CN107779404B - Ralstonia alba and culture method and application thereof - Google Patents

Ralstonia alba and culture method and application thereof Download PDF

Info

Publication number
CN107779404B
CN107779404B CN201611079486.8A CN201611079486A CN107779404B CN 107779404 B CN107779404 B CN 107779404B CN 201611079486 A CN201611079486 A CN 201611079486A CN 107779404 B CN107779404 B CN 107779404B
Authority
CN
China
Prior art keywords
pax
cacteus
irpex
treatment
culture medium
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201611079486.8A
Other languages
Chinese (zh)
Other versions
CN107779404A (en
Inventor
郭清子
郭尚印
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to CN201911227157.7A priority Critical patent/CN110791438A/en
Priority to CN201911226565.0A priority patent/CN110804557A/en
Publication of CN107779404A publication Critical patent/CN107779404A/en
Application granted granted Critical
Publication of CN107779404B publication Critical patent/CN107779404B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14—Fungi; Culture media therefor
    • C12N1/145—Fungal isolates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/645—Fungi ; Processes using fungi
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/06—Fungi, e.g. yeasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14—Fungi; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P1/00—Preparation of compounds or compositions, not provided for in groups C12P3/00 - C12P39/00, by using microorganisms or enzymes
    • C12P1/02—Preparation of compounds or compositions, not provided for in groups C12P3/00 - C12P39/00, by using microorganisms or enzymes by using fungi
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2250/00—Food ingredients
    • A23V2250/20—Natural extracts
    • A23V2250/208—Fungi extracts
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2300/00—Processes
    • A23V2300/14—Extraction

Abstract

The invention discloses a Rapex cacteus and a culture method and application thereof. The invention firstly provides Irpex lacteus (PAX-2014-1 with the preservation registration number of CGMCC NO.12519, which is called as the Irpex lacteus PAX-2014-1 for short. The invention also provides a preparation method of the extract of the irpex cacteus PAX-2014-1, which is characterized by comprising the following steps: the method comprises the following steps of taking the irpex cacteus PAX-2014-1 as a raw material: (a1) water extraction; (a2) precipitating with ethanol; (a3) and collecting the precipitate. The invention also protects a product, the active ingredients of which are as follows (c1) or (c 2): (c1) harpagophytum procumbens PAX-2014-1; (c2) the extract is prepared. The function of the product is as follows: treatment and/or prevention of gout; treatment and/or prevention of hyperuricemia; treatment and/or prevention of chronic glomerulonephritis; treatment and/or prevention of glomerulonephritis; treating and/or preventing nephritis. The invention has great application prospect.

Description

Ralstonia alba and culture method and application thereof
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a rakah odontophyllum and a culture method and application thereof.
Background
Irpex lacteus (Fr.) Fr. ], also known as Irpex lacteus, belongs to the order polyporales, the family of porpeziaceae (Meruliaceae), the genus Irpex, grows on standing, withered or fallen broad-leaved trees, and can cause white decay of wood, with annual, constant lying down and rolling back, and occasionally lateral growth.
The irpex cacteus is one of medicinal fungi in China, has the efficacy of treating symptoms such as oliguria, edema, lumbago, blood pressure increase and the like, and has anti-inflammatory activity. Moreover, because the harringtonia denticulata contains degradable enzymes such as ligninase, cellulase, laccase and the like and has higher growth speed, the harringtonia denticulata is widely applied to industries such as industrial papermaking, paper pulp modification, papermaking sewage treatment, printing and dyeing sewage treatment, beverage industry, clothing industry, organic synthesis and the like, and is used for treating and repairing the pollution of heavy metals.
Disclosure of Invention
The invention aims to provide a harringtonia alba and a culture method and application thereof.
The invention firstly provides Irpex lacteus (PAX-2014-1). Irpexlateus (Irpexlateus) PAX-2014-1, which has been deposited in China general microbiological culture Collection center (CGMCC, No. 3 of the institute of microbiology, China academy of sciences, North West Lu No.1 of the south Kogyo, Beijing) on 29 th 6 th in 2016, with the collection registration number of CGMCC NO. 12519. Ralstonia alba (Irpex lacteus) PAX-2014-1CGMCC NO.12519, which is called Ralstonia alba PAX-2014-1 for short.
The invention also protects a culture medium for culturing the irpex cacteus PAX-2014-1, which is a culture medium I or a culture medium II. The culture medium I comprises a carbon source, a nitrogen source, calcium carbonate, potassium dihydrogen sulfate, magnesium sulfate and water. The carbon-nitrogen ratio of the culture medium I is 3-15: 1. The carbon-nitrogen ratio of the culture medium I can be specifically 6.67: 1. 12.3: 1 or 9.23: 1. the culture medium II comprises a carbon source, a nitrogen source, a growth factor, potassium dihydrogen sulfate, magnesium sulfate and water. The carbon-nitrogen ratio of the culture medium II is 3-15: 1. The carbon-nitrogen ratio of the culture medium II can be specifically 6.67: 1. 12.3: 1 or 9.23: 1.
the culture medium I can be prepared from the following raw materials per liter: 45-60 g of carbon source, 20-35 g of nitrogen source, 0.5-0.6 g of calcium carbonate, 1.0-2.0 g of monopotassium phosphate, 0.5-1.5 g of magnesium sulfate and the balance of water. The culture medium I can be prepared from the following raw materials per liter: 45-60 g of carbon source, 15-20 g of peptone, 5-15 g of yeast extract, 0.5-0.6 g of calcium carbonate, 1.0-2.0 g of monopotassium phosphate, 0.5-1.5 g of magnesium sulfate and the balance of water.
The culture medium II can be prepared from the following raw materials per liter: 45-60 g of carbon source, 20-35 g of nitrogen source, 0.5-0.6 g of growth factor, 1.0-2.0 g of monopotassium phosphate, 0.5-1.5 g of magnesium sulfate and the balance of water. The culture medium II can be prepared from the following raw materials per liter: 45-60 g of carbon source, 15-20 g of peptone, 5-15 g of yeast extract, 0.5-0.6 g of growth factor, 1.0-2.0 g of monopotassium phosphate, 0.5-1.5 g of magnesium sulfate and the balance of water.
The carbon source may specifically be soluble starch and/or glucose.
The nitrogen source may be specifically peptone and/or yeast extract.
The culture medium I can be specifically a culture medium A, a culture medium B or a culture medium C.
The culture medium A per liter can be composed of the following raw materials: 60.0 g of soluble starch, 20.0 g of peptone, 15.0 g of yeast extract, 0.6 g of calcium carbonate, 2.0 g of monopotassium phosphate, 1.5 g of magnesium sulfate and the balance of water. The pH is natural.
The culture medium B per liter can be composed of the following raw materials: 60.0 g of glucose, 15.0 g of peptone, 5.0 g of yeast extract, 0.5 g of calcium carbonate, 1.0 g of monopotassium phosphate, 0.5 g of magnesium sulfate and the balance of water. The pH is natural.
The culture medium per liter can be specifically composed of the following raw materials: 45.0 g of glucose, 15.0 g of peptone, 5.0 g of yeast extract, 0.5 g of calcium carbonate, 1.0 g of monopotassium phosphate, 0.5 g of magnesium sulfate and the balance of water. The pH is natural.
The invention also provides a method for culturing the irpex cacteus PAX-2014-1, which comprises the following steps: the culture medium is adopted to culture the irpex cacteus PAX-2014-1.
The method specifically comprises the following steps:
(1) inoculating single colony of the irpex cacteus PAX-2014-1 on a PDA culture medium plate, and standing and culturing for 5 days at 30 ℃;
(2) the cake of 6 mm in diameter was punched out from the plate on which step (1) was performed, and the culture medium was inoculated into 1L at 12 cells per cake, and cultured at 30 ℃ for 72 hours with shaking at 150 rpm.
The culture medium provided by the invention has clear components. The culture medium provided by the invention for producing the irpex cacteus mycelium has the advantages of simple process, no heavy metal pollution, high thallus growth speed, high thallus yield, stable product quality and the like.
The invention also provides a preparation method of the extract of the irpex cacteus PAX-2014-1, which is characterized by comprising the following steps: the method comprises the following steps of taking the irpex cacteus PAX-2014-1 as a raw material:
(a1) water extraction;
(a2) precipitating with ethanol;
(a3) and collecting the precipitate.
The water extraction condition in the step (a1) can be specifically 90 ℃ standing extraction, the water extraction condition in the step (a1) can be specifically 90 ℃ standing extraction for 2-6 hours, the proportion of the harpagophytum pectiniferum PAX-2014-1 to water in the step (a1) can be 30-90 ml of water, and the step (a1) specifically comprises the steps of taking ① g of harpagophytum pectiniferum PAX-2014-1 (wet weight), adding 30 ml of water, standing extraction for 2 hours at 90 ℃, collecting supernatant, ② taking the residual thallus in the step ①, adding 30 ml of water, standing extraction for 2 hours at 90 ℃, collecting supernatant, ③ taking the residual thallus in the step ②, adding 30 ml of distilled water, standing extraction for 2 hours at 90 ℃, collecting supernatant, ④, combining the supernatant obtained in the step 4 and the step ②, and concentrating the supernatant into a third of the concentrated supernatant, wherein the concentrated supernatant is obtained in the step ③.
In the step (a2), the ethanol precipitation may be ethanol precipitation. In the step (a2), the alcohol precipitation condition may be specifically 4 ℃. In the step (a2), the alcohol precipitation condition may be specifically that the solution is allowed to stand at 4 ℃ for 24 hours. In the step (a2), the volume ratio of the concentrated solution to the absolute ethyl alcohol is 1: 3. the step (b3) specifically comprises the following steps: 1 part by volume of the concentrate obtained in step (a1) was mixed with 3 parts by volume of absolute ethanol, and the mixture was allowed to stand at 4 ℃ for 24 hours.
In the (a3), the precipitate was collected by centrifugation. The centrifugation conditions may specifically be: centrifuge at 8000rpm for 30 min.
The method further comprises the steps of: freeze-drying the precipitate obtained in (a3) to obtain a lyophilized powder.
The invention also provides a preparation method of the extract of the irpex cacteus PAX-2014-1, which sequentially comprises the following steps:
(b1) adopting any one of the culture media to culture the irpex cacteus PAX-2014-1, and then collecting thallus precipitates;
(b2) water extraction;
(b3) precipitating with ethanol;
(b4) and collecting the precipitate.
The step (b1) specifically comprises the following steps:
(1) inoculating single colony of the irpex cacteus PAX-2014-1 on a PDA culture medium plate, and standing and culturing for 5 days at 30 ℃;
(2) the cake of 6 mm in diameter was punched out from the plate on which step (1) was performed, and the culture medium was inoculated into 1L at 12 cells per cake, and cultured at 30 ℃ for 72 hours with shaking at 150 rpm.
(3) After the step (2) is finished, taking the whole culture system, centrifuging at 6000rpm for 20min, and collecting thalli precipitates.
The water extraction condition in the step (b2) can be specifically that the water extraction condition is 90 ℃ standing extraction, the water extraction condition in the step (b2) can be specifically that the water extraction condition is 90 ℃ standing extraction for 2-6 hours, the ratio of the thallus precipitate to water in the step (b2) can be 1 g of thallus precipitate (wet weight) and 30-90 ml of water, the step (b2) specifically comprises the steps of ① taking n g of the thallus precipitate, adding 30 n ml of water, standing extraction for 2 hours at 90 ℃, collecting supernatant, ② taking the thallus remaining in the step ①, adding 30 n ml of water, standing extraction for 2 hours at 90 ℃, collecting supernatant, ③ taking the thallus remaining in the step ②, adding 30 n ml of distilled water, standing extraction for 2 hours at 90 ℃, collecting supernatant, ④ combining the supernatant obtained in the step ①, the supernatant obtained in the step ② and the supernatant obtained in the step ③, then concentrating the mixture under reduced pressure to obtain a third volume of positive concentrated solution.
In the step (b3), the alcohol precipitation may be ethanol precipitation. In the step (b3), the alcohol precipitation condition may be specifically 4 ℃. In the step (b3), the alcohol precipitation condition may be specifically that the solution is allowed to stand at 4 ℃ for 24 hours. In the step (b3), the volume ratio of the concentrated solution to the absolute ethyl alcohol is 1: 3. the step (b3) specifically comprises the following steps: taking 1 volume part of the concentrated solution obtained in the step (b2), mixing with 3 volume parts of absolute ethyl alcohol, and standing at 4 ℃ for 24 hours.
In the (b4), the precipitate was collected by centrifugation. The centrifugation conditions may specifically be: centrifuge at 8000rpm for 30 min.
The method further comprises the steps of: and (c) freeze-drying the precipitate obtained in the step (b4) to obtain freeze-dried powder.
The extract prepared by any method is also in the protection scope of the invention.
The invention also protects a product, the active ingredients of which are as follows (c1) or (c 2):
(c1) harpagophytum procumbens PAX-2014-1;
(c2) any of the above extracts.
The function of the product is as follows (d1) and/or (d2) and/or (d3) and/or (d4) and/or (d 5):
(d1) treatment and/or prevention of gout;
(d2) treatment and/or prevention of hyperuricemia;
(d3) treatment and/or prevention of chronic glomerulonephritis;
(d4) treatment and/or prevention of glomerulonephritis;
(d5) treating and/or preventing nephritis.
The invention also protects the application of the irpex cacteus PAX-2014-1 or any one of the extracts in the preparation of products.
The function of the product is as follows (d1) and/or (d2) and/or (d3) and/or (d4) and/or (d 5):
(d1) treatment and/or prevention of gout;
(d2) treatment and/or prevention of hyperuricemia;
(d3) treatment and/or prevention of chronic glomerulonephritis;
(d4) treatment and/or prevention of glomerulonephritis;
(d5) treating and/or preventing nephritis.
The product is a medicine or a health product.
The invention provides a new strain of irpex cacteus, develops and optimizes a culture medium for culturing the new strain and prepares an extract of the strain. The extract of the irpex cacteus PAX-2014-1 has good curative effect on various diseases, has low side effect and has great application prospect.
Drawings
FIG. 1 is a photograph of strain PAX-2014-1 after 5 days of culture on potato dextrose agar medium at 25 ℃.
FIG. 2 is a photograph under a microscope of the hyphae of the strain PAX-2014-1.
Detailed Description
The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.
The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.
Control medium: cutting 200g of potato into blocks, boiling, filtering with gauze, collecting filtrate, adding 20g of glucose into the filtrate, and diluting with distilled water to 1000 ml.
PDA culture medium: 200g of potato is cut into blocks and boiled, filtered by gauze and the filtrate is collected, 20g of glucose and 20g of agar are added into the filtrate, and the volume is adjusted to 1000ml by distilled water.
Yishenkang capsule: changchun Yishenkang biopharmaceutical Co., Ltd.
The control irpex cacteus is preserved in China general microbiological culture Collection center with the preservation registration number of CGMCC NO. 1016. The control Rapex cacteus is described in patent application No. 201210461164.5 (the publication number of the patent is CN 102935095B; publication date is 2013-11-27).
Example 1 preparation of Rapex cacteus PAX-2014-1
First, isolation of the Strain
In 2014, a specimen of the irpex cacteus is collected from the Changbai mountain area of China, and then strains are separated through tissue blocks to obtain a plurality of pure cultured strains, wherein one strain is named as the strain PAX-2014-1.
II, identification of the strains
Morphological characteristics of the strain PAX-2014-1: the bacterial colony is white, thin and slightly raised cotton flocculent; the whole colony surface is radially arranged with dense cluster and feather aerial mycelium with interval and transparent mycelium with diameter of 1.2-4 μm and no locking combination. The photograph of the strain PAX-2014-1 after 5 days of culture on potato dextrose agar medium at 25 ℃ is shown in FIG. 1, which is a full plate with a diameter of 9 cm. The microscopic photograph of the hyphae of strain PAX-2014-1 is shown in FIG. 2.
The ITS sequence of the strain PAX-2014-1 is shown in the sequence 1 of the sequence table.
Third, preservation of the Strain
Irpex lacteus (PAX-2014-1) has been deposited in China general microbiological culture Collection center (CGMCC, No. 3 of the institute of microbiology, China academy of sciences) at 29.6.2016 under the China Committee for culture Collection of microorganisms, with the accession number of CGMCC No. 12519. Ralstonia alba (Irpex lacteus) PAX-2014-1CGMCC NO.12519, which is called Ralstonia alba PAX-2014-1 for short.
Example 2 culture of Rapex cacteus PAX-2014-1
Firstly, utilizing the carbon-nitrogen ratio of 6: 1 production of Rapex cacteus powder by Rapex cacteus semisynthetic culture medium
Medium a (natural pH): 60.0 g of soluble starch, 20.0 g of peptone, 15.0 g of yeast extract, 0.6 g of calcium carbonate, 2.0 g of monopotassium phosphate and 1.5 g of magnesium sulfate are taken, dissolved by distilled water and then the volume is fixed to 1000ml by distilled water. The carbon content in the starch is 40% (mass percentage content), the nitrogen content in the peptone is 9% (mass percentage content), and the nitrogen content in the yeast extract is 12% (mass percentage content). The mass ratio of carbon to nitrogen in the medium A is calculated to be 6.67: 1.
1. the single colony of the irpex cacteus PAX-2014-1 is inoculated on a PDA culture medium plate and is statically cultured for 5 days at the temperature of 30 ℃.
2. The 6 mm diameter cake was punched out from the plate for completion of step 1 using a punch, and every 12 cakes were inoculated into 1L medium A (or control medium) and cultured at 30 ℃ for 72 hours with shaking at 150 rpm.
3. After the step 2 is completed, the whole culture system is taken, centrifuged at 6000rpm for 20min, and thalli precipitates are collected.
4. And (4) freeze-drying the thallus precipitate obtained in the step (3) to obtain freeze-dried powder.
When the culture medium A is adopted, 15.25 g of freeze-dried powder is obtained per liter of culture system (average value of five repeated experiments).
Using the control medium, 3.83 g of lyophilized powder per liter of culture system were obtained (average of five replicates).
Secondly, utilizing the carbon-nitrogen ratio of 12: 1 production of Rapex cacteus powder by Rapex cacteus semisynthetic culture medium
And (3) culture medium B: 60.0 g of glucose, 15.0 g of peptone, 5.0 g of yeast extract, 0.5 g of calcium carbonate, 1.0 g of monopotassium phosphate and 0.5 g of magnesium sulfate are taken, dissolved by distilled water and then the volume is fixed to 1000ml by distilled water. The carbon content in glucose was 40% (mass percentage content), the nitrogen content in peptone was 9% (mass percentage content), and the nitrogen content in yeast extract was 12% (mass percentage content). The mass ratio of carbon to nitrogen in the culture medium B is calculated to be 12.3: 1.
1. the single colony of the irpex cacteus PAX-2014-1 is inoculated on a PDA culture medium plate and is statically cultured for 5 days at the temperature of 30 ℃.
2. The 6 mm diameter cake was punched out from the plate for completion of step 1 by a punch, and every 12 cakes were inoculated into 1L medium B (or control medium) and cultured at 30 ℃ for 72 hours with shaking at 150 rpm.
3. After the step 2 is completed, the whole culture system is taken, centrifuged at 6000rpm for 20min, and thalli precipitates are collected.
4. And (4) freeze-drying the thallus precipitate obtained in the step (3) to obtain freeze-dried powder.
When the culture medium B is adopted, 15.36 g of freeze-dried powder is obtained per liter of culture system (average value of five repeated experiments).
Using the control medium, 3.83 g of lyophilized powder per liter of culture system were obtained (average of five replicates).
Thirdly, utilizing the carbon-nitrogen ratio of 9: 1 producing the irpex cacteus powder by the irpex cacteus semisynthetic culture medium
Culture medium C: taking 45.0 g of glucose, 15.0 g of peptone, 5.0 g of yeast extract, 0.5 g of calcium carbonate, 1.0 g of monopotassium phosphate and 0.5 g of magnesium sulfate, dissolving with distilled water, and then fixing the volume to 1000ml with distilled water. The carbon content in glucose was 40% (mass percentage content), the nitrogen content in peptone was 9% (mass percentage content), and the nitrogen content in yeast extract was 12% (mass percentage content). The mass ratio of carbon to nitrogen in the culture medium C is calculated to be 9.23: 1.
1. the single colony of the irpex cacteus PAX-2014-1 is inoculated on a PDA culture medium plate and is statically cultured for 5 days at the temperature of 30 ℃.
2. The 6 mm diameter cake was punched out from the plate after completion of step 1 by a punch, and every 12 cakes were inoculated into 1L medium C (or control medium) and cultured at 30 ℃ for 72 hours with shaking at 150 rpm.
3. After the step 2 is completed, the whole culture system is taken, centrifuged at 6000rpm for 20min, and thalli precipitates are collected.
4. And (4) freeze-drying the thallus precipitate obtained in the step (3) to obtain freeze-dried powder.
Using medium C, 16.27 g of lyophilized powder per liter of culture system were obtained (average of five replicates).
Using the control medium, 3.83 g of lyophilized powder per liter of culture system were obtained (average of five replicates).
Example 3 preparation of capsules from Rapex cacteus PAX-2014-1
Culture medium C: taking 45.0 g of glucose, 15.0 g of peptone, 5.0 g of yeast extract, 0.5 g of calcium carbonate, 1.0 g of monopotassium phosphate and 0.5 g of magnesium sulfate, dissolving with distilled water, and then fixing the volume to 1000ml with distilled water.
1. The single colony of the irpex cacteus PAX-2014-1 is inoculated on a PDA culture medium plate and is statically cultured for 5 days at the temperature of 30 ℃.
2. The 6 mm diameter cake was punched out from the plate for completion of step 1 by a punch, and the cake was inoculated into 1L medium C at 30 ℃ for 72 hours with shaking at 150 rpm.
3. After the step 2 is completed, the whole culture system is taken, centrifuged at 6000rpm for 20min, and thalli precipitates are collected.
4. The bacterial pellet obtained in step 3 (wet weight: n g, n is positive number) was taken, 30 × n ml of distilled water was added, and the mixture was allowed to stand at 90 ℃ for 2 hours to extract, and the supernatant was collected.
5. And (4) adding 30 x n milliliters of distilled water into the residual thallus in the step (4), standing and extracting for 2 hours at 90 ℃, and collecting supernatant.
6. And (3) adding 30 x n milliliters of distilled water into the residual thallus in the step (5), standing and extracting for 2 hours at 90 ℃, and collecting supernatant.
7. And (3) combining the supernatant obtained in the step (4), the supernatant obtained in the step (5) and the supernatant obtained in the step (6), and then concentrating under reduced pressure to one third of the volume to obtain a concentrated solution.
8. And (3) mixing 1 volume part of the concentrated solution obtained in the step (7) with 3 volume parts of absolute ethyl alcohol, standing at 4 ℃ for 24 hours, centrifuging at 8000rpm for 30min, collecting precipitates, and freeze-drying to obtain freeze-dried powder.
9. And (3) filling 0.3g of the freeze-dried powder obtained in the step (8) into each capsule shell to obtain the PAX-2014-1 capsule.
And (3) replacing the irpex cacteus PAX-2014-1 with the control irpex cacteus to carry out the steps to obtain the control capsule.
Example 4 application of Rapex cacteus PAX-2014-1 in treating gout and hyperuricemia
24 patients with hyperuricemia complicated with gout (male 16 cases, female 8 cases), 4 patients with gout without hyperuricemia (male 2 cases, female 2 cases), and 4 patients with hyperuricemia without gout (all males). All the patients were informed consenting volunteers diagnosed in the third hospital. Of the patients, 22 men and 10 women had an age of 33-78 years and a course of disease of 5 months-6 years. The treatment process has eliminated: 1) pregnant women; 2) those allergic to the drug and any component thereof; 3) patients with serious primary diseases of cardiovascular, liver, hematopoietic system, etc.; 4) HIV patients and other severely immunocompromised persons; 5) psychotic patients; 6) it is not adhered to taking medicine.
The patients were treated as follows: the PAX-2014-1 capsule prepared in example 3 is taken 3 times a day for 3 times each time, and the capsule is continuously taken for 60 days.
After completion of the treatment, evaluation of the treatment effect and evaluation of side effects were carried out.
The criteria for the evaluation of the therapeutic effect were as follows:
the healing process comprises the steps of completely eliminating the pain, red swelling and other symptoms of ① diseased parts, enabling the uric acid content in ② serum to reach the health standard, and judging the healing process to be complete when the uric acid content in the 3526 serum meets the ① and ②;
① has obvious effects that compared with the prior treatment, the symptoms such as pain, red swelling and the like of the diseased region are obviously improved, the uric acid content in ② serum does not reach the health standard, but the reduced value of the uric acid content in the serum is more than or equal to 20 mu mol/L compared with the prior treatment, the pain of the ③ diseased region completely disappears, the uric acid content in the serum is not increased compared with the prior treatment, and the disease is judged to be effective when ③ is met or ① and ② are met;
① has obviously improved symptoms such as pain, red swelling and the like of the diseased part compared with before treatment, ② has no obvious reduction and no increase of the content of uric acid in the serum compared with before treatment, and the results of ① and ② are met to judge that the traditional Chinese medicine is effective;
①, compared with before treatment, the symptoms of pain, red swelling and the like of the diseased part are not obviously improved or aggravated, ② compared with before treatment, the content of uric acid in blood serum is not obviously reduced or increased, and the conditions of ① and ② are judged to be ineffective;
the health standard of the uric acid content in the blood serum comprises that the uric acid content in the blood serum of a male is 150-440 mu mol/L, and the uric acid content in the blood serum of a female is 95-360 mu mol/L.
The criteria for the evaluation of side effects were as follows: dry mouth and/or stomach discomfort and/or nausea.
The mean values of uric acid content, creatinine content and urea nitrogen content in the patient's serum before treatment (day before treatment started), after treatment (day after treatment ended) are shown in table 1.
TABLE 1
Before treatment After treatment
Uric acid (mu mol/L) 569,+/-182 512,+/-105
Creatinine (mu mol/L) 327.6,+/-114.6 238.5,+/-79.2
Urea nitrogen (mmol/L) 9.79,+/-5.81 7.75,+/-3.88
Of the 32 patients: 3 cases are cured, 14 cases are obviously effective, 11 cases are effective, 4 cases are ineffective, and the total effective rate is 87.5 percent; 17 cases in which pain completely disappeared at the affected site, and 28 cases in which the overall symptoms were significantly improved; 5 cases with dry mouth side effects, 4 cases with stomach upset side effects, 0 case with nausea side effects.
The results show that the irpex cacteus PAX-2014-1 extract can obviously improve the pain and red swelling symptoms of patients with hyperuricemia and/or gout, reduce the uric acid content, the creatinine content and the urea nitrogen content in blood serum and has low side effect.
Example 5 application of Rapex cacteus PAX-2014-1 in treatment of chronic glomerulonephritis
A first group: 129 patients with chronic glomerulonephritis (69 men and 60 women). Second group: 132 patients with chronic glomerulonephritis (64 men and 68 women). Third group: 132 patients with chronic glomerulonephritis (62 men and 70 women). All the patients were informed consenting volunteers diagnosed in the third hospital. The treatment process has eliminated: 1) pregnant women; 2) those allergic to the drug and any component thereof; 3) patients with serious primary diseases of cardiovascular, liver, hematopoietic system, etc.; 4) HIV patients and other severely immunocompromised persons; 5) psychotic patients; 6) it is not adhered to taking medicine.
Two groups of patients were treated as follows:
a first group: the PAX-2014-1 capsule prepared in example 3 is taken 2 capsules each time, 3 times a day and continuously for 30 days.
Second group: the control capsules prepared in example 3 were administered 2 capsules at a time, 3 times a day, for 30 consecutive days.
Third group: the capsule is administered 2 capsules each time, 3 times a day for 30 days.
The criteria for the evaluation of the therapeutic effect were as follows:
the recovery comprises that ① edema and other symptoms and signs completely disappear, ② urine protein examination is continuously negative and/or 24 hours urine protein quantification is continuously less than 200mg, ③ high power micturition erythrocyte disappears, ④ urine sediment count is normal, ⑤ renal function is recovered to be normal (the recovery of renal function is represented by normal creatinine content in serum and normal urea nitrogen content in serum, 62-115 mu mol/L in male serum is normal, 53-97 mu mol/L in female serum is normal, 3.2-7.1 mmol/L in serum is normal, and the requirements are met from ① to ⑤;
the obvious effect is that ① edema and other symptoms and signs basically disappear, the ② urine protein examination is continuously reduced by more than 50 percent, ③ high power urine red blood cells under the microscope are less than 3, the ④ urine sediment count is close to normal, the difference between ⑤ renal function and the normal value is not more than 15 percent, and the requirements of ① to ⑤ are met;
the clinical application has the advantages that ① edema and other symptoms and signs are obviously improved, ② urine protein examination is continuously reduced by 1 + or 24 hours, the quantitative urine protein is continuously reduced by more than 25 percent, ③ high-power urine red blood cells under a microscope are less than 5, ④ renal function is improved, and the requirements of ① to ④ are met;
and (4) invalidation: the clinical manifestations and the above examination items were not improved or aggravated significantly.
Of the 129 patients in the first group: 18 cases are cured, 45 cases are obviously effective, 65 cases are effective, 1 case is ineffective, and the total effective rate is 99.2%; there were 2 cases of dry mouth side effects and 1 case of stomach discomfort side effects.
In the second group of 132 patients, 16 patients are cured, 44 patients with obvious effect, 66 patients with effect and 6 patients with no effect, and the total effective rate is 95.4%; 6 cases with dry mouth side effects, 3 cases with stomach discomfort side effects, and 2 cases with anorexia side effects.
In 132 patients in the third group, 14 patients are cured, 40 patients with obvious effect, 69 patients with effect and 9 patients with no effect, and the total effective rate is 93.1%; 32 cases with dry mouth side effect, 40 cases with stomach discomfort side effect, 20 cases with anorexia side effect, and 12 cases with nausea side effect.
Sequence listing
<110> Guo Qing Zi Guo Shang seal
<120> a strain of irpex cacteus and culture method and application thereof
<130>GNCYX161649
<160>1
<210>1
<211>634
<212>DNA
<213> Irpex lacteus (Irpex lacteus)
<400>1
cattatcgag ttttgaacgg gttgtagctg gcctctcacg aggcatgtgc acgcctggct 60
catccactct taacctctgt gcactttatg taagagaaaa aaatggtgga agcttccagg 120
atctcgcgag aggtcttcgg ttgaacaagc cgtttttctttcttatgttt tactacaaac 180
gcttcagtta tagaatgtca actgtgtata acacatttat atacaacttt cagcaacgga 240
tctcttggct ctcgcatcga tgaagaacgc agcgaaatgc gataagtaat gtgaattgca 300
gaattcagtg aatcatcgaa tctttgaacg caccttgcac tccttggtat tccgaggagt 360
atgcctgttt gagtctcatg gtattctcaa cccctaaatt tttgtaatga aggtttagcg 420
ggcttggact tggaggttgt gtcggccctt gtcggtcgac tcctctgaaa tgcattagcg 480
tgaatcttac ggatcgcctt cagtgtgata attatctgcg ctgtggtgtt gaagtattta 540
tggtgttcat gcttcgaacc gtctccttgc cgagacaatc atttgacaat ctgagctcaa 600
atcaggtagg actacccgct gaacttaagc atat 634

Claims (3)

1. The collection number of the Irpex lacteus (PAX-2014-1) is CGMCC NO. 12519.
2. A pharmaceutical or health product comprising as an active ingredient the Rapex cacteus according to claim 1.
3. Use of the irpex cacteus of claim 1 for the preparation of a medicament or health product.
CN201611079486.8A 2016-08-31 2016-11-30 Ralstonia alba and culture method and application thereof Active CN107779404B (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN201911227157.7A CN110791438A (en) 2016-08-31 2016-11-30 Rapex cacteus extract and preparation method and application thereof
CN201911226565.0A CN110804557A (en) 2016-08-31 2016-11-30 Culture method and culture medium of irpex cacteus

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN201610783882 2016-08-31
CN2016107838822 2016-08-31

Related Child Applications (2)

Application Number Title Priority Date Filing Date
CN201911226565.0A Division CN110804557A (en) 2016-08-31 2016-11-30 Culture method and culture medium of irpex cacteus
CN201911227157.7A Division CN110791438A (en) 2016-08-31 2016-11-30 Rapex cacteus extract and preparation method and application thereof

Publications (2)

Publication Number Publication Date
CN107779404A CN107779404A (en) 2018-03-09
CN107779404B true CN107779404B (en) 2020-07-14

Family

ID=61437805

Family Applications (3)

Application Number Title Priority Date Filing Date
CN201911226565.0A Pending CN110804557A (en) 2016-08-31 2016-11-30 Culture method and culture medium of irpex cacteus
CN201611079486.8A Active CN107779404B (en) 2016-08-31 2016-11-30 Ralstonia alba and culture method and application thereof
CN201911227157.7A Pending CN110791438A (en) 2016-08-31 2016-11-30 Rapex cacteus extract and preparation method and application thereof

Family Applications Before (1)

Application Number Title Priority Date Filing Date
CN201911226565.0A Pending CN110804557A (en) 2016-08-31 2016-11-30 Culture method and culture medium of irpex cacteus

Family Applications After (1)

Application Number Title Priority Date Filing Date
CN201911227157.7A Pending CN110791438A (en) 2016-08-31 2016-11-30 Rapex cacteus extract and preparation method and application thereof

Country Status (1)

Country Link
CN (3) CN110804557A (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102380296B1 (en) * 2021-06-15 2022-03-28 롱런 메디칼 푸드 피티이. 엘티디. Culture broth of Irpex lacteus mycelium and composition comprising the same for preventing or treating diabetes mellitus

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1279159C (en) * 2003-12-12 2006-10-11 杨静 CZ-81 strain of 'Baibachi' bacterium and artificial culture method
CN1594539A (en) * 2004-06-30 2005-03-16 南京大学 Specific strain for degrading organic waste water of medicine production and its construction method
US8460897B1 (en) * 2009-12-17 2013-06-11 Eclipse Bioproducts, LLC Methods of culturing fungi and producing cellulases and chitin
CN102559513B (en) * 2011-12-19 2013-05-01 吉林大学 High-yield Irpex lacteus mutant strain and culture method thereof
CN102690147B (en) * 2012-06-06 2013-12-25 吉林大学 Liquid nutrient medium for Irpex lacteus fermentation and preparation method thereof
CN102935095B (en) * 2012-11-16 2013-11-27 长春益肾康生物制药有限公司 Bidirectional solid fermentation irpex cacteus mycoplasm extractive and preparation method and application thereof
CN104138395B (en) * 2014-07-11 2017-10-24 吉林大学 Purposes of the Irpex lacteus in anti-hypoxia medicament is prepared
US10604734B2 (en) * 2016-01-28 2020-03-31 University of Alaska Anchorage Thermal insulation material from mycelium and forestry byproducts
CN106635821B (en) * 2016-08-13 2019-10-25 辽宁省农业科学院微生物工程中心 A kind of mycorrhizal fungi and the preparation method and application thereof for promoting blueberry nutrient to absorb

Also Published As

Publication number Publication date
CN110791438A (en) 2020-02-14
CN110804557A (en) 2020-02-18
CN107779404A (en) 2018-03-09

Similar Documents

Publication Publication Date Title
CN103146592B (en) Microzyme converting ginsenoside Rb1 to generate Rd and application thereof
CN101492706A (en) Method for improving cordyceps sinensis bacterium native volume of production with cordyceps militaris link liquid fermentation
CN103966105B (en) One kind conversion ginsenoside Rg3Produce Rh2Aspergillus oryzae, production method and application
CN101531968B (en) Method for improving output of cordyceps militars fruiting body and cordycepin by adopting red yeast rice synergistic fermentation
CN107779404B (en) Ralstonia alba and culture method and application thereof
CN111437224B (en) Method for extracting antioxidant component from cannabis sativa leaves by using microorganisms and application of antioxidant component
CN105418785A (en) Production method and application of eleutherococcus senticosus polysaccharide
CN115895977A (en) Lactobacillus paracasei and application thereof
CN116355816A (en) Microorganism of fermented samara oil seed and blood lipid reducing composition thereof
CN103504286A (en) Method for extracting grifola frondosa mycelium based on membrane technology
CN106036281A (en) Cordyceps militaris fermented drink and production method thereof
CN101139569B (en) alpha-amylase inhibitor production bacterium and method for preparing alpha-amylase inhibitor and application
CN103911294A (en) Liquid fermentation method of ginseng-radix astragali-lucid ganoderma medical mycoplasm
CN110251499B (en) Dandelion extract and application thereof in preparing medicine for preventing and treating woman vaginal diseases
CN111345419A (en) Compound fermentation type shark cartilage powder health drink
CN112079938A (en) Highland barley polysaccharide extraction method, highland barley polysaccharide extract and application thereof
CN112535237A (en) Mangosteen fermentation extract, preparation method and application
CN112646728A (en) Aspergillus awamori and its application in preparing tannase and degrading tannin
CN112553088B (en) Endophytic fungus A871 extract, preparation method thereof and application thereof in preparing medicament for treating gout
CN103650920A (en) Method for fermenting ganoderma lucidum mycelia liquid rich in microelements
CN112626149B (en) Application of phellinus igniarius fermentation broth polysaccharide in anti-avian influenza virus medicine
CN111440735B (en) Baicalensis endophyte for producing cellulase and application of enzyme produced by same in extraction of baicalin from Baicalensis
CN114703064B (en) Method for extracting ganoderma lucidum by breaking cell walls of ganoderma lucidum and breaking cell walls of ganoderma lucidum by using trichoderma harzianum
CN113425750B (en) Preparation and application of microecological preparation with liver injury protection effect
AU2020102037A4 (en) A method of efficiently increasing the alpha-glucosidase inhibitor content in fresh mulberry leaves by the solid-state fermentation

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
TA01 Transfer of patent application right
TA01 Transfer of patent application right

Effective date of registration: 20191008

Address after: 116023 1-5-2, No. 14 1-5-2, C1 District, Xinghai Square, Shahekou District, Shahekou

Applicant after: Guo Qing Zi

Address before: 116023 1-5-2, No. 14 1-5-2, C1 District, Xinghai Square, Shahekou District, Shahekou

Applicant before: Guo Qing Zi

Applicant before: Guo Shang Yin

GR01 Patent grant
GR01 Patent grant