CN107815496B

CN107815496B - Primer for amplifying UCK2 gene of Blackett black cattle, kit and method for screening high-quality Blackett black cattle

Info

Publication number: CN107815496B
Application number: CN201711051968.7A
Authority: CN
Inventors: 康晓晨; 董雅娟
Original assignee: Individual
Current assignee: Individual
Priority date: 2017-10-30
Filing date: 2017-10-30
Publication date: 2020-12-29
Anticipated expiration: 2037-10-30
Also published as: CN107815496A

Abstract

The invention discloses a primer for amplifying a Blackett black cattle UCK2 gene and a kit and a method for screening high-quality Blackett black cattle breeds, wherein the method comprises the following steps: the Blackett black cattle breed with high expression level of the UCK2 gene mRNA of the Blackett black cattle is selected as the high-quality cattle breed. The invention provides a method for screening high-quality cattle seeds by detecting the mRNA expression level of the UCK2 gene for the first time, and provides a new idea for cultivating high-quality Bracester beef cattle varieties. When in detection, the specific primers and the kit are used, the expression quantity of the mRNA level of the Blackett black cattle is detected by a qRT-PCR method, high-quality cattle seeds can be screened by judging the protein expression level through the mRNA expression level, the transcriptome sequencing technology and the qRT-PCR technology are combined, the instability of the traditional SNP and the limitation of the common RFLP are solved, and the method is simple, rapid, low in cost, high in accuracy, visual in detection result and convenient to popularize.

Description

Primer for amplifying UCK2 gene of Blackett black cattle, kit and method for screening high-quality Blackett black cattle

Technical Field

The invention relates to a primer used for amplifying a Blackett black cattle UCK2 gene, and also relates to a kit and a screening method for screening high-quality Blackett black cattle, belonging to the technical field of animal molecular genetics.

Background

With the improvement of living standard and the development of food culture, the selection of meat is not limited to traditional pork, chicken and other products. The amino acid composition of the beef is closer to the human body level than that of the pork, so that the beef is more in line with the healthy diet requirements of human beings. At present, the average beef occupation of China is only about 5 kg, the average level of the world is more than 10 kg, and the average beef occupation of developed countries is up to 50 kg, so that the beef demand of China still has a great space for rising. China has abundant local beef cattle varieties, such as Qinchuan cattle, Luxi yellow cattle and the like, although the local beef cattle varieties have various characteristics, the comprehensive production level is low, and the difference with foreign high-quality beef cattle is not small, which is one of the reasons for the year-by-year increase of beef imports in China. However, as the consumption level is improved and the consumption population is increased, the specific gravity of the cattle species in meat consumption is increased year by year, and the price of the cattle species is continuously increased. While the total consumption amount is continuously increased, people have higher requirements on the quality of the cattle seeds, the snowflake cattle seeds and the high-grade cattle seeds become consumption fashion gradually, and the demand of consumers on the high-grade cattle seeds is more and more urgent. Most of high-grade beef breeds in China at present mainly depend on import, and the practical situation provides a new challenge for breeding high-grade beef breeds in China. The existing five major varieties and eight major local varieties of beef cattle in China are all dual-purpose types, the comprehensive production level of the beef cattle is low, particularly, the quality of cattle species has great difference compared with that of cattle in foreign countries, the cultivation of high-grade beef cattle is relatively lagged, and the cultivation of the high-grade beef cattle is a necessary trend. Therefore, it is urgent to breed beef cattle with better meat quality and nutrition.

The Blackett black cattle is a new high-quality beef cattle germplasm, and is an excellent germplasm resource obtained by improving local Luxi yellow cattle and Bohai black cattle by combining modern biotechnology such as somatic cell cloning and the like with a conventional breeding hybridization method. The hybrid germplasm fully shows hybrid vigor, retains beef quality characteristics and partial appearance characteristics, and obtains the physiological characteristics of the Luxi yellow cattle and the Bohai black cattle which adapt to the local environment and geographic conditions. The beef has the biggest characteristics of good meat quality, typical marble patterns, also called as snowflake meat, tenderness and succulence, rich protein in the beef, amino acid composition closer to the requirement of a human body than pork, capability of improving disease resistance of the body, functions of nourishing cardiac muscle and enhancing resistance, rich iron content, low content of saturated fatty acid in intramuscular fat, high content of unsaturated fatty acid, unique flavor, fresh and tender meat quality, good taste, rich trace elements and CoQ10, and is a new high-quality beef cattle germplasm which is rare in beef cattle germplasm resources in China.

At present, few methods for screening or breeding high-quality cattle species of Blackett black cattle are reported, single nucleotide polymorphism detection and population genetic polymorphism analysis are carried out by SSCP and common RFLP technologies which are commonly used at present, the methods are unstable, and mutation may not be detected under common conditions, so that a considerable proportion of false negative results may be encountered in practical application; meanwhile, the sensitivity of the existing detection technology is not high, and the repeatability is poor due to the influence of various factors; and the complex operation process greatly limits the application of the method in production. Therefore, it is important to find a rapid and effective identification method.

Disclosure of Invention

Aiming at the defect that the method for rapidly and effectively screening the high-quality black cattle breeds of the Blackett black cattle in the prior art is few, the invention provides the method for screening the high-quality black cattle breeds of the Blackett black cattle, the method can rapidly and simply screen the high-quality black cattle breeds of the Blackett black cattle, the accuracy is high, and the technical support is provided for cultivating the black cattle breeds with better meat quality and nutrition.

The invention also provides a kit for screening the high-quality cattle breeds of the Blackett black cattle, and the kit can be used for conveniently screening the high-quality cattle breeds and is convenient to apply.

The invention also provides a primer for amplifying the UCK2 gene of the Blackett black cattle, the primer can accurately amplify the UCK2 gene of the Blackett black cattle, and a good basis is provided for screening high-quality cattle. In the breeding process of black cattle, the meat quality of the Blackett black cattle is different, not all the bred Blackett black cattle have the unique characteristics of good meat quality, rich nutrition and unique flavor, and excellent cattle seeds need to be continuously screened in order to enable the Blackett black cattle to continuously maintain excellent varieties.

At present, research on screening and breeding of high-quality Blackett black cattle species is less, no good screening method exists, and the inventor tries to research the relationship between genes and black cattle species from the perspective of molecular biology and provides a new idea for breeding high-quality Blackett beef cattle species. Under the guidance of the idea, the inventor selects the difference genes which possibly influence the meat quality by taking the Blackett black cattle and other cattle species in a Blackett black cattle farm as research objects, and finds that the difference of UCK2 genes of the black cattle can obviously influence the quality of the black cattle through comparison, the higher the expression level of the mRNA of the UCK2 gene is, the better the metabolism is, and the meat tenderness is, so the UCK2 gene is taken as the difference gene influencing the quality of the black cattle, and the screening method for screening the high-quality cattle species by detecting the expression level of the mRNA of the UCK2 gene is determined.

The specific technical scheme of the invention is as follows:

a method for screening high-quality cattle breeds of Blackett black cattle comprises the following steps: the Blackett black cattle breed with high expression level of the UCK2 gene mRNA of the Blackett black cattle is selected as the high-quality cattle breed.

According to the invention, UCK2 gene mRNA expression level is used for screening high-quality cattle seeds, the method can conveniently and quickly judge the quality of the black cattle, better technical support is provided for optimizing the quality of the beef cattle, and the method has high accuracy and good repeatability and has good popularization and application values.

The nucleotide sequence of the UCK2 gene of the Blackett black cattle is shown as SEQ ID NO.1, and comprises the following steps: atggccggggacagcgagcgctgcctgcagaaccaccagcagcccaacggcggcgagcccttcctgatcggcgtatgatggttcacggccagcggcaagtcttccgtctgtgctaagatcgtgcagctgctggggcagaacgaggtggactatcgccagaagcaggtggtcatcctgagccaggacagcttctgccgcggctgcacttcagagcagaaggttaaagccctgaagggccagtgccactttgatcacccagatgcctttgacaatgaactcatcttcaagacactcaaagaaatcacggaagggaaaactgtgaatattcccgtgtacgactttgtttcccattcccggaaggaggagacggttactgtctaccccgcagacgtggtgctcttcgaagggatcctggccttctactcccaggaagtgcgagtgttcttccagatgaagctttttgtggacacagatgcggacacccggctctcccgcagagatttaagggacatcagcgaaagagggagggaccttgagcagattttatcttgatgcattacattcgtcaagcctgcctttgaggaattctgcttgccaacaaagaagtatgctgacgtgatcattcctttatatgcagataatctcgtggccatcaacctcatcgtgcaagaaatccaggacatcctgaacggggggctctccaaacgacagaccaatggctatctcaacggctacaccccttcccgcaagaggcaggcctcggagtccagcagccggccgcactga are provided.

Through experimental screening and verification, when the mRNA expression level of the UCK2 gene of the Blackett black cattle is more than or equal to 5, the quality of the obtained Blackett black cattle meets the requirement, so the Blackett black cattle with the mRNA expression level of the UCK2 gene more than or equal to 5 is screened as high-quality cattle.

In the screening method, the UCK2 gene of Blackett black cattle is amplified by adopting qRT-PCR (real-time fluorescent quantitative nucleic acid amplification detection system, also called real-time fluorescent quantitative PCR) to quantitatively detect the mRNA expression level of the UCK2 gene, and the method comprises the following steps:

(1) taking a sample to be detected of a Blackett black cattle, extracting RNA of the sample to be detected, and then reversely transcribing the RNA into cDNA serving as a template for real-time fluorescent quantitative PCR (qRT-PCR, real-time fluorescent quantitative nucleic acid amplification detection system) amplification;

(2) the UCK2 gene of the Blackett black cattle is amplified by adopting real-time fluorescent quantitative PCR to obtain a PCR product, and primers used for amplification are as follows:

an upstream primer: 5 'AAGGGATCCTGGCCTTCTA 3' (shown in SEQ ID NO. 2)

A downstream primer: 5 'TTCGCTGATGTCCCTTAATACTC 3' (shown in SEQ ID NO. 3);

(3) quantitatively analyzing UCK2 gene mRNA expression level by real-time fluorescence quantitative PCR instrument, detecting CT value by using GAPDH as reference gene, and adopting 2^-△△CtAnd (4) carrying out calculation analysis.

The real-time fluorescence quantitative technology was introduced by Applied Biosystems in 1996, and is a method of adding a fluorescent group into a PCR reaction system, monitoring the whole PCR process in real time by using fluorescent signal accumulation, and finally performing quantitative analysis on an unknown template through a standard curve. The technology not only realizes the quantification of the DNA template, but also has the characteristics of high sensitivity, stronger specificity and reliability, capability of realizing multiple reactions, high automation degree, no pollution, real-time property, accuracy and the like, and is widely applied to the fields of molecular biology research, medical research and the like at present. The invention adopts real-time fluorescence quantitative PCR technology to carry out fluorescence quantification on the UCK2 gene, and adopts QRT-PCR method to rapidly, conveniently and visually judge the expression level of mRNA, thereby saving time and labor.

In the quantitative detection method, the sample to be detected can be a tissue sample, a blood sample and the like of Blackett black cattle, and the selection range is wide.

In the step (1), RNA can be extracted using an extraction kit disclosed in the prior art. Reverse transcription into cDNA can be carried out using kits disclosed in the prior art.

In the step (2), the qRT-PCR reaction system is as follows: fluorescent dye 10uL (microliter), upstream and downstream primers 0.5uL, cDNA 1uL, double distilled water 8uL, total 20 uL. Wherein, the fluorescent dye can be purchased from a reagent company, and the fluorescent dye matched with the real-time fluorescent quantitative PCR instrument is selected.

In the step (2), the reaction conditions of the real-time fluorescent quantitative PCR are as follows: pre-denaturation at 94 ℃ for 10 min; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, and extension at 72 ℃ for 40s for 40 cycles.

In the step (3), Roche can be adopted

And (3) carrying out quantitative analysis by using a 480 real-time fluorescence quantitative PCR instrument. In the detection, 3 replicates are set for each sample to be detected, for more accuracy.

The invention also protects a primer for amplifying the UCK2 gene of the Blackett black cattle, and the nucleotide sequence of the primer is as follows:

an upstream primer: 5 'AAGGGATCCTGGCCTTCTA 3'

A downstream primer: 5 'TTCGCTGATGTCCCTTAATACTC 3'.

The invention also provides a kit for screening high-quality cattle breeds of Blackett black cattle, which comprises the following components in independent package: a. the primer for amplifying the UCK2 gene of the Blackett black cattle; b. green One dye.

In the kit, each component is packaged separately, wherein an upstream primer for amplifying the UCK2 gene of the Blackett black cattle: 0.5 mu L; a downstream primer for amplifying the UCK2 gene of the Blackett black cattle: 0.5 mu L; fluorescent dye 10 uL.

The kit also comprises 8ul of double distilled water which is packaged separately.

The kit has complete components and convenient use, and when in use, the components are mixed and then added into a cDNA template, so that the UCK2 gene of the Blackett black cattle can be amplified by adopting the qRT-PCR method.

The invention provides a method for screening high-quality cattle seeds by detecting the mRNA expression level of the UCK2 gene for the first time, and provides a new idea for cultivating high-quality Bracester beef cattle varieties. When in detection, the specific primer and the kit are used, preferably a qRT-PCR method is used for detecting the expression quantity of the mRNA level of the Blackett black cattle, the protein expression level is judged through the mRNA expression level, and then high-quality cattle seeds can be screened out.

Drawings

FIG. 1 shows the relative mRNA expression levels of UCK2 gene, POLR1C gene, POLR2D gene and NT5C3 gene of Blackett black cattle and Luxi yellow cattle.

FIG. 2 shows the relative expression level of mRNA of the UCK2 gene from Blackett black cattle.

Detailed Description

The invention is described and illustrated in detail below to provide a better understanding of the invention.

Example 1 selection of genes for screening high-quality bovine species

1. Materials and methods

1.1 test animals

The experimental animals are 4 fattening Blackett black cattle and 4 fattening Luxi yellow cattle selected from Shandong Blackett black cattle science and technology GmbH and Dada yellow cattle, 7-10 rib interosseous tissues are taken after slaughter, and stored in liquid nitrogen for later use.

1.2 Main instruments and reagents

1.2.1 Main Instrument

Roche of Roche

480PCR instrument, IKA high-speed colloid homogenizer, SIGMA 3K-30 high-speed refrigerated centrifuge, Milli-Q ultrapure water system, BP211D precision electronic balance, etc.

1.2.2 Primary reagents

The tissue genome RNA extraction kit and the reverse transcription kit are purchased from the company Limited of the whole formula gold; fluorescent dyes, DDH₂O (double distilled water) and the like are purchased from Qingdao living creatures, Inc.

1.3 screening of differential genes

1.3.1KEGG enrichment analysis

From the perspective of a complex control network, based on Kyoto encyclopedia of genes and genes biological pathway database (http:// www.genome.jp /), the difference gene set is subjected to KEGG database-based biological pathway enrichment analysis, so as to extract the difference genes on the most relevant biological pathways.

4 candidate genes, namely UCK2 gene, POLR1C gene, POLR2D gene and NT5C3 gene, are screened out according to the glyceride metabolism path of the differential genes, and are shown in Table 1.

TABLE 1KEGG results

1.3.2 differential Gene results

Among the transcriptome sequencing technologies, RPKM (Reads Per Kilobase of transcript Per Million mapped Reads) is a general method for expressing gene expression levels, representing the number of Reads Per one Million Reads from a gene Per Kilobase length.

DEGseq is an R-package specifically used to identify differential expression from RNA sequencing data. In this package, three existing methods are integrated and a random sampling model based on an MA graph is introduced, and Fisher's exact test and likelihood ratio test are combined. DEGseq analyzes p-and q-values assuming that the data is based on binomial or poisson distributions.

p _ value: refers to the probability of an extreme case occurring where the original hypothesis assumed that there was no difference in all genes under both sets of experimental conditions.

q _ value gene differential expression analysis is an independent hypothesis statistical test for thousands of genes, and such a multiple test has the problem of high overall false positives. To more emphasize the difference in expression, p _ value needs to be corrected. Correcting p _ value using DEGseq resulted in q _ value, the lower q _ value, the more significant the difference in gene expression. When q _ value is less than the default threshold of 0.05, it indicates that the gene expression difference is very significant.

Based on the mean value of the sample expression levels (log2) of the differential genes, more than 10-fold differential genes were selected, as shown in Table 2. And screening genes related to lipid metabolism according to the enrichment analysis result to obtain a difference gene UCK2 gene.

TABLE 2 expression differential results

1.4 genomic RNA extraction and reverse transcription

1.4.1 genomic RNA extraction

According to the instruction of the RNA extraction kit, bovine genome RNA is extracted, and the concentration is determined by a nucleic acid protein determinator and stored at-80 ℃ for later use. Table 3 shows the results of the genomic RNA assay, and it can be seen from Table 3 that RNA can be used.

TABLE 3 nucleic acid concentrations

1.4.2 reverse transcription

First strand cDNA was synthesized using the Whole-plant gold reverse transcription kit. Taking a 20uL reaction system as an example, the specific steps are as follows:

(1) thawing the total RNA on ice at-80 deg.C, 5 XgDNA Buffer, FQ-RT Primer Mix, 10 Xfast RT Buffer, RNase-Free ddH₂O was thawed at room temperature and placed on ice quickly after thawing.

(2) The complex solution was mixed according to the following Table 4, mixed well, centrifuged at 5000rpm for 10s at 42 ℃ for 3min, and then placed on ice.

TABLE 4gDNA removal System mixture

Composition of matter	Amount of the composition used
		5×gDNA Buffer	2uL
Total RNA	-
		RNase-Free ddH₂O	Make up to 10uL

(3) The mixtures were prepared as in table 5 below.

TABLE 5 reverse transcription System

Composition of matter	Amount of the composition used
		10×Fast RT Buffer	2uL
RT Enzyme Mix	1uL
		FQ-RT Primer Mix	2uL
RNase-Free ddH₂O	Make up to 10uL

(4) The reverse transcription system mixture of Table 5 was added to the mixture of Table 4, vortexed and shaken for 10 seconds, and incubated at 42 ℃ for 15 min.

(5) Incubating at 95 deg.C for 3min, cooling in ice to obtain cDNA, and storing at-20 deg.C.

1.5 primer design and Synthesis

Primers were designed based on CDS sequence of genes such as bovine UCK2 published in NCBI, and the sequences of the primers are shown in the following table, and the primers were synthesized by Qingdao engine Co.

TABLE 6 primer sequences

1.6qRT-PCR amplification

The procedure was followed in the Roche Light Cycler 480 II fluorescent PCR instrument instructions. The quantitative RT-PCR reaction was performed by the SYBR method.

(1) Prepare 20uL PCR reaction system as follows:

TABLE 7qRT-PCR reaction System

Components	Dosage of
		Nucleic acid dye SYBR Green I	10uL
ddH₂O	8uL
		Upstream primer	0.5uL
Downstream primer	0.5uL
		cDNA	1uL
General System	20uL

(2) Reaction on a Roche Light Cycler 480 II fluorescent quantitative PCR instrument, UCK2 Gene PCR program: pre-denaturation at 94 ℃ for 10 min; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, and extension at 72 ℃ for 40s for 40 cycles; other genes PCR program and UCK2 gene is the same, only different annealing temperature. Each sample was repeated 3 times.

(3) Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is used as an internal reference gene for the standardization of gene expression data. Detecting CT value of each sample, averaging, and finally adopting 2^-△△CtThe method calculates the relative expression level of mRNA.

1.7 statistical analysis of data

The CT values of 4 genes of Blackett black cattle and Luxi yellow cattle are sorted and analyzed, and are sorted by EXECL2007, and then statistical analysis is carried out by adopting SPSS 17.0 software. The difference analysis of the two groups was performed by One-way ANOVA (One-way ANOVA), the data are expressed as mean ± standard deviation, the test level α is 0.05, and P <0.05 is statistically significant.

1.8 results and analysis

The results of fluorescence quantification are shown in FIG. 1 and Table 8. It is obvious from the figure and the table that the difference of mRNA expression levels of UCK2 genes of Blackett black cattle and Luxi yellow cattle is obvious, the UCK2 gene expression level of Blackett black cattle is obviously higher than that of Luxi yellow cattle (P is less than 0.01, the difference is extremely obvious), and the POLR1C gene, the POLR2D gene and the NT5C3 gene expression level are equivalent to that of the Luxi yellow cattle, namely the difference is not obvious (P is more than 0.05).

The fluorescent quantitative RT-PCR verifies that the change of the differential gene has good consistency with the result of sequencing data of the transcriptome, and also verifies the reliability of the data of the gene expression profile chip.

TABLE 8 relative expression levels of two bovine mRNAs

Gene	Blackett black cattle	Luxi yellow cattle
			UCK2	9.59*±0.95	1.71±0.34
POLR1C	1.07±0.23	1.00±0.38
			POLR2D	1.15±0.22	1.09±0.23
NT5C3	2.11±0.35	2.96±0.42

Note: p is less than 0.05

2. Conclusion

The main function of the UCK2 gene is to participate in metabolic pathway, and the high expression level indicates strong metabolic capability. There are significant species-to-species differences in the mRNA expression of UCK2, i.e., blaekett black cattle are significantly higher than luci cattle. This is consistent with the characteristics of better meat tenderness and good meat performance of black cattle.

Through research and analysis on UCK2 gene, mRNA expression level of UCK2 gene is different, meat quality and tenderness of cattle are different, and mRNA expression level of UCK2 gene is high, tenderness is high, and obvious corresponding relation exists among the mRNA expression level, so that the method for screening high-quality cattle species through detection on the gene is determined.

Example 2

And randomly extracting 54 Blackett black cattle, numbering each black cattle, evaluating the meat tenderness of each cattle after slaughtering, and recording. Meanwhile, the 7 th to 10 th intercostal eye flesh tissues of each black cattle are taken as samples to be detected to detect the expression quantity of UCK2 gene mRNA of each black cattle.

The detection method of UCK2 gene mRNA expression level is as follows:

(1) taking the 7 th-10 th intercostal eye flesh tissues of the black cattle as samples to be detected, extracting RNA according to the method of the embodiment 1, and then reversely transcribing the RNA into cDNA;

(2) a20 uL PCR reaction system was prepared as follows:

(3) Reaction on a Roche Light Cycler 480 II fluorescent quantitative PCR instrument, PCR program: pre-denaturation at 94 ℃ for 10 min; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, and extension at 72 ℃ for 40s for 40 cycles. Each sample was repeated 3 times.

(4) Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is used as an internal reference gene for the standardization of gene expression data. Detecting CT value of each sample, averaging, and finally adopting 2^-△△CtThe method calculates the relative expression level of mRNA.

The resulting mRNA expression level results are shown in FIG. 2. Comparing the mRNA expression level with the meat tenderness, finding that the meat tenderness of the cattle is good when the relative expression level threshold of UCK2 gene mRNA is more than or equal to 5, and meeting the requirement, thus determining that the black cattle with the relative expression level threshold of UCK2 gene mRNA more than or equal to 5 are high-quality cattle.

Sequence listing

<110> Dong Yuan Juan

<120> primer for amplifying Brickel black cattle UCK2 gene, kit for screening high-quality Brickel black cattle and method

<130> 20171030

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 786

<212> DNA

<213> Bos taurus

<400> 1

atggccgggg acagcgagcg ctgcctgcag aaccaccagc agcccaacgg cggcgagccc 60

ttcctgatcg gcgtatgatg gttcacggcc agcggcaagt cttccgtctg tgctaagatc 120

gtgcagctgc tggggcagaa cgaggtggac tatcgccaga agcaggtggt catcctgagc 180

caggacagct tctgccgcgg ctgcacttca gagcagaagg ttaaagccct gaagggccag 240

tgccactttg atcacccaga tgcctttgac aatgaactca tcttcaagac actcaaagaa 300

atcacggaag ggaaaactgt gaatattccc gtgtacgact ttgtttccca ttcccggaag 360

gaggagacgg ttactgtcta ccccgcagac gtggtgctct tcgaagggat cctggccttc 420

tactcccagg aagtgcgagt gttcttccag atgaagcttt ttgtggacac agatgcggac 480

acccggctct cccgcagaga tttaagggac atcagcgaaa gagggaggga ccttgagcag 540

attttatctt gatgcattac attcgtcaag cctgcctttg aggaattctg cttgccaaca 600

aagaagtatg ctgacgtgat cattccttta tatgcagata atctcgtggc catcaacctc 660

atcgtgcaag aaatccagga catcctgaac ggggggctct ccaaacgaca gaccaatggc 720

tatctcaacg gctacacccc ttcccgcaag aggcaggcct cggagtccag cagccggccg 780

cactga 786

<210> 2

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 2

aagggatcct ggccttcta 19

<210> 3

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 3

ttcgctgatg tcccttaata ctc 23

Claims

1. A method for screening high-quality cattle breeds of Blackett black cattle is characterized by comprising the following steps: the Blackett black cattle breed with high expression level of the UCK2 gene mRNA of the Blackett black cattle is selected as the high-quality cattle breed.

2. The method of claim 1, further comprising: in the fluorescent quantitative PCR detection method using GAPDH as an internal reference gene, a Blackett black cattle species with the UCK2 gene mRNA expression level more than or equal to 5 is selected as a high-quality cattle species.

3. A method according to claim 1 or 2, characterized by: the UCK2 gene mRNA expression level detection method comprises the following steps:

(1) taking a sample to be detected of a Blackett black cattle, extracting RNA of the sample to be detected, and then reversely transcribing the RNA into cDNA serving as a template for real-time fluorescence quantitative PCR amplification;

an upstream primer: 5 'AAGGGATCCTGGCCTTCTA 3'

A downstream primer: 5 'TTCGCTGATGTCCCTTAATACTC 3';

(3) the expression level of UCK2 gene mRNA is quantitatively analyzed by a real-time fluorescent quantitative PCR instrument, GAPDH is used as an internal reference gene, and the 2-delta Ct method is adopted for calculation and analysis.

4. The method of claim 3, wherein: in the step (1), the sample to be detected is a tissue sample or a blood sample of Blackett black cattle.

5. The method of claim 3, wherein: in the step (2), the reaction system of the real-time fluorescence quantitative PCR is as follows: 10uL of fluorescent dye, 0.5uL of each of the upstream and downstream primers, 1uL of cDNA, and 8uL of double distilled water, for a total of 20 uL.

6. The method of claim 3, wherein: in the step (2), the reaction conditions of the real-time fluorescence quantitative PCR are as follows: pre-denaturation at 94 ℃ for 10 min; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, and extension at 72 ℃ for 40s for 40 cycles.