CN103882531A - Method and kit for synthesizing and screening lead compound - Google Patents
Method and kit for synthesizing and screening lead compound Download PDFInfo
- Publication number
- CN103882531A CN103882531A CN201210555088.4A CN201210555088A CN103882531A CN 103882531 A CN103882531 A CN 103882531A CN 201210555088 A CN201210555088 A CN 201210555088A CN 103882531 A CN103882531 A CN 103882531A
- Authority
- CN
- China
- Prior art keywords
- sequence
- building block
- stranded dna
- single stranded
- compound
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1068—Template (nucleic acid) mediated chemical library synthesis, e.g. chemical and enzymatical DNA-templated organic molecule synthesis, libraries prepared by non ribosomal polypeptide synthesis [NRPS], DNA/RNA-polymerase mediated polypeptide synthesis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1093—General methods of preparing gene libraries, not provided for in other subgroups
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
- C40B50/08—Liquid phase synthesis, i.e. wherein all library building blocks are in liquid phase or in solution during library creation; Particular methods of cleavage from the liquid support
- C40B50/10—Liquid phase synthesis, i.e. wherein all library building blocks are in liquid phase or in solution during library creation; Particular methods of cleavage from the liquid support involving encoding steps
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B20/00—Methods specially adapted for identifying library members
- C40B20/04—Identifying library members by means of a tag, label, or other readable or detectable entity associated with the library members, e.g. decoding processes
Abstract
The invention discloses a method for synthesizing and screening a lead compound. The method comprises the following steps of (1) taking raw materials: taking i synthetic building blocks and (i+2) single-chain DNA segments; (2) synthesizing with a combined chemistry method to obtain a single-chain DNA marked compound library, wherein initial synthetic building blocks are marked by fluorescent molecules; (3) screening: screening the compound DNA marked compound library; and (4) sequencing: taking the DNA marked compound obtained by screening of the step (3), sequencing DNA on the DNA marked compound, and determining the building block and reaction process of the compound according to the DNA sequence. The invention also discloses a kit for synthesizing and screening the lead compound, and a combined chemistry library. The method and the kit provided by the invention can synthesize and screen to obtain a target lead compound rapidly and effectively, and simultaneously, monitor the reaction process. Operations are simple and cost is low.
Description
Technical field
The present invention relates to chemical field, particularly relate to a kind of synthetic and screening method and test kit of lead compound.
Background technology
From the latter stage eighties, along with the development of the breakthrough-High Throughput Screening Assay of molecular biology research, the number of the needed recruit's entity of new drug development is more and more, scientists proceeds to attention compound group---the chemical libraries of synthetic high number from finding natural product, chemical libraries is made up of the organic compound of many different attributes.Combinatorial chemistry synthesis method is the technology in a kind of synthetic chemistry storehouse, uses this technology, and the building block of different series---reacted constituent lines up to form the diversified molecular entity group of large series in an orderly manner.Combinatorial chemistry synthesis method is often called numbers game by people, namely how to arrange the problem of numerous building blocks.Theoretically, combining synthetic total reaction product counts N and is determined by two factors, the building block number b of each step and synthetic step x, for example, for the linear combination reaction of three steps, if the reactant number of every step is respectively b1, b2, b3, the number of so theoretic total reaction product is N=b1b2b3.The target of combinatorial chemistry research is exactly all product N that how effectively to obtain this reaction.In recent years, synthetic from solid phase synthesis to quick Parallel-Liquid-Phase, combinatorial chemistry has been obtained breakthrough progress in synthetic method, conventional several synthetic methods have solid phase organic synthesis and liquid phase organic synthesis, solid phase organic synthesis comprises mixing splits point-score and parallel synthesis method, and liquid phase organic synthesis comprises multi component liquid phase synthesis method and functional group's conversion method.
In the chemical libraries that combinatorial chemistry synthetic technology is set up, product is thousands of, even more than one hundred million, and as classical organic synthesis, the qualification of purifies and separates is one by one no longer possible.High flux screening (High throughput screening, HTS) technology refers to taking the experimental technique of molecular level and cell levels as basis, using microplate format as experimental tool carrier, carry out process of the test with automation operating system, gather experimental result data with sensitive detecting instrument fast, with computer, experimental data is carried out to analyzing and processing, same time logarithm is in thousand, ten thousand sample detection, and supports the technical system of whole system running with corresponding database.High-throughput screening method has greatly improved speed and the efficiency of micromolecular compound screening, can from combinatorial chemistry library, screen the compound that acts on target molecules.But after compound being screened from chemical library with traditional high-throughput screening method, purifying also determines that the structure of target compound is very difficult, the time needing is long, and cost is high, and along with the expansion of library of compounds, difficulty is larger.
In order to address this problem, application number: 95193518.6, denomination of invention: the Patent Application Publication of " with the complex combination chemistry library of label coding " a kind of method, in synthetic each stage, for example carry out, on synthetic carrier (particle) at compound, carry out mark, to define the specific item (being often referred to added chemical reagent) of following when compou nd synthesis in company with on this carrier single-mindedly.Described mark completes with identifier molecule, and the sequenced item that between this point of subrecord synthesis phase, carrier granule experiences provides the reaction mechanism of production compound on this carrier thus.But this application does not provide the technical scheme that realizes the method.
In prior art, have report to use the synthesis unit of oligonucleotide tagged compound, according to the general knowledge of biological field, under normal condition, double-stranded DNA is stable compared with single stranded DNA, therefore conventionally selects double-stranded oligonucleotide to carry out mark to the synthesis unit of compound, as:
Notification number: EP0643778, denomination of invention: the patent of " encoded combinatorial chemical libraries " discloses the method with single stranded oligonucleotide labeled amino acid or polypeptide; Notification number: US7935658, denomination of invention: the patent of " methods for synthsis of encoded libraries " discloses a kind of with double chain DNA fragment mark building block, forms the method for library of compounds; Application number: WO/2010/094036, denomination of invention: the Patent Application Publication of " METHODS OF CREATING AND SCREENING DNA-ENCODED LIBRARIES " use oligonucleotide tagged compound, form the method for library of compounds, the double-stranded DNA that its oligonucleotide is hairpin structure.
But, during with double-stranded DNA mark building block or compound, in connection extension process, double-stranded DNA is easily crosslinked, form curling tertiary structure, when order-checking, need to unwind, operate more complicatedly, during with more than double-stranded DNA mark three steps linear combination reaction, the sequencing result error of double-stranded DNA is larger, cause the method can only rest on bidimensional, thereby can only increase compound quantity in library by increasing the building block number of every single step reaction, the library of compounds diversity making is poor, is difficult for the synthetic target compound that obtains.
Need to find newly, easy and simple to handle, result is marking method more accurately.
Summary of the invention
In order to address the above problem, the invention provides a kind of test kit and method of synthetic and screening of lead compound, and a kind of new combinatorial chemistry library.
Explanation of nouns:
Building block (Synthetic Building Block), is again synthon, refers to and possess micromolecular compound various physico-chemical properties and particular organisms chemical property, that must use in new drug (Western medicine, agricultural chemicals) R&D process.
Lead compound (lead compound) is called for short primer, is the compound with certain biological activity and chemical structure obtaining with means by all means, for further structure of modification and modification, is the starting point of modern new drug research.
Reaction mechanism: be exactly the process that reaction is experienced.
Be connected in series: refer to that between some sections of single stranded DNA sequences, two-end-point is connected successively, and on tie point, there is no branch.
The method of the synthetic and screening of lead compound of the present invention, it comprises the steps:
(1) get raw material: i kind building block and (i+2) kind single stranded DNA fragment, (i+2) to plant single stranded DNA fragment and comprise i kind flag sequence, a kind of top sequence and a kind of end sequence, i kind flag sequence is specific mark i kind building block respectively, wherein, i=1,2,3 ... n;
(2) use combinational chemistry synthetic compound:
A, prepare initial building block: select 1 ~ i kind building block fluorescent mark, again one end of top sequence is connected on building block, the specific mark sequence of the other end and described building block is connected in series, and obtains 1 ~ i kind and be marked with the initial building block of the single stranded DNA of an end dissociative;
B, the initial building block obtaining taking step a are basis, with the mode synthetic compound of linear combination reaction, in building-up process, often add new building block, the specific mark sequence that is just connected in series added building block at the single stranded DNA free end being connected with initial building block, extends described single stranded DNA, after end of synthesis gradually, be connected in series end sequence at described single stranded DNA free end, obtain the library of compounds of single stranded DNA mark;
(3) screening: screen in the library of the compound to DNA marker, selects target compound;
(4) order-checking: the DNA that step (3) is screened to the target compound obtaining checks order, and determines the structure of target compound.
Wherein, the described top of step (1) sequence comprises poly adenosine.Preferably, described poly adenosine is 12 ~ 20 adenosines.
Wherein, the length of the described flag sequence of step (1) is not less than 6bp.Preferably, the length of described flag sequence is 9 bp.
Wherein, in described step (2) building-up process, pH is 8 ~ 12, and temperature is 0 ~ 30 DEG C.
Wherein, 3 ' of the described flag sequence of step (1) end connects a ribonucleotide.Described ribonucleotide is cytidine.
In step (2), fluorescent mark is described in a step: get initial building block and fluorescence molecule, connect.
Described fluorescence molecule is 7-aminocoumarin-3-carbonic acid Acibenzolar, 7-diethylin tonka bean camphor-3-carbonic acid Acibenzolar, 7-aminocoumarin-3-carbonic acid Acibenzolar, ayapanin-3-carbonic acid Acibenzolar, 5/6-fluorescein carbonic acid Acibenzolar, fluorescein-5-lsothiocyanates (FITC), fluorescein-5 maleimide, 5-iodacetyl amido fluorescein, rhodamine 6G-5/6-carbonic acid Acibenzolar, sulfo group rhodamine B SULPHURYL CHLORIDE, X-rhodamine-6-carbonic acid Acibenzolar, sulfo group Rhodamine 101 SULPHURYL CHLORIDE, amino rhodamine-5/6-the carbonic acid of tetrem Acibenzolar, amino rhodamine-6-the maleimide of tetramethyl, Dallas Pink C2 maleimide, amino rhodamine-5/6-the lsothiocyanates of tetramethyl, amino rhodamine-5/6-the maleimide of tetramethyl, dansyl chloride, EDANS C2 maleimide, iodacetyl amido EDANS, NBD-X Acibenzolar, ThioGlo-1 or CHROMISL5HN azide.
Wherein, in step (2), in a step, top sequence with the method that initial building block is connected is:
By top sequence amination, initial building block carboxyl, sulfydryl or alkynyl, react and get final product.
Wherein, between step (2) described connection top sequence and flag sequence, flag sequence or the method for attachment of flag sequence and end sequence be: make 5 ' of single stranded DNA-end phosphorylation with many nucleoside kinases, connect with RNA ligase enzyme.Described many nucleoside kinases are the many nucleoside kinases of T4, and described RNA ligase enzyme is T4RNA ligase enzyme.
Wherein, the screening method in described step (3) is the screening method based on receptor-ligand specific reaction.
Synthetic and the screening reagent box of lead compound of the present invention, it comprises following composition:
1) i kind building block and (i+2) kind single stranded DNA fragment, single stranded DNA fragment is divided into top sequence, end sequence and i kind flag sequence, and i kind flag sequence is specific mark i kind building block respectively, wherein, i=1,2,3 ... n;
2) for fluorescent mark, reagent, top sequence are connected with building block with reagent, combinational chemistry reagent and single stranded DNA fragment connection reagent;
3) screening compound reagent;
4) DNA sequencing reagent.
Wherein, composition 1) described top sequence comprises poly adenosine.Preferably, described poly adenosine is 12 ~ 20 adenosines.
Wherein, composition 1) length of described flag sequence is not less than 6bp.Preferably, the length of described flag sequence is 9 bp.
Wherein, 3 ' of the described flag sequence of step (1) end connects a ribonucleotide.Described ribonucleotide is cytidine.
Wherein, composition 2) described fluorescent mark comprises fluorescence molecule with reagent.
Described fluorescence molecule is 7-aminocoumarin-3-carbonic acid Acibenzolar, 7-diethylin tonka bean camphor-3-carbonic acid Acibenzolar, 7-aminocoumarin-3-carbonic acid Acibenzolar, ayapanin-3-carbonic acid Acibenzolar, 5/6-fluorescein carbonic acid Acibenzolar, fluorescein-5-lsothiocyanates (FITC), fluorescein-5 maleimide, 5-iodacetyl amido fluorescein, rhodamine 6G-5/6-carbonic acid Acibenzolar, sulfo group rhodamine B SULPHURYL CHLORIDE, X-rhodamine-6-carbonic acid Acibenzolar, sulfo group Rhodamine 101 SULPHURYL CHLORIDE, amino rhodamine-5/6-the carbonic acid of tetrem Acibenzolar, amino rhodamine-6-the maleimide of tetramethyl, Dallas Pink C2 maleimide, amino rhodamine-5/6-the lsothiocyanates of tetramethyl, amino rhodamine-5/6-the maleimide of tetramethyl, dansyl chloride, EDANS C2 maleimide, iodacetyl amido EDANS, NBD-X Acibenzolar, ThioGlo-1 or CHROMISL5HN azide.
Wherein, composition 2) described top sequence is connected with building block by pack containing the reagent of amination single stranded DNA and the reagent of carboxyl, sulfydryl or the initial building block of alkynyl.
Wherein, composition 2) described single stranded DNA fragment connects and comprises multinuclear glycosides kinases and RNA ligase enzyme with reagent.
Preferably, described many nucleoside kinases are the many nucleoside kinases of T4, and described RNA ligase enzyme is that T4RNA ligase enzyme connects.
Combinatorial chemistry of the present invention library, it is taking building block as raw material, with the synthetic combinatorial chemistry library of combinational chemistry, wherein, each compound mark one section of single stranded DNA sequence and a fluorescence molecule, the structure of this single stranded DNA sequence is top sequence---i kind flag sequence---end sequence, the building block using in described i kind flag sequence specific mark i kind combinatorial chemistry building-up process, it puts in order identical with the addition sequence of building block in combinatorial chemistry building-up process.
Wherein, the length of described flag sequence is not less than 6bp.Preferably, the length of described flag sequence is 9 bp.
The length of flag sequence is 6 o'clock, can prepare 4096 not homotactic single stranded DNA fragments, DNA fragmentation coding, thousands of for the preparation of the building block in combinatorial chemistry library, can meet the needs that most compounds is synthetic and screen; Flag sequence is or 9 o'clock, can prepare 262144 not homotactic single stranded DNA fragments, its coding, reach 262144 for the preparation of the building block in combinatorial chemistry library, DNA fragmentation coding, millions of for the preparation of the building block in combinatorial chemistry library, can meet the needs of compou nd synthesis and screening completely.If flag sequence is longer, its building block quantity that can encode is larger, and the combinatorial chemistry library of preparation is larger, but corresponding, cost is higher, considers storage capacity and cost, and the length of flag sequence is 9 o'clock optimums.
Under condition of the present invention, with single stranded DNA mark building block, in connection procedure, can be not complementary between single stranded DNA and form double-strandedly, Stability Analysis of Structures, is also difficult for crosslinkedly, does not need to unwind when order-checking, simple to operate, quick, result is accurate.Therefore, the inventive method can comprise multistep linear combination reaction, and synthetic library of compounds diversity is good, and storage capacity is large, easily the synthetic target compound that obtains is also determined its building block, reaction mechanism and chemical structure, thus rapid synthetic a large amount of target compounds that obtain.
Mark fluorescence molecule on initial building block, after being connected with top sequence, carry out fluorescent imaging, dye band as standard using top sequence silver, by determining whether the two has band in same position, can accurately judge the whether successful connection of initial building block and top sequence; Similarly, in follow-up synthesis step, the compound of labeled ssdna molecule is carried out to fluorescent imaging, dye band as standard using identical single strand dna silver, by determining whether the two has band in same position, can accurately judge whether be connected with single strand dna on compound.Therefore, can by fluorescent mark deterministic compound and intermediate thereof whether mark DNA molecular, monitoring reaction process, has avoided the wasting of resources.
The inventive method is that synthesize and screening method in a kind of precise and high efficiency, lead compound library easy and simple to handle, with low cost, and application prospect is good.
The embodiment of form by the following examples, is described in further detail foregoing of the present invention.But this should be interpreted as to the scope of the above-mentioned theme of the present invention only limits to following embodiment.All technology realizing based on foregoing of the present invention all belong to scope of the present invention.
Brief description of the drawings
The process schematic diagram of combinational chemistry synthetic compound for Fig. 1 the present invention, wherein, " H " represents building block; " just " represents initiation sequence; " B " expressive notation sequence, its specific mark building block, the two corresponding relation of digitized representation, as, B1 specific mark H1; " end " represents end sequence; Left hurdle represents reactions steps, consistent with embodiment 1 reactions steps; The end product obtaining, building block only represents the addition sequence of building block from right to left, initiation sequence, flag sequence and end sequence represent the structure of the single stranded DNA sequence finally obtaining from left to right;
Fig. 2 the present invention chemistry library fluorescence imaging result.Mapping is dyed result for conventional silver, and right figure is fluorescence imaging result, swimming lane 1:DNA Marker; Swimming lane 2: the reaction with EDCI as activator.
The electrophorogram of the trypsin inhibitor that Fig. 3 the present invention chemistry library and screening obtain;
Fig. 4 sequencing result histogram, post is corresponding one by one with compound, and its height is relevant to the bonding force of this compound and target;
The IC50 collection of illustrative plates of Fig. 5 trypsin inhibitor of the present invention;
The IC50 collection of illustrative plates of Fig. 6 trypsin inhibitor of the present invention.
Embodiment
Form is by the following examples set forth embodiment, and foregoing of the present invention is described in further detail.But this should be interpreted as to the scope of the above-mentioned theme of the present invention only limits to following embodiment.All technology realizing based on foregoing of the present invention all belong to scope of the present invention.
Synthetic and the screening method of embodiment 1 lead compound of the present invention
1, preparation method
(1) get building block and single stranded DNA fragment:
I kind building block and (i+2) kind single stranded DNA fragment, (i+2) plant single stranded DNA fragment and comprise i kind flag sequence, a kind of top sequence and a kind of end sequence, and i kind flag sequence is specific mark i kind building block respectively, wherein, and i=1,2,3 ... n;
On following flag sequence, all can connect cytidine, improve the joint efficiency of follow-up single stranded DNA fragment.
Table 1 single stranded DNA fragment
(2) synthetic: as shown in Figure 1, to use combinational chemistry synthetic compound library:
a, prepare initial building block: select 1 ~ i kind building block fluorescent mark, by top sequence
one end is connected on building block, and the specific mark sequence of the other end and described building block is connected in series,
obtain the initial building block that 1 ~ i kind is marked with the single stranded DNA of an end dissociative, as, i=2;
1. initial building block is connected with top sequence:
Get top sequence, amination;
Get building block 1 and 2, (fluorescence molecule is 7-aminocoumarin-3-carbonic acid Acibenzolar to use respectively fluorescent mark, 7-diethylin tonka bean camphor-3-carbonic acid Acibenzolar, 7-aminocoumarin-3-carbonic acid Acibenzolar, ayapanin-3-carbonic acid Acibenzolar, 5/6-fluorescein carbonic acid Acibenzolar, fluorescein-5-lsothiocyanates (FITC), fluorescein-5 maleimide, 5-iodacetyl amido fluorescein, rhodamine 6G-5/6-carbonic acid Acibenzolar, sulfo group rhodamine B SULPHURYL CHLORIDE, X-rhodamine-6-carbonic acid Acibenzolar, sulfo group Rhodamine 101 SULPHURYL CHLORIDE, amino rhodamine-5/6-the carbonic acid of tetrem Acibenzolar, amino rhodamine-6-the maleimide of tetramethyl, Dallas Pink C2 maleimide, amino rhodamine-5/6-the lsothiocyanates of tetramethyl, amino rhodamine-5/6-the maleimide of tetramethyl, dansyl chloride, EDANS C2 maleimide, iodacetyl amido EDANS, NBD-X Acibenzolar, ThioGlo-1 or CHROMIS L5H N azide), carboxyl again, sulfydryl or alkynyl,
Carboxyl, sulfydryl or alkynyl; The building block 1 and 2 and the top serial response of activation of getting activation, must connect the initial building block of top sequence;
2. in top sequence, connect respectively the flag sequence (this method of attachment is except can be with following method, can also with the method for attachment of other single stranded DNAs) of building block 1 and 2:
Make 5 ' of single stranded DNA-end phosphorylation with many nucleoside kinases; RNA ligase enzyme connects;
3. mix, obtain initial building block mixture.
b, the initial building block obtaining taking step a are basis, by syntheticization of mode of linear combination reaction
compound, in building-up process, often adds new building block, just at the strand being connected with initial building block
dNA free end is connected in series the specific mark sequence of added building block, make described single stranded DNA by
gradually extend, after end of synthesis, be connected in series end sequence at described single stranded DNA free end, obtain
the library of compounds of single stranded DNA mark; Such as, three step linear combination reactions.
I：
1. synthetic (except following synthetic method, can also use other chemical synthesis process): get building block 3 ~ 4, be placed in 2 micro-scale reaction vessels, in the initial building block mixture making with step a respectively, mix, split point-score, parallel synthesis method, multi component liquid phase synthesis method or functional group's conversion method according to mixing synthetic;
2. the sequence of labelling: with step a step 2..
3. mix, obtain mixture.
Ⅱ：
1. synthetic (except following synthetic method, can also use other chemical synthesis process): get building block 5 ~ 6, be placed in 2 micro-scale reaction vessels, make mixture with step b respectively and mix, split point-score, parallel synthesis method, multi component liquid phase synthesis method or functional group's conversion method according to mixing synthetic;
2. the sequence of labelling: with step a step 2..
3. add end sequence: with step a step 2..
4. mix,
obtain the library of the compound of single stranded DNA mark.
(3) screening: screen in the library of the compound to DNA marker:
Chromatographic separation screening method based on receptor-ligand specific reaction, screen in the library of the compound with bio-target molecule to DNA marker.
Chromatogram is carried out to wash-out, the compound of the DNA marker of not being combined with biological target molecule is removed, separate the compound that obtains the DNA marker of being combined with bio-target molecule.
(4) order-checking:
Get the compound that step (3) is screened the DNA marker obtaining, to the DNA sequencing on the compound of DNA marker, can determine building block and the reaction mechanism of this compound according to DNA sequence dna.
1, material and reagent
T4PNK(500U?NEB-M0201V),T4?RNA?ligase1(NEB-M0204S),Cartridges(PCR?purification?Kit(cat.no?28104,Nucleotides?removal?Kit?cat.no?28306)purchased?from?Qiagen(Hilden,Germany).dNTPs(0.5mM,NEB,cat.no89009).
The fragment of single stranded DNA shown in table 1, synthetic by Genscript company and Biosune company.
2, preparation method
(1) prepare single stranded DNA fragment:
55 kinds of building blocks and 57 kinds of single stranded DNA fragments, 57 kinds of single stranded DNA fragments comprise 55 kinds of flags sequence, a kind of top sequence and a kind of end sequence;
On following flag sequence, all can connect cytidine, improve the joint efficiency of follow-up single stranded DNA fragment.
Table 2 single stranded DNA fragment
(2) synthetic:
a, prepare initial building block: select a kind of building block fluorescent mark, by one of top sequence
end is connected on building block, and the specific mark sequence of the other end and described building block is connected in series,
to a kind of initial building block of the single stranded DNA that is marked with an end dissociative;
1. initial building block is connected with top sequence:
Get top sequence, amination, gets building block 1 FITC mark, carboxylated; Get the synthetic of activation
the top serial response of building block 1 and activation, must connect the initial building block of top sequence.
Fluorescent mark: by building block 1(3.0mg, 0.023mmol) be dissolved in 1.0mL dimethyl sulfoxide (DMSO), under room temperature, be added dropwise to fluorescein isothiocyanate FITC(7.5mg, 0.019mmol) 1.0mL dimethyl sulphoxide solution.Reaction mixture is at room temperature after reaction overnight, by high performance liquid chromatography separation and purification.
Connect: reaction mixture cumulative volume is 150 microlitres, solvent is that water and methyl-sulphoxide volume ratio are 3:7, wherein containing triethylamine hydrochloric acid buffer system (pH10.0,80mM), wherein, the concentration of building block 1 is 30mM, activating reagent 1-ethyl-3-(3-dimethylamine propyl) carbodiimide hydrochloride (EDCI) concentration is 4mM, and 2-sulfonic group-N-hydroxy-succinamide concentration is 10mM, top sequence concentration is 20M, room temperature reaction 1 hour.
2. in top sequence, connect the flag sequence (this method of attachment is except can be with following method, can also with the method for attachment of other single stranded DNAs) of building block 1:
Make 5 ' of single stranded DNA-end phosphorylation with many nucleoside kinases; RNA ligase enzyme connects.
Connect: get 1. top after treatment sequence and flag sequence 1 of step, the reaction mixture of 15ul comprises the damping fluid of 225pmol top sequence, 25pmol flag sequence 1,50 T4RNA of unit ligase enzymes and ligation; This mixture is hatched 1.5h at 25 DEG C, after again 70 DEG C heating 20min, the sex change of T4RNA ligase enzyme; Add T4 polynucleotide kinase and 1nmATP, react 10 circulations, then hatching 20min at 75 DEG C makes extra many nucleoside kinases sex change;
Purifying: product is with in isopyknic 2 × sample-loading buffer, and this damping fluid comprises 40mMTris-HCL (pH7.6), 1M NaCL and 1mM EDTA;
The mixture obtaining purifying as follows: Qiagen Cartridge pillar on reaction solution; Suspend with 1 × sample-loading buffer; The centrifugal 1min of 1000rmp, with the filtration of silication glass wool; Rinse successively with 1 × sample-loading buffer, 0.5M NaCL solution and 80% ethanol; With 20ul PE elutriant wash-out; Vacuum-drying.
Detect: dye electrophoresis and fluorescence imaging with conventional silver and detect, fluoroscopic image and silver are dyed to image and align, on the image dying at silver, contrast and find corresponding band by the molecular weight of DNA before DNA Marker and reaction.If there is band in the corresponding position on fluoroscopic image, the covalently bound success of small molecules-DNA is described, the power of fluorescence response shows the quality that reaction is carried out.As shown in Figure 2, there is band in the corresponding position on fluoroscopic image in detected result, the covalently bound success of small molecules-DNA.Experimental result explanation, can be with the initial building block of fluorescent mark, so monitoring compound and intermediate thereof whether mark DNA molecular, avoid the wasting of resources.
b, the initial building block that obtains taking step a are basis, close by the mode that three step linear combinations are reacted
become compound, in building-up process, often add new building block, be just connected with initial building block
single stranded DNA free end is connected in series the specific mark sequence of added building block, makes described strand
dNA extends gradually, after end of synthesis, is connected in series end sequence at described single stranded DNA free end,
obtain the library of compounds of single stranded DNA mark;
first building block, i.e. initial building block (1): building block 1;
second batch building block (5): building block 2 ~ 6;
the 3rd batch of building block (49): building block 7 ~ 55;
I：
1. synthetic
Get building block 2 ~ 6, be placed in respectively 5 micro-scale reaction vessels, the initial building block making with step a mixes, and splits point-score, parallel synthesis method, multi component liquid phase synthesis method or functional group's conversion method synthetic according to mixing.
Be placed in respectively 5 micro-scale reaction vessels, the initial building block making with step a reacts.Taking building block 2 as example, reaction conditions is 150 microlitre reaction mixtures, solvent is that water and methyl-sulphoxide volume ratio are 3:7, wherein, containing triethylamine hydrochloric acid buffer system (pH9.0,80mM), the concentration of building block 1 is 30mM, activating reagent 1-ethyl-3-(3-dimethylamine propyl) carbodiimide hydrochloride (EDCI) 4mM, 2-sulfonic group-N-hydroxy-succinamide 10mM, the concentration 1.5M of building block 2, room temperature reaction 15 hours.
2. add respectively the flag sequence of building block 2 ~ 6: with step a step 2..
3. mix, obtain mixture.
Ⅱ：
1. synthetic
Get building block 7 ~ 55, be placed in respectively 49 micro-scale reaction vessels, the initial building block making with step a mixes, and splits point-score, parallel synthesis method, multi component liquid phase synthesis method or functional group's conversion method synthetic according to mixing.
Be placed in respectively 49 micro-scale reaction vessels, the initial building block making with step a reacts.Taking building block 2 as example, reaction conditions is 150 microlitre reaction mixtures, solvent is that water and methyl-sulphoxide volume ratio are 3:7, wherein, containing triethylamine hydrochloric acid buffer system (pH9.0,80mM), the concentration of building block 1 is 30mM, activating reagent 1-ethyl-3-(3-dimethylamine propyl) carbodiimide hydrochloride (EDCI) 4mM, 2-sulfonic group-N-hydroxy-succinamide 10mM, the concentration 1.5M of building block 2, room temperature reaction 15 hours.
2. the sequence of labelling: with step a step 2..
3. add end sequence: with step a step 2..
4. mix,
obtain the library of the compound of single stranded DNA mark.
(3) screening: screen in the library of the compound to DNA marker:
Chromatographic separation screening method based on receptor-ligand specific reaction, screen in the library of the compound with bio-target molecule to DNA marker.
1. CNBr resin activation:
1) 0.1033 gram of CBNr activation Sepharose4B resin, and they are divided into 2 is then inner static at the hydrogen chloride solution (PH3.0) of the 1mM of 4ml;
2) clean 15 minutes with hydrochloric acid (the pH value 3.0) scavenging solution of 1mM;
3) trypsinase of 4mg is dissolved in the coupling buffer (0.1M sodium bicarbonate, 0.5M sodium-chlor, pH value 8.3) of 0.5 milliliter;
4) slightly shake up and down mixture 1 hour, in room temperature or 4 DEG C of night incubation;
5) wash away unnecessary protein with 4ML coupling solution;
6) resin is proceeded in the Tris-HCl damping fluid (pH8.0) of 4mL0.1M, hatch 2 hours;
7) clean resin three times with cleaning buffer solution 1 and 2; (scavenging solution 1:0.1M acetic acid, 0.5M NaCl, pH4.0; , scavenging solution 2:0.1M Tris-HCl, 0.5M NaCl, pH8.0.)
8) centrifugation resin, 6000r/min, 10min.
2. trypsinase solidifying on activation CNBr resin
1) in the hydrochloric acid of the CNBr resin that takes 100 milligrams of activation as for 4 milliliters of 1mM, hatch;
2) clean with the 1mM hydrochloric acid (pH value 3.0) of 8mL;
3) by 0.004mg/ml, 0.02mg/ml, 0.1mg/ml, 0.5mg/ml, the trypsin solution of 2.5mg/ml activates CNBr mixed with resin with five parts respectively, hatches 5 hours at 4 DEG C;
4) with 0.1M Tris hydrochloric acid, 0.5M sodium-chlor, (pH value 8.3) solution cleans resin;
5) use 0.1M sodium-acetate, 0.5M sodium-chlor, (pH4.0) solution cleans resin;
6) repeat 4,5 steps, alternately clean at least 3 circulations.
7) resin curing trypsinase is kept at 4 DEG C to (pH7.4) in PBS damping fluid;
3. the affine screening in trypsinase compound storehouse
1) library of the compound of the single stranded DNA mark that the step (2) of getting obtains is mixed (17uL:255uL) with PBS damping fluid with 1:15 volume ratio;
2) respectively the library sample of 50 μ L is added to pancreas bovine trypsin/CNBr paste resin (2.5,0.5,0.1,0.02,0.004 and 0mg/mL);
3) prepare the herring sperm dna solution of 0.3 mg/ml with PBS damping fluid;
4) step 3) obtains herring sperm dna solution and step 2) pancreas bovine trypsin/CNBr paste resin of obtaining hatches 1 hour at 25 DEG C;
5) mixture of step 4) is transferred in the Spin pillar of 2ml, removed supernatant liquor;
6) with 200 μ L PBS damping fluid washing resins, repeat 4 times;
7) in the slurries after cleaning, add 100 μ L sterilized waters, screening obtains and trypsinase part sample.
Qualification: the library of compounds of getting the single stranded DNA mark that step (2) obtains screens the affine sample electrophoresis detection of the trypsinase obtaining with step (3).
Detected result as shown in Figure 3, is screened and is all obtained a target stripe with different concns pancreas bovine trypsin/CNBr paste resin, and negative control is blank band, illustrates that the present invention's screening has obtained the trypsinase part sample of purifying.
(4) order-checking:
Get the compound that step (3) is screened the DNA marker obtaining, to the DNA sequencing on the compound of DNA marker, can determine building block and the reaction mechanism of this compound according to DNA sequence dna:
Getting step (3) screens the sample obtaining and carries out polysaccharase link reaction (PCR), the oligonucleotide code of numeralization compound is carried out to pcr amplification (cumulative volume 50 microlitres, 30 circulations, 94 DEG C of each circulations 1 minute, 55 DEG C are reacted 1 minute, 72 DEG C are reacted 40 seconds), taking 5 μ L trypsinase 245 storehouses (concentration 100fM) as template.
Adopt Illumina Hiseq2000 high-flux sequence platform, order-checking flow process is as follows:
1) the screening oligonucleotide library after pcr amplification, utilizes the MAG-PCR-CL-250 test kit of Axygen company to carry out purifying and quality examination report;
2) utilize the Picogreen test kit of Illumina company to carry out nucleic acid quantification, draw sample nucleic acid concentration, carry out next step sequencing library preparation;
3) utilize the chip-seq DNA sample test kit of Illumina company specific Hiseq2000 sequence measuring joints (6 base length) to be connected on to 5 ' end and 3 ' ends of order-checking sample, be fixed to again above the chip chip-seq plate of Hiseq2000 sequenator, carry out next step bridge-type amplification;
4) utilize Truseq PE Cluster Kit v3-cBot-HS test kit to carry out the amplification of sample of nucleic acid bridge-type, on each chip-seq lane, obtain the nucleic acid bunch (cluster) that enough order-checking is used;
5) utilize the laser imaging system of Hiseq2000, the tape label dNTP of Truseq SBS Kit v3-HS (200cycles), each base appearance order and the frequency that record starts to read from sequence measuring joints, test sample of nucleic acid base;
6) lower machine takes out data, data processing.
As shown in Figure 4, sequence is as shown in SEQ ID NO.1 for sequencing result:
TCAGGCAGAGGCGATAGAGGCGATAGA, associative list 2 can determine that the structure of the trypsinase part that obtains of screening is as follows:
According to this structural formula, after synthetic this compound, detect, detect and determine that this compound is trypsin inhibitor, its Inhibiting enzyme activity is as shown in Fig. 5 ~ 6, and IC50 is 8.1 ± 2.1nM, illustrates that the compound that screening obtains is trypsinase part really.
Experimental result explanation, the present invention has built a chemical library of containing 245 compounds, and screening has obtained a trypsinase part, it has the tryptic activity of inhibition, illustrate that the inventive method can effectively synthesize and screen lead compound, fluorescent mark can effectively be monitored whole building-up process.
Synthetic and the screening reagent box of embodiment 3 lead compounds of the present invention
1, the composition of test kit of the present invention (the synthetic consumption of N building block)
1) i kind building block and i+2 kind single stranded DNA fragment, be divided into top sequence, end sequence and i kind flag sequence by single stranded DNA fragment, and i kind flag sequence is respectively the code of i kind building block, wherein, and i=1,2,3 ... n;
Table 3 building block and not homotactic single stranded DNA fragment
2) top sequence is connected with building block with reagent, synthetic reagent and the single stranded DNA fragment connection reagent used of combinational chemistry;
Table 4 top sequence is connected and uses reagent with building block
| Reagent name | Consumption |
| Triethylamine salt acid buffer, pH10.0 | （800mM，15ul） |
| 1-ethyl-3-(3-dimethylamine propyl) carbodiimide | （40mM，15ul） |
| 2-sulfonic group-N-hydroxy-succinamide | （100mM，15ul） |
Table 5 fluorescent mark reagent
| Reagent name | Consumption |
| Dimethyl sulfoxide (DMSO) | Volume: 2ml |
| Fluorescein isothiocyanate FITC | （7.5mg,0.019mmol） |
Table 6 combinatorial chemistry synthetic method reagent
| Reagent name | Consumption |
| Triethylamine salt acid buffer, pH9.0 | （800mM，15ul） |
| 1-ethyl-3-(3-dimethylamine propyl) carbodiimide | （40mM，15ul） |
| 2-sulfonic group-N-hydroxy-succinamide | （100mM，15ul） |
Table 7DNA fragment connection reagent
| Reagent name | Consumption |
| T4PNK(10U/ul) | N×10ul |
| 10×T4?RNA?ligase?buffer | N×10ul |
| ddH2O | N×77.4ul |
| T4RNA?ligase(10U/ul) | N×10ul |
| 10×T4?RNA?ligase?buffer | N×2.5ul |
| ATP(10mM) | N×0.1ul |
3) screening compound reagent;
Table 8 screening compound reagent
4) DNA sequencing reagent.
Table 9DNA order-checking reagent
| Purposes | Reagent name |
| PCR purifying | MAG-PCR-CL-250 |
| Nucleic acid quantification | Picogreen test kit |
| Library construction | chip-seq?DNA?sample?kit |
| Bridge-type amplification | Truseq?PE?Cluster?Kit?v3-cBot-HS |
| Upper machine order-checking | Truseq?SBS?Kit?v3-HS(200cycles) |
The method that test kit of the present invention provides according to the embodiment of the present invention 1 is used, and can be used for the synthetic and screening fast of lead compound.
To sum up, compared with prior art use double-stranded DNA mark building block, single stranded DNA mark building block for the present invention, in connection procedure, single stranded DNA can be not complementary, be difficult for being cross-linked, Stability Analysis of Structures, the pcr amplification of single stranded DNA and order-checking are more convenient, quick compared with double-stranded DNA; Screening obtains after target compound, can be easily and fast, determine accurately the single stranded DNA sequence of target-marking compound, thus determine building block, reaction mechanism and the chemical structure of the target compound of its mark, greatly improve screening efficiency; Mark fluorescence molecule on initial building block, deterministic compound and intermediate thereof whether mark DNA molecular, monitoring reaction process, has avoided the wasting of resources.
Synthetic and screening method and the test kit precise and high efficiency, easy and simple to handle, with low cost of lead compound of the present invention, have a good application prospect.
Claims (27)
1. a synthetic and screening method for lead compound, is characterized in that: it comprises the steps:
(1) get raw material: i kind building block and (i+2) kind single stranded DNA fragment, (i+2) to plant single stranded DNA fragment and comprise i kind flag sequence, a kind of top sequence and a kind of end sequence, i kind flag sequence is specific mark i kind building block respectively, wherein, i=1,2,3 ... n;
(2) with combinational chemistry synthetic compound library:
A, prepare initial building block: select 1 ~ i kind building block fluorescent mark, again one end of top sequence is connected on building block, the specific mark sequence of the other end and described building block is connected in series, and obtains 1 ~ i kind and be marked with the initial building block of the single stranded DNA of an end dissociative;
B, the initial building block obtaining with step a, with 1 ~ i kind building block, with the mode synthetic compound of linear combination reaction, in building-up process, often add new building block, be just connected in series the specific mark sequence of added building block at the single stranded DNA free end being connected with initial building block, described single stranded DNA is extended gradually, after end of synthesis, be connected in series end sequence at described single stranded DNA free end, obtain the library of compounds of single stranded DNA mark;
(3) screening: screen in the library of the compound to DNA marker, selects target compound;
(4) order-checking: the DNA that step (3) is screened to the target compound obtaining checks order, and determines building block and the reaction mechanism of target compound.
2. method according to claim 1, is characterized in that: the described top of step (1) sequence comprises poly adenosine.
3. method according to claim 2, is characterized in that: described poly adenosine is 12 ~ 20 adenosines.
4. method according to claim 1, is characterized in that: the length of the described flag sequence of step (1) is not less than 6bp.
5. method according to claim 4, is characterized in that: the length of described flag sequence is 9bp.
6. method according to claim 1, is characterized in that: 3 ' end of the described flag sequence of step (1) connects a ribonucleotide.
7. method according to claim 6, is characterized in that: described ribonucleotide is cytidine.
8. method according to claim 1, is characterized in that: in step (2), the fluorescence molecule that fluorescent mark uses described in a step is 7-aminocoumarin-3-carbonic acid Acibenzolar, 7-diethylin tonka bean camphor-3-carbonic acid Acibenzolar, 7-aminocoumarin-3-carbonic acid Acibenzolar, ayapanin-3-carbonic acid Acibenzolar, 5/6-fluorescein carbonic acid Acibenzolar, fluorescein-5-lsothiocyanates (FITC), fluorescein-5 maleimide, 5-iodacetyl amido fluorescein, rhodamine 6G-5/6-carbonic acid Acibenzolar, sulfo group rhodamine B SULPHURYL CHLORIDE, X-rhodamine-6-carbonic acid Acibenzolar, sulfo group Rhodamine 101 SULPHURYL CHLORIDE, amino rhodamine-5/6-the carbonic acid of tetrem Acibenzolar, amino rhodamine-6-the maleimide of tetramethyl, Dallas Pink C2 maleimide, amino rhodamine-5/6-the lsothiocyanates of tetramethyl, amino rhodamine-5/6-the maleimide of tetramethyl, dansyl chloride, EDANS C2 maleimide, iodacetyl amido EDANS, NBD-X Acibenzolar, ThioGlo-1 or CHROMIS L5H N azide.
9. method according to claim 1, is characterized in that: in step (2), in a step, top sequence with the method that initial building block is connected is:
By top sequence amination, initial building block carboxyl, sulfydryl or alkynyl, react and get final product.
10. method according to claim 1, is characterized in that: in step (2), building-up process pH is 8 ~ 12, and temperature is 0 ~ 30 DEG C.
11. methods according to claim 1, it is characterized in that: in step (2), between top sequence and flag sequence, flag sequence or the method for attachment of flag sequence and end sequence be: make 5 ' of single stranded DNA-end phosphorylation with many nucleoside kinases, connect with RNA ligase enzyme.
12. methods according to claim 11, is characterized in that: described many nucleoside kinases are the many nucleoside kinases of T4, and described RNA ligase enzyme is T4RNA ligase enzyme.
13. methods according to claim 1, is characterized in that: the described screening method of step (3) is the screening method based on receptor-ligand specific reaction.
Synthetic and the screening reagent box of 14. 1 kinds of lead compounds, is characterized in that: it comprises following composition:
1) i kind building block and (i+2) kind single stranded DNA fragment, (i+2) plant single stranded DNA fragment and comprise i kind flag sequence, a kind of top sequence and a kind of end sequence, and i kind mark is sequence specific mark i kind building block respectively, wherein, and i=1,2,3 ... n;
2) for fluorescent mark, reagent, top sequence are connected with initial building block with reagent, synthetic reagent and the single stranded DNA fragment connection reagent used of combinational chemistry;
3) screening compound reagent;
4) DNA sequencing reagent.
15. test kits according to claim 14, is characterized in that: composition 1) described top sequence comprises poly adenosine.
16. test kits according to claim 15, is characterized in that: described poly adenosine is 12 ~ 20 adenosines.
17. test kits according to claim 14, is characterized in that: composition 1) length of described flag sequence is not less than 6bp.
18. test kits according to claim 17, is characterized in that: the length of described flag sequence is 9bp.
19. test kits according to claim 14, is characterized in that: composition 1) described flag sequence 3 ' end connect a ribonucleotide.
20. test kits according to claim 19, is characterized in that: described ribonucleotide is cytidine.
21. according to the test kit described in claim 14, it is characterized in that: composition 2) described fluorescent mark reagent comprises fluorescence molecule, described fluorescence molecule is 7-aminocoumarin-3-carbonic acid Acibenzolar, 7-diethylin tonka bean camphor-3-carbonic acid Acibenzolar, 7-aminocoumarin-3-carbonic acid Acibenzolar, ayapanin-3-carbonic acid Acibenzolar, 5/6-fluorescein carbonic acid Acibenzolar, fluorescein-5-lsothiocyanates (FITC), fluorescein-5 maleimide, 5-iodacetyl amido fluorescein, rhodamine 6G-5/6-carbonic acid Acibenzolar, sulfo group rhodamine B SULPHURYL CHLORIDE, X-rhodamine-6-carbonic acid Acibenzolar, sulfo group Rhodamine 101 SULPHURYL CHLORIDE, amino rhodamine-5/6-the carbonic acid of tetrem Acibenzolar, amino rhodamine-6-the maleimide of tetramethyl, Dallas Pink C2 maleimide, amino rhodamine-5/6-the lsothiocyanates of tetramethyl, amino rhodamine-5/6-the maleimide of tetramethyl, dansyl chloride, EDANS C2 maleimide, iodacetyl amido EDANS, NBD-X Acibenzolar, ThioGlo-1 or CHROMIS L5H N azide.
22. test kits according to claim 14, is characterized in that: composition 2) described top sequence is connected with building block by pack containing the reagent of amination single stranded DNA and the reagent of carboxyl, sulfydryl or alkynyl building block.
23. test kits according to claim 14, is characterized in that: composition 2) described single stranded DNA fragment connects and comprises multinuclear glycosides kinases and RNA ligase enzyme with reagent.
24. test kits according to claim 23, is characterized in that: described many nucleoside kinases are the many nucleoside kinases of T4, and described RNA ligase enzyme is that T4RNA ligase enzyme connects.
25. 1 kinds of combinatorial chemistry libraries, it is characterized in that: it is taking building block as raw material, with the synthetic combinatorial chemistry library of combinational chemistry, wherein, each compound mark one section of single stranded DNA sequence and a fluorescence molecule, the structure of this single stranded DNA sequence is top sequence---i kind flag sequence---end sequence, the building block using in described i kind flag sequence specific mark i kind combinatorial chemistry building-up process, it puts in order identical with the addition sequence of building block in combinatorial chemistry building-up process.
26. combinatorial chemistry according to claim 25 libraries, is characterized in that: the length of described flag sequence is not less than 6bp.
27. combinatorial chemistry according to claim 26 libraries, is characterized in that: the length of described flag sequence is 9 bp.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210555088.4A CN103882531B (en) | 2012-12-20 | 2012-12-20 | A kind of synthesis of lead compound and screening method and test kit |
| PCT/CN2013/089875 WO2014094621A1 (en) | 2012-12-20 | 2013-12-18 | Lead compound synthesis and screening method and kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210555088.4A CN103882531B (en) | 2012-12-20 | 2012-12-20 | A kind of synthesis of lead compound and screening method and test kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103882531A true CN103882531A (en) | 2014-06-25 |
| CN103882531B CN103882531B (en) | 2015-12-09 |
Family
ID=50951640
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210555088.4A Active CN103882531B (en) | 2012-12-20 | 2012-12-20 | A kind of synthesis of lead compound and screening method and test kit |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN103882531B (en) |
| WO (1) | WO2014094621A1 (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108070009A (en) * | 2017-12-12 | 2018-05-25 | 上海药明康德新药开发有限公司 | A kind of method for preparing DNA encoding library of compounds and starting head fragment compound and DNA encoding compound obtained |
| CN110658163A (en) * | 2018-06-29 | 2020-01-07 | 成都先导药物开发股份有限公司 | Method for monitoring reaction in synthesis of DNA coding compound |
| WO2020015683A1 (en) * | 2018-07-18 | 2020-01-23 | Shanghaitech University | Functionality independent labeling of organic compounds |
| CN112794874A (en) * | 2019-11-13 | 2021-05-14 | 成都先导药物开发股份有限公司 | Synthesis method of On-DNA Petasis reaction |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20020192707A1 (en) * | 1999-09-29 | 2002-12-19 | Pharmacia & Upjohn | Methods for creating a compound library |
| CN1898257A (en) * | 2003-12-17 | 2007-01-17 | 普雷西斯药品公司 | Methods for synthesis of encoded libraries |
| US7377894B2 (en) * | 1999-09-29 | 2008-05-27 | Pharmacia & Upjohn Company | Methods for creating a compound library and identifying lead chemical templates and ligands for target molecules |
-
2012
- 2012-12-20 CN CN201210555088.4A patent/CN103882531B/en active Active
-
2013
- 2013-12-18 WO PCT/CN2013/089875 patent/WO2014094621A1/en active Application Filing
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20020192707A1 (en) * | 1999-09-29 | 2002-12-19 | Pharmacia & Upjohn | Methods for creating a compound library |
| US7377894B2 (en) * | 1999-09-29 | 2008-05-27 | Pharmacia & Upjohn Company | Methods for creating a compound library and identifying lead chemical templates and ligands for target molecules |
| CN1898257A (en) * | 2003-12-17 | 2007-01-17 | 普雷西斯药品公司 | Methods for synthesis of encoded libraries |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108070009A (en) * | 2017-12-12 | 2018-05-25 | 上海药明康德新药开发有限公司 | A kind of method for preparing DNA encoding library of compounds and starting head fragment compound and DNA encoding compound obtained |
| CN108070009B (en) * | 2017-12-12 | 2021-04-13 | 上海药明康德新药开发有限公司 | Method for preparing DNA coding compound library and initial fragment compound and prepared DNA coding compound |
| CN110658163A (en) * | 2018-06-29 | 2020-01-07 | 成都先导药物开发股份有限公司 | Method for monitoring reaction in synthesis of DNA coding compound |
| WO2020015683A1 (en) * | 2018-07-18 | 2020-01-23 | Shanghaitech University | Functionality independent labeling of organic compounds |
| CN112794874A (en) * | 2019-11-13 | 2021-05-14 | 成都先导药物开发股份有限公司 | Synthesis method of On-DNA Petasis reaction |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103882531B (en) | 2015-12-09 |
| WO2014094621A1 (en) | 2014-06-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10895019B2 (en) | Encoded self-assembling chemical libraries (ESACHEL) | |
| US20240003892A1 (en) | Heterogeneous single cell profiling using molecular barcoding | |
| Chan et al. | Novel selection methods for DNA-encoded chemical libraries | |
| Goodnow Jr | A handbook for DNA-encoded chemistry: theory and applications for exploring chemical space and drug discovery | |
| Melkko et al. | Encoded self-assembling chemical libraries | |
| Ecker et al. | Combinatorial drug discovery: which methods will produce the greatest value? | |
| JP5415264B2 (en) | Detectable nucleic acid tag | |
| US7052841B2 (en) | Systems, tools and methods of assaying biological materials using spatially-addressable arrays | |
| Scheuermann et al. | DNA-encoded chemical libraries | |
| CN103882532B (en) | A kind of synthesis of lead compound and screening method and test kit | |
| CN113166974B (en) | Biochip, preparation method and application thereof | |
| Battersby et al. | Optical encoding of microbeads for gene screening: alternatives to microarrays | |
| CN103882531B (en) | A kind of synthesis of lead compound and screening method and test kit | |
| US6541203B2 (en) | Detecting structural or synthetic information about chemical compounds | |
| EP2090888B1 (en) | Method for producing a biomolecule assay chip | |
| Schneider et al. | Recording Binding Information Directly into DNA-Encoded Libraries Using Terminal Deoxynucleotidyl Transferase | |
| WO2020128064A1 (en) | Nucleic acid encoded chemical libraries | |
| KR20080108652A (en) | Nucleic acid chip for obtaining bind profile of single strand nucleic acid and unknown biomolecule, manufacturing method thereof, and analysis method of unknown biomolecule using nucleic acid chip | |
| Ku et al. | The evolution of high-throughput sequencing technologies: From sanger to single-molecule sequencing | |
| US20220025430A1 (en) | Sequence based imaging | |
| CN114540359A (en) | Aptamer capable of specifically recognizing trimethoprim and screening and application thereof | |
| CN115948518A (en) | Coded microbead for single cell detection and preparation method thereof | |
| WO2024015875A2 (en) | Determination of protein information by recoding amino acid polymers into dna polymers | |
| McGregor et al. | Using DNA to Program Chemical Synthesis, Discover New Reactions, and Detect Ligand Binding | |
| US20050164293A1 (en) | Dynamic determination of analytes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CP03 | Change of name, title or address |
Address after: 610000 R&D Building 1001, No. 88 South Keyuan Road, Fengjiawan Industrial Park, Chengdu High-tech Zone, Sichuan Province Patentee after: Chengdu Pioneer Drug Development Co., Ltd. Address before: 610041 R&D Building 1001, No. 88 South Keyuan Road, Fengjiagang Industrial Park, Chengdu High-tech Zone, Sichuan Province Patentee before: Chengdu lead drug development corporation, Ltd. |
|
| CP03 | Change of name, title or address |