CN107760686A - The aptamer of the albumen of DKK 1 and its application - Google Patents
The aptamer of the albumen of DKK 1 and its application Download PDFInfo
- Publication number
- CN107760686A CN107760686A CN201610709646.6A CN201610709646A CN107760686A CN 107760686 A CN107760686 A CN 107760686A CN 201610709646 A CN201610709646 A CN 201610709646A CN 107760686 A CN107760686 A CN 107760686A
- Authority
- CN
- China
- Prior art keywords
- dkk
- aptamer
- albumen
- seq
- product
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7115—Nucleic acids or oligonucleotides having modified bases, i.e. other than adenine, guanine, cytosine, uracil or thymine
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Hematology (AREA)
- Microbiology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Urology & Nephrology (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Organic Chemistry (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- Cell Biology (AREA)
- Pathology (AREA)
- Biophysics (AREA)
- Food Science & Technology (AREA)
- Plant Pathology (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of aptamer of the identification albumen of DKK 1 or derivatives thereof, the aptamer has the nucleotide sequence shown in any one in SEQ ID NO.1~SEQ ID NO.24.The invention also discloses the application of above-mentioned aptamer or derivatives thereof.The aptamer of the albumen of DKK 1 of the present invention, can be with the efficient specific bond of the albumen of DKK 1, available for the albumen of DKK 1 or realization is captured from complex system to the vitro detection of the albumen of DKK 1, suitable for the purifying of the albumen of DKK 1, detection and the diagnosis of the relevant diseases of DKK 1, have a extensive future.
Description
Technical field
The present invention relates to technical field of bioengineering, more particularly to a kind of aptamer of DKK-1 albumen and its application.
Background technology
Dickkopf-1 (DKK-1) passes through Wnt/ beta-catenins (β-catenin) classical signals pathway and Wnt
Non-classical signal transduction path induced various types of tumors Apoptosis in vivo, regulates and controls Bone tumour and the promotion of kinds of tumor cells
The infiltration and invasion and attack of some tumour cells, so as to be played a significant role in terms of the occurrence and development of tumour.It has been reported that
DKK-1 can be used as the diagnosis marker of lung cancer and liver cancer.
Aptamer (aptamer) is the single stranded oligonucleotide that a kind of length is less than 100 bases, passes through SELEX
(Systematic Evolution of Ligands by Exponential Enrichment) technology is sieved from random library
Choosing obtains.The technology was initially reported in nineteen ninety, using two terminal sequences, it is known that library of the tundish containing 15~60 randomized bases as
Starting point, PCR amplification techniques index concentration and the oligonucleotides of target molecule specific bond, then prepare single stranded DNA or are transcribed into
RNA, put into the screening of next round.By 6~15 wheel incubation-elution-amplifications, and last wheel library is cloned, surveyed
Sequence, the aptamer of high specificity high with target affinity can be obtained.
Aptamer has some peculiar advantages compared to antibody.First, aptamer not only can specifically be known
Other various biomolecules, can also identify biomolecule, and it identifies that target includes metal ion, organic dyestuff, medicine, amino
Acid, protein, cell etc., the relatively low and virose target of immunogenicity can also obtain corresponding aptamers sequence；Second, core
Sour aptamers prepare that cost is cheap, and oligonucleotide molecules amount used is small, and immunogenicity is low, chemically synthesizes, be easy to modification and into
This is relatively low；Third, aptamer stable in physicochemical property, stability is good, is easy to preserve, insensitive to high temperature and drastic conditions.
Therefore, aptamer has a good application prospect.
The content of the invention
The invention solves the technical problem of the current aptamer for lacking specific binding DKK-1 albumen, there is provided one
The aptamer of kind of DKK-1 albumen, the aptamer can with the efficient specific bond of DKK-1 albumen, available for from complicated body
DKK-1 albumen is captured in system or is realized to the vitro detection of DKK-1 albumen, purifying, detection suitable for DKK-1 albumen and
The diagnosis of DKK-1 relevant diseases.
In order to solve the above-mentioned technical problem, the present invention is achieved through the following technical solutions:
In one aspect of the invention, there is provided a kind of aptamer of identification DKK-1 albumen or derivatives thereof, it is described
Aptamer has the nucleotide sequence shown in any one in SEQ ID NO.1~SEQ ID NO.24.
X in SEQ ID NO.12~SEQ ID NO.22 sequences is the modified base of following structures：
In the present invention, the derivative includes：
(1) by any one missing of nucleic acid aptamer sequence shown in SEQ ID NO.1~SEQ ID NO.24 or increase by one
Individual or multiple nucleotides, obtain the aptamer derivative with the aptamer identical function；
(2) any one progress base of nucleic acid aptamer sequence shown in SEQ ID NO.1~SEQ ID NO.24 is substituted
Or modification, obtain the aptamer derivative with the aptamer identical function；
(3) molecular skeleton of any one of nucleic acid aptamer sequence shown in SEQ ID NO.1~SEQ ID NO.24 is entered
Row modification, obtains the aptamer derivative with the aptamer identical function；
(4) as shown in SEQ ID NO.1~SEQ ID NO.24 aptamer encode peptide nucleic acid, obtain with it is described
The aptamer derivative of aptamer identical function；Or
(5) by one end or centre of any one of nucleic acid aptamer sequence shown in SEQ ID NO.1~SEQ ID NO.24
Signaling molecule and/or bioactive molecule and/or functional group are connected, obtains the aptamer with the aptamer identical function
Derivative.
In another aspect of this invention, there is provided above-mentioned aptamer or derivatives thereof is preparing capture and purifying DKK-
Application in the product of 1 albumen.
In another aspect of this invention, additionally provide above-mentioned aptamer or derivatives thereof and prepare vitro detection DKK-
Application in the product of 1 albumen.
In another aspect of this invention, additionally provide above-mentioned aptamer or derivatives thereof and prepare diagnosis or treatment
Application in the product of DKK-1 relevant diseases.The DKK-1 relevant diseases include lung cancer, liver cancer, the cancer of the esophagus, cancer of pancreas, marrow
Knurl, carcinoma of endometrium, cervical carcinoma, rheumatoid arthritis etc..
In another aspect of this invention, the product of a kind of purifying or vitro detection DKK-1 albumen is additionally provided, comprising at least
Nucleic acid aptamer sequence shown in one SEQ ID NO.1~SEQ ID NO.24.
In another aspect of this invention, a kind of product of diagnosis DKK-1 relevant diseases is additionally provided, includes at least one
Nucleic acid aptamer sequence shown in SEQ ID NO.1~SEQ ID NO.24.
The product includes kit or detection chip.
The aptamer that the present invention is combined with DKK-1 albumen differential high efficients, the capture of DKK-1 albumen, external inspection can be used for
Survey or the clinical diagnosis of DKK-1 relevant diseases, are had a extensive future, and the aptamer largely can be prepared manually, method letter
Single, cost is cheap, is advantageous to marketing.
Brief description of the drawings
The present invention is further detailed explanation with reference to the accompanying drawings and detailed description.
Fig. 1 is the DKK-1 albumen aptamers and target binding curve figure of the embodiment of the present invention 4；
Fig. 2 is the DKK-1 albumen aptamers and DKK-1 protein binding specificity verification result figures of the embodiment of the present invention 4；
Fig. 3 is pull-down knot of the common base aptamers of DKK-1 albumen of the embodiment of the present invention 4 in serum matrix
Fruit is schemed；
Fig. 4 is the DKK-1 albumen aptamers and target binding curve figure of the embodiment of the present invention 5；
Fig. 5 is the DKK-1 albumen aptamers and DKK-1 protein binding specificity verification result figures of the embodiment of the present invention 5；
Fig. 6 is the DKK-1 albumen aptamers and target binding curve figure of the embodiment of the present invention 6；
Fig. 7 is the DKK-1 albumen aptamers and DKK-1 protein binding specificity verification result figures of the embodiment of the present invention 6.
Embodiment
Because shortage can efficiently specifically bind the aptamer of DKK-1 albumen at present, the present invention is obtained by screening
A series of special aptamers for being directed to DKK-1 albumen, these aptamers can be with DKK-1 albumen high-affinity, height
Specific binding, has good application prospect.In order to screen these aptamers, the present invention synthesizes a both ends sequence first
Row are known, DNA library of the centre containing 30 randomized bases.Using DKK-1 albumen as target protein, using SELEX technology screenings
With high-affinity, DNA, RNA of high specific, modifying DNA aptamers.It is suitable by structure prediction software mfold analysis predictions
The secondary structure of part.By enzyme-linked aptamers detection technique (ELASA), pull down technical appraisement aptamers to target protein
Affinity and specificity, obtained multiple high with DKK-1 protein affinities, aptamers sequences of high specificity, those adaptations
Body can form each special loop-stem structure.
Aptamer of the invention containing modified base, its modified base have following structures：
In the present invention, the nucleic acid comprising modified base is synthesized by chemistry or biological method, and the modified base used leads to
Raw material is often used as using IAA-dU phosphoramidite or triguaiacyl phosphate derivative or its salt.
Preferably, IAA-dU triguaiacyl phosphate derivative is 5- [(3- indyls) propionyl amine-n-acrylic] -2 '-deoxidation
Uridylic acid (abbreviation IAA-dUTP), there is following structural formula：
Embodiment 1 passes through the aptamer without modifying DNA base screening DKK-1 albumen
The initial random library of chemical synthesis, sequence are as follows：
tagggaagagaaggacatatgat(SEQ ID NO.25)-N30-ttgactagtacatgaccacttga(SEQ
ID NO.26)
Wherein N30 is 30 random oligonucleotides.
Primer P1：TAGGGAAGAGAAGGACATATGAT(SEQ ID NO.27)
Primer P2：5’phosphorylation-TCAAGTGGTCATGTACTAGTCAA(SEQ ID NO.28)
The DKK-1 albumen that 50pmol contains 6 × His labels, 25 DEG C of incubation 30min are added in 1nmol libraries.Then add
Enter 50ul His-Mag magnetic beads, 25 DEG C of incubation 30min.Magnetic bead WB (137mM NaCl, 2.7mM KCl, 10mM Na2HPO4,
2mM KH2PO4,5mM MgCl2, 5mM imidazoles, 0.02%tween-20) clean three times, each 1ml.50ul is added in magnetic bead
500mM imidazoles, 1min is stored at room temperature, draws supernatant.Product pre- 6 circulations of amplification in 500ul PCR systems.Then with circulation
Number gradient experiment is determined to expand most suitable period, using pre- amplified production as template, with 5 pipe 50ul PCR systems, expanded respectively
6cycle、8cycle、10cycle、12cycle、14cycle.Product electrophoresis, select most suitable period and to screening product
Carry out amplification and prepare double-strand.Amplified production is quantified by purifying with Nanodrop.10 × digestions of 5ul are added in per 2ug products
Buffer solution, 1ul lambda excision enzymes, and 50ul, 37 DEG C of digestion 30min are complemented to water, obtain secondary library and be used for next round
Screening.Screening carries out six wheels altogether.
By screening, the common base DNA aptamers of following sequence are obtained：
Embodiment 2 screens the aptamer of DKK-1 albumen by modifying DNA base
The initial random library of chemical synthesis, sequence are as follows：
ATCCAGAGTGACGCAGCA(SEQ ID NO.29)-40N-TGGACACGGTGGCTTAGT(SEQ ID NO.30)
Wherein N40 is 40 random oligonucleotides.
Primer P3：5’phosphorylation-ATCCAGAGTGACGCAGCA(SEQ ID NO.31)
Primer P4：5’biotin-ACTAAGCCACCGTGTCCA(SEQ ID NO.32)
Prepare modified base library.Single-stranded for template with the common DNA of 5 ' terminal modified biotins, configuration scheme is as follows：10*
Buffer 25ul, P4 (100uM) 24ul, dA, dG, dC (each 2mM) 10ul, IAA-dUTP (5- [(3- indyls) propionyl amine-n -s
Acrylic] -2 '-deoxyuridylic acid) 10ul, KOD enzyme 10ul, water 71ul, template (20uM) 100ul.95 DEG C of 1min, 55 DEG C
1min, 72 DEG C of 1h.Product adds 300ul SA agarose bead, room temperature concussion 10min.After WB is washed three times, 700ul is added
150mM NaOH, room temperature concussion 5min.640ul supernatants are drawn, 160ul 600mM HCl is added and neutralizes.Using water as control,
Nanodrop determines Single stranded DNA concentration.Production concentration scope in 20~40ng/ul, A260/A280 scopes 1.60~1.80 it
Between.
After library is quantitative, the DKK-1 albumen that 50pmol contains 6 × His labels, 25 DEG C of incubations are added in 1nmol products
30min.Then add 50ul His-Mag magnetic beads (GE), 25 DEG C of incubation 30min.Magnetic bead WB (137mM NaCl, 2.7mM
KCl,10mM Na2HPO4,2mM KH2PO4,5mM MgCl2, 5mM imidazoles, 0.02%tween-20) clean three times, each 1ml.
50ul500mM imidazoles is added, is stored at room temperature 1min, draws supernatant.Product pre- 6 circulations of amplification in 500ul PCR systems.With
Determined to expand most suitable period with period gradient experiment afterwards, using pre- amplified production as template, with 5 pipe 50ul PCR systems,
6cycle, 8cycle, 10cycle, 12cycle, 14cycle are expanded respectively.Product electrophoresis, select most suitable period and right
Screening product carries out amplification and prepares double-strand.Amplified production prepares single-stranded, addition 50ul streptavidin magnetic beads, shake by paramagnetic particle method
10min is swung, WB is cleaned three times, each 1ml.It is single-stranded that 50ul 150mM NaOH elutions are added in magnetic bead, product addition
25ul300mM HCl are neutralized.Product, which extends to prepare modification chain and reclaim, to be quantified, and adding 10 × digestions of 5ul in every 2ug products delays
Fliud flushing, 1ul lambda excision enzymes, and 50ul digestions are complemented to water, obtain secondary library and screened for next round.Modify alkali
Base screening carries out six wheels altogether.
By screening, the modified base aptamer of following sequence is obtained, wherein, X=IAA-dU：
Embodiment 3 screens the aptamer of DKK-1 albumen by RNA bases
The initial random library of chemical synthesis, sequence are as follows：
ATCCAGAGTGACGCAGCA(SEQ ID NO.29)-40N-TGGACACGGTGGCTTAGT(SEQ ID NO.30)
Wherein N40 is 40 random oligonucleotides.
Primer P5：ATCCAGAGTGACGCAGCA(SEQ ID NO.31)
Primer P6：GATAATACGACTCACTATAGGGACTAAGCCACCGTGTCCA(SEQ ID NO.33)
Prepare RNA libraries.Single-stranded DNA library is template, and entering performing PCR with P5, P6 expands.Double-stranded products it is purified it is quantitative after
Add t7 rna polymerase transcription, 42 DEG C of 3h.Then add DNase I digestion DNA profiling, and with purification column purifying RNA.
Nanodrop determines RNA concentration.
After library is quantitative, the DKK-1 albumen that 50pmol contains 6 × His labels, 25 DEG C of incubations are added in 1nmol libraries
30min.Then add 50ul His-Mag magnetic beads (GE), 25 DEG C of incubation 30min.Magnetic bead WB (137mM NaCl, 2.7mM
KCl,10mM Na2HPO4,2mM KH2PO4,5mM MgCl2, 5mM imidazoles, 0.02%tween-20) clean three times, each 1ml.
200ul DEPC water is added in magnetic bead, 95 DEG C of 5min draw supernatant.Supernatant reverse transcription is true with period gradient experiment into after DNA
The most suitable period of fixed amplification, using reverse transcription product as template, with 5 pipe 50ul PCR systems, expand respectively 6cycle,
8cycle、10cycle、12cycle、14cycle.Product electrophoresis, select most suitable period and screening product is expanded
Increase and prepare double-strand.Amplified production obtains secondary library by responsive transcription and screened for next round.RNA screenings carry out six wheels altogether.
By screening, the RNA aptamers of following sequence are obtained：
The common base aptamer that the screening of embodiment 4 obtains is combined with DKK-1 protein-specifics
1. enzyme-linked aptamers adsorption experiment (ELASA)
DKK-1 albumen is taken to be diluted in PBS (preservation of pH7.4,0.22um membrane filtration), final concentration of 200ng/
mL；It is coated on 96 orifice plates per hole 50uL in the half transparent ELISA Plates of volume ELISA, shrouding is simultaneously incubated overnight in 4 DEG C.Abandon in hole
Liquid, fill each hole with cleaning solution, stand 10 seconds, dry, be repeated four times after being patted dry on blotting paper.If the individual concentration (root in 8 (9)
According to DKK-1 aptamers affinity, maximum concentration is set respectively), by biotin labeling DKK-1 aptamers in combination buffer times
Than dilution, each concentration does multiple holes.Concentration dilution liquid is added into each hole, per hole 50uL volumes, and set blank control wells and
BSA control wells.Shrouding, put 25 DEG C and be incubated 2 hours.After repeating manual board-washing step, add SA-HRP enzyme mark reaction solution 50uL per hole,
Shrouding, put 25 DEG C and be incubated 1 hour.Manual board-washing, 50uL TMB colour developing mixed liquors are added per hole, and 37 DEG C of shrouding juxtaposition is incubated 20 points
Clock.Add 50uL 1N H per hole2SO4Terminate liquid, mix.With ELIASA, (reference wavelength 630nm) is read respectively under wavelength 450nm
Hole OD values.
As a result as shown in figure 1, the common base aptamer that screening obtains has high-affinity with DKK-1 albumen, such as
DKK14 affinity costant is 17.956 ± 2.160nM；DKK58 affinity costant is 15.492 ± 1.741pM；DKK10's is affine
Constant is 1.277 ± 0.092nM.Moreover, the combination of these aptamers and DKK-1 albumen has high specific, with other
Albumen such as BSA albumen is hardly combined (see Fig. 2).
The common base aptamer pull-down experiments of 2.DKK-1 albumen
The pretreatment of serum matrix.100ng DKK-1 pure proteins are taken to be mixed into 50uL mixed human serums, incubation at room temperature 1
After hour, final volume 200uL is diluted to combination buffer；Draw 20uL streptavidin magnetic beads, the washing of 1mL combination buffers
2 times, above-mentioned serum sample is added in pre- washed magnetic bead, put after 25 DEG C of air rotations are incubated 1 hour and magnetic is separated in magnetic field
Pearl, take supernatant standby.Magnetic bead is coated with aptamer.20uL streptavidin magnetic beads are drawn, 1mL combination buffers are washed 2 times
200uL combination buffers are added afterwards, and adding the common nucleotides aptamers of 20pmol Sheng Gong companies synthesis, (negative control group is
It is not coated with the empty magnetic bead of aptamers), put 25 DEG C of air rotations and be incubated 1 hour, magnetic bead is collected in magnetic field, and 1mL combination buffers are washed
Wash, wash 3 times altogether.The serum matrix of pretreatment and the magnetic bead incubation for being coated with common nucleotides aptamers.By above-mentioned serum with
Magnetic bead mixing is placed in 25 DEG C of air rotations and is incubated 1 hour, and magnetic bead is collected in magnetic field, and the vibration of 1mL lavation buffer solutions is washed 3 minutes,
Wash 4 times altogether.Draw 20uL 1X SDS sample-loading buffers and mix the magnetic bead collected, denaturation elution is carried out in 95 DEG C of water-bath 5min.
The sample row 8%SDS-PAGE glue that will be obtained, finally carry out silver staining detection.
As a result as shown in figure 3, pull-down experiment in the common base aptamers of DKK-1 as capture probe in serotonin
Being capable of specific combination target proteinses in matter.In Fig. 3, swimming lane 1-7 is respectively：1.fermentas pre-dyed albumen marker
SM0671；2. negative control, pure protein X (50ng)；3. negative control：Empty magnetic bead is with adding the dilute of DKK-1 pure proteins (100ng)
Release serum matrix pull-down results；4,5. the magnetic bead of coating protein X aptamers and are mixed with X pure proteins (100ng) respectively
Dilute serum matrix pull-down results；6.DKK-1 pure proteins (50ng)；7. it is coated with the common base aptamers of Dkk1 albumen
Magnetic bead and the dilute serum matrix pull-down results for being mixed with DKK-1 pure proteins (100ng).
The modified base aptamer that the screening of embodiment 5 obtains is combined with DKK-1 protein-specifics
Enzyme-linked aptamers adsorption experiment (ELASA)
DKK-1 albumen is taken to be diluted in PBS (preservation of pH7.4,0.22um membrane filtration), final concentration of 200ng/
mL；It is coated on 96 orifice plates per hole 50uL in the half transparent ELISA Plates of volume ELISA, shrouding is simultaneously incubated overnight in 4 DEG C.Abandon in hole
Liquid, fill each hole with cleaning solution, stand 10 seconds, dry, be repeated four times after being patted dry on blotting paper.If the individual concentration (root in 8 (9)
According to DKK-1 modified base aptamers affinity, maximum concentration is set respectively), by biotin labeling DKK-1 modified base aptamers
The doubling dilution in combination buffer, each concentration do multiple holes.Concentration dilution liquid is added into each hole, per hole 50uL volumes, and
Blank control wells and BSA control wells are set.Shrouding, put 25 DEG C and be incubated 2 hours.After repeating manual board-washing step, add SA- per hole
HRP enzyme mark reaction solution 50uL, shrouding, put 25 DEG C and be incubated 1 hour.Manual board-washing, 50uL TMB colour developing mixed liquors, envelope are added per hole
37 DEG C of plate juxtaposition is incubated 20 minutes.Add 50uL 1N H per hole2SO4Terminate liquid, mix.(joined under wavelength 450nm with ELIASA
Examine wavelength 630nm) read each hole OD values.
As a result as shown in figure 4, the modified base aptamer that screening obtains has high-affinity with DKK-1 albumen, such as
DKK28 affinity costant is 84.480 ± 23.523nM；DKK32 affinity costant is 30.244 ± 2.459nM；DKK34 parent
It is 19.731 ± 0.805nM with constant.Moreover, the combination of these aptamers and DKK-1 albumen has high specific, with it
He is hardly combined (see Fig. 5) albumen.
The RNA aptamers that the screening of embodiment 6 obtains are combined with DKK-1 protein-specifics
Enzyme-linked aptamers adsorption experiment (ELASA)
DKK-1 albumen is taken to be diluted in PBS (preservation of pH7.4,0.22um membrane filtration), final concentration of 200ng/
mL；It is coated on 96 orifice plates per hole 50uL in the half transparent ELISA Plates of volume ELISA, shrouding is simultaneously incubated overnight in 4 DEG C.Abandon in hole
Liquid, fill each hole with cleaning solution, stand 10 seconds, dry, be repeated four times after being patted dry on blotting paper.If the individual concentration (root in 8 (9)
According to DKK-1 RNA aptamers affinity, maximum concentration is set respectively), biotin labeling DKK-1 RNA aptamers are being combined
Doubling dilution in buffer solution, each concentration do multiple holes.Concentration dilution liquid is added into each hole, per hole 50uL volumes, and sky is set
White control wells and BSA control wells.Shrouding, put 25 DEG C and be incubated 2 hours.After repeating manual board-washing step, add SA-HRP enzyme marks per hole
Reaction solution 50uL, shrouding, put 25 DEG C and be incubated 1 hour.Manual board-washing, 50uL TMB colour developing mixed liquors, shrouding juxtaposition are added per hole
37 DEG C are incubated 20 minutes.Add 50uL 1N H per hole2SO4Terminate liquid, mix.With ELIASA under wavelength 450nm (reference wavelength
630nm) read each hole OD values.
As a result as shown in fig. 6, the RNA aptamers that screening obtains have high-affinity, such as DKK40 with DKK-1 albumen
Affinity costant be 15.627 ± 1.156nM；DKK43 affinity costant is 8.582 ± 0.544nM.Moreover, these nucleic acid are adapted to
The combination of body and DKK-1 albumen has high specific, is hardly combined with other albumen (see Fig. 7).
Embodiment described above only expresses embodiments of the present invention, and its description is more specific and detailed, but can not
Therefore it is interpreted as the limitation to the scope of the claims of the present invention.It should be pointed out that for the person of ordinary skill of the art,
Without departing from the inventive concept of the premise, various modifications and improvements can be made, these belong to the protection model of the present invention
Enclose.Therefore, the protection domain of patent of the present invention should be determined by the appended claims.
Claims (9)
1. a kind of aptamer of identification DKK-1 albumen or derivatives thereof, the aptamer have SEQ ID NO.1~
Nucleotide sequence in SEQ ID NO.24 shown in any one.
2. aptamer according to claim 1 or derivatives thereof, it is characterised in that the SEQ ID NO.12~
X in SEQ ID NO.22 sequences is the modified base of following structures：
3. the answering in the product for preparing capture and purifying DKK-1 albumen of aptamer or derivatives thereof described in claim 1
With.
4. application of the aptamer or derivatives thereof described in claim 1 in the product for preparing vitro detection DKK-1 albumen.
5. aptamer or derivatives thereof described in claim 1 is in the product for preparing diagnosis or treatment DKK-1 relevant diseases
Application.
6. application according to claim 5, it is characterised in that the DKK-1 relevant diseases include lung cancer, liver cancer, oesophagus
Cancer, cancer of pancreas, myeloma, carcinoma of endometrium, cervical carcinoma, rheumatoid arthritis.
7. a kind of purifying or the product of vitro detection DKK-1 albumen, include at least one SEQ ID NO.1~SEQ ID NO.24
Shown nucleic acid aptamer sequence.
A kind of 8. product of diagnosis DKK-1 relevant diseases, comprising shown at least one SEQ ID NO.1~SEQ ID NO.24
Nucleic acid aptamer sequence.
9. the product according to claim 7 or 8, it is characterised in that the product includes kit, detection chip.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610709646.6A CN107760686B (en) | 2016-08-23 | 2016-08-23 | Aptamer of DKK-1 protein and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610709646.6A CN107760686B (en) | 2016-08-23 | 2016-08-23 | Aptamer of DKK-1 protein and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107760686A true CN107760686A (en) | 2018-03-06 |
| CN107760686B CN107760686B (en) | 2021-04-16 |
Family
ID=61264222
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610709646.6A Active CN107760686B (en) | 2016-08-23 | 2016-08-23 | Aptamer of DKK-1 protein and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107760686B (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109576272A (en) * | 2018-07-02 | 2019-04-05 | 广西医科大学 | A kind of DKK-1 aptamer and its application |
| CN110261340A (en) * | 2019-05-24 | 2019-09-20 | 同济大学 | A kind of quick visualization analyzes the method and sensor of a variety of phthalate total amount of pollutant |
| CN112121147A (en) * | 2019-06-24 | 2020-12-25 | 林霖 | Application of polypeptide in medicament for treating or preventing myeloma, polypeptide, nucleic acid, medicament and recombinant expression vector |
| CN114410638A (en) * | 2022-01-24 | 2022-04-29 | 郑州大学 | Nucleic acid aptamer and application thereof in esophageal cancer detection |
| CN114836426A (en) * | 2022-04-11 | 2022-08-02 | 中国科学院基础医学与肿瘤研究所(筹) | Aptamer combined with DKK1 protein and application thereof |
| WO2023046147A1 (en) * | 2021-09-26 | 2023-03-30 | 安沛治疗有限公司 | Aptamer for dkk1 and use thereof |
| RU2814580C1 (en) * | 2023-07-28 | 2024-03-01 | Федеральное государственное бюджетное учреждение науки Институт химической биологии и фундаментальной медицины Сибирского отделения Российской академии наук (ИХБФМ СО РАН) | Dna aptamer that specifically binds to human dickkopf-1 protein |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2446582A1 (en) * | 2001-05-17 | 2002-11-21 | Genome Therapeutics Corporation | Reagents and methods for modulating dkk-mediated interactions |
| CN104830867A (en) * | 2015-06-07 | 2015-08-12 | 杨洋 | Aptamer capable of being specifically combined with DKK1 protein in cancer cells |
-
2016
- 2016-08-23 CN CN201610709646.6A patent/CN107760686B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2446582A1 (en) * | 2001-05-17 | 2002-11-21 | Genome Therapeutics Corporation | Reagents and methods for modulating dkk-mediated interactions |
| CN104830867A (en) * | 2015-06-07 | 2015-08-12 | 杨洋 | Aptamer capable of being specifically combined with DKK1 protein in cancer cells |
Non-Patent Citations (2)
| Title |
|---|
| HAO YANG等: "Dickkopf-1: As a Diagnostic and Prognostic Serum Marker for Early Hepatocellular Carcinoma", 《INT J BIOL MARKERS》 * |
| 赵衡等: "DKK-1、DKK-2和GPC3蛋白在肝细胞癌组织中的表达及其临床意义", 《肿瘤》 * |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109576272A (en) * | 2018-07-02 | 2019-04-05 | 广西医科大学 | A kind of DKK-1 aptamer and its application |
| CN110261340A (en) * | 2019-05-24 | 2019-09-20 | 同济大学 | A kind of quick visualization analyzes the method and sensor of a variety of phthalate total amount of pollutant |
| CN112121147A (en) * | 2019-06-24 | 2020-12-25 | 林霖 | Application of polypeptide in medicament for treating or preventing myeloma, polypeptide, nucleic acid, medicament and recombinant expression vector |
| CN112121147B (en) * | 2019-06-24 | 2023-07-04 | 中国人民解放军海军特色医学中心 | Application of polypeptide in medicine for treating or preventing myeloma, polypeptide, nucleic acid, medicine and recombinant expression vector |
| WO2023046147A1 (en) * | 2021-09-26 | 2023-03-30 | 安沛治疗有限公司 | Aptamer for dkk1 and use thereof |
| CN114410638A (en) * | 2022-01-24 | 2022-04-29 | 郑州大学 | Nucleic acid aptamer and application thereof in esophageal cancer detection |
| CN114410638B (en) * | 2022-01-24 | 2023-04-14 | 郑州大学 | Nucleic acid aptamer and application thereof in esophageal cancer detection |
| CN114836426A (en) * | 2022-04-11 | 2022-08-02 | 中国科学院基础医学与肿瘤研究所(筹) | Aptamer combined with DKK1 protein and application thereof |
| CN114836426B (en) * | 2022-04-11 | 2023-07-25 | 中国科学院基础医学与肿瘤研究所(筹) | Nucleic acid aptamer combined with DKK1 protein and application thereof |
| RU2814580C1 (en) * | 2023-07-28 | 2024-03-01 | Федеральное государственное бюджетное учреждение науки Институт химической биологии и фундаментальной медицины Сибирского отделения Российской академии наук (ИХБФМ СО РАН) | Dna aptamer that specifically binds to human dickkopf-1 protein |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107760686B (en) | 2021-04-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107760686A (en) | The aptamer of the albumen of DKK 1 and its application | |
| US10858647B2 (en) | Removal of DNA fragments in mRNA production process | |
| US11396672B2 (en) | Composition and methods for detecting adenosine modifications | |
| US6730482B2 (en) | Modified SELEX processes without purified protein | |
| US6515120B1 (en) | Method for sequencing and characterizing polymeric biomolecules using aptamers and a method for producing aptamers | |
| JP2003508761A (en) | Method for encoding and selecting in vitro translated protein | |
| JP2003505094A (en) | Peptide acceptor ligation method | |
| WO2020223936A1 (en) | Construction method for high-quality rice ribosome imprint library | |
| CN103739664B (en) | Methods for separating and identifying DNA (deoxyribonucleic acid) binding protein through DNA co-immunoprecipitation | |
| CN107109698A (en) | RNA STITCH are sequenced：For RNA in directly mapping cell:The measure of RNA interactions | |
| CN114127282A (en) | Method for screening aptamer and immunoassay method using aptamer | |
| CN117487813B (en) | Single-stranded DNA aptamer sequence for specifically recognizing azithromycin and application thereof | |
| CN103882532B (en) | A kind of synthesis of lead compound and screening method and test kit | |
| JP2008253176A (en) | Linker for obtaining highly affinitive molecule | |
| JP5733784B2 (en) | Efficient synthesis of cDNA / mRNA-protein conjugates | |
| CN113621616A (en) | ssDNA aptamer for specifically recognizing ACE2 protein and application thereof | |
| CN104388426B (en) | A kind of Oligo dT primers and the method in construction cDNA library | |
| JP2004097213A (en) | Method for selecting nucleic acid and/or protein | |
| CN103882531A (en) | Method and kit for synthesizing and screening lead compound | |
| WO2003062417A1 (en) | Rna-dna ligation product and utilization thereof | |
| CN104774923B (en) | A kind of method for determining transcription control complex | |
| US20220267839A1 (en) | Target validation, binding site identification, and profiling of rna targets | |
| CN111334511B (en) | Aptamer for specifically recognizing bovine pregnancy-associated glycoprotein and application thereof | |
| JP2023504683A (en) | Methods of obtaining profiles for target molecular populations of samples | |
| IT201900015914A1 (en) | PROCEDURE TO PREPARE AN RNA SAMPLE FOR SEQUENCING AND RELATED KIT |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |