CN107841556B - Kit for screening drug developmental toxicity based on C/EBP alpha and IGF1R genes and application - Google Patents
Kit for screening drug developmental toxicity based on C/EBP alpha and IGF1R genes and application Download PDFInfo
- Publication number
- CN107841556B CN107841556B CN201711378994.0A CN201711378994A CN107841556B CN 107841556 B CN107841556 B CN 107841556B CN 201711378994 A CN201711378994 A CN 201711378994A CN 107841556 B CN107841556 B CN 107841556B
- Authority
- CN
- China
- Prior art keywords
- igf1r
- cell
- promoter
- methimazole
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/66—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving luciferase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/142—Toxicological screening, e.g. expression profiles which identify toxicity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a kit for screening drug developmental toxicity based on a C/EBP alpha-IGF 1R gene and application thereof. The kit comprises primers for detecting mRNA expression of C/EBP alpha and IGF1R genes; mammalian cell lines or differentiated cells to which the drug is administered, and cell lines or differentiated cells transfected with a plasmid containing an IGF1R promoter and a luciferase reporter gene; a cell lysate; a luciferase. The judgment standards of the kit are that the expression of C/EBP alpha gene in the cell of the compound to be screened is increased, the expression of IGF1R gene is reduced, and the activity of luciferase reporter gene acting on the cell containing IGF1R promoter-reporter gene is reduced, which indicates that the compound to be screened has developmental toxicity. The kit is novel, efficient and reliable, can be used for screening high-flux drugs, and has important significance for rapidly detecting drugs and other compounds with developmental toxicity.
Description
Technical Field
The invention belongs to the field of drug toxicology, and relates to a kit for screening development toxicity of drugs or other compounds based on C/EBP alpha and IGF1R genes and application thereof.
Background
Drug developmental toxicity (drug developmental toxicity) refers to structural or functional damage of offspring from intrauterine to pre-sexual maturity caused by drug factors, including structural malformation, dysfunction, growth retardation and even death. Drug developmental toxicity is one of the important contents for drug safety evaluation. Currently, internationally recognized guidelines related to drug developmental toxicity include "chemical detection guidelines 414 of the organization for development of economic cooperation (OECD) -studies on developmental toxicity during pregnancy" and "drug registration guidelines (ICH)", which all use the results of whole animal reproduction experiments as main measures for evaluating drug developmental toxicity, but have the disadvantages of large animal consumption, long experimental period, poor specificity, low sensitivity, incapability of elucidating the generation mechanism of the drug from the cellular or molecular level, and the like. Even in the in vitro evaluation system for drug developmental toxicity developed in recent years based on the "3R (reduction) principle, such as whole embryo culture, micelle culture method and embryonic stem cell culture, there are problems of high culture difficulty, high cost, limited time, low specificity of detection index, and the like.
Intrauterine growth retardation (IUGR) refers to the limitation of embryo (fetus) growth and development caused by various adverse factors during pregnancy, and mainly shows multiple organ dysfunction, growth retardation and low birth weight, which are the most common developmental toxicity manifestations [1 ]. It is known that different manifestations of drug developmental toxicity are closely related to the time course of administration. Since the "withdrawal of reaction" event, the teratogenic danger of drugs in the early stages of pregnancy has been highly appreciated by people. However, the short-term and long-term hazards and the mechanism of occurrence of the hazards are not clear due to low perinatal concentration and long-term medication. According to statistics, the IUGR global morbidity is 2.75% -15.53%, and the national morbidity is 3% -10%. IUGR not only causes perinatal fetal distress, neonatal asphyxia and perinatal death, but its harm will continue after birth as physical, mental retardation, increased susceptibility to adult chronic diseases, even with cross-generation genetic effects, thereby seriously affecting the quality of life of the population and bringing about a series of family and social problems [2,3 ]. In conclusion, the in vitro evaluation system for drug developmental toxicity has major limitations, and is mainly related to unclear expression of drug developmental toxicity and lack of a theoretical system of occurrence mechanism, so that the in vitro evaluation system for high-throughput drug developmental toxicity based on a toxicity mechanism and a molecular target is yet to be researched.
The early phase I room internationally proposes and systematically proves that offspring IUGR and adult metabolic syndrome susceptible neuroendocrine metabolism programming mechanism caused by exogenous exposure in pregnancy period are easily generated [4-6 ]; it has further recently been proposed that multiple fetal tissues "GC-IGF 1 axis programming" resulting from exposure to maternal Glucocorticoid (GC) may be the primary mechanism of developmental toxicity (including both recent and distant toxicity) [7,8 ]. Insulin-like growth factor 1 (IGF 1) is known to be a type of cell growth factor with insulin-like biological activity, and IGF1 can act through IGF 1receptor (IGF 1R). IGF1R belongs to a receptor tyrosine kinase (receptor tyrosine kinase) family member, and mediates mitogenic actions of IGF1 and IGF 2.IGF1R is a heterotetramer composed of two alpha and two beta subunits, where the alpha subunit is primarily involved in ligand binding and the beta subunit has tyrosine kinase activity. Phosphorylated IGF1R activates multiple downstream signaling pathways involved in the processes of proliferation, differentiation, matrix synthesis and metabolism of pre-and post-natal tissue cells.
GC is known to regulate cell proliferation, differentiation and metabolic processes through interaction of GR with the transcription factor CCAAT enhancer binding proteins (C/EBPs) [9 ]. C/EBP alpha is an important transcription factor for rapidly regulating the expression of downstream genes in cooperation with GC/GR. C/EBP α has also been found to play a key role in regulating hepatocyte genesis [10 ]. C/EBP alpha knockout mice develop liver structural disorders and hypoglycemia leading to neonatal death [11 ]. C/EBP α can inhibit cell proliferation by p21 [12 ]. It is suggested that C/EBP alpha plays an important role in liver development. With the continuous and intensive research on the C/EBP alpha-IGF 1R target, the target is found to be a key target for the development toxicity of multiple organs.
With the development of biotechnology, people continuously and deeply know fetal diseases, and a screening method based on specific drug targets replaces the traditional non-specific method. A prediction system based on a drug development toxicity molecular mechanism is established at the cellular level, and large-scale in vitro high-throughput screening of innovative drugs is carried out, so that the defects of time consumption, labor consumption and the like of human or animal experiments can be avoided. In addition, the in vitro detection requires the establishment of a simple detection method, such as a luciferase reporter gene detection method with high sensitivity.
Luciferase is an ideal reporter because mammalian cells do not contain endogenous luciferase, which produces functional luciferase once transcription is complete. Luciferase catalyzes the oxidation of luciferin to oxyluciferin, which, in the oxidation of luciferin, emits bioluminescence. The luciferase reporter system provides a sensitive, rapid and nonradioactive detection method for the detection of promoter activity, and the principle is briefly described as follows: 1) inserting a specific fragment of a target gene promoter in front of a luciferase expression sequence to construct a reporter gene plasmid; 2) transfecting the constructed reporter gene plasmid into cells; 3) the luciferase activity can be determined by adding a specific luciferase substrate, reacting the luciferase with the substrate to generate fluorescence, and detecting the intensity of the fluorescence.
Reference documents:
[1]A.Imdad,M.Y.Yakoob,S.Siddiqui,Z.A.Bhutta,Screening and triage of intrauterine growth restriction(IUGR)in general population and high risk pregnancies:a systematic review with a focus on reduction of IUGR related stillbirths,BMC Public Health 11 Suppl 3(2011)S1.
[2]P.R.Nielsen,P.B.Mortensen,C.Dalman,T.B.Henriksen,M.G.Pedersen,C.B.Pedersen,E.Agerbo,Fetal growth and schizophrenia:a nested case-control and case-sibling study,Schizophr.Bull.39(6)(2013)1337-42.
[3]M.V.Veenendaal,R.C.Painter,S.R.de Rooij,P.M.Bossuyt,J.A.van der Post,P.D.Gluckman,M.A.Hanson,T.J.Roseboom,Transgenerational effects of prenatal exposure to the 1944-45 Dutch famine,BJOG 120(5)(2013)548-53.
[4]Y.Liu,D.Xu,J.Feng,H.Kou,G.Liang,H.Yu,X.He,B.Zhang,L.Chen,J.Magdalou,H.Wang,Fetal rat metabonome alteration by prenatal caffeine ingestion probably due to the increased circulatory glucocorticoid level and altered peripheral glucose and lipid metabolic pathways,Toxicol.Appl.Pharmacol.262(2)(2012)205-16.
[5]L.Liu,F.Liu,H.Kou,B.J.Zhang,D.Xu,B.Chen,L.B.Chen,J.Magdalou,H.Wang,Prenatal nicotine exposure induced a hypothalamic-pituitary-adrenal axis-associated neuroendocrine metabolic programmed alteration in intrauterine growth retardation offspring rats,Toxicol.Lett.214(3)(2012)307-13.
[6]L.P.Xia,L.Shen,H.Kou,B.J.Zhang,L.Zhang,Y.Wu,X.J.Li,J.Xiong,Y.Yu,H.Wang,Prenatal ethanol exposure enhances the susceptibility to metabolic syndrome in offspring rats by HPA axis-associated neuroendocrine metabolic programming,Toxicol.Lett.226(1)(2014)98-105.
[7]L.Wang,L.Shen,J.Ping,L.Zhang,Z.Liu,Y.Wu,Y.Liu,H.Huang,L.Chen,H.Wang,Intrauterine metabolic programming alteration increased susceptibility to non-alcoholic adult fatty liver disease in prenatal caffeine-exposed rat offspring,Toxicol.Lett.224(3)(2014)311-8.
[8]L.Shen,Z.Liu,J.Gong,L.Zhang,L.Wang,J.Magdalou,L.Chen,H.Wang,Prenatal ethanol exposure programs an increased susceptibility of non-alcoholic fatty liver disease in female adult offspring rats,Toxicol.Appl.Pharmacol.274(2)(2014)263-73.
[9]M.Kadmiel,J.A.Cidlowski,Glucocorticoid receptor signaling in health and disease,Trends Pharmacol.Sci.34(9)(2013)518-30.
[10]H.Yuan,B.Wen,X.Liu,C.Gao,R.Yang,L.Wang,S.Chen,Z.Chen,H.de The,J.Zhou,J.Zhu,CCAAT/enhancer-binding protein alpha is required for hepatic outgrowth via the p53 pathway in zebrafish,Sci Rep 5(2015)15838.
[11]N.D.Wang,M.J.Finegold,A.Bradley,C.N.Ou,S.V.Abdelsayed,M.D.Wilde,L.R.Taylor,D.R.Wilson,G.J.Darlington,Impaired energy homeostasis in C/EBP alpha knockout mice,Science 269(5227)(1995)1108-12.
[12]N.A.Timchenko,M.Wilde,M.Nakanishi,J.R.Smith,G.J.Darlington,CCAAT/enhancer-binding protein alpha(C/EBP alpha)inhibits cell proliferation through the p21(WAF-1/CIP-1/SDI-1)protein,Genes Dev.10(7)(1996)804-15.
disclosure of Invention
In order to solve the problems in the prior art, the invention provides a method for screening the developmental toxicity of drugs or other compounds based on the detection of intracellular C/EBP alpha and IGF1R gene expression and the transfection of plasmids containing IGFIR promoters and luciferase reporter genes for detecting the intracellular luciferase activity. The method is efficient and reliable, can be used for screening high-flux drugs, and has important significance for rapidly detecting drugs or other compounds with developmental toxicity.
In order to achieve the purpose, the invention adopts the following technical scheme:
in a first aspect of the invention, a kit for detecting the developmental toxicity of a drug or other compound based on C/EBP alpha and IGF1R genes is provided, wherein the kit comprises primers for detecting mRNA expression of C/EBP alpha and IGF1R genes; mammalian cell lines or differentiated cells to be treated with the drug, and cell lines or differentiated cells transfected with a plasmid containing an IGFIR promoter and a luciferase reporter gene into the cells; a cell lysate; a luciferase.
Preferably, the sequences of the primer pair aiming at C/EBP alpha are shown as SEQ ID NO:1-2, the sequences of the primer pair for IGF1R are shown in SEQ ID NO: 3-4; the plasmid containing the IGFIR promoter and luciferase reporter gene is a GV238 vector which is subjected to MluI/BglII enzyme digestion, a sequence containing the IGFIR promoter is inserted, the sequence is shown as SEQ ID NO:5, and the GV238 vector is purchased from Shanghai Jikai gene chemistry technology Co.
Preferably, the judgment standard of the kit is that the treatment group of the drug or other compound to be screened simultaneously satisfies the following 3 indexes relative to the control group: a) the expression of C/EBP alpha gene in the cell of the drug or other compounds to be screened is increased; b) decreased IGF1R gene expression; c) decreased luciferase reporter activity in cells containing the IGF1R promoter-reporter suggests developmental toxicity for the drug or other compound being screened.
The second aspect of the present invention provides the use of the above-mentioned kit for detecting the developmental toxicity of a drug or other compound, comprising the steps of:
1) the cell line or differentiated cell is cultured at 5X 105One/well inoculated in 6-well plates containing 10% serum complete medium at 37 ℃ with 5% CO2Culturing in a saturated incubator;
2) selecting a drug or other compounds to be screened, dissolving the drug or other compounds into a solution with the concentration of 1nM-1M according to the characteristics of the drug or other compounds, adding the dissolved drug or other compounds into the cells cultured in the step 1) according to respective concentration gradients, setting a control group, and treating for 24 hours;
3) after the treatment is finished, discarding the cell culture medium of each hole, washing the cell culture medium once by PBS, and then adding 1000 mul of Trizol 500-;
4) adding 200 mul chloroform into an EP tube added with Trizol, violently shaking for 30s, centrifuging at 12000rpm for 15min, sucking supernatant, adding isopropanol with the same volume, reversing, uniformly mixing, standing for 10min, centrifuging at 12000rpm for 10min, and discarding the supernatant; washing twice with 75% precooled ethanol to remove ions or salts, detecting the concentration and purity of RNA on a photometer, carrying out reverse transcription PCR reaction, and detecting the mRNA expression of C/EBP alpha and IGF 1R;
5) selecting the cell line or differentiated cell transfected with step 1) containing IGF1R promoter-luciferase reporter gene at 5X 105One/well inoculated in 6-well plates containing 10% serum complete medium at 37 ℃ with 5% CO2Culturing in a saturated incubator;
6) selecting a drug or other compounds to be screened, dissolving the drug or other compounds into a solution with the concentration of 1nM-1M according to the characteristics of the drug or other compounds, adding the dissolved drug or other compounds into the cells cultured in the step 5) according to respective concentration gradients, setting a control group, and treating for 24 hours;
7) after the treatment is finished, discarding the cell culture medium of each hole, washing the cell culture medium once by PBS, and adding 200-;
8) fully blowing and cracking the cells, transferring cell fragments and liquid into a centrifuge tube, and centrifuging at 12000rpm for 5 min; adding luciferase into the supernatant, mixing uniformly, reacting, and detecting by a fluorescence photometer;
9) according to the detection results of the step 4) and the step 8), the treatment group of the drug or other compound to be screened simultaneously satisfies the following 3 indexes relative to the control group: a) the expression of C/EBP alpha gene in the cell of the drug or other compounds to be screened is increased; b) decreased IGF1R gene expression; c) decreased luciferase reporter activity in cells containing the IGF1R promoter-reporter suggests developmental toxicity for the drug or other compound being screened.
Preferably, the drug or other compound to be screened is one or more of a synthetic compound, a natural product, a small organic molecule, a small inorganic molecule, a lipid, and a carbohydrate.
Preferably, the kit for detecting the developmental toxicity of the drug or other compounds by using the C/EBP alpha and IGF1R genes is applied to high-throughput detection of the drug or other compounds with developmental toxicity.
Compared with the prior art, the invention has the following beneficial technical benefits:
1. the method has the advantages of reliability, adaptability and stability;
2. the luciferase reporter gene is utilized, so that the method is more direct and has high sensitivity;
3. the application range is wide;
4. the detection process is rapid and can be used for high-throughput screening.
Drawings
GV238 Carrier information.
FIG. 2 shows the electrophoresis chart of the cleavage result of IGF 1R. 1#, the product of enzyme digestion of the carrier; 10kb Marker (bands are from top to bottom in sequence: 5kb, 3kb, 2kb, 1.5kb, 1kb, 750bp, 500bp, 250bp, 100 bp).
FIG. 3 electrophoresis of PCR-identified recombinant clones. 1#: negative control (ddH 2O); 2#: negative control (no-load self-ligation control group); 3 #: positive control (GAPDH); 4 #: the Marker is 5Kb, 3Kb, 2Kb, 1.5Kb, 1Kb, 750bp, 500bp, 250bp and 100bp from top to bottom in sequence; 5-12 #: IGF1R 1 No. 1-8 transformant.
FIG. 4. detection of PCR results for C/EBP α -IGF1R after treatment of L02 cells and WJ-MSC differentiated cells for 24h after methimazole administration. C/EBP alpha mRNA expression of methimazole-treated L02 cells; b, the methimazole treats the C/EBP alpha mRNA expression of the WJ-MSCs differentiated cells; expression of IGF1R mRNA from methimazole-treated L02 cells; and D, carrying out methimazole treatment on the expression of IGF1R mRNA of the WJ-MSCs differentiated cells. Compared with the control group, the compound of the formula,*P<0.05,**P<0.01。
FIG. 5 luciferase activity was assayed in L02 cells and in WJ-MSCs differentiated cells 24h after treatment with different concentrations of methimazole. Luciferase activity of IGF1R from L02 cells treated with methimazole; metronidazole-treated WJ-MSCs differentiated cells showed luciferase activity of IGF 1R. Compared with the control group, the compound of the formula,*P<0.05,**P<0.01。
Detailed Description
The features and advantages of the present invention will be further understood from the following detailed description taken in conjunction with the accompanying drawings. The examples provided are merely illustrative of the method of the present invention and do not limit the remainder of the disclosure in any way.
[ example 1]
A kit for detecting drug developmental toxicity based on C/EBP alpha and IGF1R genes has effect on developmental toxicity drug methimazole in L02 cell line model.
The kit is composed of detection of C/EBP alpha and IGF1R gene expression in cells and detection of luciferase activity containing IGFIR promoter and luciferase reporter gene. The application steps of the kit for detecting the developmental toxicity of the drug based on the C/EBP alpha and IGF1R genes in the L02 cell line model are as follows:
1 preparation of human fetal L02 cells
1.1 remove the cell cryopreservation tube from the liquid nitrogen tank, put it rapidly in a 37 ℃ water bath and thaw it as soon as possible without occasional shaking.
1.2 after completely unfreezing, 1300rpm, centrifuging for 3min, wiping the freezing tube with 75% alcohol for disinfection, and then moving to a biological safety cabinet.
1.3 removing supernatant of frozen stock solution by suction, adding 1mL of fresh complete 1640 culture medium to resuspend cells, inoculating the cell suspension into 6cm dish containing 3mL of complete culture medium, shaking uniformly, placing at 37 deg.C and 5% CO2An incubator.
1.4 the culture medium was replaced once and then the culture was continued.
1.5 growing 90% confluent cells for subculture. After trypsinization, the complete 1640 culture medium is prepared into cell suspension, the cell suspension is divided into two new 6cm dis, the complete culture medium is supplemented to 4mL, and the culture is continued.
1.6 adding the dissolved methimazole into the cells cultured in the step (5) according to the concentration gradient of 0, 0.8, 4 and 20nM, and then treating for 24 h.
1.7 after the treatment, the cell culture medium in each well was discarded, washed once with PBS, and 200. mu.l of Trizol was added to each well for the extraction of total RNA from the cells.
2. Specific primer design and preparation
Primers were designed and verified using Primer Premier 5.0 and NCBI Blast database. After designing the primer sequence, it was synthesized by Biotechnology engineering (Shanghai) GmbH and purified by PAGE. Centrifuging 7500g of EP tube filled with newly synthesized primers for 10 minutes, adding molecular biological ultrapure water with the volume marked on the tube wall, and shaking and mixing uniformly for later use. The information on the primers used in this section is shown in Table 1. In addition, newly designed and synthesized primers need to be tested for specificity before first use. A fluorescent real-time quantitative PCR reaction system was set up according to the RT-PCR procedure, the procedure of which is described in the materials and methods section of the first section of the text. PCR reaction conditions were set on an ABI StepOne Plus fluorescent real-time quantitative PCR instrument. After all reactions are finished, the system is used for calling and observing the dissolution curve of the PCR product by using the self-contained software. And judging the specificity of the primer and the existence of primer dimer according to the peak-appearing time and peak area of the PCR product in the dissolution curve.
TABLE 1 RT-PCR sequences
3. Construction of IGF1R promoter-containing reporter gene plasmid
The IGF1R promoter-reporter gene-containing plasmid is constructed by Shanghai Jikai Gene chemistry Technida GmbH, and the steps are as follows:
3.1 obtaining the target Gene fragment
Designing IGF1R promoter primer by using primer premier 5.0 primer design software, carrying out PCR by using human genome as a template, and amplifying to obtain a target fragment, wherein the nucleotide sequence of the target fragment containing the promoter is as follows:
ACGCGTTTCTAATAAATTTATTTCACTGTTAAATCTAGGAACATCCAAAACTGAAACTCTTTATTTAAAAATCAAGCTGAATTTCAGTTAAACAAAACCATCCCATCATATGAATAACTTTCTTAGGTAAAACAAGGTTTATTTTCTTTCTATACAACTGACTCTGAATTGAGCTAGAAATTTCCAAGGAGGAAAATGATCTAGGAAACAACTTTAGAAAAAAAGGGCTAAGTTTCCGTTATGATAGCTTTTGACTTGTTTTCAGCTCTTAAAAAATTATTTACGAACGATGGATACACGTTCTAATGCAGAAGTATTTTAGAATTAGAGAGTAAAAGAAACCTACTACCTTCCTTTACATCAGGTCCCTTCTACCATCCTACCCGATTGTTTGAGACAACCACTTCTTATCTCGACAATTCACAACTCTTTTATTAGCTATCTTAAAAAAATTTATTACTGGCATCAATTAGCCTGAGTCATGAAACCGGACCACATTAAGGGCGACACATGGTCCAATCACTGTTTGTAAAAGTCCACGTATTTCAAACTCCTCTCTCCTGCCACTGCTGGGCTGTTTCCCTCTTTGAGGACCTGGTCTCCGCAGCATTTATTCATTAGATGGCAGTCCTAGGGGAGTCTCGCTTTGGGGAAACCTCTCCTCCTGCACATTCAAGAAAACAACCGCGGAGACTTAGGGTCGGTACTGGTTTCCAGTCACTTACGTAGCAAACGAAGCAAGAGGAACGTGCCTGGGAGGACCCGAGACAGGTGCGGGTGGGTTTCCGCAGTAGCCGCTGATCCCGAGTGCATGCGGCGTGTTCCCGGGTCGGGACCGCGGCCAAGGGAGGCTTCCCGGCCCCAGCCTCCACCCCCTCCTCGGCGCCCCGGGACCCGGACACGCCCCCCGAGCTTCGGAGACCCGCAGCGTGCACGCGCCCCGGCCGCTCCCCGCAGCCGCCCACGTGGTGGAGCCCTGAGCTGCGCGAGGCCGCGGAGAGCGCTCAGGGCGGGCGGCTGGTCCGGGAGGCCACGCCAGCGCGACCCAGCCGAGTCGGCCCCCAGCCCGGGCCCCCACATTTCCTCCCCCGGAGGGAGGGAGGCGACTCTCCGCGGGCTGCCCTCCCCAGCGCCCGCCGCGCCCTCTGGCGGCCGCCGCGGGGACGCGCCCGGGGCACGCGGCGCTGCCTGTCTGGGCCCCCCTTCCGGGGCGCGGGGCCCGCGAGGGGCGGCGGGGTCCTCTCTCCTCGAGCCACTCTGGGCCGAGCCACACGGGCCGCGCCCTTCCCCCTCCGCTCCCCCTGAGCCCCCAAACTCCGGGCTCCACGGTCGCAACGCCGCGGGCACCCCAGCCTGGCGTGAAAGTGCCCGGCGTAGTAGCCTGGGGGGGGGGTCCCCTTTCTCCCAGGTGCGCCCCTTCCGCCACGTTCGGGCTTTCCAGTACGCAGCGAAAAAAATGCCGCATGCACGCATTTATTTATTTTGCAACAGCTGCAAGAAACAATGAAGCTTTTCAAGAACCGGGGAAACGCGCTTTCCAGCCGCGCTGTTGTTGTTTTCAATGAACCTCTCCCAGCCCCGCACTCCCCGCCCACCCCTCCCCTCTCCTGCCCACCCCTCCCCTGCCTAGCCTTTCCCTGGCTACCCACCCCTGCCCCGCCGAGACCGGACCGGCGGCGGGGGCATTGTTTTTGGAGTCGGGCGGGAGGGGAGGGCGCGTGCGGGGTGGCCGGCGCAGTGCGGTGGGGGCGGGAGCGGGTGGGCACGCGCGCGTGTCTCTGTGTGCGCGCGGGAGGCGGTGGGGCGGGAGATGGGGGCGGCGCCTCGCAGTCTCGCGCCCCACGCCCGGGCTCCGCTCCGCACGTCTTGGGGAACCGGGCTCCGGTTTTTTGCGCGCGCCGGCCTGGGCCGGGCCCTCGGCGCGCCGCTGCTGCGGCGGTGGCCGCTCGAGTGTGCGAGCGGGCGCGTGTGCGCGGGCCAGGGCGCGCGCGCGCGCGCGAGCCCCCAGTGTGTGGCAGCGGCGGCGGCGGCGCGGCGAGGCTGGGGCTCTTGTTTACCAGCATTAACTCCGCTGAGCGGAAAAAAAAAGGGAAAAAACCCGAGGAGGAGCGAGCGCACCAGGCGAACTCGAGAGAGGCGGGAGAGCGAGAGGGACAGATCT
3.2 digestion of chemically synthesized plasmid containing target Gene with MluI/BglII
An enzyme digestion reaction system:
| ddH2O | 40.5μl |
| 10X buffer | 5μl |
| 100×BSA | 0.5μl |
| purified DNA plasmid (1 ug/. mu.l) | 2μl |
| MluI(20U/μl) | 1μl |
| BglII(20U/μl) | 1μl |
| Total | 50μl |
The purified plasmid was GV238 vector, purchased from GmbH. The mixed reaction was left at 37 ℃ for 2 h. The size of the cleaved fragment was 2151bp, and the cleavage electrophoresis pattern is shown in FIG. 2.
3.3 construction of recombinant plasmids
And (3) connecting the PCR product into a linearized expression vector, preparing competent cells, transforming, and then identifying a transformant by PCR, wherein the size of the PCR product of the positive transformant is 826, and an electrophoresis chart is shown in figure 3.
PCR identification primer:
| ID | seq |
| KL9220-P3 | ACAATGAAGCTTTTCAAGAAC |
| GLprimer2 | CTTTATGTTTTTGGCGTCTTCCA |
3.4 sequencing results and analysis of results for Positive clones
4. Plasmid transfection of cells of interest
4.1 log yieldLong-term cells were suspended, counted and plated on 6-well plates (cell number approximately 5X 10)5)，37℃、5％CO2Culturing in an incubator.
4.2 according to the cell transfection preliminary experiments and invitrogen lipofectamine 2000 transfection reagent using the instruction design, add appropriate amount of plasmid and transfection reagent.
After 4.34-6 h, the cell status was observed and replaced with fresh complete medium. Observing the expression condition of the fluorescence labeling gene on the plasmid after 24-48h of transfection, wherein the fluorescence rate is more than 80%.
5. Methimazole-treated transfected L02 cells containing IGF1R promoter reporter gene
The solubilized methimazole was added to transfected L02 cells containing the IGF1R promoter reporter gene in 0, 0.8, 4, 20nM concentration gradients and then treated for 24 h. After the treatment, the cell culture medium in each well was discarded, washed once with PBS, and then 200. mu.l of cell lysate was added to each well for luciferase reporter gene detection.
6. Luciferase Activity detection
Fully blowing and cracking the cells, transferring cell fragments and liquid into a centrifuge tube, and centrifuging at 12000rpm for 5 min; and adding luciferase into the supernatant, uniformly mixing, reacting, detecting by a fluorescence photometer, and collecting and analyzing data.
7. Results of the experiment
7.1 construction of IGF1R luciferase reporter Gene
After the constructed vector is subjected to enzyme digestion and electrophoresis, the IGF1R enzyme digestion product is strongly positively expressed near 2kb (FIG. 2). PCR showed that the IGF1R positive transformant PCR product ranged from 750bp to 1Kb (FIG. 3), and sequencing showed 100% sequence identity to GenBank alignment. The product of the recombinant clone was suggested to be IGF 1R.
7.2 Effect of methimazole on C/EBP α and IGF1R mRNA expression
Methimazole increased C/ebpa mRNA expression (P <0.01, fig. 4A) and decreased IGF1R mRNA expression (P <0.05, fig. 4C) concentration-dependently compared to controls, with 20nM methimazole being most pronounced. Suggesting that methimazole increased C/EBP α expression and decreased IGF1R expression.
7.3 Effect of methimazole on IGF1R luciferase Activity
Methimazole reduced IGF1R luciferase expression concentration-dependently (P <0.05 or P <0.01, fig. 5A) compared to controls, most significantly with 20nM methimazole. It was suggested that methimazole inhibits IGF1R luciferase activity.
[ example 2]
A kit for detecting drug developmental toxicity based on C/EBP alpha and IGF1R genes plays a role in a developmental toxicity drug methimazole in a WJ-MSCs liver-like differentiated cell model.
Primary extraction and liver sample differentiation of WJ-MSCs
1.1 WJ-MSCs Primary extraction
Taking umbilical cord of fetus born by caesarean section under aseptic condition in operating room, cleaning blood, soaking in pre-cooled normal saline, and returning to laboratory. The umbilical cord is taken out from the superclean bench, and all separation processes are carried out in pre-cooled physiological saline. Cut into pieces of 4-6 cm/length, and washed with a syringe to remove blood. Removing umbilical cord adventitia, umbilical artery and umbilical vein, and stripping Wharton's gum: fixing two ends of an umbilical cord on a wood board by using studs, taking one end as an inlet, longitudinally separating an outer membrane by an ophthalmic scissors, separating while cutting, completely separating the outer membrane from two sides of one end, respectively clamping the outer membrane and Wharton's jelly by two hemostatic forceps, forcibly tearing, completely separating the outer membrane, and carefully separating arteriovenous. Wharton gum was torn into strips as much as possible and transferred to vials. Transferring the strips into a culture dish containing PBS, washing repeatedly, transferring to a vial again, and cutting into pieces of 1 × 1 × 1mm with ophthalmic scissors3The larger and smaller the tissue mass, the better the fragmentation. Cutting umbilical cord tissue into minced meat, transferring into 50mL centrifuge tube, adding 40mL digestive juice (containing 40mL DMEM/F121: 1 culture medium +80mg collagenase I (2mg/mL), sealing with sealing membrane, mixing, digesting in 37 deg.C water bath for 4 hr (or in 37 deg.C temperature controlled shaking table), shaking once every half hour, adding 250mL PBS, repeatedly blowing to dilute, centrifuging at 2500rpm for 8min (or centrifuging at 3000rpm for 3min), collecting cells, marking the position of cell wall on the centrifuge tube with marker pen, and making into desired shapeAccurately blowing, and re-suspending. The supernatant can be centrifuged again, and cells can still be obtained; discarding the supernatant and the floating adipose tissues, adding about 4mL of DMEM/F-12 complete culture medium containing 10% fetal calf serum and 1ng/mL bFGF, and air-beating to prepare cell suspension; and the number of cells was counted under an inverted microscope using a cell counting plate. Placing at 37 ℃ and 5% CO2And culturing in an incubator with 95% humidity. The adherent growth of the cells can be observed every day, and the adherent growth of the cells can be seen after 3 days.
1.2 liver-like differentiation of WJ-MSC
The induced differentiation medium adopted in the experiment is IMDM culture solution containing: 1% fetal calf serum, 1% streptomycin, HGF 40ng/ml, FGF-410 ng/ml. The specific implementation steps are as follows: the mesenchymal stem cells with good growth state of 3-5 generations are replaced by 1 × 105Cell density of cells/well seeded in 6 wells or 1X 104Inoculating the cell density of the cells/hole into a 24-hole culture plate, adding a growth medium, performing conventional culture, removing the growth medium when the cell density reaches 70%, washing with PBS, adding a hepatocyte induced differentiation solution for induced differentiation, changing the solution once every 3 days during the induced differentiation period, and performing induced differentiation for 14 days.
2. Methimazole-treated WJ-MSCs liver-like differentiated cell
2.1 Add the dissolved methimazole to the cells cultured in the above step in a concentration gradient of 0, 0.8, 4, 20nM, then treat for 24 h.
2.2 after the treatment, the cell culture medium in each well is discarded, the cells are washed once with PBS, and then 200. mu.l of Trizol is added to each well for the extraction of total RNA of the cells.
2.3 construction of plasmid containing IGF1R promoter-reporter Gene As in example 1, the plasmid was transfected into WJ-MSCs hepatoblastoid differentiated cells which were differentiated for 14 days, WJ-MSCs hepatoblastoid cells containing IGF1R promoter-reporter gene were treated with methimazole at different concentrations for 24h, after the treatment, the cell culture medium was discarded from each well, which was washed once with PBS, and then 200 μ l of cell lysate was added per well for luciferase reporter gene detection.
2.4 RT-PCR assays for C/EBP α and IGF1R mRNA expression and luciferase reporter for IGF1R luciferase activity.
3. Results of the experiment
3.1 Effect of methimazole on C/EBP alpha and IGF1R mRNA expression
Methimazole increased C/ebpa mRNA expression (P <0.05, P <0.01, fig. 4B) concentration-dependently and decreased IGF1R mRNA expression (P <0.05, fig. 4D) concentration-dependently compared to controls, with 20nM methimazole being most pronounced. Suggesting that methimazole increased C/EBP α expression and decreased IGF1R expression.
3.2 Effect of methimazole on IGF1R luciferase Activity
Compared with the control group, the methimazole can reduce the expression of IGF1R luciferase (P <0.05 or P <0.01, FIG. 5B) in a concentration-dependent manner, and the expression is most obvious when 20nM methimazole is used. It was suggested that methimazole could inhibit IGF1R luciferase expression.
In conclusion, the invention provides different concentrations of the compound to be screened (such as methimazole) on an L02 cell line and a WJ-MSCs differentiated cell model, detects the expression of C/EBP alpha and IGF1R mRNA in cells and detects the luciferase activity containing an IGFIR promoter and a luciferase reporter gene, for example, the compound to be screened can increase the expression of C/EBP alpha mRNA and reduce the expression of IGF1R mRNA and the luciferase activity. Suggesting that the compound to be screened has developmental toxicity.
The drug screening system established by the invention is novel, efficient and reliable, can be used for screening high-flux drugs, and has important significance for detecting drugs and compounds with developmental toxicity.
Obviously, many modifications, substitutions, and alterations are possible in light of the above teachings of the invention, without departing from the basic technical ideas of the invention, as defined by the following general technical knowledge and conventional practices of the art.
Sequence listing
<110> Wuhan university
<120> kit for screening drug developmental toxicity based on C/EBP alpha and IGF1R genes and application
<160> 9
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
<210> 2
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ggttgagcac agggtacttt a 21
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ttggtgcgtc taagatgagg 20
<210> 4
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
ttggagcggt gagtttgc 18
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
<210> 7
<211> 2161
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
acgcgtttct aataaattta tttcactgtt aaatctagga acatccaaaa ctgaaactct 60
ttatttaaaa atcaagctga atttcagtta aacaaaacca tcccatcata tgaataactt 120
tcttaggtaa aacaaggttt attttctttc tatacaactg actctgaatt gagctagaaa 180
tttccaagga ggaaaatgat ctaggaaaca actttagaaa aaaagggcta agtttccgtt 240
atgatagctt ttgacttgtt ttcagctctt aaaaaattat ttacgaacga tggatacacg 300
ttctaatgca gaagtatttt agaattagag agtaaaagaa acctactacc ttcctttaca 360
tcaggtccct tctaccatcc tacccgattg tttgagacaa ccacttctta tctcgacaat 420
tcacaactct tttattagct atcttaaaaa aatttattac tggcatcaat tagcctgagt 480
catgaaaccg gaccacatta agggcgacac atggtccaat cactgtttgt aaaagtccac 540
gtatttcaaa ctcctctctc ctgccactgc tgggctgttt ccctctttga ggacctggtc 600
tccgcagcat ttattcatta gatggcagtc ctaggggagt ctcgctttgg ggaaacctct 660
cctcctgcac attcaagaaa acaaccgcgg agacttaggg tcggtactgg tttccagtca 720
cttacgtagc aaacgaagca agaggaacgt gcctgggagg acccgagaca ggtgcgggtg 780
ggtttccgca gtagccgctg atcccgagtg catgcggcgt gttcccgggt cgggaccgcg 840
gccaagggag gcttcccggc cccagcctcc accccctcct cggcgccccg ggacccggac 900
acgccccccg agcttcggag acccgcagcg tgcacgcgcc ccggccgctc cccgcagccg 960
cccacgtggt ggagccctga gctgcgcgag gccgcggaga gcgctcaggg cgggcggctg 1020
gtccgggagg ccacgccagc gcgacccagc cgagtcggcc cccagcccgg gcccccacat 1080
ttcctccccc ggagggaggg aggcgactct ccgcgggctg ccctccccag cgcccgccgc 1140
gccctctggc ggccgccgcg gggacgcgcc cggggcacgc ggcgctgcct gtctgggccc 1200
cccttccggg gcgcggggcc cgcgaggggc ggcggggtcc tctctcctcg agccactctg 1260
ggccgagcca cacgggccgc gcccttcccc ctccgctccc cctgagcccc caaactccgg 1320
gctccacggt cgcaacgccg cgggcacccc agcctggcgt gaaagtgccc ggcgtagtag 1380
cctggggggg gggtcccctt tctcccaggt gcgccccttc cgccacgttc gggctttcca 1440
gtacgcagcg aaaaaaatgc cgcatgcacg catttattta ttttgcaaca gctgcaagaa 1500
acaatgaagc ttttcaagaa ccggggaaac gcgctttcca gccgcgctgt tgttgttttc 1560
aatgaacctc tcccagcccc gcactccccg cccacccctc ccctctcctg cccacccctc 1620
ccctgcctag cctttccctg gctacccacc cctgccccgc cgagaccgga ccggcggcgg 1680
gggcattgtt tttggagtcg ggcgggaggg gagggcgcgt gcggggtggc cggcgcagtg 1740
cggtgggggc gggagcgggt gggcacgcgc gcgtgtctct gtgtgcgcgc gggaggcggt 1800
ggggcgggag atgggggcgg cgcctcgcag tctcgcgccc cacgcccggg ctccgctccg 1860
cacgtcttgg ggaaccgggc tccggttttt tgcgcgcgcc ggcctgggcc gggccctcgg 1920
cgcgccgctg ctgcggcggt ggccgctcga gtgtgcgagc gggcgcgtgt gcgcgggcca 1980
gggcgcgcgc gcgcgcgcga gcccccagtg tgtggcagcg gcggcggcgg cgcggcgagg 2040
ctggggctct tgtttaccag cattaactcc gctgagcgga aaaaaaaagg gaaaaaaccc 2100
gaggaggagc gagcgcacca ggcgaactcg agagaggcgg gagagcgaga gggacagatc 2160
t 2161
<210> 8
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
acaatgaagc ttttcaagaa c 21
<210> 9
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
ctttatgttt ttggcgtctt cca 23
Claims (1)
- The application of the combination of C/EBP alpha and IGF1R genes and an IGF1R promoter in preparing a kit for detecting the developmental toxicity of methimazole is characterized in that the kit contains a primer pair for detecting the mRNA expression of the C/EBP alpha and IGF1R genes, the sequence of the primer pair aiming at the C/EBP alpha is shown as SEQ ID NO. 1-2, and the sequence of the primer pair aiming at IGF1R is shown as SEQ ID NO. 3-4; mammalian fetal liver cell line or stem cell liver-like differentiated cell of a subject with methimazole action, and mammalian fetal liver cell line or stem cell liver-like differentiated cell transfected with a plasmid containing IGF1R promoter and luciferase reporter gene into the cell, wherein the plasmid containing IGF1R promoter and luciferase reporter gene is GV238 vectorMluI / BglII, enzyme digestion, namely inserting a sequence containing an IGF1R promoter, wherein the sequence containing the IGF1R promoter is shown as SEQ ID NO. 5; a cell lysate; a luciferase enzyme; the judgment standard of the kit is that the treatment group of the methimazole to be detected simultaneously satisfies the following 3 indexes relative to the control group: a) increased expression of the C/EBP alpha gene in cells treated with methimazole to be detected, b) decreased expression of the IGF1R gene, C) decreased activity of the luciferase reporter gene in cells containing the IGF1R promoter-reporter gene, suggesting that methimazole to be detected is developmentally toxic.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711378994.0A CN107841556B (en) | 2017-12-19 | 2017-12-19 | Kit for screening drug developmental toxicity based on C/EBP alpha and IGF1R genes and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711378994.0A CN107841556B (en) | 2017-12-19 | 2017-12-19 | Kit for screening drug developmental toxicity based on C/EBP alpha and IGF1R genes and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107841556A CN107841556A (en) | 2018-03-27 |
| CN107841556B true CN107841556B (en) | 2020-12-01 |
Family
ID=61684004
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711378994.0A Active CN107841556B (en) | 2017-12-19 | 2017-12-19 | Kit for screening drug developmental toxicity based on C/EBP alpha and IGF1R genes and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107841556B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110904047B (en) * | 2019-11-25 | 2022-01-04 | 武汉大学 | Cell model for screening developmental toxicity exogenous compound by taking 11 beta-HSD 2 as target spot, construction method and application thereof |
| CN114686424B (en) * | 2022-03-09 | 2023-09-22 | 海南医学院 | Method for regulating and controlling C/EBP alpha gene expression and C/EBP alpha expression inhibitor |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2239580A1 (en) * | 2009-04-09 | 2010-10-13 | Sofar SPA | Determination of 5-ASA efficacy in CRC prevention and/or treatment by gene expression analysis |
| CN102653782A (en) * | 2011-03-01 | 2012-09-05 | 广西壮族自治区药用植物园 | Screening method of anti-infection traditional Chinese medicine component |
| EP2689023A2 (en) * | 2011-03-22 | 2014-01-29 | Merck Sharp & Dohme Corp. | Promoters for high level recombinant expression in fungal host cells |
| CN103627779A (en) * | 2013-12-02 | 2014-03-12 | 山东大学 | Screening system of anti-tumor drugs based on TRAIL receptor signal channel |
| CN104508143A (en) * | 2012-03-12 | 2015-04-08 | 纪念斯隆-凯特琳癌症中心 | Methods and compositions for the diagnosis, prognosis and treatment of acute myeloid leukemia |
-
2017
- 2017-12-19 CN CN201711378994.0A patent/CN107841556B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2239580A1 (en) * | 2009-04-09 | 2010-10-13 | Sofar SPA | Determination of 5-ASA efficacy in CRC prevention and/or treatment by gene expression analysis |
| CN102653782A (en) * | 2011-03-01 | 2012-09-05 | 广西壮族自治区药用植物园 | Screening method of anti-infection traditional Chinese medicine component |
| EP2689023A2 (en) * | 2011-03-22 | 2014-01-29 | Merck Sharp & Dohme Corp. | Promoters for high level recombinant expression in fungal host cells |
| CN104508143A (en) * | 2012-03-12 | 2015-04-08 | 纪念斯隆-凯特琳癌症中心 | Methods and compositions for the diagnosis, prognosis and treatment of acute myeloid leukemia |
| CN103627779A (en) * | 2013-12-02 | 2014-03-12 | 山东大学 | Screening system of anti-tumor drugs based on TRAIL receptor signal channel |
Non-Patent Citations (7)
| Title |
|---|
| GC-IGF1轴编程介导孕期咖啡因暴露所致子代大鼠肾上腺功能异常的宫内发生机制;陈光辉;《2017（第三届）毒性测试替代方法与转化毒理学（国际）学术研讨会会议论文集》;20170731;第179-180页 * |
| NG_009492.1;NCBI;《PubMed》;20170915;https://www.ncbi.nlm.nih.gov/nuccore/222144288?sat=47&satkey=627071 * |
| NM_000875.4;NCBI;《PubMed》;20171206;https://www.ncbi.nlm.nih.gov/nuccore/629266060?sat=46&satkey=123607952 * |
| NM_001287424.1;NCBI;《PubMed》;20171206;https://www.ncbi.nlm.nih.gov/nuccore/NM_001287424.1 * |
| Prenatal caffeine exposure-induced adrenal developmental abnormality in male offspring rats and its possible intrauterine programming mechanisms;Zheng He等;《Toxicology Research》;20160301;第5卷(第2期);摘要，表1，图3，图6 * |
| Zheng He等.Prenatal caffeine exposure-induced adrenal developmental abnormality in male offspring rats and its possible intrauterine programming mechanisms.《Toxicology Research》.2016,第5卷(第2期),第388-398页. * |
| 人IGF1R启动子克隆及荧光素酶报告基因载体构建;李莎等;《医学分子生物学杂志》;20140324;第11卷(第1期);第17-21页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107841556A (en) | 2018-03-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Bidarimath et al. | Pregnancy and spontaneous fetal loss: A pig perspective | |
| Zhang et al. | CRISPR/Cas9‐mediated sheep MSTN gene knockout and promote sSMSCs differentiation | |
| US20220112492A1 (en) | Compositions and methods for induced tissue regeneration in mammalian species | |
| Gao et al. | Overexpression of microRNA-10a in germ cells causes male infertility by targeting Rad51 in mouse and human | |
| KR20140130562A (en) | Method for regulating muscle cell proliferation and differentiation, treating muscle cell, controling gene expression which are using MICRORNAS, and derepession vector of MICRORNAS molecule, Kit and Myocyt using them | |
| Ding et al. | FSH acts on the proliferation of type A spermatogonia via Nur77 that increases GDNF expression in the Sertoli cells | |
| Li et al. | Mesenchymal stem cells with downregulated Hippo signaling attenuate lung injury in mice with lipopolysaccharide‑induced acute respiratory distress syndrome | |
| Pan et al. | MicroRNA-574 suppresses oocyte maturation via targeting hyaluronan synthase 2 in porcine cumulus cells | |
| US20190153446A1 (en) | Mir-149-3p and method for treating metabolic disease using the same | |
| CN102224241A (en) | Amniotic fluid cells and uses thereof | |
| CN107841556B (en) | Kit for screening drug developmental toxicity based on C/EBP alpha and IGF1R genes and application | |
| Kolanowski et al. | In vitro and in vivo characteristics of connexin 43-modified human skeletal myoblasts as candidates for prospective stem cell therapy for the failing heart | |
| Lei et al. | Cultured pluripotent planarian stem cells retain potency and express proteins from exogenously introduced mRNAs | |
| Shao et al. | ADSC exosomes mediate lncRNA-MIAT alleviation of endometrial fibrosis by regulating miR-150-5p | |
| Córdova et al. | Effect of leptin during in vitro maturation of prepubertal calf oocytes: embryonic development and relative mRNA abundances of genes involved in apoptosis and oocyte competence | |
| CN114366812B (en) | Application of CHIR-99021 or BML-284 in preparation of product for recovering ddx 24-knocked-down cerebral vascular development | |
| Yang et al. | MicroRNA-27a promotes porcine myoblast proliferation by downregulating myostatin expression | |
| Kim et al. | Oocyte cytoplasmic Gas6 and heparan sulfate (HS) are required to establish the open chromatin state in nuclei during remodeling and reprogramming | |
| CN116574674A (en) | Activation of exosomal driven somatic cell reconstitution pluripotency using CD3254 | |
| Duo et al. | Single-base editing in IGF2 improves meat production and intramuscular fat deposition in Liang Guang Small Spotted pigs | |
| Cui et al. | miR-205 expression elevated with EDS treatment and induced leydig cell apoptosis by targeting RAP2B via the PI3K/AKT signaling pathway | |
| Onuma et al. | Nkx2-1 and FoxE regionalize glandular (mucus-producing) and thyroid-equivalent traits in the endostyle of the chordate Oikopleura dioica | |
| Zhao et al. | LXRα gene downregulation by lentiviral-based RNA interference enhances liver function after fatty liver transplantation in rats | |
| CN110904047B (en) | Cell model for screening developmental toxicity exogenous compound by taking 11 beta-HSD 2 as target spot, construction method and application thereof | |
| Zhang et al. | Circular RNA circZEB1 regulates goat brown adipocytes differentiation and thermogenesis through miR-326–3p |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |