CN107858337B - Heat-resistant mutant lipase, preparation method and application - Google Patents
Heat-resistant mutant lipase, preparation method and application Download PDFInfo
- Publication number
- CN107858337B CN107858337B CN201711220144.8A CN201711220144A CN107858337B CN 107858337 B CN107858337 B CN 107858337B CN 201711220144 A CN201711220144 A CN 201711220144A CN 107858337 B CN107858337 B CN 107858337B
- Authority
- CN
- China
- Prior art keywords
- lipase
- mutant
- gly
- val
- disulfide bonds
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/18—Carboxylic ester hydrolases (3.1.1)
- C12N9/20—Triglyceride splitting, e.g. by means of lipase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
- C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y301/00—Hydrolases acting on ester bonds (3.1)
- C12Y301/01—Carboxylic ester hydrolases (3.1.1)
- C12Y301/01003—Triacylglycerol lipase (3.1.1.3)
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Mycology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses a heat-resistant mutant lipase, a preparation method and application thereof. The heat-resistant mutant lipase is prepared by introducing multiple pairs of disulfide bond mutations in yarrowia lipolytica lipase 2 by an iterative combination method to obtain lipase 4s, lipase 5s and lipase 6s rich in multiple pairs of disulfide bond mutations, wherein the amino acid sequence of the lipase 4s is shown as SEQ ID No. 1; the amino acid sequence of the lipase 5s is shown as SEQ ID NO. 2; the amino acid sequence of the lipase 6s is shown as SEQ ID NO. 3. The invention adopts a strategy of iteratively combining multiple pairs of disulfide bond mutation, improves the thermal stability of the lipase, greatly improves the thermal stability of the medium-temperature lipase by further increasing the number of introduced disulfide bonds compared with the traditional strategy of introducing disulfide bonds, and is particularly suitable for industrial application.
Description
Technical Field
The invention belongs to the field of enzyme engineering, and particularly relates to heat-resistant mutant lipase, and a preparation method and application thereof.
Background
The traditional chemical reaction needs to be carried out under the conditions of high temperature and high pressure, but the catalyst is expensive and difficult to recover, and a large amount of side reactions are accompanied in the reaction process; compared with a chemical method, the biological enzyme preparation has mild catalytic reaction conditions, various types and low price. And the biological enzyme preparation has the characteristics of substrate specificity and the like, and by-products generated by the reaction are greatly reduced. Therefore, the bio-enzyme preparation is widely used in the industrial field. As an important biological enzyme preparation, yarrowia lipolytica lipase 2(Lip2) is a lipase with excellent performance, has high esterification, hydrolysis and transesterification activities, and is widely applied to the fields of ester hydrolysis and synthesis, biodiesel preparation and the like at present. But the lipase has poor heat resistance, is not beneficial to production, processing, storage and transportation, is an important bottleneck of production and application, and has great significance for improving the heat resistance.
Disulfide bonds are covalent bonds between sulfur atoms in the form-S-formed by oxidation of 2 sulfhydryl groups. The sulfhydryl groups of 2 cysteine residues on the peptide chain can be oxidized to form a disulfide bond; with the formation of disulfide bonds, cysteine residues are converted to cystine residues. The formation of disulfide bonds has a very important effect on the maintenance of the active function of the protein, and whether its pairing is correct or not is an important reason for influencing the folding of the polypeptide chains of the protein. Meanwhile, many proteins require disulfide bonds to maintain their specific high-order structures. When the disulfide bond is broken and reduced to a sulfhydryl group, the protein structure will probably change, and the original biological function is partially or completely lost. There have been a lot of studies on heat-resistant protein mutants, such as lipase, amylase, mannanase, etc., obtained by the strategy of introducing disulfide bonds. However, the number of disulfide bonds artificially introduced is usually small, and the influence of many pairs of disulfide bonds on the heat resistance of proteins is not studied.
At present, the research on the iterative evolution of disulfide bonds to improve the thermal stability is relatively few in the literature, so that the iterative evolution of disulfide bond-rich bonds is necessary to investigate the influence of disulfide bond-rich bonds on the thermal stability.
Disclosure of Invention
The primary purpose of the present invention is to overcome the disadvantages and shortcomings of the prior art, and to introduce multiple pairs of disulfide bonds into yarrowia lipolytica lipase 2 to improve its heat resistance, and to provide 3 heat-resistant lipases.
Another object of the present invention is to provide a method for preparing the thermostable mutant lipase.
It is still another object of the present invention to provide use of the thermostable mutant lipase.
The purpose of the invention is realized by the following technical scheme: a thermostable lipase is prepared by introducing multiple pairs of disulfide bond mutations in yarrowia lipolytica lipase 2 by an iterative combination method to obtain the thermostable lipase rich in the multiple pairs of disulfide bond mutations.
The disulfide bonds include disulfide bonds S2-210 (disulfide bond formed by two amino acids after mutation of amino acids at positions 2 and 210), S8-214 (disulfide bond formed by two amino acids after mutation of amino acids at positions 8 and 214), S14-216 (disulfide bond formed by two amino acids after mutation of amino acids at positions 14 and 216), S60-69 (disulfide bond formed by two amino acids after mutation of amino acids at positions 60 and 69), S122-196 (disulfide bond formed by two amino acids after mutation of amino acids at positions 122 and 196), and S118-177 (disulfide bond formed by two amino acids after mutation of amino acids at positions 118 and 177).
The introduced multiple pairs of disulfide bonds are preferably 4-6 pairs of disulfide bonds.
The heat-resistant mutant lipase is preferably lipase 4s, lipase 5s or lipase 6 s;
the iterative combination method is to combine disulfide bonds S8-214, S60-69, S122-196 and S118-177(4S), S2-210, S8-214, S60-69, S122-196 and S118-177(5S), or S2-210, S8-214, S14-216, S60-69, S122-196 and S118-177 (6S).
The amino acid sequence of the heat-resistant mutant lipase is shown as follows:
the amino acid sequence of lipase 4s is as follows:
VYTSTETCHIDQESYNFFEKYARLANIGYCVGPGTKIFKPFNCGLQCAHFPNVELIEEFCDPRLIFDVCGYLAVDHASKQIYLVIRGTHSLEDVITDIRIMQAPLTNFDLAANISSTCTCDCCLVHNGFIQSYNNTYNQIGPKLDSVIEQYPDYQIAVTGHSLGGAAALLFGINLKCNGHDPLVVTLGQPIVGNACFANWVDKLFFGQENPDVCKVSKDRKLYRITHRGDIVPQVPFWDGYQHCSGEVFIDWPLIHPPLSNVVMCQGQSNKQCSAGNTLLQQVNVIGNHLQYFVTEGVCGI；
the amino acid sequence of lipase 5s is as follows:
VCTSTETCHIDQESYNFFEKYARLANIGYCVGPGTKIFKPFNCGLQCAHFPNVELIEEFCDPRLIFDVCGYLAVDHASKQIYLVIRGTHSLEDVITDIRIMQAPLTNFDLAANISSTCTCDCCLVHNGFIQSYNNTYNQIGPKLDSVIEQYPDYQIAVTGHSLGGAAALLFGINLKCNGHDPLVVTLGQPIVGNACFANWVDKLFFGQECPDVCKVSKDRKLYRITHRGDIVPQVPFWDGYQHCSGEVFIDWPLIHPPLSNVVMCQGQSNKQCSAGNTLLQQVNVIGNHLQYFVTEGVCGI；
the amino acid sequence of lipase 6s is as follows:
VCTSTETCHIDQECYNFFEKYARLANIGYCVGPGTKIFKPFNCGLQCAHFPNVELIEEFCDPRLIFDVCGYLAVDHASKQIYLVIRGTHSLEDVITDIRIMQAPLTNFDLAANISSTCTCDCCLVHNGFIQSYNNTYNQIGPKLDSVIEQYPDYQIAVTGHSLGGAAALLFGINLKCNGHDPLVVTLGQPIVGNACFANWVDKLFFGQECPDVCKCSKDRKLYRITHRGDIVPQVPFWDGYQHCSGEVFIDWPLIHPPLSNVVMCQGQSNKQCSAGNTLLQQVNVIGNHLQYFVTEGVCGI。
the nucleotide sequence for coding the heat-resistant mutant lipase is shown as follows:
the nucleotide sequence of lipase 4s is as follows:
gtgtacacctctaccgagacctgtcacattgaccaggagtcctacaacttctttgagaagtacgcccgactcgcaaacattggatattgtgttggtcccggcactaagatcttcaagcccttcaactgtggcctgcaatgtgcccacttccccaacgttgagctcatcgaggagttctgtgacccccgtctcatctttgatgtttgtggttacctcgctgttgatcatgcctccaagcagatctaccttgttattcgaggaacccactctctggaggacgtcataaccgacatccgaatcatgcaggctcctctgacgaactttgatcttgctgctaacatctcttctacttgtacttgtgattgttgtcttgtccacaatggcttcatccagtcctacaacaacacctacaatcagatcggccccaagctcgactctgtgattgagcagtatcccgactaccagattgctgtcaccggtcactctctcggaggagctgcagcccttctgttcggaatcaacctcaagtgtaacggccacgatcccctcgttgttactcttggtcagcccattgtcggtaacgcttgttttgctaactgggtcgataaactcttctttggccaggagaaccccgatgtctgtaaggtgtccaaagaccgaaagctctaccgaatcacccaccgaggagatatcgtccctcaagtgcccttctgggacggttaccagcactgctctggtgaggtctttattgactggcccctgatccaccctcctctctccaacgttgtcatgtgccagggccagagcaataaacagtgctctgccggtaacactctgctccagcaggtcaatgtgattggaaaccatctgcagtacttcgtcaccgagggtgtctgtggtatctaataa；
the nucleotide sequence of lipase 5s is as follows:
gtgtgtacctctaccgagacctgtcacattgaccaggagtcctacaacttctttgagaagtacgcccgactcgcaaacattggatattgtgttggtcccggcactaagatcttcaagcccttcaactgtggcctgcaatgtgcccacttccccaacgttgagctcatcgaggagttctgtgacccccgtctcatctttgatgtttgtggttacctcgctgttgatcatgcctccaagcagatctaccttgttattcgaggaacccactctctggaggacgtcataaccgacatccgaatcatgcaggctcctctgacgaactttgatcttgctgctaacatctcttctacttgtacttgtgattgttgtcttgtccacaatggcttcatccagtcctacaacaacacctacaatcagatcggccccaagctcgactctgtgattgagcagtatcccgactaccagattgctgtcaccggtcactctctcggaggagctgcagcccttctgttcggaatcaacctcaagtgtaacggccacgatcccctcgttgttactcttggtcagcccattgtcggtaacgcttgttttgctaactgggtcgataaactcttctttggccaggagtgtcccgatgtctgtaaggtgtccaaagaccgaaagctctaccgaatcacccaccgaggagatatcgtccctcaagtgcccttctgggacggttaccagcactgctctggtgaggtctttattgactggcccctgatccaccctcctctctccaacgttgtcatgtgccagggccagagcaataaacagtgctctgccggtaacactctgctccagcaggtcaatgtgattggaaaccatctgcagtacttcgtcaccgagggtgtctgtggtatctaataa；
the nucleotide sequence of lipase 6s is as follows:
gtgtgtacctctaccgagacctgtcacattgaccaggagtgttacaacttctttgagaagtacgcccgactcgcaaacattggatattgtgttggtcccggcactaagatcttcaagcccttcaactgtggcctgcaatgtgcccacttccccaacgttgagctcatcgaggagttctgtgacccccgtctcatctttgatgtttgtggttacctcgctgttgatcatgcctccaagcagatctaccttgttattcgaggaacccactctctggaggacgtcataaccgacatccgaatcatgcaggctcctctgacgaactttgatcttgctgctaacatctcttctacttgtacttgtgattgttgtcttgtccacaatggcttcatccagtcctacaacaacacctacaatcagatcggccccaagctcgactctgtgattgagcagtatcccgactaccagattgctgtcaccggtcactctctcggaggagctgcagcccttctgttcggaatcaacctcaagtgtaacggccacgatcccctcgttgttactcttggtcagcccattgtcggtaacgcttgttttgctaactgggtcgataaactcttctttggccaggagtgtcccgatgtctgtaagtgttccaaagaccgaaagctctaccgaatcacccaccgaggagatatcgtccctcaagtgcccttctgggacggttaccagcactgctctggtgaggtctttattgactggcccctgatccaccctcctctctccaacgttgtcatgtgccagggccagagcaataaacagtgctctgccggtaacactctgctccagcaggtcaatgtgattggaaaccatctgcagtacttcgtcaccgagggtgtctgtggtatctaataa。
the preparation method of the heat-resistant mutant lipase comprises the following steps:
(1) taking pPICZ α A-Lip2 as a template, mutating the selected amino acid site into cysteine through reverse PCR mutation, transferring the cysteine into escherichia coli, carrying out amplification culture, plasmid extraction and sequencing to obtain mutant lipase recombinant plasmids with four, five or six pairs of disulfide bonds introduced;
(2) carrying out linearization treatment on the recombinant plasmid with correct sequencing by using a Pme I restriction enzyme, carrying out electric shock transformation on the recombinant plasmid into competent Pichia pastoris X33, and further carrying out YPDS-Zeocin plate screening to obtain corresponding mutant engineering bacteria;
(3) carrying out propagation culture on the mutant engineering bacteria in an YPD liquid culture medium, transferring to a BMGY liquid culture medium for inhibition removal culture, finally inoculating a BMMY liquid culture medium for fermentation, and centrifuging the bacterial liquid to obtain a supernatant coarse enzyme liquid;
(4) and (3) carrying out ultrafiltration concentration on the crude enzyme solution by using an ultrafiltration tube, purifying by using a nickel column one-step method to separate out lipase protein with a histidine tag, and detecting the protein purity by using reducing SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) to obtain purified lipase, namely heat-resistant mutant lipase.
The four, five and six pairs of disulfide bonds introduced in step (1) are disulfide bonds S8-214, S60-69, S122-196 and S118-177, disulfide bonds S2-210, S8-214, S60-69, S122-196 and S118-177, disulfide bonds S2-210, S8-214, S14-216, S60-69, S122-196 and S118-177, respectively.
The escherichia coli engineering bacteria in the step (1) are preferably escherichia coli TOP 10.
The concentration of Zeocin in the YPDS-Zeocin plate described in the step (2) is preferably 100. mu.g/mL.
The fermentation time in step (3) is preferably 96 h.
The ultrafiltration tube in step (4) is preferably a 10kDa ultrafiltration tube.
The mutant lipase in the step (4) is lipase 4s, lipase 5s or lipase 6 s.
The preparation method of the heat-resistant mutant lipase also comprises the following steps:
(5) determination of the melting temperature (T) of Lipase by DSF fluorescence detectionm) Determination of 15min semi-inactivation temperature (T) by p-NPP colorimetric method50) Half life (t) at 55 or 70 ℃1/2) Optimum reaction temperature (T)opt) Optimum reaction pH (pH)opt) And/or pH stability.
The heat-resistant lipid mutation lipase has strong heat stability and acid and alkali resistance, and is particularly suitable for industrial application.
Compared with the prior art, the invention has the following advantages and effects:
1. the invention screens out single-pair disulfide bonds, disulfide bonds S2-210, S8-214, S14-216, S60-69, S122-196 and S118-177 (making T of lipase) which can improve the heat resistance of Lip2mThe values are respectively improved by 10.48, 7.50, 5.70, 5.97, 4.55 and 3.33 ℃, and the heat stability of the lipase is improved by adopting a strategy of iteratively combining multiple pairs of disulfide bond mutations. Compared with the traditional strategy of introducing disulfide bonds, the heat stability of the mesophilic lipase is greatly improved by further increasing the number of the introduced disulfide bonds.
2. The present invention obtains thermostable lipases 4s, lipases 5s and lipases 6s by iteratively combining four, five and six pairs of disulfide bonds in Lip 2. T of Lipase 4s, Lipase 5s and Lipase 6s relative to the parent Lipase (Lip2)mThe T is increased by 16.45, 20.23 and 22.53 ℃ respectively50The values are respectively increased to 27.49, 29.83 and 31.23 ℃, the half-life period of the lipase is respectively 11.95, 24.76 and 101.93min at 70 ℃, and the heat resistance of the lipase 4s, the lipase 5s and the lipase 6s is greatly improved.
Drawings
FIG. 1 is a graph showing the optimum reaction pH of Lip2, lipase 4s, lipase 5s and lipase 6 s.
Fig. 2 is a graph of pH stability of Lip2, lipase 4s, lipase 5s, and lipase 6 s.
Detailed Description
The present invention will be described in further detail with reference to examples and drawings, but the present invention is not limited thereto.
The materials and reagents are pPICZ α A-Lip2 Pichia pastoris expression vector synthesized and constructed by the whole gene of Shanghai Kingshi biological company, plasmid extraction kit from Omega trade company Limited, KOD-PLUS mutation kit from Toyo textile company, Protein Thermal Shift screening kit from Thermo company, TOP10 Escherichia coli competent cell from Tiangen biological company, mutation primer from Shanghai biological engineering company, Pme I restriction enzyme from New England Biolabs, PCR product purification and recovery kit from Dalibao biological company, electrotransformation apparatus from Bio-Rad company, LLB + Zeocin, YPD + Zeocin, BMGY and BMMY culture medium prepared according to Invitrogen Pichia expression kit operation manual, nickel column purification kit from Shanghai biological engineering company, and other reagents are all purchased at the analytical pure level of China.
Example 1: construction of mutant Lipase expression plasmid
The method comprises the following steps of carrying out mutation by using pPICZ α A-Lip2 as a template (the construction method refers to Chinese patent application 201610279266.3, "a thermostable lipase, a preparation method and application") and primers in a table 1 to obtain 3 sections of mutant amino acids, wherein 3 sections of amino acid sequences are shown as follows:
the amino acid sequence of lipase 4s is as follows:
VYTSTETCHIDQESYNFFEKYARLANIGYCVGPGTKIFKPFNCGLQCAHFPNVELIEEFCDPRLIFDVCGYLAVDHASKQIYLVIRGTHSLEDVITDIRIMQAPLTNFDLAANISSTCTCDCCLVHNGFIQSYNNTYNQIGPKLDSVIEQYPDYQIAVTGHSLGGAAALLFGINLKCNGHDPLVVTLGQPIVGNACFANWVDKLFFGQENPDVCKVSKDRKLYRITHRGDIVPQVPFWDGYQHCSGEVFIDWPLIHPPLSNVVMCQGQSNKQCSAGNTLLQQVNVIGNHLQYFVTEGVCGI；
the amino acid sequence of lipase 5s is as follows:
VCTSTETCHIDQESYNFFEKYARLANIGYCVGPGTKIFKPFNCGLQCAHFPNVELIEEFCDPRLIFDVCGYLAVDHASKQIYLVIRGTHSLEDVITDIRIMQAPLTNFDLAANISSTCTCDCCLVHNGFIQSYNNTYNQIGPKLDSVIEQYPDYQIAVTGHSLGGAAALLFGINLKCNGHDPLVVTLGQPIVGNACFANWVDKLFFGQECPDVCKVSKDRKLYRITHRGDIVPQVPFWDGYQHCSGEVFIDWPLIHPPLSNVVMCQGQSNKQCSAGNTLLQQVNVIGNHLQYFVTEGVCGI；
the amino acid sequence of lipase 6s is as follows:
VCTSTETCHIDQECYNFFEKYARLANIGYCVGPGTKIFKPFNCGLQCAHFPNVELIEEFCDPRLIFDVCGYLAVDHASKQIYLVIRGTHSLEDVITDIRIMQAPLTNFDLAANISSTCTCDCCLVHNGFIQSYNNTYNQIGPKLDSVIEQYPDYQIAVTGHSLGGAAALLFGINLKCNGHDPLVVTLGQPIVGNACFANWVDKLFFGQECPDVCKCSKDRKLYRITHRGDIVPQVPFWDGYQHCSGEVFIDWPLIHPPLSNVVMCQGQSNKQCSAGNTLLQQVNVIGNHLQYFVTEGVCGI。
the nucleotide sequence for coding the heat-resistant lipase is shown as follows:
the nucleotide sequence of lipase 4s is as follows:
gtgtacacctctaccgagacctgtcacattgaccaggagtcctacaacttctttgagaagtacgcccgactcgcaaacattggatattgtgttggtcccggcactaagatcttcaagcccttcaactgtggcctgcaatgtgcccacttccccaacgttgagctcatcgaggagttctgtgacccccgtctcatctttgatgtttgtggttacctcgctgttgatcatgcctccaagcagatctaccttgttattcgaggaacccactctctggaggacgtcataaccgacatccgaatcatgcaggctcctctgacgaactttgatcttgctgctaacatctcttctacttgtacttgtgattgttgtcttgtccacaatggcttcatccagtcctacaacaacacctacaatcagatcggccccaagctcgactctgtgattgagcagtatcccgactaccagattgctgtcaccggtcactctctcggaggagctgcagcccttctgttcggaatcaacctcaagtgtaacggccacgatcccctcgttgttactcttggtcagcccattgtcggtaacgcttgttttgctaactgggtcgataaactcttctttggccaggagaaccccgatgtctgtaaggtgtccaaagaccgaaagctctaccgaatcacccaccgaggagatatcgtccctcaagtgcccttctgggacggttaccagcactgctctggtgaggtctttattgactggcccctgatccaccctcctctctccaacgttgtcatgtgccagggccagagcaataaacagtgctctgccggtaacactctgctccagcaggtcaatgtgattggaaaccatctgcagtacttcgtcaccgagggtgtctgtggtatctaataa；
the nucleotide sequence of lipase 5s is as follows:
gtgtgtacctctaccgagacctgtcacattgaccaggagtcctacaacttctttgagaagtacgcccgactcgcaaacattggatattgtgttggtcccggcactaagatcttcaagcccttcaactgtggcctgcaatgtgcccacttccccaacgttgagctcatcgaggagttctgtgacccccgtctcatctttgatgtttgtggttacctcgctgttgatcatgcctccaagcagatctaccttgttattcgaggaacccactctctggaggacgtcataaccgacatccgaatcatgcaggctcctctgacgaactttgatcttgctgctaacatctcttctacttgtacttgtgattgttgtcttgtccacaatggcttcatccagtcctacaacaacacctacaatcagatcggccccaagctcgactctgtgattgagcagtatcccgactaccagattgctgtcaccggtcactctctcggaggagctgcagcccttctgttcggaatcaacctcaagtgtaacggccacgatcccctcgttgttactcttggtcagcccattgtcggtaacgcttgttttgctaactgggtcgataaactcttctttggccaggagtgtcccgatgtctgtaaggtgtccaaagaccgaaagctctaccgaatcacccaccgaggagatatcgtccctcaagtgcccttctgggacggttaccagcactgctctggtgaggtctttattgactggcccctgatccaccctcctctctccaacgttgtcatgtgccagggccagagcaataaacagtgctctgccggtaacactctgctccagcaggtcaatgtgattggaaaccatctgcagtacttcgtcaccgagggtgtctgtggtatctaataa；
the nucleotide sequence of lipase 6s is as follows:
gtgtgtacctctaccgagacctgtcacattgaccaggagtgttacaacttctttgagaagtacgcccgactcgcaaacattggatattgtgttggtcccggcactaagatcttcaagcccttcaactgtggcctgcaatgtgcccacttccccaacgttgagctcatcgaggagttctgtgacccccgtctcatctttgatgtttgtggttacctcgctgttgatcatgcctccaagcagatctaccttgttattcgaggaacccactctctggaggacgtcataaccgacatccgaatcatgcaggctcctctgacgaactttgatcttgctgctaacatctcttctacttgtacttgtgattgttgtcttgtccacaatggcttcatccagtcctacaacaacacctacaatcagatcggccccaagctcgactctgtgattgagcagtatcccgactaccagattgctgtcaccggtcactctctcggaggagctgcagcccttctgttcggaatcaacctcaagtgtaacggccacgatcccctcgttgttactcttggtcagcccattgtcggtaacgcttgttttgctaactgggtcgataaactcttctttggccaggagtgtcccgatgtctgtaagtgttccaaagaccgaaagctctaccgaatcacccaccgaggagatatcgtccctcaagtgcccttctgggacggttaccagcactgctctggtgaggtctttattgactggcccctgatccaccctcctctctccaacgttgtcatgtgccagggccagagcaataaacagtgctctgccggtaacactctgctccagcaggtcaatgtgattggaaaccatctgcagtacttcgtcaccgagggtgtctgtggtatctaataa。
reverse PCR was performed using pPICZ α A-Lip2 as a template, and two reverse PCR reactions were performed for each pair of disulfide bonds introduced, since the disulfide bonds S14-216 and S2-210, S8-214 were both between two loop segments (amino acid 1 to amino acid 14 and amino acid 207 to amino acid 221), and the disulfide bonds S14-216 and S2-210 were relatively close to the enzyme active center, S8-214, S60-69, S122-196 and S118-177 were selected as the four disulfide bonds of 4S, S2-210, S8-214, S60-69, S122-196 and S118-177 as the five disulfide bonds of 5S, S2-210, S8-214, S14-216, S60-69, S122-196 and S118-177 as the six disulfide bonds of 6S, and the primers 122C-F and 122-R of Table 1 were used as primers to obtain the first amplification of lipase 4.
TABLE 1 summary of mutant primers
Note: the point with the thick line is a mutation site
The PCR amplification conditions were: 94 ℃ for 2 min; 10 cycles of 94 ℃ for 10s, 66 ℃ for 30s, and 68 ℃ for 5 min. The reaction system is shown in table 2 below.
TABLE 2PCR reaction System
| Upstream primer (10. mu.M) | 1.5μL | |
| Downstream primer (10. mu.M) | 1.5μL | |
| KOD-Plus high fidelity enzyme | 1μL | |
| Stencil (50 ng/. mu.L) | 1μL | |
| Double distilled | 35μL | |
| 5× | 5μL | |
| 5×dNTP(2M) | 5μL | |
| General System | 50μL |
The amplified product was digested with Dnp I enzyme, after detecting the size of the mutant band by agarose gel electrophoresis, circularized overnight with T4 ligase ligation, followed by heat shock method to transfer the mutant plasmid into TOP10 E.coli competent cells, and plated on LLB + Zeocin (Zeocin concentration 25. mu.g/ml) plates for overnight culture at 37 ℃ to select positive transformants for plasmid sequencing.
After the positive transformants which were correctly sequenced were grown overnight in LLB + Zeocin (Zeocin concentration: 25. mu.g/ml) liquid medium, plasmids were extracted. Using this plasmid as a template, 7 mutations were made in the same manner using primers 196C-F and 196C-R, 196+118C-F and 196+118C-R, 177C-F and 177C-R, 8C-F and 8C-R, 214C-F and 214C-R, 60C-F and 60C-R, 69C-F and 69C-R of Table 1 in this order to obtain a recombinant plasmid for lipase 4 s.
The plasmid of lipase 4s was used as a template, and 2 mutations were performed in the order of primers 210+8C-F and 210+8C-R, 210+214C-F and 210+214C-R of Table 1 to obtain a recombinant plasmid of lipase 5 s.
The plasmid of lipase 5s is taken as a template, and 2 times of mutation are carried out by sequentially taking the primers 210+214+14C-F and 210+214+14C-R, 210+214+216C-F and 210+214+216C-R in the table 1 to obtain the recombinant plasmid of lipase 6 s.
Example 2: linear plasmid electrotransformation pichia pastoris, transformant screening and enzyme production screening
After the positive transformant with correct sequencing is subjected to overnight amplification culture in a LLB + Zeocin liquid medium (the concentration of the Zeocin is 25 mu g/ml), plasmids are extracted, are subjected to linearization treatment by Pme I and are purified and recovered, and the plasmid linearization product with the total amount of 5 mu g is subjected to competent mixed shock transformation with the Pichia pastoris X33. Pichia pastoris competence preparation reference is made to the Invitrogen company operating Manual. The electrotransfer program was set up according to parameters recommended by Bio-Rad.
After the completion of the electrotransformation, 1mL of 1mol/L sorbitol solution was added, and the bacterial solution was incubated at 30 ℃ for 1 hour for resuscitation, and then uniformly spread on YPDS + Zeocin (the concentration of Zeocin was 100. mu.g/mL) resistant plates for screening.
Example 3: fermentation of recombinant engineered strains
Refer to the operating manual of the Pichia expression kit from Invitrogen corporation with minor modifications as follows: the engineering strain single colony is inoculated into 2mL YPDS-Zeocin liquid medium (the concentration of Zeocin is 100 mu g/mL) for purification culture overnight, the cells are suspended and cultured overnight by centrifugation with BMGY liquid medium, and then inoculated into 50mL BMMY liquid medium, cultured for 96h at 25 ℃ and 280r/min, and supplemented with methanol every day to the final concentration of 1% (v/v).
Example 4: separation and purification of lipases
1) Concentrating by ultrafiltration
Centrifuging 100mL fermentation liquid at 4 deg.C and 5000r/min for 5min, sucking supernatant, centrifuging at 4 deg.C and 5000r/min with 10kDa ultrafiltration tube for 50min, and collecting concentrated enzyme solution.
2) One-step nickel column purification
① the nickel column was equilibrated with 5mL of Binding Buffer containing 10mM imidazole to remove the residual ethanol sufficiently;
② mixing the concentrated enzyme solution with Binding Buffer containing 120mM imidazole according to the proportion of 1:1, adding the mixture into a nickel column and combining;
③ Wash buffer containing 60mM imidazole in 15mL to elute the hetero protein thoroughly;
④ eluting the target protein with 15mL of Elution Buffer containing 300mM imidazole;
⑤ ultrafiltering and concentrating the purified enzyme solution under the above conditions;
obtaining purified mutant lipase, and finally detecting the purity of the enzyme by using reducing SDS-PAGE vertical electrophoresis, wherein the purity is over 90 percent.
Example 5: and (4) determining the enzymatic properties of the lipase.
The T of the mutant lipase is measured by a fluorescent quantitative PCR instrument according to the recommended reaction program of the Protein Thermal Shift kitmThe results are shown in Table 3, and the introduction of multiple disulfide bonds greatly improves the T of lipasemT of 6smThe values are further improved than 4s and 5 s.
TABLE 3DSF measurement results
| Lipase enzyme | Tm | ΔTm |
| Lip2 | 48.32±0.25 | - |
| 4s | 64.77±0.10 | 16.45 |
| 5s | 68.55±0.15 | 20.23 |
| 6s | 70.85±0.01 | 22.53 |
T50The determination method comprises the following steps: accurately keeping the purified protein solution of 0.1mg/mL in a PCR instrument at 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 and 80 ℃ for 15min respectively, taking 50mM Tris-HCl buffer solution containing 40mM p-NPP as a reaction system (pH 7.50), accurately reacting for 10min, adding 20% (w/v) trichloroacetic acid to stop the reaction for 5min, developing color in 20% (w/v) sodium carbonate solution, measuring the absorbance at 410nm, and calculating the residual relative enzyme activity of the lipase after different temperature heat preservation.
t1/2The determination method comprises the following steps: precisely preserving 0.1mg/mL purified protein solution in a PCR instrument at 55 or 70 ℃ for 0, 5, 10, 15, 30, 45 and 60min, taking 50mM Tris-HCl buffer solution containing 40mM p-NPP as a reaction system (pH 7.50), adding 20% (w/v) trichloroacetic acid to terminate the reaction after 10min of precise reaction, developing color by 20% (w/v) sodium carbonate solution, measuring the absorbance at 410nm, and calculating the residual activity of lipase after different temperature preservation.
ToptThe determination method comprises the following steps: adding the protein solution of 30, 35, 40, 45, 50, 55, 60, or,After being preheated at 65 ℃ and 70 ℃, 50mM Tris-HCl buffer (pH 7.50) containing 40mM p-NPP is accurately reacted for 10min, 20% (w/v) trichloroacetic acid is added to stop the reaction, 20% (w/v) sodium carbonate solution is used for developing color, the absorbance at 410nm is measured, and the relative enzyme activity of the lipase at different temperatures is calculated.
pHoptDetermination of the value: the p-NPP standard mother liquor was added to citric acid-sodium dihydrogenphosphate buffer solutions (Table 4) having pH values of 2.0, 3.0, 4.0, 5.0, 6.0, 6.5, 7.0, 7.5 and 8.0, respectively, 5. mu.L of purified 0.1mg/mL of the enzyme solution was added thereto, the residual activity was measured by colorimetry by accurate reaction at 30 ℃ for 10min, the enzyme activity at the optimum reaction pH was defined as 100%, and the pH was plotted against the relative activity to obtain a measurement curve.
Determination of pH stability: diluting the enzyme solution to 1mg/mL with double distilled water, and then diluting the enzyme solution to a final concentration of 0.1mg/mL with buffers with pH of 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0 and 11.0; wherein the pH is 2.0-8.0 using citric acid-sodium dihydrogen phosphate buffer (Table 4), and the pH is 9.0-11.0 using glycine-sodium hydroxide buffer (see Table 5). Incubating at 25 deg.C for 24h, and performing accurate reaction at 30 deg.C for 10min by colorimetry to determine the residual activity of lipase.
TABLE 4 disodium hydrogen phosphate-citric acid buffer (25 ℃ C.)
Note: na (Na)2HPO4The molecular weight is 141.98, and the solution of 0.2mol/L is 28.40 g/L; with Na2HPO4·2H2O preparation of Na2HPO4Solution, Na2HPO4·2H2O molecular weight is 178.05, 0.2mol/L solution is 35.61 g/L; the citric acid has a molecular weight of 210.14, and the 0.1mol/L solution is 21.01 g/L.
TABLE 5 Glycine-sodium hydroxide buffer (0.05mol/L)
| pH | x/ml | y/ml | pH | x/ml | y/ml |
| 8.6 | 50 | 4.0 | 9.6 | 50 | 22.4 |
| 8.8 | 50 | 6.0 | 9.8 | 50 | 27.2 |
| 9.0 | 50 | 8.8 | 10.0 | 50 | 32.0 |
| 9.2 | 50 | 12.0 | 10.4 | 50 | 38.6 |
| 9.4 | 50 | 16.8 | 10.6 | 50 | 45.5 |
Note: x mL of 0.2mol/L glycine + y mL of 0.2mol/L NaOH, and adding water to dilute the mixture to 200 mL; the molecular weight of glycine is 75.07, and the 0.2mol/L glycine solution is 15.01 g/L.
T50、t1/2And ToptpH as shown in Table 6opt and pH stability are shown in figures 1 and 2, respectively:
TABLE 6 results of measurement of thermal stability
| T50(℃) | t1/2(min) | Topt(℃) | |
| Lip2 | 40.86 | 0.34 | 35 |
| 4s | 68.35 | 11.95 | 40 |
| 5s | 70.69 | 24.76 | 55 |
| 6s | 72.06 | 101.93 | 55 |
Note: the Lip2 measurement temperature was 55 ℃ with the remainder being 70 ℃.
Therefore, the thermal stability of lipase 4s, lipase 5s and lipase 6s is obviously improved, and T is50Are all greatly improved. The optimum reaction temperature for lipase 4s was raised to 40 ℃ and for both lipase 5s and lipase 6s to 55 ℃. And the lipase 5s and the lipase 6s have longer half-life periods at 70 ℃, the pH reaction interval is widened, and the acid and alkali resistance is enhanced.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.
Sequence listing
<110> southern China university of agriculture
<120> heat-resistant mutant lipase, preparation method and application
<160>30
<170>SIPOSequenceListing 1.0
<210>1
<211>301
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> amino acid sequence of Lipase 4s
<400>1
Val Tyr Thr Ser Thr Glu Thr Cys His Ile Asp Gln Glu Ser Tyr Asn
1 5 10 15
Phe Phe Glu Lys Tyr Ala Arg Leu Ala Asn Ile Gly Tyr Cys Val Gly
20 25 30
Pro Gly Thr Lys Ile Phe Lys Pro Phe Asn Cys Gly Leu Gln Cys Ala
35 40 45
His Phe Pro Asn Val Glu Leu Ile Glu Glu Phe Cys Asp Pro Arg Leu
50 55 60
Ile Phe Asp Val Cys Gly Tyr Leu Ala Val Asp His Ala Ser Lys Gln
65 70 75 80
Ile Tyr Leu Val Ile Arg Gly Thr His Ser Leu Glu Asp Val Ile Thr
85 90 95
Asp Ile Arg Ile Met Gln Ala Pro Leu Thr Asn Phe Asp Leu Ala Ala
100 105 110
Asn Ile Ser Ser Thr Cys Thr Cys Asp Cys Cys Leu Val His Asn Gly
115 120 125
Phe Ile Gln Ser Tyr Asn Asn Thr Tyr Asn Gln Ile Gly Pro Lys Leu
130 135 140
Asp Ser Val Ile Glu Gln Tyr Pro Asp Tyr Gln Ile Ala Val Thr Gly
145 150 155 160
His Ser Leu Gly Gly Ala Ala Ala Leu Leu Phe Gly Ile Asn Leu Lys
165 170 175
Cys Asn Gly His Asp Pro Leu Val Val Thr Leu Gly Gln Pro Ile Val
180 185 190
Gly Asn Ala Cys Phe Ala Asn Trp Val Asp Lys Leu Phe Phe Gly Gln
195 200 205
Glu Asn Pro Asp Val Cys Lys Val Ser Lys Asp Arg Lys Leu Tyr Arg
210 215 220
Ile Thr His Arg Gly Asp Ile Val Pro Gln Val Pro Phe Trp Asp Gly
225 230 235 240
Tyr Gln His Cys Ser Gly Glu Val Phe Ile Asp Trp Pro Leu Ile His
245 250 255
Pro Pro Leu Ser Asn Val Val Met Cys Gln Gly Gln Ser Asn Lys Gln
260 265 270
Cys Ser Ala Gly Asn Thr Leu Leu Gln Gln Val Asn Val Ile Gly Asn
275 280 285
His Leu Gln Tyr Phe Val Thr Glu Gly Val Cys Gly Ile
290 295 300
<210>2
<211>301
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> amino acid sequence of lipase 5s
<400>2
Val Cys Thr Ser Thr Glu Thr Cys His Ile Asp Gln Glu Ser Tyr Asn
1 5 10 15
Phe Phe Glu Lys Tyr Ala Arg Leu Ala Asn Ile Gly Tyr Cys Val Gly
20 25 30
Pro Gly Thr Lys Ile Phe Lys Pro Phe Asn Cys Gly Leu Gln Cys Ala
35 40 45
His Phe Pro Asn Val Glu Leu Ile Glu Glu Phe Cys Asp Pro Arg Leu
50 55 60
Ile Phe Asp Val Cys Gly Tyr Leu Ala Val Asp His Ala Ser Lys Gln
65 70 75 80
Ile Tyr Leu Val Ile Arg Gly Thr His Ser Leu Glu Asp Val Ile Thr
85 90 95
Asp Ile Arg Ile Met Gln Ala Pro Leu Thr Asn Phe Asp Leu Ala Ala
100 105 110
Asn Ile Ser Ser Thr Cys Thr Cys Asp Cys Cys Leu Val His Asn Gly
115 120 125
Phe Ile Gln Ser Tyr Asn Asn Thr Tyr Asn Gln Ile Gly Pro Lys Leu
130 135 140
Asp Ser Val Ile Glu Gln Tyr Pro Asp Tyr Gln Ile Ala Val Thr Gly
145 150 155 160
His Ser Leu Gly Gly Ala Ala Ala Leu Leu Phe Gly Ile Asn Leu Lys
165 170 175
Cys Asn Gly His Asp Pro Leu Val Val Thr Leu Gly Gln Pro Ile Val
180 185 190
Gly Asn Ala Cys Phe Ala Asn Trp Val Asp Lys Leu Phe Phe Gly Gln
195 200 205
Glu Cys Pro Asp Val Cys Lys Val Ser Lys Asp Arg Lys Leu Tyr Arg
210 215 220
Ile Thr His Arg Gly Asp Ile Val Pro Gln Val Pro Phe Trp Asp Gly
225 230 235 240
Tyr Gln His Cys Ser Gly Glu Val Phe Ile Asp Trp Pro Leu Ile His
245 250 255
Pro Pro Leu Ser Asn Val Val Met Cys Gln Gly Gln Ser Asn Lys Gln
260 265 270
Cys Ser Ala Gly Asn Thr Leu Leu Gln Gln Val Asn Val Ile Gly Asn
275 280 285
His Leu Gln Tyr Phe Val Thr Glu Gly Val Cys Gly Ile
290 295 300
<210>3
<211>301
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> amino acid sequence of lipase 6s
<400>3
Val Cys Thr Ser Thr Glu Thr Cys His Ile Asp Gln Glu Cys Tyr Asn
1 5 10 15
Phe Phe Glu Lys Tyr Ala Arg Leu Ala Asn Ile Gly Tyr Cys Val Gly
20 25 30
Pro Gly Thr Lys Ile Phe Lys Pro Phe Asn Cys Gly Leu Gln Cys Ala
35 40 45
His Phe Pro Asn Val Glu Leu Ile Glu Glu Phe Cys Asp Pro Arg Leu
50 55 60
Ile Phe Asp Val Cys Gly Tyr Leu Ala Val Asp His Ala Ser Lys Gln
65 70 75 80
Ile Tyr Leu Val Ile Arg Gly Thr His Ser Leu Glu Asp Val Ile Thr
85 90 95
Asp Ile Arg Ile Met Gln Ala Pro Leu Thr Asn Phe Asp Leu Ala Ala
100 105 110
Asn Ile Ser Ser Thr Cys Thr Cys Asp Cys Cys Leu Val His Asn Gly
115 120 125
Phe Ile Gln Ser Tyr Asn Asn Thr Tyr Asn Gln Ile Gly Pro Lys Leu
130 135 140
Asp Ser Val Ile Glu Gln Tyr Pro Asp Tyr Gln Ile Ala Val Thr Gly
145 150 155 160
His Ser Leu Gly Gly Ala Ala Ala Leu Leu Phe Gly Ile Asn Leu Lys
165 170 175
Cys Asn Gly His Asp Pro Leu Val Val Thr Leu Gly Gln Pro Ile Val
180 185 190
Gly Asn Ala Cys Phe Ala Asn Trp Val Asp Lys Leu Phe Phe Gly Gln
195 200 205
Glu Cys Pro Asp Val Cys Lys Cys Ser Lys Asp Arg Lys Leu Tyr Arg
210 215 220
Ile Thr His Arg Gly Asp Ile Val Pro Gln Val Pro Phe Trp Asp Gly
225 230 235 240
Tyr Gln His Cys Ser Gly Glu Val Phe Ile Asp Trp Pro Leu Ile His
245 250 255
Pro Pro Leu Ser Asn Val Val Met Cys Gln Gly Gln Ser Asn Lys Gln
260 265 270
Cys Ser Ala Gly Asn Thr Leu Leu Gln Gln Val Asn Val Ile Gly Asn
275 280 285
His Leu Gln Tyr Phe Val Thr Glu Gly Val Cys Gly Ile
290 295 300
<210>4
<211>909
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> nucleotide sequence of lipase 4s
<400>4
gtgtacacct ctaccgagac ctgtcacatt gaccaggagt cctacaactt ctttgagaag 60
tacgcccgac tcgcaaacat tggatattgt gttggtcccg gcactaagat cttcaagccc 120
ttcaactgtg gcctgcaatg tgcccacttc cccaacgttg agctcatcga ggagttctgt 180
gacccccgtc tcatctttga tgtttgtggt tacctcgctg ttgatcatgc ctccaagcag 240
atctaccttg ttattcgagg aacccactct ctggaggacg tcataaccga catccgaatc 300
atgcaggctc ctctgacgaa ctttgatctt gctgctaaca tctcttctac ttgtacttgt 360
gattgttgtc ttgtccacaa tggcttcatc cagtcctaca acaacaccta caatcagatc 420
ggccccaagc tcgactctgt gattgagcag tatcccgact accagattgc tgtcaccggt 480
cactctctcg gaggagctgc agcccttctg ttcggaatca acctcaagtg taacggccac 540
gatcccctcg ttgttactct tggtcagccc attgtcggta acgcttgttt tgctaactgg 600
gtcgataaac tcttctttgg ccaggagaac cccgatgtct gtaaggtgtc caaagaccga 660
aagctctacc gaatcaccca ccgaggagat atcgtccctc aagtgccctt ctgggacggt 720
taccagcact gctctggtga ggtctttatt gactggcccc tgatccaccc tcctctctcc 780
aacgttgtca tgtgccaggg ccagagcaat aaacagtgct ctgccggtaa cactctgctc 840
cagcaggtca atgtgattgg aaaccatctg cagtacttcg tcaccgaggg tgtctgtggt 900
atctaataa 909
<210>5
<211>909
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> nucleotide sequence of lipase 5s
<400>5
gtgtgtacct ctaccgagac ctgtcacatt gaccaggagt cctacaactt ctttgagaag 60
tacgcccgac tcgcaaacat tggatattgt gttggtcccg gcactaagat cttcaagccc 120
ttcaactgtg gcctgcaatg tgcccacttc cccaacgttg agctcatcga ggagttctgt 180
gacccccgtc tcatctttga tgtttgtggt tacctcgctg ttgatcatgc ctccaagcag 240
atctaccttg ttattcgagg aacccactct ctggaggacg tcataaccga catccgaatc 300
atgcaggctc ctctgacgaa ctttgatctt gctgctaaca tctcttctac ttgtacttgt 360
gattgttgtc ttgtccacaa tggcttcatc cagtcctaca acaacaccta caatcagatc 420
ggccccaagc tcgactctgt gattgagcag tatcccgact accagattgc tgtcaccggt 480
cactctctcg gaggagctgc agcccttctg ttcggaatca acctcaagtg taacggccac 540
gatcccctcg ttgttactct tggtcagccc attgtcggta acgcttgttt tgctaactgg 600
gtcgataaac tcttctttgg ccaggagtgt cccgatgtct gtaaggtgtc caaagaccga 660
aagctctacc gaatcaccca ccgaggagat atcgtccctc aagtgccctt ctgggacggt 720
taccagcact gctctggtga ggtctttatt gactggcccc tgatccaccc tcctctctcc 780
aacgttgtca tgtgccaggg ccagagcaat aaacagtgct ctgccggtaa cactctgctc 840
cagcaggtca atgtgattgg aaaccatctg cagtacttcg tcaccgaggg tgtctgtggt 900
atctaataa 909
<210>6
<211>909
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> nucleotide sequence of lipase 6s
<400>6
gtgtgtacct ctaccgagac ctgtcacatt gaccaggagt gttacaactt ctttgagaag 60
tacgcccgac tcgcaaacat tggatattgt gttggtcccg gcactaagat cttcaagccc 120
ttcaactgtg gcctgcaatg tgcccacttc cccaacgttg agctcatcga ggagttctgt 180
gacccccgtc tcatctttga tgtttgtggt tacctcgctg ttgatcatgc ctccaagcag 240
atctaccttg ttattcgagg aacccactct ctggaggacg tcataaccga catccgaatc 300
atgcaggctc ctctgacgaa ctttgatctt gctgctaaca tctcttctac ttgtacttgt 360
gattgttgtc ttgtccacaa tggcttcatc cagtcctaca acaacaccta caatcagatc 420
ggccccaagc tcgactctgt gattgagcag tatcccgact accagattgc tgtcaccggt 480
cactctctcg gaggagctgc agcccttctg ttcggaatca acctcaagtg taacggccac 540
gatcccctcg ttgttactct tggtcagccc attgtcggta acgcttgttt tgctaactgg 600
gtcgataaac tcttctttgg ccaggagtgt cccgatgtct gtaagtgttc caaagaccga 660
aagctctacc gaatcaccca ccgaggagat atcgtccctc aagtgccctt ctgggacggt 720
taccagcact gctctggtga ggtctttatt gactggcccc tgatccaccc tcctctctcc 780
aacgttgtca tgtgccaggg ccagagcaat aaacagtgct ctgccggtaa cactctgctc 840
cagcaggtca atgtgattgg aaaccatctg cagtacttcg tcaccgaggg tgtctgtggt 900
atctaataa 909
<210>7
<211>27
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223>122C-F
<400>7
tgttgtcttg tccacaatgg cttcatc 27
<210>8
<211>33
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223>122C-R
<400>8
atcacaagta gcagtagaag agatgttagc agc 33
<210>9
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223>196C-F
<400>9
acaagcgtta ccgacaatgg gctg 24
<210>10
<211>31
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223>196C-R
<400>10
tttgctaact gggtcgataa actcttcttt g 31
<210>11
<211>31
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223>196+118C-F
<400>11
acttgtgatt gttgtcttgt ccacaatggc t 31
<210>12
<211>37
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223>196+118C-R
<400>12
acaagtagaa gagatgttag cagcaagatc aaagttc 37
<210>13
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223>177C-F
<400>13
tgtaacggcc acgatcccct cgt 23
<210>14
<211>27
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223>177C-R
<400>14
cttgaggttg attccgaaca gaagggc 27
<210>15
<211>30
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223>8C-F
<400>15
tgtcacattg accaggagtc ctacaacttc 30
<210>16
<211>29
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223>8C-R
<400>16
ggtctcggta gaggtgtaca catggtgat 29
<210>17
<211>29
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223>214C-F
<400>17
tgtaaggtgtccaaagaccg aaagctcta 29
<210>18
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223>214C-R
<400>18
gacatcgggg ttctcctggc ca 22
<210>19
<211>26
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223>60C-F
<400>19
tgtgaccccc gtctcatctt tgatgt 26
<210>20
<211>26
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223>60C-R
<400>20
gaactcctcg atgagctcaa cgttgg 26
<210>21
<211>26
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223>69C-F
<400>21
tgtggttacc tcgctgttga tcatgc 26
<210>22
<211>26
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223>69C-R
<400>22
aacatcaaag atgagacggg ggtcac 26
<210>23
<211>30
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223>210+8C-F
<400>23
tgtcacattg accaggagtc ctacaacttc 30
<210>24
<211>30
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223>210+8C-R
<400>24
ggtctcggta gaggtacaca catggtgatg 30
<210>25
<211>29
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223>210+214C-F
<400>25
tgtaaggtgt ccaaagaccg aaagctcta 29
<210>26
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223>210+214C-R
<400>26
gacatcggga cactcctggc ca 22
<210>27
<211>30
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223>210+214+14C-F
<400>27
tacaacttct ttgagaagta cgcccgactc 30
<210>28
<211>28
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223>210+214+14C-R
<400>28
acactcctgg tcaatgtgac aggtctcg 28
<210>29
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223>210+214+216C-F
<400>29
ccgaatcacc caccgaggag atatc 25
<210>30
<211>30
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223>210+214+216C-R
<400>30
tagagctttc ggtctttgga acacttacag 30
Claims (6)
1. A thermostable mutant lipase, characterized in that: is obtained by introducing a plurality of pairs of disulfide bond mutations in yarrowia lipolytica lipase 2 through an iterative combination method; the introduced multiple pairs of disulfide bonds are 4-6 pairs of disulfide bonds;
the disulfide bonds are disulfide bonds S2-210, S8-214, S14-216, S60-69, S122-196 and S118-177;
the heat-resistant mutant lipase is lipase 4s, lipase 5s or lipase 6 s;
the amino acid sequence of the lipase 4s is shown as SEQ ID NO. 1;
the amino acid sequence of the lipase 5s is shown as SEQ ID NO. 2;
the amino acid sequence of the lipase 6s is shown as SEQ ID NO. 3.
2. A nucleotide sequence encoding the thermotolerant mutant lipase of claim 1, wherein:
the encoding nucleotide sequence of the lipase 4s is shown as SEQ ID NO. 4;
the coding nucleotide sequence of the lipase 5s is shown as SEQ ID NO. 5;
the coding nucleotide sequence of the lipase 6s is shown as SEQ ID NO. 6.
3. The method for preparing a thermostable mutant lipase according to claim 1, comprising the steps of:
(1) taking pPICZ α A-Lip2 as a template, mutating the selected amino acid site into cysteine through reverse PCR mutation, transferring the cysteine into escherichia coli, carrying out amplification culture, plasmid extraction and sequencing to obtain mutant lipase recombinant plasmids with four, five or six pairs of disulfide bonds introduced;
(2) carrying out linearization treatment on the recombinant plasmid with correct sequencing by using a Pme I restriction enzyme, carrying out electric shock transformation on the recombinant plasmid into competent Pichia pastoris X33, and further carrying out YPDS-Zeocin plate screening to obtain corresponding mutant engineering bacteria;
(3) carrying out propagation culture on the mutant engineering bacteria in an YPD liquid culture medium, transferring to a BMGY liquid culture medium for inhibition removal culture, finally inoculating a BMMY liquid culture medium for fermentation, and centrifuging the bacterial liquid to obtain a supernatant coarse enzyme liquid;
(4) and (3) carrying out ultrafiltration concentration on the crude enzyme solution by using an ultrafiltration tube, purifying by using a nickel column one-step method to separate out lipase protein with a histidine tag, and detecting the protein purity by using reducing SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) to obtain the purified heat-resistant mutant lipase.
4. The method for producing a thermostable mutant lipase according to claim 3, characterized in that: the Escherichia coli in the step (1) is Escherichia coli TOP 10.
5. The method for producing a thermostable mutant lipase according to claim 3, characterized in that: the concentration of Zeocin in the YPDS-Zeocin plate described in the step (2) was 100. mu.g/mL.
6. The method for preparing thermostable mutant lipase according to claim 3, characterized by further comprising the steps of:
(5) the melting temperature of the lipase is measured by DSF fluorescence detection,p-NPP colorimetry to determine the half-inactivation temperature at 15min, half-life at 55 or 70 ℃, optimum reaction temperature, optimum reaction pH, and pH stability.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711220144.8A CN107858337B (en) | 2017-11-29 | 2017-11-29 | Heat-resistant mutant lipase, preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711220144.8A CN107858337B (en) | 2017-11-29 | 2017-11-29 | Heat-resistant mutant lipase, preparation method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107858337A CN107858337A (en) | 2018-03-30 |
| CN107858337B true CN107858337B (en) | 2020-05-15 |
Family
ID=61702704
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711220144.8A Active CN107858337B (en) | 2017-11-29 | 2017-11-29 | Heat-resistant mutant lipase, preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107858337B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110904073B (en) * | 2019-05-31 | 2020-12-01 | 江南大学 | Lipase mutant and application thereof in decontamination |
| CN110819609B (en) * | 2019-12-13 | 2022-05-10 | 华南农业大学 | Mutant lipase with improved thermal stability as well as preparation method and application thereof |
| CN111117982B (en) * | 2019-12-25 | 2023-05-12 | 武汉新华扬生物股份有限公司 | Pyrethroid degrading enzyme, encoding gene, recombinant strain and application thereof |
| CN111073876B (en) * | 2020-01-18 | 2021-07-27 | 江南大学 | Bacillus subtilis lipase A with improved heat stability |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102660517A (en) * | 2011-12-08 | 2012-09-12 | 上海交通大学 | Lipase mutant with improved heat stability, and construction method thereof |
| CN105950585A (en) * | 2016-04-29 | 2016-09-21 | 华南农业大学 | Thermally stable lipase as well as preparation method and applications thereof |
| CN106047838A (en) * | 2016-06-07 | 2016-10-26 | 华南农业大学 | Heatproof mutation lipase with high catalytic activity as well as preparation method and application of heatproof mutation lipase |
-
2017
- 2017-11-29 CN CN201711220144.8A patent/CN107858337B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102660517A (en) * | 2011-12-08 | 2012-09-12 | 上海交通大学 | Lipase mutant with improved heat stability, and construction method thereof |
| CN105950585A (en) * | 2016-04-29 | 2016-09-21 | 华南农业大学 | Thermally stable lipase as well as preparation method and applications thereof |
| CN106047838A (en) * | 2016-06-07 | 2016-10-26 | 华南农业大学 | Heatproof mutation lipase with high catalytic activity as well as preparation method and application of heatproof mutation lipase |
Non-Patent Citations (2)
| Title |
|---|
| Shedding light on the efficacy of laboratory evolution based on iterative saturation mutagenesis;Manfred T. Reetz等;《Molecular BioSystems》;20081209;第5卷;第115-122页 * |
| 热稳定性伯克霍尔德菌脂肪酶A突变体的筛选;刘艳如等;《微生物学报》;20150604;第55卷(第6期);第748-754页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107858337A (en) | 2018-03-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107858337B (en) | Heat-resistant mutant lipase, preparation method and application | |
| CN107858338B (en) | Heat-resistant mutant lipase combining disulfide bonds as well as preparation method and application thereof | |
| CN110054702B (en) | Zearalenone degrading enzyme fusion protein and encoding gene and application thereof | |
| US10053682B2 (en) | β-galactosidase mutant with high transglycosidase activity, and preparation method thereof and uses thereof | |
| CN107201352B (en) | β -galactosidase combined mutant with high transglycosidic activity and preparation method and application thereof | |
| CN113862233B (en) | Method for improving acid stability of glucose oxidase, mutant Q241E/R499E, gene and application | |
| CN108085308B (en) | Recombinant engineering bacterium capable of improving yield of heat-resistant lipase and construction method and application thereof | |
| US11332731B2 (en) | Nitrile hydratase mutant, genetically engineered bacterium containing mutant and applications thereof | |
| CN110358754B (en) | Method for improving activity of displaying beta-glucuronidase on surface of pichia pastoris | |
| CN112301012B (en) | Cyclodextrin glucosyltransferase mutant and construction method thereof | |
| WO2023236638A1 (en) | Thermal stability-improved glucose oxidase goxm10 mutant e361p, derivative mutant thereof, and use thereof | |
| CN113684198A (en) | Method for improving cellulase catalytic efficiency and mutant 5I77-M2 | |
| CN110819609B (en) | Mutant lipase with improved thermal stability as well as preparation method and application thereof | |
| CN110358751B (en) | Recombinant lipase mutant, encoding gene, recombinant engineering bacterium and application | |
| CN114736880B (en) | Mutant D497N of glucose oxidase GoxM10 with improved acid stability as well as derivative mutant and application thereof | |
| CN106995809B (en) | Low-temperature xylanase Xyn27, and gene and application thereof | |
| CN111286497B (en) | Lipase with improved catalytic performance and application thereof | |
| CN111172143B (en) | D-xylonic acid dehydratase and application thereof | |
| CN111004794B (en) | Subtilisin E mutant with improved thermal stability and application thereof | |
| CN114214308A (en) | Nitrilase mutant with activity improved through semi-rational modification | |
| CN105200070A (en) | Pullulanase enzyme production gene, carrier containing same and application of carrier | |
| CN113151210B (en) | Peroxidase mutant with high specific enzyme activity and application thereof | |
| CN102719463B (en) | A kind of method producing restructuring mixing L-arabinose isomerase | |
| CN107446907A (en) | A kind of thermophilic Pullulanase and preparation method thereof | |
| CN112481245B (en) | Recombinant D-tagatose 3 epimerase DTE-CM and construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |