WO2020223936A1

WO2020223936A1 - Construction method for high-quality rice ribosome imprint library

Info

Publication number: WO2020223936A1
Application number: PCT/CN2019/086055
Authority: WO
Inventors: 刘琳; 杨晓玉; 崔洁; 宋波; 陈雪梅; 莫蓓莘
Original assignee: 深圳大学; 深圳大学龙华生物产业创新研究院
Priority date: 2019-05-07
Filing date: 2019-05-08
Publication date: 2020-11-12
Also published as: CN110317771A

Abstract

The present invention primarily relates to a construction method for a high-quality rice ribosome imprint library. A high-quality ribosome/RNA complex is isolated by means of an improved ribosome extract, and with the steps of a nuclease treatment, the extraction of an imprint RNA per an SDS method, the purification of the imprint RNA, the removal of an rRNA in a ribosome imprint RNA, a terminus repair, the addition of a 3'-end connector sequence, a reverse transcription, cyclization, and the PCR enrichment of a library. In an ultimately acquired imprint fragment length set, a high-quality rice ribosome imprint library having a significant 3 base periodicity is found, and the construction process provides strengthened universality. For the rice ribosome imprint library constructed per the present invention, imprint fragment lengths are concentrated and the peak values are mostly at the ideal length of 28 bases, a few are found at the position of 27 or 29 bases, but significant 3 base periodicity is provided; moreover, the library is stable in terms of quality and is not affected by poor material and growth conditions. The present invention carries great significance in promoting research related to rice translationomics.

Description

Method for constructing high-quality rice ribosome imprinting library

Technical field

The invention belongs to the technical field of molecular biology, and is a method for constructing a high-quality ribosome imprinting library of rice, and has important significance for the research of rice translationomics.

Background technique

The invention mainly relates to a method for constructing a high-quality rice ribosome imprinting library. The ribosome imprinting library is the basis for the use of ribosome profile sequencing technology for translationomics related research. The earliest library was constructed by Ingolia by isolating the ribosome imprints from yeast in 2009, and then the technology was widely used in bacteria and fungi. , Animal and human translation group research. However, the application in plant-related research is extremely lagging, and there are no reports on the rice construction process; and the plant ribosome imprint library obtained by the existing construction process has the following two important defects: 1) The isolated ribosome imprint fragment The length is scattered, which deviates greatly from the ideal value (28 base length); 2) The imprint 3 base periodicity, which reflects the translation dynamics of plant ribosomes, is not significant. The present invention solves the above-mentioned defects.

Summary of the invention

The purpose of the present invention is to overcome the above-mentioned shortcomings of the prior art and provide a method for constructing a high-quality rice ribosome imprinting library. The present invention intends to establish a set of technical procedures for constructing a high-quality rice ribosome imprinting library to solve the existing problems. The length of the ribosome imprinted fragments in the plant library obtained by the process is not ideal, and the 3-base periodicity is not significant.

In addition, the purpose of the present invention is to overcome the shortcomings of the prior art and provide an improved ribosome extract formula, which is suitable for species including but not limited to rice, and has strong universality.

In order to achieve the above object, the present invention provides an improved ribosome extract formula, which includes the following components:

0.05～0.15M Tris-HCl (Tris-HCl, pH 8.0);

30～50mM potassium chloride (KCl);

10～30mM magnesium chloride (MgCl ₂ );

1.5～2.5% (V/V) polyoxyethylene (10) tridecyl ether (polyoxyethylene (10) tridecyl ether);

0.1～0.3%(W/V) deoxycholic acid;

0.5～1.5mM dithiothreitol (DL-Dithiothreitol, DTT);

50～100μg/mL cycloheximide;

And 5 ~ 15U/mL deoxyribonuclease I (DNaseI).

Chinese names are provided for the above components, and the corresponding English names are also provided in brackets. The above components are explained: Tris-HCl in Chinese is tris-hydroxymethylaminomethane-hydrochloric acid, which is a buffer; KCl in Chinese is potassium chloride; MgCl ₂ in Chinese is magnesium chloride; polyoxyethylene(10)tridecyl ether The Chinese name is polyoxyethylene (10) tridecyl ether; the Chinese name of deoxycholic acid is deoxycholic acid; the Chinese name of DTT is dithiothreitol; the Chinese name of cycloheximide is 放线菌ketone; the Chinese name of DNaseI It is deoxyribonuclease I.

Regarding the improved ribosome extract formula of this application, further explanation or expansion is needed: Tris-HCl buffer is widely used as a solvent for nucleic acids and proteins, which can maintain the stability of the pH value in the ribosome extraction system, and the buffer The liquid has little interference to the biochemical process, and is not easy to precipitate with magnesium, calcium and heavy metal ions; on the one hand, KCl and MgCl ₂ can provide a hypotonic environment to destroy the cell membrane, promote the release of cell contents, and increase the production of ribosomes. At the same time, the presence of both can stabilize the binding of ribosomes and RNA, which is of great significance for subsequent ribosome imprinting separation; in addition, Mg ²⁺ plays a key role in activating DNaseI; polyoxyethylene(10)tridecyl ether and deoxycholic acid are Organic detergents can separate ribosomal proteins from the endoplasmic reticulum and cytoskeleton, increasing the yield of ribosomes; DTT is a commonly used reducing agent, which can maintain a reducing environment, protect the reducing groups on the enzyme molecule, and stabilize Enzyme activity; cycloheximide is a eukaryotic protein synthesis inhibitor, which can hinder the translation process by interfering with the translocation step in the protein synthesis process; DNaseI can be used to remove DNA mixed in the extracted product. Among them, DTT can be replaced by other reducing agents such as mercaptoethanol, and cycloheximide can be replaced by other protein synthesis inhibitors such as emetine or used in combination with chloramphenicol. Compared with the extracts previously reported, this formula reduces the types of components to make the preparation more convenient, optimizes the working concentration of deoxycholic acid without affecting the extraction quality, and avoids the addition of deoxycholic acid to the existing formula The problem of precipitation is very prone to occur. Secondly, a lower ion concentration is used to make the ribosome and RNA bind properly. Therefore, the nuclease treatment can obtain the ideal length of imprinted fragments. The addition of DNaseI to the extract minimizes the amount of The presence of DNA adversely affects the final result. The concentrated solution of each component can be prepared in advance with RNase-free water. The concentrated solution of Tris-HCl, KCl, MgCl ₂ and deoxycholic acid can be stored at room temperature, and the concentrated solution of DTT and cycloheximide can be stored below -20℃; the extract is used now It is prepared by adding appropriate amount of concentrated solution in the following order: Tris-HCl, KCl, MgCl ₂ , appropriate amount of RNase-free water, polyoxyethylene(10) tridecyl ether, DTT, cycloheximide, DNaseI and deoxycholic acid, and finally with RNase-free Make up the water to the final volume. In the preparation process, after each component is added, the next component should be thoroughly mixed before adding the next component. The prepared extract is stored at low temperature for use. There is room for further optimization in this formula, for example, an appropriate amount of protease inhibitors such as heparin can be added to protect the integrity of ribosomal protein.

Preferably, the cycloheximide (cycloheximide) can be replaced by other protein synthesis inhibitors such as emetine or used in combination with chloramphenicol.

More preferably, the present invention provides an improved ribosome extract formula, including the following components:

0.1M Tris-HCl (pH 8.0);

40mM KCl;

20mM MgCl ₂ ;

2％(V/V) polyoxyethylene(10) tridecyl ether;

0.2%(W/V) deoxycholic acid;

1mM DTT;

100μg/mL cycloheximide;

And 10U/mL DNaseI.

To achieve another objective, the present invention provides a method for constructing a high-quality ribosomal imprinting library of rice, which includes the following steps:

S1: Separate ribosome/RNA samples from rice materials through modified ribosome extracts;

S3, the ribosome/RNA sample is subjected to nuclease treatment and SDS extraction method to obtain rice ribosomal imprinted RNA

Fragment

S4, remove the rRNA in the rice ribosomal imprinted RNA fragment;

S5, repair the ends of rice ribosomal imprinted RNA fragments;

S6, connect the rice ribosomal imprinted RNA fragment to the 3'end linker sequence;

S7, obtaining a rice ribosomal imprinted DNA library by reverse transcription;

S9, circularize and PCR enrich the ribosome imprinted DNA library.

Preferably, step S2 is further included after step S1, that is, ultraviolet detection is performed on the rice ribosome/RNA sample.

Preferably, after any of the above steps is completed, the step of purifying the intermediate product is further included.

More preferably, a method for constructing a high-quality rice ribosomal imprinting library includes the following steps:

S1. Extract the ribosome/RNA complex from rice material: Weigh the rice material, quick-freeze it with liquid nitrogen, and grind it fully.

Transfer to an RNase-free centrifuge tube containing the pre-cooled modified ribosome extract, centrifuge once or several times at low temperature,

Put the supernatant containing the ribosome/RNA complex into a new RNase-free centrifuge tube;

S3, the ribosome/RNA sample obtained from S1 is treated with nuclease, and then transferred to the pre-nucleic acid extraction buffer

Liquid-balanced separation column, centrifuge, add SDS solution to the filtrate, purify with RNA purification and enrichment kit and return

Receive ribosomal imprinted RNA fragments;

S4, remove the rRNA in the rice ribosomal imprinted RNA fragment;

S5, repair the ends of rice ribosomal imprinted RNA fragments;

S7, obtaining a rice ribosomal imprinted DNA library by reverse transcription;

It also includes S8 to purify the ribosome imprinted DNA library;

S9, circularize and PCR enrich the ribosome imprinted DNA library;

It also includes S10, after the ribosomal imprinted DNA library is enriched, the ribosomal imprinted DNA library is purified again.

Preferably, S1, specifically: Weigh 1g of rice material, quick-frozen in liquid nitrogen, grind it thoroughly, and transfer it into a pre-cooled modified ribosome extract containing 5mL [0.05～0.15M Tris-HCl (pH 8.0), 30～50mM KCl, 10～30mM MgCl2, 1.5～2.5%(V/V)polyoxyethylene(10)tridecylether(SIGMA), 0.1～0.3%(W/V)deoxycholic acid(SIGMA), 0.5～1.5mM DTT, 50～100μg /mL cycloheximide(SIGMA) and 5～15U/mL DNaseI(Epicentre)] 50mL RNase-free centrifuge tube, mix well, centrifuge at 5000～10000g for about 10 minutes at low temperature, transfer the supernatant to a new 15mL RNase-free centrifuge tube Centrifuge at 15000～20000g for 10 minutes at low temperature (Beckman), put the supernatant containing ribosomes into a new 2mL RNase-free centrifuge tube, and measure the RNA concentration with a micro-spectrophotometer.

Preferably, in S3, the nuclease treatment is specifically: adding nuclease to the ribosome extract at a ratio of 15-40 U nuclease/40 μg RNA, and shaking treatment at 600-800 rpm in a metal bath at room temperature for 1 to 2 hours.

Preferably, in S3, the ribosome sample is subjected to nuclease treatment and SDS extraction; then the purification and enrichment kit is used for purification and enrichment operations. At this time, the sample is added to the filter element for filtration and RNase-free water is used from the filter element The bound nucleic acid sample is eluted on the top, and the column is repeated several times.

As a further improvement, in S3, the purification and enrichment operation with the purification and enrichment kit includes the purification of ribosomal imprinted RNA with the RNA purification and enrichment kit R1017. This operation includes: after the sample is passed through the column, it is transferred to the filter column Add 400μL RNA washing buffer, centrifuge at 12000～16000g for 30 seconds to 1 minute at room temperature, discard the filtrate, add 80μL DNaseI treatment solution to the filter column, the DNaseI treatment solution specifically includes 5μL DNaseI and 75μL DNaseI buffer, and let stand at room temperature 15-20 minutes.

Specifically, S3, adjust the RNA concentration in the ribosome/RNA sample obtained through S1 to 400ng/μL, take 200μL and add 30～80U nuclease (Illumina) to it, that is, according to 15～40U nuclease/40μg RNA Add nuclease in proportion; treat in a metal bath at room temperature and shake at 600～800rpm for 1～2 hours, add 10～20μL of RNase inhibitor SUPERaseIn (Thermo) to stop the reaction; then transfer to a separation column pre-equilibrated with ribosome extract ( GE Healthcare), centrifuge at 600-800 rpm at room temperature for 2 to 5 minutes; then add 20 μL 10% (W/V) SDS solution to the filtrate, mix well, and then use Zymo Research's RNA Purification and Enrichment Kit R1017 and R1015 was used to purify and recover the ribosome imprinted fragments separately. More specific steps are as follows:

S31, use kit R1017 to purify and recover the ribosome imprinted fragments: add 2 times the volume of binding buffer to the ribosome imprinted fragment solution, mix well, then add the same volume of absolute ethanol as the mixed solution, and mix well Transfer to the filter column equipped with kit R1017, centrifuge at 12000～16000g for 30 seconds to 1 minute at room temperature, transfer the filtrate to the filter column again, repeat the centrifugation once, discard the filtrate; add 400μL RNA washing buffer to the filter column Centrifuge at 12000～16000g for 30 seconds to 1 minute at room temperature, discard the filtrate, add 80μL DNaseI treatment solution (5μL DNaseI and 75μL DNaseI buffer) to the filter column, and let stand at room temperature for 15-20 minutes to fully remove ribosomal imprinted RNA DNA residues that may exist in the fragment; add 400μL RNA Pre buffer to the filter column, centrifuge at 12000～16000g for 30 seconds to 1 minute at room temperature, discard the filtrate; wash the filter column with 700μL and 400μL RNA washing buffer in turn, at room temperature Centrifuge at 12000～16000g for 30 seconds～2 minutes respectively, discard the filtrate; add 50μL of RNase-free water to the filter column, let it stand for a few minutes at room temperature, centrifuge at 12000～16000g at room temperature for 1 to several minutes, and then transfer the filtrate to the filter column again , Centrifuge at 12000～16000g for 1～several minutes, and reserve the filtrate for later use. (Note: The test can be terminated here, and ribosome imprinted RNA samples can be stored in an ultra-low temperature refrigerator at -80～-65℃.)

S32, use kit R1015 to purify and recover ribosomal imprinted fragments: add 2 times the volume of binding buffer to the sample obtained in S31, mix well, and then add the same volume of absolute ethanol as that of the mixed solution to it, mix well and transfer Put it into the filter column equipped with kit R1015, centrifuge at 12000~16000g for 30 seconds to 1 minute at room temperature, then transfer the filtrate to the filter column again, repeat the centrifugation once, discard the filtrate; add 400μL RNA Pre buffer, 12000 at room temperature Centrifuge at ~16000g for 30 seconds ~ 1 minute, discard the filtrate; wash the filter column with 700μL and 400μL RNA washing buffer in sequence, centrifuge at 12000 ~ 16000g at room temperature for 30 seconds ~ 2 minutes, discard the filtrate; add 26μL to the filter column RNase water, stand at room temperature for a few minutes, centrifuge at 12000～16000g at room temperature for 1～ several minutes, then transfer the filtrate to the filter column again, centrifuge at 12000～16000g for 1～ several minutes, and measure the ribosomal imprinted RNA in the filtrate with a micro spectrophotometer Concentration, keep it for later use. (Note: The test can be terminated here. Ribosome imprinted RNA samples can be stored in the refrigerator at -80～-65℃.)

Preferably, S4 is specifically: using an rRNA removal kit to remove rRNA in ribosomal imprinted RNA.

Preferably, S4 specifically includes the following sub-steps:

S41, preparing rRNA for purification to remove magnetic beads;

S42, pretreating the RNA sample;

S43, removing rRNA in the RNA sample;

S44, column purification is performed on the ribosomal imprinted RNA sample;

S45, perform PAGE purification on the ribosome imprinted RNA sample.

The above-mentioned S45 is further limited: S45, when the nucleic acid sample is purified by PAGE, the gel sample is placed in a rotary mixer and rotated overnight at 20-40 rpm at low temperature; the gel is separated by a filter column with a pore size of 0.45 μm.

Preferably, S10 is included after S9. After the ribosome imprinted DNA library is enriched, the ribosome imprinted DNA library is purified again, which specifically includes:

S101, DNA binding magnetic beads purification;

S102, Native PAGE purification, specifically: Native PAGE purification of the PCR product, cut out the ribosome imprinting library gel block, grind it, and resuspend it in 400 μL 0.4N NaCl solution; filter; add 2 μL glycogen and 40 μL 3M sodium acetate to the filtrate. pH 5.2) and 1 mL of absolute ethanol for precipitation.

In the above solutions, the low temperature is a low temperature environment of about 4°C. Preferably, the low temperature is 4°C.

The beneficial effects of the present invention are:

1. The present invention adjusts the components of the ribosome extract to make the ribosome and RNA bind properly, and through nuclease vibration treatment for a certain period of time at room temperature, the naked RNA is fully enzymatically decomposed and the imprinted fragment protected by the ribosome is retained; Then through RNA purification and concentration kit and PAGE gel sorting, the too small and too large imprinted fragments are removed, so that the imprinted fragments of 28 to 30 bases in length can be retained to the greatest extent; the rRNA removal operation greatly improves The ratio of effective imprinted fragments in the sample; multiple sorting in the library construction process effectively removes the fragments and primer dimer residues that are too large or too small in the library, which is also important for the final high-quality library acquisition.

2. The present invention mainly relates to a method for constructing a high-quality rice ribosome imprinting library. The ribosome imprinting library is the basis for the use of ribosome profile sequencing technology for translationomics related research. The earliest library was constructed by Ingolia by isolating the ribosome imprints from yeast in 2009, and then the technology was widely used in bacteria and fungi. , Animal and human translation groups. However, the application in plant research is extremely lagging, and there is no report on the construction process of rice; and the plant ribosome imprint library obtained by the existing construction process has the following two important defects: 1) The length of the isolated ribosomal imprint fragment Dispersion, which deviates greatly from the ideal value (28 base length); 2) The imprint 3 base periodicity, which reflects the translational dynamics of plant ribosomes, is not significant. In the rice ribosome imprinting library constructed by the process shown in the present invention, the imprinted fragment lengths are relatively concentrated and the peaks are mostly at the ideal length of 28 bases, a few are located at 27 or 29 bases, but all have significant 3-base periodicity, and The library quality is stable and not affected by differences in materials and growth conditions. The present invention has important significance for promoting the related research of rice translationomics.

Description of the drawings

Figure 1. Nipponbare (NB) rice (Oryza sativa ssp. Geng/japonica) ribosomal imprinting library fragment length distribution. The materials used for building the library are the three-leaf stage rice seedlings under normal growth conditions and treated with 150 mM salt stress for 24 hours, and two independent biological replicates (repeat 1 and repeat 2) under each growth condition. From the results shown in this figure, it can be seen that the imprinted fragments in the ribosome imprinting library constructed by the process of the present invention are mainly concentrated in the ideal value of 28 bases or slightly deviated (29 bases), indicating that the construction process is beneficial to obtain A high-quality imprinted fragment with a length of 28 bases.

Figure 2 Nipponbare (NB) rice (Oryza sativa ssp. Geng/japonica) ribosomal imprinting library 3-base periodicity analysis. The materials for building the database are the three-leaf stage rice seedlings under normal growth conditions and treated with 150 mM salt stress for 24 hours, and two independent biological replicates (repeat 1 and repeat 2) under each growth condition. The vertical and horizontal dotted lines in the figure respectively indicate the 3-base periodic position and its significance threshold. From the results shown in this figure, it can be seen that the ribosome imprinting library constructed by the process of the present invention has a significant 3-base periodicity, indicating that the construction process is beneficial to obtain high-quality ribose with significant 3-base periodicity. Body Imprint Library.

Figure 3 Sea Rice 86 (Sativa 86, SR86) Rice (Oryza sativa ssp. Xian/indica) ribosomal imprinting library fragment length distribution. The materials used to build the library were the three-leaf stage rice seedlings under normal growth conditions and 150 mM salt stress for 24 hours. Two independent biological replicates (repeat 1 and repeat 2) under each growth condition. It can be seen from the results shown in this figure that the length of the imprinted fragments in the ribosome imprinting library constructed by the process of the present invention is mainly concentrated at the ideal value of 28 bases or slightly deviated (27 bases), indicating that the construction process has Conducive to obtaining high-quality imprinted fragments with a length of 28 bases.

Figure 4 Sea Rice 86 (Sativa 86, SR86) Rice (Oryza sativa ssp. Xian/indica) ribosomal imprinting library 3-base periodic analysis. The materials used to build the library were the three-leaf stage rice seedlings under normal growth conditions and 150 mM salt stress for 24 hours. Two independent biological replicates (repeat 1 and repeat 2) under each growth condition. The vertical and horizontal dotted lines in the figure respectively indicate the 3-base periodic position and its significance threshold. From the results shown in this figure, it can be seen that the ribosome imprinting library constructed by the process of the present invention has a significant 3-base periodicity, indicating that the construction process is conducive to obtaining high quality with significant 3-base periodicity Ribosome imprinting library.

The realization of the objectives, functional characteristics and advantages of the present invention will be further described in conjunction with the embodiments and with reference to the accompanying drawings.

Detailed ways

Example 1

This embodiment provides a method for constructing a high-quality rice ribosomal imprint library, which specifically includes the following steps:

S1, separation of rice ribosome/RNA complex:

Weigh 1g of rice material, quick-frozen in liquid nitrogen, grind it in a mortar, transfer it to a 50mL RNase-free centrifuge tube containing 5mL of low-temperature pre-cooled rice ribosome extract, mix well, and centrifuge at 5000～10000g for about 10 minutes at low temperature , Transfer the supernatant to a new 15mL RNase-free centrifuge tube, centrifuge at 15000～25000g for about 10 minutes at low temperature (Beckman), transfer the supernatant containing ribosome/RNA complex into a new 2mL RNase-free centrifuge tube, The concentration of RNA was measured with a micro spectrophotometer.

It should also be pointed out that the above-mentioned low temperature is about 4℃, and the best value of low temperature is 4℃, that is, the best pre-cooling temperature is 4℃, and the best temperature for centrifugation at low temperature is 4℃. The micro-spectrophotometer may be Nanodrop (Thermo), and any micro-spectrophotometer can be used to determine the RNA concentration, and the RNA concentration can be measured by the micro-spectrophotometer and the A260 value recorded. An optional model of the micro spectrophotometer is available here: Nanodrop (Thermo).

The formula of the above-mentioned rice ribosome extract is: 0.05～0.15M Tris-HCl (pH 8.0), 30～50mM KCl, 10～30mM MgCl ₂ , 1.5～2.5%(V/V)polyoxyethylene(10)tridecyl ether (SIGMA), 0.1 to 0.3% (W/V) deoxycholic acid (SIGMA), 0.5 to 1.5 mM DTT, 50 to 100 μg/mL cycloheximide (SIGMA), and 5 to 15 U/mL DNaseI (Epicentre).

S3, extraction of rice ribosomal imprints:

Adjust the RNA concentration in the ribosome/RNA sample obtained in S1 to 400ng/μL, take 200μL and add to it the nuclease 30～80U (Illumina) configured in the TruSeq Ribo Profile kit, metal bath at room temperature, 600～800rpm Shake for 1 to 2 hours, add 10 to 20 μL of RNase inhibitor SUPERaseIn (Thermo) to stop the reaction, and then transfer to the Illustra MicroSpin S-400 HR separation column (GE Healthcare) pre-equilibrated with the ribosome extract, at room temperature 600 Centrifuge at ~800rpm for 2~5 minutes, add 20μL of 10%(W/V) SDS solution to the filtrate, mix well, and then use Zymo Research's RNA Purification and Enrichment Kit R1017 and R1015 to purify and recover ribosomal imprinted fragments. The steps are as follows:

S31, use kit R1017 for purification and recovery of ribosomal imprinted fragments

Add 2 times the volume of binding buffer to the ribosome imprinted fragment solution, mix well, then add the same volume of absolute ethanol as the mixed solution, mix well and transfer to the filter column equipped in the kit, 12000～16000g at room temperature Centrifuge for 30 seconds to 1 minute, transfer the filtrate to the filter column again, repeat the centrifugation once, discard the filtrate; add 400 μL RNA washing buffer to the filter column, centrifuge at 12000 to 16000 g for 30 seconds to 1 minute at room temperature, discard the filtrate, and discard the filtrate. Add 80μL DNaseI treatment solution (5μL DNaseI+75μL DNaseI buffer) to the filter column, and let stand at room temperature for 15-20 minutes to fully remove the DNA residues that may exist in the ribosome imprinted RNA fragments; add 400μL RNA Pre buffer to the filter column Centrifuge at 12000～16000g for 30 seconds～1 minute at room temperature, discard the filtrate; wash the filter column with 700μL and 400μL RNA washing buffer, and centrifuge at 12000～16000g for 30～2 minutes at room temperature, discard the filtrate; Add 50μL of RNase-free water, let it stand at room temperature for a few minutes, centrifuge at 12000~16000g for 1~several minutes at room temperature, then transfer the filtrate to the filter column again, centrifuge at 12000~16000g for 1~several minutes, and keep the filtrate for later use. (Note: The test can be terminated here, and ribosome imprinted RNA samples can be stored in an ultra-low temperature refrigerator at -80～-65℃.)

S32, use kit R1015 for purification and recovery of ribosomal imprinted fragments

Add 2 times the volume of binding buffer to the sample obtained in S31, mix well, then add the same volume of absolute ethanol as the mixed solution, and transfer to the filter column equipped with the kit after mixing, and centrifuge at 12000～16000g at room temperature 30 seconds to 1 minute, then transfer the filtrate to the filter column again, repeat the centrifugation once, discard the filtrate; add 400μL RNA Pre buffer, centrifuge at 12000～16000g for 30 seconds to 1 minute at room temperature, discard the filtrate; use 700μL and 400μL Wash the filter column in sequence with RNA washing buffer, centrifuge at 12000～16000g at room temperature for 30 seconds～2 minutes, discard the filtrate; add 26μL of RNase-free water to the filter column, and let stand at room temperature for several minutes (preferably 2 minutes), 12000 Centrifuge at room temperature at ~16000g for 1 to several minutes, then transfer the filtrate to the filter column again, centrifuge at 12000 to 16000g for 1 to several minutes, measure the concentration of ribosome imprinted RNA in the filtrate with a micro-spectrophotometer, and keep it for later use. (Note: The test can be terminated here, and ribosomal imprinted RNA samples can be stored in an ultra-low temperature refrigerator at -80～-65℃.)

The above scheme is further limited: the micro spectrophotometer can be a micro spectrophotometer produced by Nanodrop.

Further explanation of the above scheme: Both kits (R1017 and R1015) can purify small RNA fragments, but the adsorption capacity of the two columns is different, R1017 can adsorb more imprinted fragments; in addition, the minimum amount of eluent used is also different , R1017 eluent volume should be greater than or equal to 25 microliters, while R015 is 6 microliters. The first step is to use R1017 to recover, mainly because the amount of RNA in the sample in this step is large, which can improve the recovery efficiency; the subsequent use of R1015 can further purify the imprinted RNA on the one hand, and use a smaller volume to recover the imprinted RNA to ensure its concentration And the volume meets the subsequent operation.

S4, remove the rRNA in the rice ribosomal imprinted RNA fragment:

Refer to the method introduced by Ribo-Zero Plant Leaf rRNA Removal Kit (Illumina). The working principle is that the nucleic acid probe binds to the rRNA in the imprinted sample, and then the probe is captured by magnetic beads to remove the rRNA in the sample. The specific steps are as follows:

S41, prepare rRNA for purification to remove magnetic beads

Take 225μL rRNA to remove magnetic beads at room temperature, transfer it to a 1.5mL RNase-free centrifuge tube, then place it on the magnetic stand until the liquid in the centrifuge tube clarifies, remove the supernatant, and remove the centrifuge tube from the magnetic stand; add 225μL without RNase water, shake and mix well, wash the magnetic beads, place it on a magnetic stand until the liquid is clear, remove the supernatant, and repeat the washing once; add 65μL of resuspension buffer to the washed magnetic beads, shake and mix for later use.

It should be noted that the function of the rRNA removing magnetic beads is to capture the rRNA bound to the probe, thereby removing the rRNA in the sample. In the present invention, rRNA removal magnetic beads can also be referred to as magnetic beads for short.

S42, pretreatment of RNA samples

Table 1. Preparation of rRNA removal master mix

The above-mentioned Table 1 discloses a recipe for removing the premix solution, including: RNA sample, 5 μg (26 μL); rRNA removal solution, 10 μL; rRNA removal buffer, 4 μL; 40 μL in total after mixing.

Further explanation of the formula shown in Table 1 above: In the formula shown in Table 1, the RNA sample is 5 μg (26 μL), which means that 5 μg of RNA sample is diluted to 26 μL. The rRNA removal buffer is provided and disclosed by the rRNA removal kit (Illumina). The present invention does not improve the rRNA removal buffer. The rRNA removal buffer can be purchased commercially, such as by purchasing Ribo-Zero plant leaf rRNA removal Kit (Illumina), just take the rRNA removal buffer and use it for the recipe in Table 1. In short, the present invention only uses the rRNA removal buffer that has been disclosed by the Ribo-Zero plant leaf rRNA removal kit (Illumina), and the rRNA removal kit (Illumina) has already been used.

Refer to Table 1 to prepare rRNA removal premix in an RNase-free PCR tube, pipette to mix it, place it in a PCR machine (Bio-Rad), react at 68°C for 10 minutes, take out the PCR tube, and centrifuge at low speed for a few seconds , Let stand at room temperature for several minutes (preferably 5 minutes). The purpose of this step is to combine the nucleic acid probe in the removal solution with the rRNA in the RNA sample to prepare for the next step of rRNA removal.

The above content also needs to be explained:

a) The probe here is the single-stranded nucleic acid molecule equipped in the kit (rRNA removal kit, Illumina). The specific information of the probe sequence has not been disclosed, but the kit can be purchased from public channels, that is, the probe The needle has been used publicly. And, according to our previous experience, the probe here may be a series of single-stranded DNA labeled with biotin (biotin) or other labels, which can be complementary to rRNA, and then the DNA/RNA containing the labeled molecule can be coupled The compound on the magnetic beads is captured, so as to achieve the purpose of removing rRNA in the sample.

b) The function of the probe here is to specifically bind to rRNA, so as to facilitate the removal of rRNA. If you are interested in the sequence of the probe in the rRNA removal kit (Illumina), the person implementing this patent can sequence the probe in the kit to obtain specific information about the sequence. When the kit is already available for public purchase, this Those in the field can easily obtain the probe sequence information. The use of kits for removing rRNA in the system is to make it easier, more reliable, and reduce costs.

c) In fact, the person who implements this patent can also redesign the probe by himself, and then synthesize the probe by himself. The probe has a specific label to facilitate the combination with the compound on the magnetic bead, and then use the self-designed probe. The probe can also remove rRNA, but this undoubtedly increases the difficulty and cost of the experimental operation. However, the stability of the self-designed probe-magnetic bead system and the effect of rRNA removal are open to question. The scheme using the kit is more mature and reliable.

d) Therefore, this application is still preferred to use kits to remove rRNA in the system, and in the field of biotechnology and bioengineering, it is very common to use mature kits to complete specific functional operations, and the kits can be publicly purchased Under the premise, the present invention does not clarify the information of the probe more. After the above explanation, the description of the operation steps for rRNA removal has reached the level of detail that can be actually operated by those skilled in the art.

S43, remove rRNA in RNA sample

Transfer the premixed solution after S42 treatment to 65μL magnetic beads in S41, pipette to mix evenly, let stand at room temperature for about 10 minutes, then place the centrifuge tube on the magnetic stand, let it stand until the liquid is clear, and transfer the supernatant Put it in a new 1.5mL RNase-free centrifuge tube and place it in an ice bath for later use. (Note: The test can be terminated here, and the sample after removal of rRNA can be stored in a refrigerator at -25～-15℃ overnight; or stored in an ultra-low temperature refrigerator at -80～-65℃ for up to one month. )

S44, column purification of ribosomal imprinted RNA samples

Refer to the improved Zymo RNA Concentration and Purification Kit (R1015) method: adjust the sample volume of the imprinted fragment after rRNA removal with RNase-free water to 100μL, then add 200μL binding buffer and 450μL absolute ethanol, and mix well Transfer to the filter column equipped with the kit, centrifuge at 12000～16000g for 30 seconds to 1 minute at room temperature, then transfer the filtrate to the filter column again, repeat the centrifugation once, discard the filtrate; add 400μL RNA Pre buffer, 12000 at room temperature Centrifuge at ~16000g for 30 seconds ~ 1 minute, discard the filtrate; wash the filter column with 700μL and 400μL RNA washing buffer sequentially, centrifuge at 12000 ~ 16000g at room temperature for 30 seconds ~ 2 minutes, discard the filtrate; add 11μL to the filter column RNase water, stand at room temperature for a few minutes, centrifuge at 12000~16000g for 1~several minutes at room temperature, then transfer the filtrate to the filter column again, centrifuge at 12000~16000g for 1~several minutes, and reserve the filtrate for later use.

The above steps are explained: the effect of adding absolute ethanol is to precipitate nucleic acid and improve the binding efficiency when passing through the column.

S45, PAGE purification of ribosomal imprinted RNA samples

Prepare 1.00mm 15% denatured PAGE glue [6.3g urea (urea, SIGMA), 5.625mL 40% (W/V) methylene bisacrylamide (Acrylamide/Bis, Ambion) solution, 0.75ml 10×Tris-boron Salt-EDTA (TBE) buffer, 12μL 10%(W/V) ammonium persulfate (APS, SIGMA) solution, 9μL tetramethylethylenediamine (TEMED, SIGMA)/15mL PAGE gel] for use; from TruSeq Ribo Take 5μL of imprinted RNA control [SEQ ID No.1: NNGUACACGGAGUCGACCCGCAACGCNN (28 base length); SEQ ID No. 2: NNGUACACGGAGUCAAGACCCGCAACGCNN (30 base length)], transfer to 1μL 6×Blue/Orange nucleic acid loading At the same time, add 2μL of 6×Blue/Orange nucleic acid loading dye solution to the ribosomal imprinted RNA (about 10μL) recovered in S41, and mix the two samples in a 95℃ metal bath for about 5 minutes. Then quickly transfer to an ice bath to cool the sample; transfer the cooled control sample and ribosome imprinted RNA sample to 15% denaturing PAGE gel for electrophoresis separation, and stop electrophoresis until the bromophenol blue is close to the bottom of the PAGE gel; remove the denaturation gel and transfer Put it into the pre-cooled SYBR Gold (Thermo) nucleic acid stain, place it at a low temperature (preferably 4°C) for about 10 minutes, and cut out the control and ribosomes containing 28-30 bases in length under the blue electrophoresis observer (TGreen) The gel blocks for imprinting RNA are transferred to 2mL RNase-free centrifuge tubes, grind the gel blocks, add 2μL 10% (W/V) SDS solution, 40μL 5M ammonium acetate and 400μL RNase-free water, mix well, and place in a rotating tube. On the mixer (MIULAB), rotate overnight at 20-40 rpm (preferably 30 rpm) at low temperature (preferably 4°C); then transfer the mixture in the centrifuge tube to the COSTAR Spin-X filter column (Corning) with a pore size of 0.45μm Centrifuge at 12000～16000g for 5～15 minutes at room temperature, add 2uL glycogen (Invitrogen) and 700μL isopropanol to the filtrate, place it in a refrigerator at -25～-15℃ overnight for precipitation, and then centrifuge at 12000～16000g at low temperature For 30 minutes to 1 hour, discard the supernatant, wash the pellet with 70-80% ethanol, discard the supernatant, air-dry the pellet at room temperature, and resuspend the control and ribosomal imprinted RNA in 8uL and 20uL RNase-free water.

It should also be noted that when the purpose of adding glycogen is to recover a small amount of nucleic acid samples, it is convenient to observe the precipitation position at the bottom of the centrifuge tube, and to avoid accidental discarding of the precipitate after centrifugation and washing. The addition of isopropanol is used to precipitate imprinted fragments; isopropanol can be replaced by absolute ethanol, but the volume should be changed from 700μL to 1mL.

S5, repair the ends of rice ribosomal imprinted RNA fragments:

Table 2 End repair reaction system

Explain to Table 2: Ribosome imprinted RNA is the final sample obtained using S45.

Prepare the end-repair reaction solution according to Table 2, mix well, and react in a PCR machine at 37°C for 1 hour. Use Zymo Research's RNA Concentration and Purification Kit (R1015) to recover the end-repaired ribosomal imprinted RNA: First, use RNase-free water to Adjust the volume of the ribosome imprinted RNA repair reaction solution to 100μL, then add 200μL of binding buffer and 450μL of absolute ethanol, mix and transfer to the filter column equipped in the kit, centrifuge at 12000～16000g for 30 seconds to 1 minute at room temperature. Then transfer the filtrate to the filter column again, repeat the centrifugation once, discard the filtrate; add 400μL RNA Pre buffer, centrifuge at 12000～16000g for 30 seconds to 1 minute at room temperature, discard the filtrate; use 700μL and 400μL RNA washing buffer in sequence Wash the filter column, centrifuge at 12000～16000g for 30 seconds to 2 minutes at room temperature, discard the filtrate; add 11μL of RNase-free water to the filter column, let stand for a few minutes at room temperature (preferably 2 minutes), and centrifuge at 12000～16000g at room temperature for 1～ After a few minutes, transfer the filtrate to the filter column again, centrifuge at 12000~16000g for 1 to several minutes, and place the filtrate in an ice bath for later use.

S6, connect the rice ribosomal imprinted RNA fragment to the 3′ end linker sequence:

Add 1 μL of the TruSeq Ribo Profile 3'end adapter (SEQ ID No. 3: AGATCGGAAGAGCACACGTCT) to the control sample in S45 and the ribosome imprint sample obtained in S5, and then place the PCR machine at 65°C for 2 minutes, and cool to 4 ℃ (the cooling here refers to the rapid cooling in the PCR machine), then add 3.5μL TruSeq Ribo Profile ligation buffer, 1μL 100mM DTT and 1.5μL TruSeq Ribo Profile ligase to the control and ribosome imprinting samples, and mix well. React in a PCR machine at 23°C for 2 hours, and then add 2μL of TruSeq Ribo Profile AR enzyme to the two sample reaction solutions, mix well, incubate in the PCR machine at 30°C for 2 hours, and place in an ice bath for later use.

It should also be pointed out that: placing in an ice bath for standby can be replaced by placing in a refrigerator at 4°C, or by placing it under other low-temperature conditions for standby.

S7, obtain rice ribosomal imprinted DNA library by reverse transcription:

Add TruSeq Ribo Profile reverse transcription reaction mixture 4.5μL, 1.5μL 100mM DTT, 1μL EpiScript reverse transcriptase and 6μL RNase-free water to the control and ribosome imprinted samples obtained in S6 respectively, mix well, and use the PCR machine at 50℃ React for 30 minutes; then add 1μL TruSeq Ribo Profile exonuclease to the two samples respectively, mix well, react at 37℃ for 30 minutes, 80℃ for 15 minutes, and cool to 4℃ for later use (Note: The test can be terminated here , Put the obtained sample in a refrigerator below -20°C for long-term storage); then add 1μL of TruSeq Ribo Profile RNase premix to the control and ribosome imprinting samples, mix them, and treat them in a PCR machine at 55°C for 5 minutes, and place Ice bath for later use.

S8, purification of ribosome imprinting library:

S81, Use kit R1015 to purify rice ribosomal imprinting library

Add 18μL of nuclease-free water to the product obtained in S7 to make the total volume reach 50μL, then add 100μL of binding buffer and 150μL of absolute ethanol, mix well, transfer to the filter column equipped with R1015 kit, 12000～16000g at room temperature Centrifuge for 30 seconds to 1 minute, then transfer the filtrate to the filter column again, repeat the centrifugation once, discard the filtrate; add 400μL RNA Pre buffer to the filter column, centrifuge at 12000~16000g for 30 seconds to 1 minute at room temperature, discard the filtrate; Wash the filter column with 700μL and 400μL RNA washing buffer in sequence, centrifuge at 12000～16000g at room temperature for 30 seconds～2 minutes, discard the filtrate; add 11μL of RNase-free water to the filter column, and let it stand at room temperature for a few minutes, 12000～ Centrifuge at 16000g for 1 to several minutes at room temperature, then transfer the filtrate to the filter column again, centrifuge at 12000 to 16000g for 1 to several minutes, and place the filtrate in an ice bath for later use.

S82, use 10% denaturing PAGE gel to purify rice ribosomal imprinting library

Prepare 1.00mm 10% denatured PAGE gel [6.3g urea, 3.75mL 40%(W/V) Acrylamide/Bis solution, 0.75ml 10×TBE buffer, 12μL 10%(W/V)APS solution, 9μL TEMED /15mL gel] for use; add 2μL of 6×Blue/Orange nucleic acid loading dye to the control and ribosome imprinted cDNA respectively, mix well, treat at 95℃ for about 5 minutes on a PCR machine, then place on ice to cool; after cooling Transfer the sample to 10% denaturing PAGE gel for electrophoresis separation, and stop the electrophoresis after the bromophenol blue completely escapes the denaturation gel; remove the denaturation gel, transfer it to the pre-cooled SYBR Gold nucleic acid stain, and place it at low temperature for about 10 minutes. Under the blue-light electrophoresis observation instrument, cut the control and ribosome imprinted cDNA gel blocks with a size of 70 to 90 bases, respectively transfer them into a 2mL RNase-free centrifuge tube, grind the gel blocks, and add 2μL 10% (W/V) SDS solution, 40μL 5M ammonium acetate and 400μL RNase-free water, mix well, place in a rotary mixer, and rotate overnight at 20-40 rpm at low temperature; then transfer the mixture in the centrifuge tube to the COSTAR Spin-X filter column, 12000 at room temperature Centrifuge at ～16000g for 5～15 minutes, add 2μL of glycogen (Invitrogen) and 700μL of isopropanol to the filtrate, place it in a refrigerator at -25～-15℃ for overnight precipitation, then centrifuge at 12000～16000g for 30 minutes at low temperature～1 After hours, discard the supernatant, wash the pellet with 70-80% (V/V) ethanol, discard the supernatant, air-dry the pellet at room temperature, and resuspend the control and ribosome imprinted cDNA in 10 uL nuclease-free water. (Note: The test can be terminated here, and the obtained sample can be stored in a refrigerator below -20°C for a long time.)

S9, circularize and PCR enrich the ribosome imprinted DNA library:

Table 3. Cyclization reaction system

Table 4. PCR reaction system for library enrichment

Among them, X+Y=21μL, X>0μL, and Y≥0μL.

Regarding Table 4 above, it is also necessary to point out:

1. TruSeq Ribo Profile forward primer is:

SEQ ID No. 4 (AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACG)

2. The TruSeq Ribo Profile Index primers are:

SEQ ID No. 5 (CAAGCAGAAGACGGCATACGAGATATCACGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT) or SEQ ID No. 6

(CAAGCAGAAGACGGCATACGAGAT

CGATGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT) or SEQ ID No. 7

(CAAGCA

GAAGACGGCATACGAGATTTAGGCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT) or SEQ ID No. 8

(CAAGCAGAAGACGGCATACGAGATTGACCAGTGACTGGAGTTCAG

ACGTGTGCTCTTCCGATCT) or SEQ ID No. 9

(CAAGCAGAAGACGGCATACGAGATACAG

TGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT) or SEQ ID No. 10

(CAAGCAGAAGA

CGGCATACGAGATGCCAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT) or SEQ ID No. 11

(CAAGCAGAAGACGGCATACGAGATCAGATCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT) or SEQ ID No. 12

(CAAGCAGAAGACGGCATACGAGATACTTGAGTG

ACTGGAGTTCAGACGTGTGCTCTTCCGATCT) or SEQ ID No. 13

(CAAGCAGAAGACGGC

ATACGAGATGATCAGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT) or SEQ ID No. 14

(CAAGCAGAAGACGGCATACGAGATTAGCTTGTGACTGGAGTTCAGACGTGTGCT TCCGATCT) or SEQ ID No. 15

(CAAGCAGAAGACGGCATACGAGATGGCTACGTGACTGG

AGTTCAGACGTGTGCTCTTCCGATCT) or SEQ ID No. 16

(CAAGCAGAAGACGGCATACG

AGATCTTGTAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT)

It should be pointed out that the 25th to 30th sequences of SEQ ID No. 5 ~ SEQ ID No. 16 are the characteristic sequences used to split data after sequencing, and are the common characteristic sequences in the Illumina sequencing platform. The specific information comes from the instructions attached to the kit used to build the library. The characteristic sequences listed above are only a small part of the available combinations, and new characteristic sequences can be obtained by recombining bases. Furthermore, the non-characteristic sequence part here is also possible to be modified, such as a single-site base replacement for the non-characteristic sequence part. In short, SEQ ID No. 5 to SEQ ID No. 16 are only examples of Index primers, and other permutations and combinations of the characteristic sequences of SEQ ID No. 5 to SEQ ID No. 16 (permutation and combination of characteristic sequences and SEQ ID No. 5 to SEQ ID No. 16 have different characteristic sequences), simple base substitutions are performed on non-characteristic sequences, and other primer sequences formed can also be applied to the above steps.

Refer to Table 3 to prepare the cyclization reaction solution, mix well, and react on the PCR machine at 60°C for 2 hours, then transfer to an ice bath; refer to Table 4 to prepare the PCR reaction system, in which the amount of cDNA needs to be determined according to the specific conditions of the experiment. The most suitable amount. The amount of nuclease-free water is adjusted according to the amount of cDNA. Mix the prepared reaction system and place it in a PCR machine. Run the PCR reaction according to the following procedure:

S10, purification of the library after enrichment:

S101, DNA binding magnetic beads purification

Transfer the PCR product obtained in S9 into a 1.5 mL centrifuge tube containing 90 μL DNA-binding magnetic beads (Agencourt AMPure XP, Beckman), pipette to mix, and let stand at room temperature for 5-10 minutes, and then place it on a magnetic rack until centrifuged The liquid in the tube is clear, discard the supernatant, and then add 200μL of 70-80% (V/V) ethanol to the centrifuge tube to wash the magnetic beads, place them on the magnetic stand until the liquid is clear, discard the supernatant, and repeat the cleaning; set the centrifuge tube to room temperature Let stand for about 5 minutes to air-dry the magnetic beads, add 16 μL of nuclease-free water to resuspend the magnetic beads to elute the ribosome imprinted library bound to the magnetic beads, and then place the centrifuge tube on the magnetic stand until the liquid in the tube is clear, and the supernatant Transfer to a new 1.5mL centrifuge tube and place in an ice bath for later use.

S102, 8% Native PAGE purification

Prepare 1.00mm size 8% Native PAGE gel [3mL 40%(W/V) Acrylamide/Bis solution, 0.75ml 10×TBE buffer, 12μL 10%(W/V)APS solution and 9μL TEMED/15mL gel] for later use ; Add 3μL of 6×Blue/Orange nucleic acid loading dye to the control and ribosome imprinting library purified by S101, mix well, transfer to 8% Native PAGE gel for electrophoresis separation, bromophenol blue moves to the bottom of the gel and stops Electrophoresis; remove the gel, transfer it to the pre-cooled SYBR Gold nucleic acid stain, place it at low temperature for about 10 minutes, under the blue electrophoresis observer, cut out the ribosome imprinting library gel block with the size of 140-160 bases, and transfer Put into a 2mL nuclease-free centrifuge tube, grind the gel pieces, add 400μL 0.4N NaCl solution, mix well, place on a rotary mixer, rotate overnight at 20-40 rpm at low temperature; then transfer the mixture in the centrifuge tube into In COSTAR Spin-X filter column, centrifuge at 12000～16000g for 5～15 minutes at room temperature, add 2μL glycogen, 40μL 3M sodium acetate (pH5.2) and 1mL absolute ethanol to the filtrate, mix well, and place at -80～ Precipitate overnight in an ultra-low temperature refrigerator at -65℃, then centrifuge at 12000～16000g at low temperature for 30 minutes～1 hour, discard the supernatant, wash the pellet with 70～80% ethanol, discard the supernatant, air-dry the pellet at room temperature, and resuspend the ribosome The cDNA was imprinted in an appropriate amount of nuclease-free water for sequencing analysis.

Example 2

Nipponbare and Sea Rice 86 are cultivated in a nutrient solution in an incubator. The culture conditions are 12 hours photoperiod, day temperature 28°C, night temperature 25°C, and air relative humidity 60-70%. Until the seedlings reach the three-leaf stage, 150mM NaCl After 24 hours of treatment, take two species of normal growth and 24 hours of salt-treated seedlings, two biological replicates, and quick-frozen in liquid nitrogen. Refer to the process of the present invention to separate ribosome/RNA complexes, extract ribosome imprinted RNA, Remove rRNA, purify, add linker, then reverse transcription to obtain rice ribosome imprinting library, purify and circularize library cDNA, finally PCR enrich the library, sequencing to verify the quality of the library, the results show that the rice ribosomes constructed using the process shown in the present invention Imprinted library, the imprinted fragment length is relatively concentrated and the peaks are mostly at the ideal length of 28 bases, a few are located at 27 or 29 bases, but all have significant 3-base periodicity, and the library quality is stable, independent of material and growth conditions The impact (see Figure 1 to Figure 4). The information contained in Figures 1 to 4 will be further explained below:

Figure 1: This figure shows the distribution of the length of the imprinted fragments in the ribosome imprinting library constructed using the process of the present invention, using the shoots of Nipponbare rice seedlings under normal growth and salt stress as the material, mainly focusing on the ideal value of 28 bases Or a slight deviation (29 bases), Figure 1 shows that this construction process is conducive to obtaining high-quality imprinted fragments with a length of 28 bases.

Figure 2: This figure shows the 3-base periodicity of the imprints in the ribosome imprinting library constructed using the process of the present invention using the shoots of Nipponbare rice seedlings under normal growth and salt stress as the material. The vertical and horizontal dots in Figure 2 The shape lines respectively indicate the position of the 3-base periodicity and its significance threshold. From the results in Figure 2, it can be seen that all libraries have a significant 3-base periodicity, indicating that this construction process is beneficial to obtain a significant 3-base periodicity Of high-quality ribosomal imprinting libraries.

Figure 3: This figure shows the distribution of the length of the imprinted fragments in the ribosome imprinting library constructed using the process of the present invention, using the above-ground part of sea rice 86 rice seedlings under normal growth and salt stress as the material, mainly focusing on the ideal value of 28 bases The base may be slightly deviated (27 bases). Figure 3 shows that this construction process is conducive to obtaining high-quality imprinted fragments with a length of 28 bases.

Figure 4: This figure shows the 3-base periodicity of the imprints in the ribosome imprinting library constructed using the process of the present invention, using the aboveground parts of sea rice 86 rice seedlings under normal growth and salt stress as the material. The vertical and horizontal dots in the figure The shape lines respectively indicate the position of the 3-base periodicity and its significance threshold. From the results in the figure, it can be seen that all libraries have a significant 3-base periodicity. Figure 4 shows that the construction process is beneficial to obtain a significant 3-base periodicity. Sexual high-quality ribosome imprinting library.

Example 2 is a specific implementation of the construction method provided in Example 1.

Example 3

After step S1, it can also include S2: UV detection of rice ribosome profile:

Prepare 15-60% (W/V) gradient sucrose in a 13×51mm polypropylene ultracentrifuge tube (Beckman, catalog number 326819) using a density gradient preparation instrument (Lead Fluid), and then take the ribose obtained from 1000A260 units of S1 The body/RNA sample was placed on a gradient sucrose solution and centrifuged at 170,000g for 1.5 hours at 4°C with a SW55 horizontal rotor (Beckman), and the centrifuged product was placed on a density gradient separator (BRANDEL) associated with a UA-6 ultraviolet absorption detector. The product was separated from top to bottom, and the light absorption value at 254nm was recorded.

Step S2 is an optional step. For the construction method of the present invention, S2 is not an indispensable step. Through S2, the rice ribosome/RNA samples obtained by S1 can be observed more intuitively, such as the dispersion of the length of the ribosome imprinted fragments. If the density gradient images of the ribosome/RNA samples obtained by S1 are more concentrated and concentrated At the corresponding position of the fragment containing 28 bases, it can be more intuitively proved that the improved ribosome extract formula of the present application has a good effect.

The other parts of this embodiment 3 are the same as those of embodiment 1, and the difference lies only in the introduction of S2.

Also need to point out the matters needing attention in this application:

1. The solutions, reagents, pipette tips and centrifuge tubes used in the construction process must be free of DNA/RNase.

2. The ribosome extract should be used on-the-spot, and the concentration of each component should be strictly controlled, especially the concentration of deoxycholic acid. If the concentration is too high, it will cause ions to precipitate and cause the experiment to fail.

3. When storing the extracted ribosome/RNA samples, it is best to quickly freeze them with liquid nitrogen and transfer them to ultra-low temperature refrigerators.

4. When nuclease treatment is performed on ribosome/RNA samples, the enzyme dosage and treatment time may be slightly different due to tissue differences, so they can be adjusted according to the specific situation when necessary.

5. A control must be added during PAGE purification to facilitate the judgment of the band size and sample recovery.

6. When the library is enriched by PCR, the template concentration and the number of PCR cycles need to be adjusted appropriately according to the specific situation, and the template concentration and the number of PCR cycles should not be too high.

Although the embodiments of the present invention have been shown and described above, it can be understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those of ordinary skill in the art will not depart from the principle and purpose of the present invention. Under the circumstances, changes, modifications, substitutions and modifications can be made to the above-mentioned embodiments within the scope of the present invention.

Claims

An improved ribosome extract formula, which is characterized by comprising the following components:

0.05～0.15M Tris-HCl (Tris-HCl, pH 8.0);

30～50mM potassium chloride (KCl);

10～30mM magnesium chloride (MgCl 2 );

1.5～2.5% (V/V) polyoxyethylene (10) tridecyl ether (polyoxyethylene (10) tridecyl ether);

0.1～0.3%(W/V) deoxycholic acid;

0.5～1.5mM dithiothreitol (DL-Dithiothreitol, DTT);

50～100μg/mL cycloheximide;

And 5 ~ 15U/mL deoxyribonuclease I (DNaseI).
A method for constructing a high-quality rice ribosomal imprinting library, which is characterized in that it comprises the following steps:

S1: Separate ribosome/RNA samples from rice materials through modified ribosome extracts;

S3, nuclease treatment and SDS extraction are performed on the ribosome/RNA sample to obtain rice ribosomal imprinted RNA fragments;

S4, remove the rRNA in the rice ribosomal imprinted RNA fragment;

S5, repair the ends of rice ribosomal imprinted RNA fragments;

S6, connect the rice ribosomal imprinted RNA fragment to the 3'end linker sequence;

S7, obtaining a rice ribosomal imprinted DNA library by reverse transcription;

S9, circularize and PCR enrich the ribosome imprinted DNA library.
The method for constructing a high-quality ribosome imprinting library of rice according to claim 2, characterized in that, after any of the above steps, it further comprises a step of purifying the intermediate product.
The method for constructing a high-quality ribosome imprinting library of rice according to claim 3, wherein, in S3, the nuclease treatment is specifically: adding 15-40 U nuclease/40 μg RNA to the ribosome/RNA sample Nuclease, metal bath at room temperature, 600-800rpm shaking treatment for 1 to 2 hours.
The method for constructing a high-quality ribosome imprinting library of rice according to claim 4, wherein in S3, the ribosome/RNA sample is subjected to nuclease treatment and SDS extraction; and then purified with a purification enrichment kit And enrichment operation, at this time, the sample is added to the filter element for filtration and the bound nucleic acid sample is eluted from the filter element with RNase-free water, and the column is repeated several times.
The method for constructing a high-quality rice ribosomal imprint library according to claim 5, wherein in S3, purifying and enriching with a purification and enrichment kit includes purifying ribosomal imprints with RNA purification and enrichment kit R1017 The operation of RNA includes: adding 400 μL of RNA washing buffer to the filter column after the sample is passed through the column, centrifuging at 12000~16000g for 30 seconds to 1 minute at room temperature, discarding the filtrate, and adding 80 μL of DNaseI treatment solution to the filter column. The DNaseI treatment solution specifically includes 5 μL DNaseI and 75 μL DNaseI buffer solution, and the solution is allowed to stand at room temperature for 15-20 minutes.
The method for constructing a high-quality ribosomal imprinted library of rice according to claim 2, wherein S4, specifically: using an rRNA removal kit to remove rRNA in ribosomal imprinted RNA.
The method for constructing a high-quality ribosomal imprinting library of rice according to claim 7, wherein S4 specifically comprises:

S41, preparing rRNA for purification to remove magnetic beads;

S42, pretreating the RNA sample;

S43, removing rRNA in the RNA sample;

S44, column purification is performed on the ribosomal imprinted RNA sample;

S45, perform PAGE purification on the ribosome imprinted RNA sample.
The method for constructing a high-quality ribosome imprinting library of rice according to claim 8, wherein when the nucleic acid sample is purified by S45 and PAGE, the gel sample is placed in a rotary mixer and rotated at 20-40 rpm overnight at low temperature; using 0.45 Separate the gel with a μm pore filter column.
The method for constructing a high-quality ribosome imprinted library of rice according to claim 8, characterized in that, after S9, it further includes S10. After the ribosome imprinted DNA library is enriched, the ribosome imprinted DNA library is purified again, which specifically includes :

S101, DNA binding magnetic beads purification;

S102, Native PAGE purification, specifically: Native PAGE purification of the PCR product, cut out the ribosome imprinting library gel block, grind it, and resuspend it in 400μL 0.4N NaCl solution; filter; add 2μL glycogen and 40μL 3M sodium acetate to the filtrate (pH 5.2) and 1 mL of absolute ethanol for precipitation.