CN107857801A - A kind of signal peptide and its application that can be used for improving secernment efficiency - Google Patents

A kind of signal peptide and its application that can be used for improving secernment efficiency Download PDF

Info

Publication number
CN107857801A
CN107857801A CN201710990135.0A CN201710990135A CN107857801A CN 107857801 A CN107857801 A CN 107857801A CN 201710990135 A CN201710990135 A CN 201710990135A CN 107857801 A CN107857801 A CN 107857801A
Authority
CN
China
Prior art keywords
signal peptide
seq
improving
nucleotide sequence
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201710990135.0A
Other languages
Chinese (zh)
Other versions
CN107857801B (en
Inventor
潘力
刘欣
叶燕锐
王斌
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
South China University of Technology SCUT
Original Assignee
South China University of Technology SCUT
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by South China University of Technology SCUT filed Critical South China University of Technology SCUT
Priority to CN201710990135.0A priority Critical patent/CN107857801B/en
Publication of CN107857801A publication Critical patent/CN107857801A/en
Application granted granted Critical
Publication of CN107857801B publication Critical patent/CN107857801B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/32—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Bacillus (G)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1025—Acyltransferases (2.3)
    • C12N9/104—Aminoacyltransferases (2.3.2)
    • C12N9/1044—Protein-glutamine gamma-glutamyltransferase (2.3.2.13), i.e. transglutaminase or factor XIII
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2468—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1) acting on beta-galactose-glycoside bonds, e.g. carrageenases (3.2.1.83; 3.2.1.157); beta-agarase (3.2.1.81)
    • C12N9/2471—Beta-galactosidase (3.2.1.23), i.e. exo-(1-->4)-beta-D-galactanase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y203/00—Acyltransferases (2.3)
    • C12Y203/02—Aminoacyltransferases (2.3.2)
    • C12Y203/02013—Protein-glutamine gamma-glutamyltransferase (2.3.2.13), i.e. transglutaminase or factor XIII
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01023—Beta-galactosidase (3.2.1.23), i.e. exo-(1-->4)-beta-D-galactanase

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention discloses a kind of signal peptide and its application that can be used for improving secernment efficiency.The amino acid sequence of the signal peptide is as shown in SEQ ID NO.1.The nucleotide sequence for encoding the signal peptide is selected from following any sequence：(a) nucleotide sequence or its complementary series as shown in SEQ ID NO.2；(b) carry out what one or more nucleotides substitution, missing or additions were obtained to the nucleotide sequence shown in SEQ ID NO.2, have and nucleotide sequence or its complementary series of the nucleotide sequence identical shown in SEQ ID NO.2 as signal peptide function.The invention provides a kind of signal peptide with very strong secreting, expressing activity, the high expression of foreign gene can be realized, effective element is provided for bacillus subtilis expression alien gene.

Description

A kind of signal peptide and its application that can be used for improving secernment efficiency
Technical field
The invention belongs to gene engineering technology field, more particularly to a kind of signal peptide that can be used for improving secernment efficiency and its Using.
Background technology
Bacillus subtilis (Bacillus subtilis) is a kind of Gram positive aerobic type bacillus, is widely used in Industrial enzyme produces.Compared with other prokaryotes, protein expression is carried out using bacillus subtilis as host has following advantage: 1st, genetic background is clear, has completed genome sequencing；2nd, without codon-bias；3rd, fermentation is simple, to nutrition without special It is required that；4th, a set of efficient protein excretory system is possessed, and the protein through its secretion has bioactivity and natural structure more As；5th, no pathogenicity, any endotoxin is not produced.
There is more in-depth study on expression excretory system and related secretion element in bacillus subtilis, wherein believing The screening of number peptide is as a kind of tactful means for effectively improving destination protein and secreting yield.Signal peptide is to be located at newborn secretory protein One section of distinctive amino acid sequence of matter and epicyte protein N-terminal, it has great shadow for the cross-film secernment efficiency of albumen Ring.Signal peptide sequence does not have obvious conserved amino acid sequences typically, typically by the N domains with positive charge, is rich in The H structure domain of hydrophobic amino acid and the C-structure domain composition with negative electrical charge.There are some researches show between secretory protein and signal peptide There is the problem of suitability, unlike signal peptide guides same protein secretion efficiency variance notable.Therefore, bacillus subtilis is studied High efficient expression and mechanism of secretion of the different types of signal peptide of bacterium itself for realizing foreign gene etc. is significant.
The content of the invention
The shortcomings that primary and foremost purpose of the present invention is to overcome prior art and deficiency, there is provided one kind can be used for improving secretion effect The signal peptide of rate.
Another object of the present invention is to provide the encoding gene that can be used for improving the signal peptide of secernment efficiency.
A further object of the present invention is to provide the application that can be used for improving the signal peptide of secernment efficiency.
The purpose of the present invention is achieved through the following technical solutions：A kind of signal peptide that can be used for improving secernment efficiency, its ammonia Base acid sequence is as shown in SEQ ID NO.1.
The coding gene that can be used for improving the signal peptide of secernment efficiency, its nucleotide sequence are selected from following any sequence Row：
(a) nucleotide sequence or its complementary series as shown in SEQ ID NO.2；
(b) one or more nucleotides substitutions, missing or addition institute are carried out to the nucleotide sequence shown in SEQ ID NO.2 Obtain, have with the nucleotide sequence identical shown in SEQ ID NO.2 as the nucleotide sequence of signal peptide function or Its complementary series.
Containing any of the above-described recombinant expression carrier, recombination that can be used for improving the gene of the signal peptide of secernment efficiency Engineering bacteria, transgenic cell line or expression cassette fall within protection scope of the present invention.
Described recombination engineering bacteria is by any of the above-described gene that can be used for improving the signal peptide of secernment efficiency Being fused to needs the N-terminal of expressing gene, makes the N-terminal fusion of the albumen of the gene code after fusion have corresponding signal peptide；Preferably The genetic engineering bacterium that beta galactosidase ability improves is secreted, or is the genetic engineering bacterium that can secrete transglutaminase；It is more excellent Elect Bacillus subtilis genes engineering bacteria as.
Application of the described signal peptide that can be used for improving secernment efficiency in protein secretion expression is improved.
Described albumen is thermostable beta-galactosidase or transglutaminase.
Described protein secretion is expressed as the secreting, expressing in prokaryotic expression system；Divide preferably in bacillus subtilis Secrete expression.
Described bacillus subtilis is preferably bacillus subtilis ATCC6051 (B.subtilis ATCC6051).
The present invention is had the following advantages relative to prior art and effect：
1st, the present invention is by from bacillus subtilis homologous protein signal peptide storehouse, building various signal peptides and beta galactose The expression vector that glycosides enzyme coding gene is combined, with reference to high-throughout screening technique, beta galactosidase point can be improved by filtering out The signal peptide secreted.The expression vector that the signal peptide is combined with transglutaminase proenzyme encoding gene is built simultaneously, is realized The secreting, expressing of transglutaminase proenzyme.
2nd, the invention provides a kind of amino acid fragment, there is the signal peptide of very strong secreting, expressing activity, can realize outer The high expression of source gene, effective element is provided especially for bacillus subtilis expression alien gene.
3rd, the present invention can make the increase of beta galactosidase secretory volume by merging signal peptide, and enzyme activity is further carried It is high.
4th, the present invention realizes transglutaminase proenzyme secreting, expressing by merging signal peptide.
Brief description of the drawings
Fig. 1 is the PCR primer electrophoretogram that biobrick is expanded in embodiment 1；Wherein, swimming lane M is marker DNA, swimming lane 1 is biobrick pcr amplification product.
Fig. 2 is plasmid pBEp43s-biobrick-bgaB and plasmid pBEp43-SP-bgaB structures signal in embodiment 1 Figure.
Fig. 3 is amplification SPyocA fragment electrophoretic figures in embodiment 2；Wherein, swimming lane M：marker DNA；Swimming lane 1 is SPyocA fragments.
Fig. 4 is the structure schematic diagram of expression plasmid pBEp43-SPyocA-proMTG in embodiment 2.
Fig. 5 is the SDS-PAGE that B.subtilis ATCC6051 (pBEp43-SPyocA-proMTG) are expressed in embodiment 2 Running gel figure；Wherein, swimming lane M：marker；Swimming lane 1 is B.subtilis ATCC6051；Swimming lane 2 is B.subtilis ATCC6051(pBEp43-SPyocA-proMTG)；Arrow represents destination protein MTG position.
Embodiment
With reference to embodiment, the present invention is described in further detail, but the implementation of the present invention is not limited to this.
Molecular biology experiment technology employed in following examples includes PCR amplifications, plasmid extraction, DNA fragmentation enzyme Cut, connect, gel electrophoresis etc. referring specifically to《Molecular Cloning:A Laboratory guide》(third edition) (Sambrook J, Russell DW, Janssen K, Argentine J. Huang Peitangs etc. are translated, and 2002, Beijing:Science Press).
The screening of the signal peptide of the beta galactosidase efficient secretory expression of embodiment 1
With reference to the method for (Christian Degering et.Al, 2010), by from bacillus subtilis homologous protein In signal peptide storehouse, the expression vector that various signal peptides are combined with beta galactosidase encoding gene (bgaB) is built, with reference to height The screening technique of flux, the signal peptide for improving beta galactosidase secretion effect in various degree is obtained from clone, is specifically included Following steps：
(1) pBEp43-biobrick-bgaB carriers are built：With two sections of artificial synthesized fragment SEQ ID NO.3, SEQ ID The PCR fragment for the biobrick (biological building blocks) that NO.4 annealing extensions obtain carries restriction enzyme site Kpn I and Xho I, and use is restricted The PCR primer (such as Fig. 1) of endonuclease digestion and the 100bp sizes purified insertion plasmid pBE-P43-bgaB (presses patent document：Pan A kind of DNA fragmentations with promoter function of the such as power and application .CN201510074949.0 [P] .2015. are built) identical inscribe Enzyme position, obtain pBEp43s-biobrick-bgaB plasmids (such as Fig. 2), the biobrick of design PCR fragment such as SEQ ID Shown in NO.5.The PCR fragment base sequence of amplification is sequenced by Sanger to be confirmed.
(2) pBEp43-SP (signal peptide database)-bgaB carriers are built：Extract bacillus subtilis (Bacillus subttlis168, being purchased from Guangdong Province's Culture Collection) genomic DNA (Omega bacterial genomes DNA extraction agents box), use corresponding primer (F-SpyocA：5′- GAGAGGAATGTCGACATGAAGAAAAAGAGAAAAGGCTGTT-3′；R-SpyocA：5′- CGTTGTCCATCTCGAGGGCGATGACAAAGACAAAAATCAT-3 ') genomic DNA is expanded, then by PCR primer Reclaim (Omega DNA gels QIAquick Gel Extraction Kit), the above-mentioned pBEp43-biobrick- built is inserted by Cloning Transformation In bgaB carriers, the use of restriction enzyme site is Kpn I and Xho I, is built into pBEp43-SP-bgaB carriers (such as Fig. 2).
(3) the pBEp43-SP-bgaB carriers built are passed through into electricity going to Bacillus subtillis B.subtilis ATCC6051, specific method is with reference to non-patent literature record (Natalia P, Zakataeva, Oksana V et al.A simple method to introduce marker-free genetic modification into chromosome of naturally nontransformable Bacillus amyloliquefaciens strains[J].Appl Microbiol Biotechnol.2010,85:1201-1209), cloned in resistant panel (the μ g/mL of kanamycins 20) Son.
(4) picked clones uses 96 orifice plate cultures, by determining β-glucose galactose glycosides enzyme enzyme activity, it is determined that secretion is excellent The clone of change.The measure of β-glucose galactose glycosides enzyme enzyme activity：By 32 μ L nutrient solutions and 288 μ L 0.25%ONPG (o- Nitrophenyl- β-D-Galactopyranoside, ortho-nitrophenyl β-D- synthesis) mix, incubated at 55 DEG C 15min, reaction terminating add 320 μ L (w/w) Na2CO3.Reaction is in chromogenic reaction, and light absorption value is determined under 405nm wavelength.
(5) secretion optimization clone is sequenced, determines whether signal peptide is changed.Screen and obtain by above-mentioned steps The signal peptide of beta galactosidase secretion effect can be improved, is the signal peptide of yocA genes, amino acid sequence after NCBI verifications For：MKKKRKGCFAAAGFMMIFVFVIA (SEQ ID NO.1), the nucleotides sequence for encoding the amino acid sequence is classified as： ATGAAGAAAAAGAGAAAAGGCT GTTTCGCTGCTGCGGGTTTTATGATGATTTTTGTCTTTGTCATCGCC(SEQID NO.2)。
The detection of the signal peptide expression of embodiment 2
(1) MTG (transglutaminase) extracellular expression plasmid is built：Patent document (is pressed with plasmid pBEp43-proMTG： The bacillus subtilis of the plant weight groups of the such as Pan Li mono- and its method .CN201210052578.2 [P] for producing transglutaminase .2012. build) be expression plasmid, the pBEp43-SPyocA-bgaB plasmids obtained using above-described embodiment 1 as template, primers F- SPyocA(5′-GAGAGGAATGTCGACATGAAGAAAAAGAGAAAAGGCTGTT-3′)、R-SPyocA(5′- CGTTGTCCATCTCGAGGGCGATGACAAAGACAAAAATCAT-3 ') amplification about 100bp SPyocA fragments (see Fig. 3).With In-fusion methods (concrete operation method is shown in the HiFi DNA Assembly Master Mix of NEBuilder companies) will be believed Number peptide (SPyocA fragments) and plasmid (pBEp43-proMTG) connection, structure obtain MTG and express extracellular plasmid pBEp43- SPyocA-proMTG (see Fig. 4).First converted with chemical transformation to Escherichia coli (E.coli JM110), obtain positive colony Son, extracts plasmid after sequencing, and the method for electricity consumption conversion is converted to bacillus subtilis B.subtilis ATCC6051.
(2) the transformant B.subtilis ATCC6051 (pBEp43-SPyocA-bgaB) and B.subtilis that will be obtained ATCC6051 (pBEp43-SPyocA-proMTG) is incubated in 10mL LB culture mediums (the μ g/mL of kanamycins 20), 37 DEG C, 200rpm activates 12h, and the seed liquor of activation is inoculated in 50mL LB culture mediums into (the μ g/mL of kanamycins 20,1% (w/w) Portugal Grape sugar) inoculum concentration be 1% (volume ratio), 37 DEG C, 200rpm always fermented 48h, every sampling in 6 hours.
(3) measure of β-glucose galactose glycosides enzyme enzyme activity：As a result β-glucose half of signal peptide SPyocA secretions is shown Lactoside expression of enzymes, for enzyme activity in 30~48h expression highest, wherein 36h reaches highest enzyme activity 5.76U/mL.
(4)SDS-PAGE：B.subtilis ATCC6051 (pBEp43-SPyocA-proMTG) have been cultivated to 36h hair Zymotic fluid centrifuging and taking supernatant, supernatant run SDS-PAGE electrophoresis, make with wild-type B. subtilis B.subtilis ATCC6051 For control, protein adhesive figure, which is shown in 44-46KDa, that band and MTG albumen are in the same size, and wild type control is in this magnitude range Interior no band, experimental result illustrate that MTG pepsinogens are expressed (see Fig. 5).Illustrate that SPyocA can be used as useful signal peptide to make For bacillus subtilis.
Above-described embodiment is the preferable embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment Limitation, other any Spirit Essences without departing from the present invention with made under principle change, modification, replacement, combine, simplification, Equivalent substitute mode is should be, is included within protection scope of the present invention.
Sequence table
<110>South China Science ＆ Engineering University
<120>A kind of signal peptide and its application that can be used for improving secernment efficiency
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 23
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<220>
<223>Signal peptide
<400> 1
Met Lys Lys Lys Arg Lys Gly Cys Phe Ala Ala Ala Gly Phe Met Met
1 5 10 15
Ile Phe Val Phe Val Ile Ala
20
<210> 2
<211> 69
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<220>
<223>The encoding gene of signal peptide
<400> 2
atgaagaaaa agagaaaagg ctgtttcgct gctgcgggtt ttatgatgat ttttgtcttt 60
gtcatcgcc 69
<210> 3
<211> 51
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
ggtaccatgg cgttcagcaa catgtctgcg caggctgcgg ccggtgcaca t 51
<210> 4
<211> 51
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
atggagctcg gatccgaatt caagcttgtc gacctgcagt ctagactcga g 51
<210> 5
<211> 102
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 5
ggtaccatgg cgttcagcaa catgtctgcg caggctgcgg ccggtgcaca tatggagctc 60
ggatccgaat tcaagcttgt cgacctgcag tctagactcg ag 102
<210> 6
<211> 40
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<220>
<223> f-spyoca
<400> 6
gagaggaatg tcgacatgaa gaaaaagaga aaaggctgtt 40
<210> 7
<211> 40
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<220>
<223> r-spyoca
<400> 7
cgttgtccat ctcgagggcg atgacaaaga caaaaatcat 40

Claims (9)

  1. A kind of 1. signal peptide that can be used for improving secernment efficiency, it is characterised in that：Its amino acid sequence such as SEQ ID NO.1 institutes Show.
  2. 2. encode the gene that can be used for improving the signal peptide of secernment efficiency described in claim 1, it is characterised in that its nucleotides Sequence is selected from following any sequence：
    (a) nucleotide sequence or its complementary series as shown in SEQ ID NO.2；
    (b) one or more nucleotides substitutions, missing or addition is carried out to the nucleotide sequence shown in SEQ ID NO.2 to be obtained , have and the nucleotide sequence identical shown in SEQ ID NO.2 is as the nucleotide sequence of signal peptide function or its is mutual Complementary series.
  3. 3. contain the recombinant expression carrier that can be used for improving the gene of the signal peptide of secernment efficiency described in claim 2, restructuring Genetic engineering bacterium, transgenic cell line or expression cassette.
  4. A kind of 4. recombination engineering bacteria, it is characterised in that：By the letter that can be used for improving secernment efficiency described in claim 2 The Gene Fusion of number peptide makes the N-terminal fusion of the albumen of the gene code after fusion have corresponding signal to the N-terminal for needing expressing gene Peptide.
  5. 5. recombination engineering bacteria according to claim 4, it is characterised in that：Described recombination engineering bacteria is secretion The genetic engineering bacterium that beta galactosidase ability improves, or be the genetic engineering bacterium that can secrete transglutaminase.
  6. 6. application of the signal peptide that can be used for improving secernment efficiency in protein secretion expression is improved described in claim 1.
  7. 7. application according to claim 6, it is characterised in that：Described albumen is thermostable beta-galactosidase or turns paddy ammonia Amidase.
  8. 8. application according to claim 6, it is characterised in that：Described protein secretion is expressed as in prokaryotic expression system Secreting, expressing.
  9. 9. application according to claim 6, it is characterised in that：Described protein secretion is expressed as in bacillus subtilis Secreting, expressing.
CN201710990135.0A 2017-10-23 2017-10-23 Signal peptide capable of improving secretion efficiency and application thereof Active CN107857801B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710990135.0A CN107857801B (en) 2017-10-23 2017-10-23 Signal peptide capable of improving secretion efficiency and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710990135.0A CN107857801B (en) 2017-10-23 2017-10-23 Signal peptide capable of improving secretion efficiency and application thereof

Publications (2)

Publication Number Publication Date
CN107857801A true CN107857801A (en) 2018-03-30
CN107857801B CN107857801B (en) 2020-09-22

Family

ID=61696185

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710990135.0A Active CN107857801B (en) 2017-10-23 2017-10-23 Signal peptide capable of improving secretion efficiency and application thereof

Country Status (1)

Country Link
CN (1) CN107857801B (en)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998029536A2 (en) * 1996-12-31 1998-07-09 Nexia Biotechnologies, Inc. Reversibly inactive synthetic beta-galactosidase
CN104342445A (en) * 2013-07-24 2015-02-11 中国科学院海洋研究所 Vector for efficiently secreting and expressing heterogenous protein, and its application
CN105255925A (en) * 2015-11-03 2016-01-20 天津科技大学 Efficient preparation method and gene engineering bacteria of sucrose isomerase
CN105601720A (en) * 2016-03-11 2016-05-25 南京工业大学 Signal peptide capable of effectively improving protein secretion expression efficiency and application thereof
CN106282221A (en) * 2016-08-16 2017-01-04 齐鲁工业大学 The construction method of a kind of secreting, expressing trehalose synthase gene engineering bacteria and application
CN107200772A (en) * 2017-05-10 2017-09-26 江西省科学院微生物研究所 A kind of signal peptide for optimizing keratinase Ker efficient secretory expressions and its application

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998029536A2 (en) * 1996-12-31 1998-07-09 Nexia Biotechnologies, Inc. Reversibly inactive synthetic beta-galactosidase
CN104342445A (en) * 2013-07-24 2015-02-11 中国科学院海洋研究所 Vector for efficiently secreting and expressing heterogenous protein, and its application
CN105255925A (en) * 2015-11-03 2016-01-20 天津科技大学 Efficient preparation method and gene engineering bacteria of sucrose isomerase
CN105601720A (en) * 2016-03-11 2016-05-25 南京工业大学 Signal peptide capable of effectively improving protein secretion expression efficiency and application thereof
CN106282221A (en) * 2016-08-16 2017-01-04 齐鲁工业大学 The construction method of a kind of secreting, expressing trehalose synthase gene engineering bacteria and application
CN107200772A (en) * 2017-05-10 2017-09-26 江西省科学院微生物研究所 A kind of signal peptide for optimizing keratinase Ker efficient secretory expressions and its application

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
XIN LIU 等: "Identification of strong promoters based on the transcriptome of Bacillus licheniformis", 《BIOTECHNOL LETT》 *
陈晓月 等: "β-半乳糖苷酶在枯草芽孢杆菌中的分泌表达", 《中国生物工程杂志》 *

Also Published As

Publication number Publication date
CN107857801B (en) 2020-09-22

Similar Documents

Publication Publication Date Title
CN107759675A (en) A kind of signal peptide and its application that secernment efficiency can be improved from bacillus subtilis
GB2133408A (en) Method for improving the production of proteins in bacillus
CN104611317B (en) A kind of method for improving L-ASP secreting, expressing
CN105601720B (en) Signal peptide capable of effectively improving protein secretion expression efficiency and application thereof
CN112522173B (en) Engineering bacterium for producing heterologous alkaline protease and construction method thereof
CN104402975B (en) Anti-aging small peptide and preparation method thereof
CN105950640A (en) Preparation method of marine bacteria-derived kappa-carrageenase gene and recombinase
CN107674119A (en) A kind of bacillus subtilis can effectively improve signal peptide and its application of secretion
CN107200772A (en) A kind of signal peptide for optimizing keratinase Ker efficient secretory expressions and its application
EP2206788A1 (en) Recombinant microorganism
CN107287229A (en) A kind of method of utilization bacillus efficient secretory expression foreign protein
CN107936096A (en) A kind of signal peptide that can effectively improve protein secretion efficiency and its application
CN104725517A (en) Method for enhancing target protein display quantity on yeast cell surface
CN107602707A (en) The dcas9 ω fusion proteins of one species specificity regulation bacillus subtilis exogenous gene expression and its application
CN110283797B (en) Tyrosinase, gene, engineering bacterium and preparation method thereof
CN105505931B (en) A kind of strong promoter and its application in raising Nattokinase expression
CN107698667A (en) A kind of bacillus subtilis can be used for signal peptide and its application for improving secernment efficiency
CN107698668A (en) A kind of bacillus subtilis can improve signal peptide and its application of secernment efficiency
CN107857801A (en) A kind of signal peptide and its application that can be used for improving secernment efficiency
CN112980753B (en) Glycoside hydrolase fusion expression system for secretion of exogenous proteins
CN107698670A (en) A kind of signal peptide for improving protein secretion efficiency and its application
CN107698666A (en) A kind of signal peptide for effectively improving secretion and its application
CN107857802A (en) A kind of bacillus subtilis can improve signal peptide and its application of secernment efficiency
EP1680502B1 (en) Recombinant microorganism
KR101530078B1 (en) Recombinant Vector and Recombinant Microorganism Comprising Chimeric kappa-Carrageenase Gene and Chimeric lamda-Carrageenase Gene

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant