CN107841556A

CN107841556A - A kind of kit and application based on C/EBP α and IGF1R genescreen medicine development toxicities

Info

Publication number: CN107841556A
Application number: CN201711378994.0A
Authority: CN
Inventors: 汪晖; 文印宪; 齐勇建; 何波; 王桂花
Original assignee: Wuhan University WHU
Current assignee: Wuhan University WHU
Priority date: 2017-12-19
Filing date: 2017-12-19
Publication date: 2018-03-27
Anticipated expiration: 2037-12-19
Also published as: CN107841556B

Abstract

The present invention relates to a kind of kit based on C/EBP α IGF1R genescreen medicine development toxicities and application.The kit includes the primer of detection C/EBP α and IGF1R gene mRNA expressions；The mammal cell line or noble cells of medicine effective object, and it is transfected into the cell cell line or noble cells after the plasmid containing IGF1R promoters and luciferase reporter gene；Cell pyrolysis liquid；Luciferase.The criterion of the kit is that C/EBP α gene expressions rise in Compound cellular to be screened, IGF1R gene expressions reduce and acted on the activity reduction of luciferase reporter gene in the cell of the reporter gene of promoter containing IGF1R, prompts compound to be screened to have development toxicity.It is novel, efficient, reliable that the kit has, and available for high-flux medicaments sifting, has the medicine of development toxicity and other compounds significant for quick detection.

Description

A kind of kit based on C/EBP α and IGF1R genescreen medicine development toxicities and Using

Technical field

The invention belongs to drug toxicology field, be related to it is a kind of based on C/EBP α and IGF1R genescreen medicines or other The kit of compound development toxicity and application.

Background technology

Medicine development toxicity (drug developmental toxicity) refers to that filial generation is in utero arrived caused by drug factors The structure or function infringement occurred before sexal maturity, including structural deformities, dysfunction, growth retardation are even dead.Medicine is developed Toxicity is one of important content of Drug safety assessment.The medicine development toxicity related guidance principle generally acknowledged in the world at present has 《Chemical 414-pregnancy period of the analyte detection guideline development toxicity research of OECD (OECD)》With《Drug registration refers to Lead file (ICH)》, main weighing apparatus of these guidelines all using whole animal reproduction experimental result as evaluation medicine development toxicity Figureofmerit, but have that animal dosage is big, experimental period is long, poor specificity, sensitivity is low, can not be illustrated from cell or molecular level The shortcomings of its mechanism.It is even former based on " 3R (reduction, refinement and replacement) " in recent years The medicine development toxicity in-vitro evaluation system then to grow up, such as Developmental toxicity, micelle cultivation and embryonic stem cell culture, There is also culture difficulty is big, cost is high, limited time or the low problem of Testing index specificity.

Intrauterine growth retardation (intrauterine growth retardation, IUGR) refer to the pregnancy period it is various it is bad because Embryo caused by element (fetus) grows limitation, it is main show multiple organ dysfunction maldevelopment, growth retardation and it is low go out raw body Weight, [1] is showed for most common development toxicity.The different manifestations of known drug development toxicity and medication time-histories are closely related.From After " reaction stops " event, the drug-induced teratism harm of pregnant early stage is paid much attention to by people.It is however, low to perinatal period dense Degree, the near, late injury caused by long-time medication and its mechanism not yet understand.According to statistics, IUGR global incidences are 2.75%-15.53%, China's incidence of disease are 3%-10%.IUGR can not only cause fetus at perinatal stage poverty-stricken, asphyxia neonatorum and Perinatal infants dead rate, it will be endangered after will also extending to birth, show as physique, intelligence development is backward, chronic disease neurological susceptibility of growing up Increase, or even there is intergenerational hereditary effect, the life quality of population is thus had a strong impact on, and bring a series of family and society Can problem [2,3].To sum up, there is larger limitation in medicine development toxicity in-vitro evaluation system, mainly be showed with medicine development toxicity Unclear and mechanism theoretical system shortage is relevant, therefore the high-throughput drug development toxicity based on toxic mechanism and molecular target In-vitro evaluation system waits to study.

My room early stage propose first in the world and system confirm the exposure of pregnancy period allogene caused by filial generation IUGR and its into Year metabolic syndrome susceptible " neuroendocrine metabolism programming mechanism " [4-6]；In the recent period it is further proposed that, Disease in Infants sugar cortical hormone A variety of tire tissues " programming of GC-IGF1 axles " caused by plain (glucocorticoid, GC) exposes excessively be probably its development toxicity (including In the recent period and toxicity at a specified future date) main mechanism [7,8].Known type-1 insulin like growth factor (insulin-like growth Factor 1, IGF1) it is a kind of Porcine HGF with Insulin-Like bioactivity, IGF1 can pass through IGF1 acceptors (insulin-like growth factor 1receptor, IGF1R) plays a role.IGF1R belongs to receptor tyrosine kinase (receptor tyrosine kinase) family member, mediation IGF1 and IGF2 mitogenesis effects.IGF1R is by two The different tetramer of α and two β subunits composition, wherein α subunits are primarily involved in ligand binding, and β subunits have tyrosine kinase activity. The IGF1R of phosphorylation can activate the multiple signal paths in downstream, participate in the forward and backward how histiocytic propagation of birth, differentiation, matrix conjunction Into and metabolic process.

Known GC can pass through GR and transcription factor CCAAT enhancer binding proteins (CCAAT enhancer binding Proteins, C/EBPs) interaction regulating cell propagation, differentiation and metabolic process [9].C/EBP α are that collaboration GC/GR is fast The important transcription factor of velocity modulation control downstream gene expression.Research finds that C/EBP α also function to key in regulation liver cell occurs Act on [10].There is liver structure disorder in the mouse that C/EBP α are knocked out and hypoglycemia causes neonatal death [11].C/EBP α can lead to Cross p21 and suppress cell propagation [12].Prompting, C/EBP α play a significant role in liver development.With we to C/EBP α- The research of IGF1R targets deepens continuously, and it is probably the key target of multi viscera development toxicity to find this target.

With the development of biotechnology, people constantly go deep into the understanding of tire source property disease, and one kind is with certain drug target Screening technique based on point, instead of traditional nonspecific method.And establish in cellular level and developed based on medicine The forecasting system of toxicity molecule mechanism, and the Large scale in vitro high flux screening of original new drug is carried out, human body or animal can be avoided The shortcomings of taking, be laborious of experiment.In addition, this vitro detection needs to establish a kind of easy detection method, as sensitivity compared with High luciferase reporter gene detection method.

Luciferase is preferable reporter gene, because being free of Intrinsic fluorescence element enzyme in mammalian cell, once turn Record is completed at once with regard to the luciferase of generating functionality.Luciferase can produces chemiluminescence oxidation generation oxyluciferin, glimmering In light element oxidizing process, bioluminescence can be sent.Luciferase assay for the detection of promoter activity provide one it is quick Sense, the quick, detection method of on-radiation, its principle are summarized as follows：1) specific fragment of target gene promoters is inserted into glimmering In front of light element expression of enzymes sequence, reporter plasmid is built；2) reporter plasmid built is transfected into cell；3) add Enter specific luciferase substrate, luciferase and substrate reactions, produce fluorescence, the intensity by detecting fluorescence can determine glimmering The activity of light element enzyme.

Bibliography：

[1]A.Imdad,M.Y.Yakoob,S.Siddiqui,Z.A.Bhutta,Screening and triage of intrauterine growth restriction(IUGR)in general population and high risk pregnancies:a systematic review with a focus on reduction of IUGR related stillbirths,BMC Public Health 11Suppl 3(2011)S1.

[2]P.R.Nielsen,P.B.Mortensen,C.Dalman,T.B.Henriksen,M.G.Pedersen, C.B.Pedersen,E.Agerbo,Fetal growth and schizophrenia:a nested case-control and case-sibling study,Schizophr.Bull.39(6)(2013)1337-42.

[3]M.V.Veenendaal,R.C.Painter,S.R.de Rooij,P.M.Bossuyt,J.A.van der Post,P.D.Gluckman,M.A.Hanson,T.J.Roseboom,Transgenerational effects of prenatal exposure to the 1944-45Dutch famine,BJOG 120(5)(2013)548-53.

[4]Y.Liu,D.Xu,J.Feng,H.Kou,G.Liang,H.Yu,X.He,B.Zhang,L.Chen, J.Magdalou,H.Wang,Fetal rat metabonome alteration by prenatal caffeine ingestion probably due to the increased circulatory glucocorticoid level and altered peripheral glucose and lipid metabolic pathways, Toxicol.Appl.Pharmacol.262(2)(2012)205-16.

[5]L.Liu,F.Liu,H.Kou,B.J.Zhang,D.Xu,B.Chen,L.B.Chen,J.Magdalou, H.Wang,Prenatal nicotine exposure induced a hypothalamic-pituitary-adrenal axis-associated neuroendocrine metabolic programmed alteration in intrauterine growth retardation offspring rats,Toxicol.Lett.214(3)(2012)307- 13.

[6]L.P.Xia,L.Shen,H.Kou,B.J.Zhang,L.Zhang,Y.Wu,X.J.Li,J.Xiong,Y.Yu, H.Wang,Prenatal ethanol exposure enhances the susceptibility to metabolic syndrome in offspring rats by HPA axis-associated neuroendocrine metabolic programming,Toxicol.Lett.226(1)(2014)98-105.

[7]L.Wang,L.Shen,J.Ping,L.Zhang,Z.Liu,Y.Wu,Y.Liu,H.Huang,L.Chen, H.Wang,Intrauterine metabolic programming alteration increased susceptibility to non-alcoholic adult fatty liver disease in prenatal caffeine-exposed rat offspring,Toxicol.Lett.224(3)(2014)311-8.

[8]L.Shen,Z.Liu,J.Gong,L.Zhang,L.Wang,J.Magdalou,L.Chen,H.Wang, Prenatal ethanol exposure programs an increased susceptibility of non- alcoholic fatty liver disease in female adult offspring rats, Toxicol.Appl.Pharmacol.274(2)(2014)263-73.

[9]M.Kadmiel,J.A.Cidlowski,Glucocorticoid receptor signaling in health and disease,Trends Pharmacol.Sci.34(9)(2013)518-30.

[10]H.Yuan,B.Wen,X.Liu,C.Gao,R.Yang,L.Wang,S.Chen,Z.Chen,H.de The, J.Zhou,J.Zhu,CCAAT/enhancer-binding protein alpha is required for hepatic outgrowth via the p53pathway in zebrafish,Sci Rep 5(2015)15838.

[11]N.D.Wang,M.J.Finegold,A.Bradley,C.N.Ou,S.V.Abdelsayed,M.D.Wilde, L.R.Taylor,D.R.Wilson,G.J.Darlington,Impaired energy homeostasis in C/EBP alpha knockout mice,Science 269(5227)(1995)1108-12.

[12]N.A.Timchenko,M.Wilde,M.Nakanishi,J.R.Smith,G.J.Darlington,CCAAT/ enhancer-binding protein alpha(C/EBP alpha)inhibits cell proliferation through the p21(WAF-1/CIP-1/SDI-1)protein,Genes Dev.10(7)(1996)804-15.

The content of the invention

In order to solve the problems, such as that prior art is present, the present invention provides a kind of based on the intracellular C/EBP α and IGF1R of detection Gene expression, and transfection have the detection intracellular luciferase of promoter containing IGFIR and luciferase reporter plasmid active Screen medicine or the method for other compound development toxicities.This method have efficiently, it is reliable, available for high-flux medicaments sifting, Have the medicine of development toxicity or other compounds significant for quick detection.

To achieve the above object, the present invention adopts the following technical scheme that：

The first aspect of the present invention, there is provided one kind is sent out based on C/EBP α and IGF1R genetic test medicines or other compounds The kit of toxicity is educated, the kit includes the primer of detection C/EBP α and IGF1R gene mRNA expressions；Medicine effective object Mammal cell line or noble cells, and be transfected into the cell containing IGFIR promoters and luciferase reporting base Cell line or noble cells after the plasmid of cause；Cell pyrolysis liquid；Luciferase.

Preferably, the sequence such as SEQ ID NO of the primer pair for C/EBP α：Shown in 1-2, for drawing for C/EBP α The sequence of thing pair such as SEQ ID NO：Shown in 3-4；Plasmid containing IGFIR promoters and luciferase reporter gene is GV238 Carrier passes through MluI/BglII digestions, the sequence of the promoter containing IGFIR is inserted, the sequence such as SEQ ID NO:Shown in 5, GV238 carriers are purchased from Shanghai JiKai Gene Chemical Technology Co., Ltd.

Preferably, the criterion of the kit is that medicine to be screened or other compound treatment groups are same relative to control group When meet following 3 indexs：A) C/EBP α gene expressions rise in medicine to be screened or other Compound cellulars；B) IGF1R bases Because expression reduces；C) activity of luciferase reporter gene is reduced in the cell of promoter containing IGF1R-reporter gene, and prompting is treated Screening medicine or other compounds have development toxicity.

The second aspect of the present invention provides application of the mentioned reagent box in detection medicine or other compound development toxicities, Step is：

1) by cell line or noble cells with 5 × 10⁵Individual/hole is inoculated in 6 orifice plates of the complete medium containing 10% serum In, 37 DEG C, 5%CO₂Saturation incubator culture；

2) medicine to be screened or other compounds are chosen, the solution of 1nM~1M concentration are first dissolved as according to its characteristic, so The medicine dissolved or other compounds are added in the cell of step 1) culture by respective concentration gradient afterwards, set simultaneously Control group, handle 24h；

3) after pending end, the cell culture medium in each hole is discarded, then, is then added per hole with PBS once Trizol 500-1000 μ l are used for the extracting of cell total rna；

4) 200 μ l chloroforms are added in the EP pipes for adding Trizol, acutely shakes 30s, 12000rpm centrifugation 15min, inhale Upper strata supernatant is taken, adds isometric isopropanol, overturns and mixes, stands 10min, 12000rpm centrifugation 10min, supernatant discarding Liquid；Cleaned twice with 75% pre-cooled ethanol, to remove deionization or salt, RNA concentration and purity are detected on photometer, is reversed Record PCR reactions, detection C/EBP α and IGF1R mRNA expression；

5) selection has transfected the cell line or noble cells of the step 1) of promoter containing IGF1R-luciferase reporter gene With 5 × 10⁵Individual/hole is inoculated in 6 orifice plates of the complete medium containing 10% serum, 37 DEG C, 5%CO₂Saturation incubator culture；

6) medicine to be screened or other compounds are chosen, the solution of 1nM-1M concentration are first dissolved as according to its characteristic, so The medicine dissolved or other compounds are added in the cell of step 5) culture by respective concentration gradient afterwards, set simultaneously Control group, handle 24h；

7) after pending end, the cell culture medium in each hole is discarded, then, adds 200-500 μ l cells with PBS once Lysate is used for the detection of luciferase reporter gene；

8) cell lysis is fully blown and beaten, cell fragment and liquid are transferred in centrifuge tube, 12000rpm centrifugations 5min；Take Supernatant adds luciferase and mixes and make its reaction, is detected by fluophotometer；

9) according to step 4) and the testing result of step 8), medicine to be screened or other compound treatment groups are relative to control Group meets following 3 indexs simultaneously：A) C/EBP α gene expressions rise in medicine to be screened or other Compound cellulars；b) IGF1R gene expressions reduce；C) activity of luciferase reporter gene reduces in the cell of promoter containing IGF1R-reporter gene, Prompt medicine to be screened or other compounds that there is development toxicity.

Preferably, medicine to be screened or other compounds be synthesis compound, it is natural products, organic molecule, inorganic small Molecule, lipid, the one or more of carbohydrate.

Preferably, the kit of described C/EBP α and IGF1R genetic test medicines or other compound development toxicities exists Application in medicine or other compounds of the high flux detection with development toxicity.

Compared with prior art, the present invention has technical benefits beneficial below：

1. the advantage with reliability, adaptability and stability；

2. utilize luciferase reporter gene, more directly, high sensitivity；

3. have a wide range of application；

4. detection process is quick, available for high flux screening.

Brief description of the drawings

Fig. 1 .GV238 carrier informations.

Fig. 2 .IGF1R digestion result electrophoretograms.1#:Carrier digestion products；2#:10kb Marker (band from top to bottom according to It is secondary to be：5kb、3kb、2kb、1.5kb、1kb、750bp、500bp、250bp、100bp).

Fig. 3 .PCR identify the electrophoretogram of recombinant clone.1#：Negative control (ddH2O)；2#：Negative control is (unloaded from connecting pair According to group)；3#：Positive control (GAPDH)；4#：Marker be followed successively by from top to bottom 5kb, 3kb, 2kb, 1.5kb, 1Kb, 750bp, 500bp、250bp、100bp；5-12#：IGF1R 1-8 transformants.

Fig. 4 are given after methimazole after detection process L02 cells and WJ-MSC noble cells 24h, and detection C/EBP α- IGF1R PCR results.A:The C/EBP α mRNA expression of methimazole processing L02 cells；B:WJ-MSCs points of methimazole processing Change the C/EBP α mRNA expression of cell；C:The IGF1R mRNA expression of methimazole processing L02 cells；B:Methimazole processing WJ-MSCs noble cells IGF1R mRNA are expressed.Compared with control group,^*P<0.05,^**P<0.01。

After Fig. 5 handle L02 cells and WJ-MSCs noble cells 24h with various concentrations methimazole, detect glimmering in cell Light element enzymatic activity.A:The IGF1R of methimazole processing L02 cells uciferase activity；B:WJ-MSCs points of methimazole processing Change the IGF1R of cell uciferase activity.Compared with control group,^*P<0.05,^**P<0.01。

Embodiment

By combination accompanying drawing described further below it will be further appreciated that the features and advantages of the invention.The implementation provided Example is only explanation to the inventive method, remaining content without limiting the invention in any way announcement.

【Embodiment 1】

A kind of kit based on C/EBP α and IGF1R genetic test medicine development toxicities is right in L02 cell line models The effect of development toxicity medicine methimazole.

The kit be by detecting intracellular C/EBP α and IGF1R gene expressions, while detect promoter containing IGFIR with it is glimmering The uciferase activity of light element enzyme reporter gene is formed.It is above-mentioned based on C/EBP α and IGF1R genetic test medicine development toxicities Kit is to the applying step of development toxicity medicine methimazole in L02 cell line models：

1 prepares people's tire L02 cells

1.1 take out cell cryopreservation tube from liquid nitrogen container, are put into rapidly in 37 DEG C of water-baths, and shaking frequently makes it solve as early as possible Freeze.

After 1.2 thaw completely, 1300rpm, 3min is centrifuged, after the sterilization of 75% alcohol wipe cryopreservation tube, moves to bio-safety Cabinet.

1.3 suck frozen stock solution supernatant, add fresh complete 1640 culture mediums of 1mL and cell is resuspended, by cell suspension inoculation To in the 6cm dish containing 3mL complete mediums, gently shake it is even after be placed in 37 DEG C, 5%CO₂Incubator.

It is cultivated for after 1.4 nutrient solutions of replacing.

The cell that 1.5 growths 90% converge carries out Secondary Culture.Complete 1640 culture medium is made cell and hanged after pancreatin digestion Liquid is divided into two new 6cm dish, supplies complete medium to 4mL, continues to cultivate.

1.6 are added to the methimazole dissolved in the cell of step (5) culture by 0,0.8,4,20nM concentration gradients, Then 24h is handled.

After 1.7 pending end, the cell culture medium in each hole is discarded, then, is then added per hole with PBS once The μ l of Trizol 200 are used for the extracting of cell total rna.

2. specific primer design is with preparing

Utilize Primer Premier 5.0 and the design of NCBI Blast databases and checking primer.Design primer sequence Afterwards, Sangon Biotech (Shanghai) Co., Ltd. is transferred to synthesize, and PAGE is purified.By the EP equipped with new synthetic primer Pipe 7500g is centrifuged 10 minutes, adds the molecular biology ultra-pure water of tube wall subscript injection body product, and concussion mixes standby.This part institute 2-1 is shown in Table with primer information.In addition, the specificity of detection primer is needed before the primer use first of new design synthesis.According to RT- PCR steps, establish fluorescence real-time quantitative PCR reaction system, material and side of the operating method referring to the Part I of this paper texts Method part.PCR reaction conditions are set on ABI StepOne Plus fluorescence real-time quantitative PCR instrument.After all reactions terminate, The solubility curve that software transferred and observed PCR primer is carried using system.According to appearance time of the PCR primer in solubility curve Judge the specificity of primer and with the presence or absence of primer dimer with peak area.

Table 1RT-PCR sequences

3. the structure of promoter containing IGF1R-reporter plasmid

Promoter containing IGF1R-reporter plasmid is built by Shanghai JiKai Gene Chemical Technology Co., Ltd, and step is such as Under：

The acquisition of 3.1 target gene fragments

Using the primer-design softwares of primer premier 5.0 design IGF1R promoter primers, using human genome as Template enters performing PCR, and amplification obtains purpose fragment, and the nucleotides sequence that this section includes promoter is classified as：

ACGCGTTTCTAATAAATTTATTTCACTGTTAAATCTAGGAACATCCAAAACTGAAACTCTTTATTTAAA AATCAAGCTGAATTTCAGTTAAACAAAACCATCCCATCATATGAATAACTTTCTTAGGTAAAACAAGGTTTATTTTC TTTCTATACAACTGACTCTGAATTGAGCTAGAAATTTCCAAGGAGGAAAATGATCTAGGAAACAACTTTAGAAAAAA AGGGCTAAGTTTCCGTTATGATAGCTTTTGACTTGTTTTCAGCTCTTAAAAAATTATTTACGAACGATGGATACACG TTCTAATGCAGAAGTATTTTAGAATTAGAGAGTAAAAGAAACCTACTACCTTCCTTTACATCAGGTCCCTTCTACCA TCCTACCCGATTGTTTGAGACAACCACTTCTTATCTCGACAATTCACAACTCTTTTATTAGCTATCTTAAAAAAATT TATTACTGGCATCAATTAGCCTGAGTCATGAAACCGGACCACATTAAGGGCGACACATGGTCCAATCACTGTTTGTA AAAGTCCACGTATTTCAAACTCCTCTCTCCTGCCACTGCTGGGCTGTTTCCCTCTTTGAGGACCTGGTCTCCGCAGC ATTTATTCATTAGATGGCAGTCCTAGGGGAGTCTCGCTTTGGGGAAACCTCTCCTCCTGCACATTCAAGAAAACAAC CGCGGAGACTTAGGGTCGGTACTGGTTTCCAGTCACTTACGTAGCAAACGAAGCAAGAGGAACGTGCCTGGGAGGAC CCGAGACAGGTGCGGGTGGGTTTCCGCAGTAGCCGCTGATCCCGAGTGCATGCGGCGTGTTCCCGGGTCGGGACCGC GGCCAAGGGAGGCTTCCCGGCCCCAGCCTCCACCCCCTCCTCGGCGCCCCGGGACCCGGACACGCCCCCCGAGCTTC GGAGACCCGCAGCGTGCACGCGCCCCGGCCGCTCCCCGCAGCCGCCCACGTGGTGGAGCCCTGAGCTGCGCGAGGCC GCGGAGAGCGCTCAGGGCGGGCGGCTGGTCCGGGAGGCCACGCCAGCGCGACCCAGCCGAGTCGGCCCCCAGCCCGG GCCCCCACATTTCCTCCCCCGGAGGGAGGGAGGCGACTCTCCGCGGGCTGCCCTCCCCAGCGCCCGCCGCGCCCTCT GGCGGCCGCCGCGGGGACGCGCCCGGGGCACGCGGCGCTGCCTGTCTGGGCCCCCCTTCCGGGGCGCGGGGCCCGCG AGGGGCGGCGGGGTCCTCTCTCCTCGAGCCACTCTGGGCCGAGCCACACGGGCCGCGCCCTTCCCCCTCCGCTCCCC CTGAGCCCCCAAACTCCGGGCTCCACGGTCGCAACGCCGCGGGCACCCCAGCCTGGCGTGAAAGTGCCCGGCGTAGT AGCCTGGGGGGGGGGTCCCCTTTCTCCCAGGTGCGCCCCTTCCGCCACGTTCGGGCTTTCCAGTACGCAGCGAAAAA AATGCCGCATGCACGCATTTATTTATTTTGCAACAGCTGCAAGAAACAATGAAGCTTTTCAAGAACCGGGGAAACGC GCTTTCCAGCCGCGCTGTTGTTGTTTTCAATGAACCTCTCCCAGCCCCGCACTCCCCGCCCACCCCTCCCCTCTCCT GCCCACCCCTCCCCTGCCTAGCCTTTCCCTGGCTACCCACCCCTGCCCCGCCGAGACCGGACCGGCGGCGGGGGCAT TGTTTTTGGAGTCGGGCGGGAGGGGAGGGCGCGTGCGGGGTGGCCGGCGCAGTGCGGTGGGGGCGGGAGCGGGTGGG CACGCGCGCGTGTCTCTGTGTGCGCGCGGGAGGCGGTGGGGCGGGAGATGGGGGCGGCGCCTCGCAGTCTCGCGCCC CACGCCCGGGCTCCGCTCCGCACGTCTTGGGGAACCGGGCTCCGGTTTTTTGCGCGCGCCGGCCTGGGCCGGGCCCT CGGCGCGCCGCTGCTGCGGCGGTGGCCGCTCGAGTGTGCGAGCGGGCGCGTGTGCGCGGGCCAGGGCGCGCGCGCGC GCGCGAGCCCCCAGTGTGTGGCAGCGGCGGCGGCGGCGCGGCGAGGCTGGGGCTCTTGTTTACCAGCATTAACTCCG CTGAGCGGAAAAAAAAAGGGAAAAAACCCGAGGAGGAGCGAGCGCACCAGGCGAACTCGAGAGAGGCGGGAGAGCGA GAGGGACAGATCT

3.2 use the plasmid containing target gene of MluI/BglII digestion chemical syntheses

Endonuclease reaction system：

ddH₂O	40.5μl
		10X buffer	5μl
100×BSA	0.5μl
		The DNA plasmid (1ug/ μ l) of purifying	2μl
MluI(20U/μl)	1μl
		BglII(20U/μl)	1μl
Total	50μl

The plasmid of purifying is GV238 carriers, purchased from Shanghai JiKai Gene Chemical Technology Co., Ltd.By the anti-of above-mentioned mixing Thing is answered to be placed in 37 DEG C, 2h.Endonuclease bamhi size is 2151bp, and restriction enzyme digestion and electrophoresis figure is shown in Fig. 2.

The structure of 3.3 recombinant plasmids

PCR primer is connected into linearisation expression vector, by preparing competent cell, conversion, then PCR identifications conversion Son, positive transformant PCR primer size are 826, and electrophoretogram is shown in Fig. 3.

PCR identifies primer：

ID	seq
		KL9220-P3	ACAATGAAGCTTTTCAAGAAC
GLprimer2	CTTTATGTTTTTGGCGTCTTCCA

3.4 positive colony sequencing results and interpretation of result

4. aim cell plasmid transfection

Cell suspension is made in the cell of 4.1 exponential phases, counts, is inoculated in 6-well culture plates that (cell number is about 5 ×10⁵), 37 DEG C, 5%CO₂Incubator culture.

4.2 according to cell transfecting preliminary experiment and the transfection reagent operation instructions of invitrogen lipofectamine 2000 Book designs, and adds the plasmid and transfection reagent of Sq.

Cell state is observed after 4.3 4-6h, is replaced by fresh complete medium.Observed after transfecting 24-48h on plasmid The expression of fluorescent marker gene, fluorescence rate are more than 80%.

5. the L02 cells of the reporter gene of promoter containing IGF1R of methimazole processing transfection

The promoter containing IGF1R that the methimazole dissolved is added into transfection by 0,0.8,4,20nM concentration gradients is reported In the L02 cells of gene, 24h is then handled.After pending end, the cell culture medium in each hole is discarded, then with PBS one It is secondary, the detection that 200-500 μ l cell pyrolysis liquids are used for luciferase reporter gene is then added per hole.

6. luciferase assays

Fully piping and druming cell lysis, cell fragment and liquid are transferred in centrifuge tube, 12000rpm centrifugations 5min；Take Clear liquid adds luciferase and mixes and make its reaction, is detected by fluophotometer, data collection and analysis.

7. experimental result

7.1 structure IGF1R luciferase reporter genes

The carrier built is subjected to digestion rear electrophoresis, it is seen that IGF1R digestion products have strong positive expression near 2kb (Fig. 2).PCR shows, IGF1R positive transformant PCR primers between 750bp~1Kb (Fig. 3), meanwhile, sequencing result shows sequence Row compare consistent for 100% with GenBank.Prompting, the product of recombinant clone is IGF1R.

The influence that 7.2 methimazoles are expressed C/EBP α and IGF1R mRNA

Compared with control group, methimazole can concentration dependent increase C/EBP α mRNA expression (P<0.01, Fig. 4 A), drop Low IGF1R mRNA express (P<0.05, Fig. 4 C), wherein the most obvious with 20nM methimazoles.Prompting, methimazole can increase C/EBP α expression and reduction IGF1R expression.

Influence of 7.3 methimazoles to IGF1R uciferase activities

Compared with control group, methimazole can concentration dependent reduction IGF1R luciferases expression (P<0.05 or P< 0.01, Fig. 5 A), it is the most obvious with 20nM methimazoles.Prompting, methimazole can suppress IGF1R uciferase activities.

【Embodiment 2】

A kind of kit based on C/EBP α and IGF1R genetic test medicine development toxicities is in WJ-MSCs into hepatoid differentiation To the effect of development toxicity medicine methimazole in cell model.

Primary extractions of 1.WJ-MSCs and into hepatoid differentiation

The primary extractions of 1.1WJ-MSCs

Cesarean esction fetal cord is taken under operating room aseptic condition, band in the physiological saline of precooling is soaked in after cleaning blood Go back to laboratory.Umbilical cord is taken out in superclean bench, all separation processes are carried out in the physiological saline of precooling.Be cut into it is long by 4~ 6cm/ sections, blood is removed with irrigation with syringe.Umbilical cord outer membrane, arteria umbilicalis, umbilical vein are removed, peels off Wharton glue：First by umbilical cord Both ends are fixed on plank with tack, are entrance from one end, eye scissors longitudinal dissociation outer membrane, are cut off in separation, then will One end both sides are completely separated into outer membrane, outer membrane and Wharton glue is clamped respectively with two haemostatic clamp, firmly tears, you can be complete Outer membrane is separated, then carefully separates arteriovenous.Wharton glue is torn into slice as far as possible, is transferred to phial.Slice is transferred to Washed repeatedly in culture dish equipped with PBS, then be transferred to phial again, shredded with eye scissors to 1 × 1 × 1mm³Size tissue Block is more broken better.Umbilical cord tissue is shredded into meat gruel shape, is transferred in 50mL centrifuge tubes, 40mL digestive juices is added and (contains 40mL DMEM/F12 1:1 culture medium+80mg clostridiopetidase As I (2mg/mL), sealed membrane is sealed, 37 DEG C of water-baths digestion about 4h of mixing (or 37 In DEG C temperature control shaking table), per half an hour, vibration is once.After digestion completely, add 250mL PBS liquid and blow and beat dilution repeatedly.2500rpm Centrifuge 8min (or 3000rpm centrifugations 3min) and collect cell.The position of the heavy wall of cell, side are marked with marking pen on centrifuge tube Just accurate piping and druming, resuspension.Supernatant can centrifuge again, can still obtain cell；Supernatant and the adipose tissue of floating are abandoned, adds and contains Cell suspension is made in the DMEM/F-12 complete mediums about 4mL of 10% hyclone and 1ng/mL bFGF, piping and druming；And use cell Tally counts cell quantity under inverted microscope.Put 37 DEG C, 5%CO₂, cultivate in 95% humidified incubator.Observation is thin daily Born of the same parents' adherent growth situation, it is the cell of visible adherent growth after 3 days.

1.2WJ-MSC is into hepatoid differentiation

The inductive differentiation medium that this experiment uses for IMDM nutrient solutions in contain：1% hyclone, 1% mycillin, HGF 40ng/ml、FGF-4 10ng/ml.Specifically implementation steps are：The mesenchyma for taking the growth conditions in generation in 3 generation -5 good is done Cell, with 1 × 10⁵The cell density of cells/well is inoculated in 6 holes or 1 × 10⁴The cell density of cells/well is inoculated in the culture of 24 holes In plate, growth medium is added, cellar culture, when cell density reaches 70%, removes growth medium, PBS is washed, and adds liver Cell induction differentiation liquid induction differentiation, changes liquid once in every 3 days, induction differentiation 14 days during induction differentiation.

2. methimazole handles WJ-MSCs into hepatoid differentiation cell

2.1 are added to the methimazole dissolved by 0,0.8,4,20nM concentration gradients in the cell of the above-mentioned culture of step In, then handle 24h.

After 2.2 pending end, the cell culture medium in each hole is discarded, then with cell of PBS, then added per hole The μ l of Trizol 200 are used for the extracting of cell total rna.

Plasmid transfection is entered to break up 14 days by the structure of 2.3 promoters containing IGF1R-reporter plasmid with embodiment 1 WJ-MSCs into hepatoid differentiation cell, the WJ-MSCs of methimazole processing promoter containing IGF1R-reporter gene of various concentrations into Hepatic lineage 24h, after processing terminates, the cell culture medium in each hole is discarded, then, 200- is then added per hole with PBS once 500 μ l cell pyrolysis liquids are used for the detection of luciferase reporter gene.

2.4RT-PCR detection C/EBP α and IGF1R mRNA expression, luciferase reporter gene detection IGF1R luciferases Activity.

3. experimental result

The influence that 3.1 methimazoles are expressed C/EBP α and IGF1R mRNA

Compared with control group, methimazole can concentration dependent increase C/EBP α mRNA expression (P<0.05, P<0.01, Fig. 4 B), concentration dependent reduces IGF1R mRNA expression (P<0.05, Fig. 4 D), wherein the most obvious with 20nM methimazoles.Carry Show, methimazole can increase C/EBP α expression and reduce IGF1R expression.

Influence of 3.2 methimazoles to IGF1R uciferase activities

Compared with control group, methimazole can concentration dependent reduction IGF1R luciferases expression (P<0.05 or P< 0.01, Fig. 5 B), it is the most obvious with 20nM methimazoles.Prompting, methimazole can suppress IGF1R luciferase expressions.

To sum up, the present invention gives various concentrations chemical combination to be screened in L02 cell lines and WJ-MSCs noble cells models Thing (such as methimazole), detects intracellular C/EBP α, IGF1R mRNA expression and detection contains IGFIR promoters and luciferase The uciferase activity of reporter gene, compound such as to be sieved can increase C/EBP α mRNA expression, reduce IGF1R mRNA expression and The activity of luciferase.Prompting, compound to be screened have development toxicity.

It is novel, efficient, reliable that the medicament sifting motion system that the present invention is established has, right available for high-flux medicaments sifting It is significant in medicine of the detection with development toxicity and compound.

Obviously, the content according to the invention described above, according to the ordinary technical knowledge and customary means of this area, is not being departed from Under the premise of the above-mentioned basic fundamental thought of the present invention, the modification, replacement or change of other diversified forms can also be made.

Sequence table

<110>Wuhan University

<120>A kind of kit and application based on C/EBP α and IGF1R genescreen medicine development toxicities

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 1

ttggtgcgtc taagatgagg 20

<210> 2

<211> 18

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 2

ttggagcggt gagtttgc 18

<210> 3

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 3

cacaggcaca caggtctcat 20

<210> 4

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 4

cccatggcca ccagattctt 20

<210> 5

<211> 2161

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 5

acgcgtttct aataaattta tttcactgtt aaatctagga acatccaaaa ctgaaactct 60

ttatttaaaa atcaagctga atttcagtta aacaaaacca tcccatcata tgaataactt 120

tcttaggtaa aacaaggttt attttctttc tatacaactg actctgaatt gagctagaaa 180

tttccaagga ggaaaatgat ctaggaaaca actttagaaa aaaagggcta agtttccgtt 240

atgatagctt ttgacttgtt ttcagctctt aaaaaattat ttacgaacga tggatacacg 300

ttctaatgca gaagtatttt agaattagag agtaaaagaa acctactacc ttcctttaca 360

tcaggtccct tctaccatcc tacccgattg tttgagacaa ccacttctta tctcgacaat 420

tcacaactct tttattagct atcttaaaaa aatttattac tggcatcaat tagcctgagt 480

catgaaaccg gaccacatta agggcgacac atggtccaat cactgtttgt aaaagtccac 540

gtatttcaaa ctcctctctc ctgccactgc tgggctgttt ccctctttga ggacctggtc 600

tccgcagcat ttattcatta gatggcagtc ctaggggagt ctcgctttgg ggaaacctct 660

cctcctgcac attcaagaaa acaaccgcgg agacttaggg tcggtactgg tttccagtca 720

cttacgtagc aaacgaagca agaggaacgt gcctgggagg acccgagaca ggtgcgggtg 780

ggtttccgca gtagccgctg atcccgagtg catgcggcgt gttcccgggt cgggaccgcg 840

gccaagggag gcttcccggc cccagcctcc accccctcct cggcgccccg ggacccggac 900

acgccccccg agcttcggag acccgcagcg tgcacgcgcc ccggccgctc cccgcagccg 960

cccacgtggt ggagccctga gctgcgcgag gccgcggaga gcgctcaggg cgggcggctg 1020

gtccgggagg ccacgccagc gcgacccagc cgagtcggcc cccagcccgg gcccccacat 1080

ttcctccccc ggagggaggg aggcgactct ccgcgggctg ccctccccag cgcccgccgc 1140

gccctctggc ggccgccgcg gggacgcgcc cggggcacgc ggcgctgcct gtctgggccc 1200

cccttccggg gcgcggggcc cgcgaggggc ggcggggtcc tctctcctcg agccactctg 1260

ggccgagcca cacgggccgc gcccttcccc ctccgctccc cctgagcccc caaactccgg 1320

gctccacggt cgcaacgccg cgggcacccc agcctggcgt gaaagtgccc ggcgtagtag 1380

cctggggggg gggtcccctt tctcccaggt gcgccccttc cgccacgttc gggctttcca 1440

gtacgcagcg aaaaaaatgc cgcatgcacg catttattta ttttgcaaca gctgcaagaa 1500

acaatgaagc ttttcaagaa ccggggaaac gcgctttcca gccgcgctgt tgttgttttc 1560

aatgaacctc tcccagcccc gcactccccg cccacccctc ccctctcctg cccacccctc 1620

ccctgcctag cctttccctg gctacccacc cctgccccgc cgagaccgga ccggcggcgg 1680

gggcattgtt tttggagtcg ggcgggaggg gagggcgcgt gcggggtggc cggcgcagtg 1740

cggtgggggc gggagcgggt gggcacgcgc gcgtgtctct gtgtgcgcgc gggaggcggt 1800

ggggcgggag atgggggcgg cgcctcgcag tctcgcgccc cacgcccggg ctccgctccg 1860

cacgtcttgg ggaaccgggc tccggttttt tgcgcgcgcc ggcctgggcc gggccctcgg 1920

cgcgccgctg ctgcggcggt ggccgctcga gtgtgcgagc gggcgcgtgt gcgcgggcca 1980

gggcgcgcgc gcgcgcgcga gcccccagtg tgtggcagcg gcggcggcgg cgcggcgagg 2040

ctggggctct tgtttaccag cattaactcc gctgagcgga aaaaaaaagg gaaaaaaccc 2100

gaggaggagc gagcgcacca ggcgaactcg agagaggcgg gagagcgaga gggacagatc 2160

t 2161

<210> 6

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 6

gcaagagcac aagaggaaga 20

<210> 7

<211> 21

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 7

ggttgagcac agggtacttt a 21

Claims

1. a kind of kit based on C/EBP α and IGF1R genetic test medicines or other compound development toxicities, its feature exist In the kit includes the primer of detection C/EBP α and IGF1R gene mRNA expressions；Medicine or other compound effects objects Mammal cell line or noble cells, and be transfected into the cell containing IGFIR promoters and luciferase reporting base Cell line or noble cells after the plasmid of cause；Cell pyrolysis liquid；Luciferase.

2. kit according to claim 1, it is characterised in that the sequence such as SEQ of the primer pair for C/EBP α ID NO:Shown in 1-2, for the sequence such as SEQ ID NO of IGF1R primer pair:Shown in 3-4；Containing IGFIR promoters with it is glimmering The plasmid of light element enzyme reporter gene is that GV238 carriers pass through MluI/BglII digestions, and the sequence of the promoter containing IGFIR is inserted, The sequence such as SEQ ID NO:Shown in 5, GV238 carriers are purchased from Shanghai JiKai Gene Chemical Technology Co., Ltd.

3. kit according to claim 1 or 2, it is characterised in that described medicine or other compounds are synthesisization Compound, natural products, organic molecule, inorganic molecules, lipid, the one or more of carbohydrate.

4. kit according to claim 1 or 2, it is characterised in that the criterion of the kit is medicine to be screened Or other compound treatment groups meet following 3 indexs relative to control group simultaneously：A) medicine to be screened or other compounds are thin Intracellular C/EBP α gene expressions raise, b) IGF1R gene expressions reduce, c) promoter containing IGF1R-reporter gene cell in it is glimmering The activity reduction of light element enzyme reporter gene, prompts medicine to be screened or other compounds to have development toxicity.

5. application of the kit in detection medicine or other compound development toxicities described in claim 1 or 2, its feature exist In step is as follows：

1) by cell line or noble cells with 5 × 10⁵Individual/hole is inoculated in 6 orifice plates of the complete medium containing 10% serum, and 37 DEG C, 5%CO₂Saturation incubator culture；

2) medicine to be screened or other compounds are chosen, the solution of 1nM-1M concentration is first dissolved as according to its characteristic, then will The medicine dissolved or other compounds are added to by respective concentration gradient in the cell of step 1) culture, while set control Group, handle 24h；

3) after pending end, the cell culture medium in each hole is discarded, then, Trizol is then added per hole with PBS once 500-1000 μ l are used for the extracting of cell total rna；

4) 200 μ l chloroforms are added in the EP pipes for adding Trizol, acutely shakes 30s, 12000rpm centrifugation 15min, in absorption Layer supernatant, adds isometric isopropanol, overturns and mixes, and stands 10min, 12000rpm centrifugation 10min, abandoning supernatant；With 75% pre-cooled ethanol is cleaned twice, and to remove deionization or salt, RNA concentration and purity are detected on photometer, carries out reverse transcription PCR Reaction, detection C/EBP α and IGF1R mRNA expression；

5) selection transfected the step 1) of promoter containing IGF1R-luciferase reporter gene cell line or noble cells with 5 × 10⁵Individual/hole is inoculated in 6 orifice plates of the complete medium containing 10% serum, 37 DEG C, 5%CO₂Saturation incubator culture；

6) medicine to be screened or other compounds are chosen, the solution of 1nM-1M concentration is first dissolved as according to its characteristic, then will The medicine dissolved or other compounds are added to by respective concentration gradient in the cell of step 5) culture, while set control Group, handle 24h；

7) after pending end, the cell culture medium in each hole is discarded, then, adds the cracking of 200-500 μ l cells with PBS once Liquid is used for the detection of luciferase reporter gene；

8) cell lysis is fully blown and beaten, cell fragment and liquid are transferred in centrifuge tube, 12000rpm centrifugations 5min；Take supernatant Liquid adds luciferase and mixes and make its reaction, is detected by fluophotometer；

9) it is same relative to control group according to step 4) and the testing result of step 8), medicine to be screened or other compound treatment groups When meet following 3 indexs：A) medicine to be screened or other compounds handle intracellular C/EBP α gene expressions rise, b) IGF1R gene expressions reduce, c) promoter containing IGF1R-reporter gene cell in luciferase reporter gene activity reduction, Prompt medicine to be screened or other compounds that there is development toxicity.

6. the kit of C/EBP α and IGF1R the genetic test medicines or other compound development toxicities described in claim 1 or 2 Application in medicine of the high flux detection with development toxicity or other compounds.