taggtggtgg acctggtgga 240

cctggtggtt ttggtggtat ggatgccggt gacattttct cccaattttt cggtggggga 300

tcatctagac cacaaggacc aagaagagga caagatatca agcatgcatt gggtgttact 360

ttggaagaat tgtacaaggg taagactgcg aaattggcat taaacaaaac cgttttatgt 420

aaggcatgtg atggtaaagg tggtaagaat gtgaagaaat gtactgcttg taatggtact 480

ggtactaagt tcatcaccag acaaatggga ccaatgattc aaagattcca aactacttgt 540

gaccaatgta atggtactgg tgatatcatg aaggaagctg acagatgtaa agtatgtaat 600

ggtaagaagg ttaccaagga gagaaagatt ttggaagttc atgttacccc aggtatgaag 660

gcaggacaaa aggttgtctt tgaaggtgaa ggtgatcaag gtccagatat tattccaggt 720

gatattgttt tcatcattga ggaaaagcca catgatttgt acgagagaaa aggcgatgat 780

ttgatccacc aacaaaagat tgatctctta agtgcgcttg caggaggtga agttgcgttt 840

aagcatgtca gcggtgaatg gttgaaactc acaattcatc ctggagaagt gattgcacca 900

ggtgctacca aagtcatcaa ggacaagggt atgccaattc caagacacgg tggttacggt 960

aacttaattg tcaaatttga tgttgaattc ccaaagaaca actttgcctc tgaggagaag 1020

ttgaagcaat tagaagccat cttacctcca agaccaaaac ttgacattcc aaagggtgcc 1080

gaagttgacg actcttgtga attggaagat ttcgacccat ccaagcacca atccagaacg1140

tccaacggtc aacgtggcgg ctattacgat tacgatgaag acgacgagga aggtggccat 1200

ccaggagtcc agtgtgcaca gcag 1224

<210>2

<211>39

<212>DNA

<213> Glycerol-producing Candida (Candida glycerinogenes)

<400>2

catgccatgg atatggttgc agacactaaa ttatatgac 39

<210>3

<211>26

<212>DNA

<213> Glycerol-producing Candida (Candida glycerinogenes)

<400>3

gcgtcgactc actgctgtgc acactg 26

<210>4

<211>408

<212>PRT

<213> Glycerol-producing Candida (Candida glycerinogenes)

<400>4

Met Val Ala Asp Thr Lys Leu Tyr Asp Ile Leu Gly Val Ser Pro Asp

1 5 10 15

Ala Thr Glu Gln Gln Leu Lys Lys Ala Tyr Arg Leu Gly Ala Leu Lys

20 25 30

Tyr His Pro Asp Lys Asn Pro Ser Pro Glu Ala Ala Glu Lys Phe Lys

35 40 45

Glu Met Thr Gly Ala Tyr Glu Ile Leu Ser Asp Pro Glu Lys Arg Glu

50 55 60

Leu Tyr Asp Gln Tyr Gly Glu Gln Gly Leu Gly Gly Gly Pro Gly Gly

65 70 75 80

Pro Gly Gly Phe Gly Gly Met Asp Ala Gly Asp Ile Phe Ser Gln Phe

85 90 95

Phe Gly Gly Gly Ser Ser Arg Pro Gln Gly Pro Arg Arg Gly Gln Asp

100 105 110

Ile Lys His Ala Leu Gly Val Thr Leu Glu Glu Leu Tyr Lys Gly Lys

115 120 125

Thr Ala Lys Leu Ala Leu Asn Lys Thr Val Leu Cys Lys Ala Cys Asp

130 135 140

Gly Lys Gly Gly Lys Asn Val Lys Lys Cys Thr Ala Cys Asn Gly Thr

145 150 155 160

Gly Thr Lys Phe Ile Thr Arg Gln Met Gly Pro Met Ile Gln Arg Phe

165 170 175

Gln Thr Thr Cys Asp Gln Cys Asn Gly Thr Gly Asp Ile Met Lys Glu

180 185 190

Ala Asp Arg Cys Lys Val Cys Asn Gly Lys Lys Val Thr Lys Glu Arg

195 200 205

Lys Ile Leu Glu Val His Val Thr Pro Gly Met Lys Ala Gly Gln Lys

210 215 220

Val Val Phe Glu Gly Glu Gly Asp Gln Gly Pro Asp Ile Ile Pro Gly

225 230 235 240

Asp Ile Val Phe Ile Ile Glu Glu Lys Pro His Asp Leu Tyr Glu Arg

245 250 255

Lys Gly Asp Asp Leu Ile His Gln Gln Lys Ile Asp Leu Leu Ser Ala

260 265 270

Leu Ala Gly Gly Glu Val Ala Phe Lys His Val Ser Gly Glu Trp Leu

275 280 285

Lys Leu Thr Ile His Pro Gly Glu Val Ile Ala Pro Gly Ala Thr Lys

290 295 300

Val Ile Lys Asp Lys Gly Met Pro Ile Pro Arg His Gly Gly Tyr Gly

305 310 315 320

Asn Leu Ile Val Lys Phe Asp Val Glu Phe Pro Lys Asn Asn Phe Ala

325 330 335

Ser Glu Glu Lys Leu Lys Gln Leu Glu Ala Ile Leu Pro Pro Arg Pro

340 345 350

Lys Leu Asp Ile Pro Lys Gly Ala Glu Val Asp Asp Ser Cys Glu Leu

355 360 365

Glu Asp Phe Asp Pro Ser Lys His Gln Ser Arg Thr Ser Asn Gly Gln

370 375 380

Arg Gly Gly Tyr Tyr Asp Tyr Asp Glu Asp Asp Glu Glu Gly Gly His

385 390 395 400

Pro Gly Val Gln Cys Ala Gln Gln

405

Claims (2)

1. A method for improving heat tolerance of Saccharomyces cerevisiae (Saccharomyces cerevisiae) by using CgYDJ1 gene, wherein the nucleotide sequence of the CgYDJ1 gene is shown as SEQ ID NO.1, the method comprises the following steps:

1) designing a primer, and cloning a gene CgYDJ1 from a Candida glycerinogenes CCTCC M93018 genome, wherein the nucleotide sequence of the gene CgYDJ1 is shown in a sequence table SEQ ID NO. 1;

the primer is as follows:

upstream primer CgYDJ 1F: CATGCCATGGATATGGTTGCAGACACTAAATTATATGAC, respectively;

downstream primer CgYDJ 1R: GCGTCGACTCACTGCTGTGCACACTG, respectively;

2) constructing a vector for over-expressing CgYDJ1 gene, and transforming the vector into Saccharomyces cerevisiae;

3) identifying the recombinant saccharomyces cerevisiae in the step 2) by adopting a genome PCR detection method;

4) and further analyzing and identifying the heat resistance of the recombinant saccharomyces cerevisiae through the growth of a 42 ℃ gradient dilution point plate, the survival rate statistics after high-temperature heat shock at 70 ℃ and the growth condition under the culture of a 42 ℃ liquid culture medium.

2. Application of CgYDJ1 gene with nucleotide sequence shown in sequence table SEQ ID NO.1 in improving heat tolerance of Saccharomyces cerevisiae.

Images