CN110317771A - A kind of construction method in high quality rice ribosomes marking library - Google Patents
A kind of construction method in high quality rice ribosomes marking library Download PDFInfo
- Publication number
- CN110317771A CN110317771A CN201910376020.1A CN201910376020A CN110317771A CN 110317771 A CN110317771 A CN 110317771A CN 201910376020 A CN201910376020 A CN 201910376020A CN 110317771 A CN110317771 A CN 110317771A
- Authority
- CN
- China
- Prior art keywords
- ribosomes
- marking
- rna
- rice
- library
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/04—Plant cells or tissues
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
- C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Botany (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- General Chemical & Material Sciences (AREA)
- Crystallography & Structural Chemistry (AREA)
- Analytical Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Cell Biology (AREA)
- Biophysics (AREA)
Abstract
The invention mainly relates to a kind of construction methods in high quality rice ribosomes marking library, high quality ribosomes/RNA compound is separated by the ribosomes extracting solution of improvement, it is repaired by the rRNA in nucleic acid enzymatic treatment, SDS method extracting marking RNA, purifying marking RNA, removal ribosomes marking RNA, end plus 3 ' termination header sequences, reverse transcription, cyclisation and PCR enriched library, the final marking fragment length that obtains is concentrated, has the periodic high quality rice ribosomes marking library of significant 3 base, and the building process has stronger universality.The rice ribosomes marking library constructed through the invention, marking fragment length is more concentrated and peak value is mostly in 28 base of ideal length, and minority is located at 27 or 29 base positions, but it is periodical to all have significant 3 base, and Library Quality is stablized, not by material and growth conditions differentia influence.The present invention is for pushing rice translation group correlative study to be of great significance.
Description
Technical field
The invention belongs to technical field of molecular biology, are a kind of building sides in the high quality ribosomes marking library of rice
Method has great importance for the research of rice translation group.
Background technique
The invention mainly relates to a kind of construction methods in high quality rice ribosomes marking library.Ribosomes marking library is
The basis of translation group correlative study is carried out using ribosomes spectrum sequencing technologies, earliest library is to be equal to 2009 by Ingolia
Year is by the way that constructed by the ribosomes marking in separation yeast, the subsequent technology is widely used in bacterium, fungi, animal and people
The research of class translation group.However, the application in plant correlative study but extremely lags, there is not yet related rice building process
Report；And there are following two major defects using existing building process resulting plant ribosome marking library: 1) separating
The dispersion of gained ribosomes marking fragment length deviates larger with ideal value (28 bases longs)；2) reflect plant internal ribosome
It is periodically not significant to translate dynamic 3 base of the marking.The present invention solves in view of the foregoing drawbacks.
Summary of the invention
A kind of high quality ribosomes print of rice is provided it is an object of the invention to overcome the deficiency of the above-mentioned prior art
Remembering the construction method in library, the present invention is proposed to found a set of techniqueflow for being used to construct high quality rice ribosomes marking library,
Solve the problems, such as that ribosomes marking fragment length is undesirable in the resulting plant library of existing process, 3 bases are periodically inapparent.
In addition, providing a kind of ribosomes extracting solution of improvement the present invention also aims to overcome the deficiency of the prior art
Formula, the applicable species of this formula include but is not limited to rice, have stronger universality.
To achieve the above object, the present invention provides a kind of ribosomes extract recipe of improvement, including following component:
Trishydroxymethylaminomethane-hydrochloric acid (Tris-HCl, pH 8.0) of 0.05~0.15M；
The potassium chloride (KCl) of 30~50mM；
Magnesium chloride (the MgCl of 10~30mM2)；
Polyoxyethylene (10) tridecyl ether (polyoxyethylene (10) tridecyl of 1.5~2.5% (V/V)
ether)；
The deoxycholic acid (deoxycholic acid) of 0.1~0.3% (W/V)；
The dithiothreitol (DTT) (DL-Dithiothreitol, DTT) of 0.5~1.5mM；
The cycloheximide (cycloheximide) of 50~100 μ g/mL；
And the deoxyribonuclease I (DNaseI) of 5~15U/mL.
Above-mentioned each component provides Chinese name, and corresponding English name is also provided in bracket.Said components are carried out
Illustrate: the entitled trishydroxymethylaminomethane-hydrochloric acid of Chinese of Tris-HCl, is buffer；The entitled potassium chloride of Chinese of KCl；
MgCl2Chinese name magnesium chloride；The entitled polyoxyethylene (10) ten of Chinese of polyoxyethylene (10) tridecyl ether
Trialkyl ether；The entitled deoxycholic acid of Chinese of deoxycholic acid；The entitled dithiothreitol (DTT) of Chinese of DTT；
The entitled cycloheximide of Chinese of cycloheximide；The entitled deoxyribonuclease I of Chinese of DNaseI.
The ribosomes extract recipe of improvement about the application, also needs further explanation or expansion: Tris-HCl
Buffer is widely used as the solvent of nucleic acid and protein, can maintain the stabilization of pH value in ribosomes extraction system, while this is slow
Fliud flushing interferes very little to Biochemical processes, and is not easy to precipitate with magnesium, calcium and heavy metal ion；KCl and MgCl2On the one hand
It hypotonic environment be can provide to destroy after birth, promote the release of cellular content, improves ribosomal yield, while the two is deposited
Ribosomes and the combination of RNA can also stablized, be of great significance for subsequent ribosomes marking separation；In addition, Mg2+For
Activate DNaseI that there is key effect；Polyoxyethylene (10) tridecyl ether and deoxycholic acid is
Organic detergent can be such that ribosomal protein separates from endoplasmic reticulum and cytoskeleton, improve ribosomal yield；DTT is common
Reducing agent can maintain reproducibility environment, protect the reproducibility group in enzyme molecule, stablize the activity of enzyme；Cycloheximide is
A kind of eukaryotic protein synthetic inhibitor can be hindered translated by the transposition step in interferencing protein synthesis process
Journey；DNaseI can be used for removing the DNA for extracting and being mixed in product.Wherein, DTT can be replaced by other reducing agents such as mercaptoethanol etc.
Generation, cycloheximide (cycloheximide) can by other oroteins synthetic inhibitor such as emetine (emetine) replace or
It is applied in combination with chloramphenicol (chloramphenicol).Compared with the extracting solution that forefathers reported, this formula reduces component
Type is more convenient to make to prepare, and the work that deoxycholic acid is optimized under the premise of not influencing and extracting quality is dense
Degree avoids existing formula and the problem of easily precipitating is added after deoxycholic acid, next using it is lower from
Sub- concentration, so that the combination appropriateness of ribosomes and RNA, therefore nucleic acid enzymatic treatment can get ideal length marking segment, extracting solution
Middle addition DNaseI reduces adverse effect of the presence to final result of DNA in extract to the maximum extent.No RNA can be used
Enzyme water prepares the concentrate of each component in advance, wherein Tris-HCl, KCl, MgCl2With deoxycholic acid concentrate room temperature
It saves, the concentrate of DTT and cycloheximide freeze at -20 DEG C or less；Extracting solution matching while using, in the following order according to
The secondary appropriate concentrate of addition is formulated: Tris-HCl, KCl, MgCl2, in right amount without RNA enzyme water, polyoxyethylene (10)
Tridecyl ether, DTT, cycloheximide, DNaseI and deoxycholic acid are finally supplied with no RNA enzyme water
To final volume, in process for preparation, it is every be added after a kind of component to mix well after add a kind of lower component, the extracting solution prepared
Low temperature is placed spare.This formula still has the space advanced optimized, such as appropriate protease inhibitors such as heparin can be added,
Protect the integrality of ribosomal protein.
Preferably, the cycloheximide (cycloheximide) can be by other oroteins synthetic inhibitor such as emetine
(emetine) it replaces or is applied in combination with chloramphenicol (chloramphenicol).
More preferably, the present invention provides a kind of ribosomes extract recipe of improvement, including following component:
The Tris-HCl (pH 8.0) of 0.1M；
The KCl of 40mM；
The MgCl of 20mM2；
Polyoxyethylene (10) tridecyl ether of 2% (V/V)；
The deoxycholic acid of 0.2% (W/V)；
The DTT of 1mM；
The cycloheximide of 100 μ g/mL；
And the DNaseI of 10U/mL.
To realize that another object, the present invention provide a kind of construction method in the high quality ribosomes marking library of rice, wrap
Include following steps:
S1 isolates ribosomes/RNA sample by the ribosomes extracting solution of improvement from rice material；
S3 carries out nucleic acid enzymatic treatment, the extracting of SDS method to ribosomes/RNA sample, obtains rice ribosomes marking RNA piece
Section；
S4 removes the rRNA in rice ribosomes marking RNA segment；
S5 repairs the end of rice ribosomes marking RNA segment；
Rice ribosomes marking RNA segment is connect by S6 with 3 ' termination header sequences；
S7 obtains rice ribosomes marking DNA library by reverse transcription；
S9 carries out cyclisation to ribosomes marking DNA library and PCR is enriched with.
It preferably, further include step S2 after step S1, that is, ultraviolet detection is carried out to rice ribosomes/RNA sample.
Preferably, after any of the above-described a step, further include the steps that purifying intermediate product.
More preferably, the construction method in the high quality ribosomes marking library of a kind of rice, includes the following steps:
S1 extracts ribosomes/RNA compound from rice material: weighing rice material, be fully ground after liquid nitrogen flash freezer,
Be transferred to the ribosomes extracting solution of the improvement containing pre-cooling without RNA enzyme centrifuge tube, be centrifuged under low temperature once or for several times, core will be contained
Sugared body/RNA compound supernatant is distributed into new no RNA enzyme centrifuge tube；
S3 is used nucleic acid enzymatic treatment to ribosomes/RNA sample that S1 is obtained, is then transferred to and is buffered in advance with nucleic acid extraction
SDS solution is added into filtrate for the splitter of liquid balance, centrifugation, with RNA purification enrichment kits and recycles ribosomes print
Remember RNA segment；
S4 removes the rRNA in rice ribosomes marking RNA segment；
S5 repairs the end of rice ribosomes marking RNA segment；
Rice ribosomes marking RNA segment is connect by S6 with 3 ' termination header sequences；
S7 obtains rice ribosomes marking DNA library by reverse transcription；
Further include S8, ribosomes marking DNA library is purified；
S9 carries out cyclisation to ribosomes marking DNA library and PCR is enriched with；
Further include S10, after completing the enrichment of ribosomes marking DNA library, ribosomes marking DNA library is purified again.
Preferably, S1, it is specific: to weigh 1g rice material, be fully ground after liquid nitrogen flash freezer, is transferred to containing 5mL pre-cooling
Improvement ribosomes extracting solution [0.05~0.15M Tris-HCl (pH 8.0), 30~50mM KCl, 10~30mM MgCl2,
1.5~2.5% (V/V) polyoxyethylene (10) tridecyl ether (SIGMA), 0.1~0.3% (W/V)
Deoxycholic acid (SIGMA), 0.5~1.5mM DTT, 50~100 μ g/mL cycloheximide (SIGMA) and 5~
15U/mL DNaseI (Epicentre)] 50mL without RNA enzyme centrifuge tube, mix, 5000~10000g is centrifuged 10 points under low temperature
Clock or so, supernatant are transferred to new 15mL without RNA enzyme centrifuge tube, and 15000~20000g is centrifuged 10 minutes or so under low temperature
(Beckman), new 2mL will be distributed into without RNA enzyme centrifuge tube containing ribosomal supernatant, micro-spectrophotometer measures RNA
Concentration.
Preferably, in S3, nucleic acid enzymatic treatment is specifically: using 15~40U nuclease/40 μ g RNA ratio to ribosomes
Nuclease is added in extracting solution, under room temperature metal bath, 600~800rpm concussion processing 1~2 hour.
Preferably, in S3, nucleic acid enzymatic treatment is carried out to ribosomes sample, SDS method extracts；Then purification enrichment kit is used
Purifying and enrichment procedure are carried out, is filtered and at this point, filter core is added in sample with no RNA enzyme water elution of bound from filter core
Nucleic acid samples repeated column for several times.
It is further to improve, in S3, purifying is carried out with purification enrichment kit and enrichment procedure includes with RNA purification enrichment
Kit R1017 purifies the operation of ribosomes marking RNA, which includes: that sample is crossed after the completion of column, and 400 μ are added into filter column
L RNA washing buffer, 12000~16000g is centrifuged 30 seconds~1 minute at room temperature, gives up filtrate, 80 μ L are added into filter column
DNaseI treatment fluid, the DNaseI treatment fluid specifically include 5 μ L DNaseI and 75 μ L DNaseI buffers, are stored at room temperature 15
~20 minutes.
Specifically, S3, RNA concentration in the ribosomes/RNA sample obtained by S1 is adjusted to 400ng/ μ L, 200 μ L are taken
And 30~80U of nuclease (Illumina) is added thereto, i.e., core is added according to 15~40U nuclease/40 μ g RNA ratio
Sour enzyme；Metal bath, 600~800rpm concussion processing 1~2 hour under room temperature, is added 10~20 μ L RNase inhibitors
SUPERaseIn (Thermo) terminates reaction；Then continue at the splitter (GE balanced in advance with ribosomes extracting solution
Healthcare in), at room temperature with 600~800rpm centrifugation 2~5 minutes；Then 20 μ L, 10% (W/ is added into filtrate
V) SDS solution mixes, and is then purified and is returned respectively with RNA purification enrichment the kit R1017 and R1015 of Zymo Research
Ribosomes marking segment is received, specifically operating procedure is as follows:
S31 carries out the purifying and recycling of ribosomes marking segment using kit R1017: molten to ribosomes marking segment
The combination buffer of 2 times of volumes is added in liquid, mixes, then addition and the isometric dehydrated alcohol of mixed liquor, are transferred to after mixing
In filter column provisioned in kit R1017,12000~16000g is centrifuged 30 seconds~1 minute at room temperature, and filtrate is transferred to filter again
In column, repeated centrifugation is primary, gives up filtrate；400 μ L RNA washing buffers are added into filter column, at room temperature 12000~
16000g is centrifuged 30 seconds~1 minute, gives up filtrate, 80 μ L DNaseI treatment fluid (5 μ L DNaseI and 75 μ L are added into filter column
DNaseI buffer), it is stored at room temperature 15~20 minutes, it is residual sufficiently to remove DNA that may be present in ribosomes marking RNA segment
It stays；400 μ L RNA Pre buffers are added into filter column, 12000~16000g is centrifuged 30 seconds~1 minute at room temperature, gives up filter
Liquid；Filter column is successively cleaned with the RNA washing buffer of 700 μ L and 400 μ L, 12000~16000g is centrifuged 30 seconds respectively at room temperature
~2 minutes, give up filtrate；50 μ L are added into filter column without RNA enzyme water, are stored at room temperature several minutes, 12000~16000g room temperature from
Then filtrate is transferred in filter column by the heart 1~several minutes again, 12000~16000g centrifugation 1~several minutes, filtrate retains spare.
(note: herein can termination test, ribosomes marking RNA sample can be reserved in -80~-65 DEG C of ultra low temperature freezer.)
S32 carries out the purifying and recycling of ribosomes marking segment using kit R1015: being added into sample obtained by S31
2 times of volume combination buffers, mix, then thereto be added with the isometric dehydrated alcohol of mixed liquor, be transferred to reagent after mixing
In filter column provisioned in box R1015,12000~16000g is centrifuged 30 seconds~1 minute at room temperature, then filtrate is transferred to filter again
In column, repeated centrifugation is primary, gives up filtrate；400 μ L RNA Pre buffers are added, at room temperature 12000~16000g centrifugation 30
Second~1 minute, give up filtrate；Filter column is sequentially cleaned with the RNA washing buffer of 700 μ L and 400 μ L, at room temperature 12000~
16000g is centrifuged 30 seconds~2 minutes respectively, gives up filtrate；26 μ L are added into filter column without RNA enzyme water, are stored at room temperature several minutes,
Filtrate, is then transferred in filter column by 12000~16000g room temperature centrifugation 1~several minutes again, and 12000~16000g centrifugation 1~
Several minutes, micro-spectrophotometer measures ribosomes marking RNA concentration in filtrate, retains spare.(note: herein can termination test,
Ribosomes marking RNA sample can be reserved in -80~-65 DEG C of refrigerator.)
Preferably, S4, specifically: using the rRNA in rRNA removal kit removal ribosomes marking RNA.
Preferably, S4 specifically includes following sub-step:
S41, the rRNA for preparing purifying remove magnetic bead；
S42 pre-processes RNA sample；
S43 is removed rRNA in RNA sample；
S44 carried out column purification to ribosomes marking RNA sample；
S45 carries out PAGE purifying to ribosomes marking RNA sample.
Further limit above-mentioned S45: when S45, PAGE purification of nucleic acid sample, gel sample is placed in rotation and mixes
20~40rpm rotation is stayed overnight under device, low temperature；Utilize the filter column separating gel in 0.45 μm of aperture.
It preferably, further include S10 after S9, after completing the enrichment of ribosomes marking DNA library, to ribosomes marking DNA
Library purifies again, specifically includes:
S101, DNA combination magnetic beads for purifying；
S102, Native PAGE purifying, specific: Native PAGE purified pcr product cuts ribosomes marking library
Blob of viscose after grinding, is resuspended in 400 μ L 0.4N NaCl solutions；Filtering；2 μ L glycogen, 40 μ L 3M sodium acetates are added into filtrate
(pH5.2) and 1mL dehydrated alcohol it, is precipitated.
In above-mentioned each scheme, the low temperature is 4 DEG C or so of low temperature environment.Preferably, the value of low temperature is 4
℃。
The beneficial effects of the present invention are:
1. the present invention passes through the adjustment of ribosomes extracting solution component, keeps the combination of ribosomes and RNA appropriate, pass through at room temperature
The concussion of nuclease certain time is handled, and sufficiently digests exposed RNA, remains the marking segment of ribosomes protection；It is then logical
The sorting for crossing RNA purifying concentrated reagent box and PAGE glue, eliminates too small and excessive marking segment so that length 28~
The marking segment of 30 bases is retained to the greatest extent；RRNA operation is gone then to greatly improve effective marking segment in sample
Ratio；Multiple sorting during building library has effectively removed segment and primer dimer too large or too small in library
Residual, also plays a significant role final high quality library.
2. the invention mainly relates to a kind of construction methods in high quality rice ribosomes marking library.Ribosomes marking library
It is the basis that translation group correlative study is carried out using ribosomes spectrum sequencing technologies, earliest library is equal to by Ingolia
2009 by constructed by the ribosomes marking in separation yeast, the subsequent technology be widely used in bacterium, fungi, animal with
And the relevant research of human translation group.However, the application in plant research but extremely lags, related rice building process is had no
Report；And there are following two major defects using existing building process resulting plant ribosome marking library: 1) separating
The dispersion of gained ribosomes marking fragment length deviates larger with ideal value (28 bases longs)；2) reflect plant internal ribosome
It is periodically not significant to translate dynamic 3 base of the marking.The rice ribosomes marking library constructed using process shown in the present invention, print
Note fragment length is more concentrated and peak value is mostly in 28 base of ideal length, and minority is located at 27 or 29 base positions, but all has
Significant 3 base is periodical, and Library Quality is stablized, not by material and growth conditions differentia influence.The present invention is for pushing water
Rice translation group correlative study has great importance.
Detailed description of the invention
Fig. 1 OryzasativaLcv.Nipponbare (Nipponbare, NB) rice (Oryza sativa ssp.Geng/japonica) ribosomes print
Remember library fragments distribution of lengths.Building library material therefor is three leaves that normal growing conditions and 150mM salt stress handle 24 hours
Phase rice seedling overground part, two independent biology repeat (repeat 1 and repeat 2) under every kind of growth conditions.It is shown from the figure
Result can be seen that using process of the present invention building ribosomes marking library in marking segment be concentrated mainly on ideal
28 base of value or slightly deviation (29 base) show that this building process help to obtain the high quality marking piece of 28 bases longs
Section.
Fig. 2 OryzasativaLcv.Nipponbare (Nipponbare, NB) rice (Oryza sativa ssp.Geng/japonica) ribosomes print
Remember 3 base periodicity analysis of library.Building library material is the tri-leaf period that normal growing conditions and 150mM salt stress handle 24 hours
Rice seedling overground part, two independent biology repeat (repeat 1 and repeat 2) under every kind of growth conditions.It is longitudinal and horizontal in figure
Denote the threshold value of 3 base periodic locations and its conspicuousness respectively to dotted lines.The result shown from the figure, which can be seen that, adopts
Significant 3 base periodicity is all had with the ribosomes marking library that process of the present invention constructs, shows that this building process has
There is the periodic high quality ribosomes marking library of significant 3 base conducive to obtaining.
The sea Fig. 3 rice 86 (Sea Rice 86, SR86) rice (Oryza sativa ssp.Xian/indica) ribosomes print
Remember library fragments distribution of lengths.Building library material therefor is three leaves that normal growing conditions and 150mM salt stress handle 24 hours
Phase rice seedling overground part, two independent biology repeat (repeat 1 and repeat 2) under every kind of growth conditions.From the figure institute exhibition
The result shown can be seen that marking fragment length in the ribosomes marking library using process of the present invention building and mainly concentrate
In 28 base of ideal value or slightly deviation (27 base), show that this building process help to obtain the high quality print of 28 bases longs
Remember segment.
The sea Fig. 4 rice 86 (Sea Rice 86, SR86) rice (Oryza sativa ssp.Xian/indica) ribosomes print
Remember 3 base periodicity analysis of library.Building library material therefor is normal growing conditions and the three of the processing of 150mM salt stress 24 hours
Leaf phase rice seedling overground part, two independent biology repeat (repeat 1 and repeat 2) under every kind of growth conditions.It is longitudinal in figure
Denote the threshold value of 3 base periodic locations and its conspicuousness respectively with lateral dotted lines.The result shown from the figure can be with
Find out, significant 3 base periodicity is all had using the ribosomes marking library that process of the present invention constructs, shows this building
Process is help to obtain with the periodic high quality ribosomes marking library of significant 3 base.
The embodiments will be further described with reference to the accompanying drawings for the realization, the function and the advantages of the object of the present invention.
Specific embodiment
Embodiment 1
The present embodiment provides a kind of construction methods in the high quality ribosomes marking library of rice, specifically include following step
It is rapid:
S1, the separation of rice ribosomes/RNA compound:
1g rice material is weighed, is fully ground in mortar after liquid nitrogen flash freezer, the rice core containing the pre-cooling of 5mL low temperature is transferred to
The 50mL of sugared body extracting solution is mixed without RNA enzyme centrifuge tube, and 5000~10000g is centrifuged 10 minutes or so under low temperature, and supernatant is transferred to
New 15mL is without RNA enzyme centrifuge tube, and 15000~25000g is centrifuged 10 minutes or so (Beckman) under low temperature, will contain ribose
Body/RNA compound supernatant is distributed into new 2mL without RNA enzyme centrifuge tube, and micro-spectrophotometer measures RNA concentration.
Also note: above-mentioned low temperature is 4 DEG C or so, and the best value of low temperature is 4 DEG C, i.e., precooling temperature is most preferably
4 DEG C, it is 4 DEG C that optimum temperature is centrifuged under low temperature.The micro-spectrophotometer is chosen as Nanodrop (Thermo), and use is any
Micro-spectrophotometer can measure RNA concentration, measure RNA concentration by micro-spectrophotometer and record A260 value.Herein
A kind of optional model of micro-spectrophotometer: Nanodrop (Thermo) is provided.
Wherein, the formula of above-mentioned rice ribosomes extracting solution is: 0.05~0.15M Tris-HCl (pH 8.0), 30~
50mM KCl, 10~30mM MgCl2, 1.5~2.5% (V/V) polyoxyethylene (10) tridecyl ether
(SIGMA), 0.1~0.3% (W/V) deoxycholic acid (SIGMA), 0.5~1.5mM DTT, 50~100 μ g/mL
Cycloheximide (SIGMA) and 5~15U/mL DNaseI (Epicentre).
S3, the extraction of the rice ribosomes marking:
By in S1 gained ribosomes/RNA sample in RNA concentration adjust to 400ng/ μ L, take 200 μ L and be added thereto
30~the 80U of nuclease (Illumina) configured in TruSeq Ribo Profile kit, at room temperature metal bath, 600~
800rpm concussion processing 1~2 hour, 10~20 μ L RNase inhibitor SUPERaseIn (Thermo) are added and terminate reaction, with
It is transferred to the Illustra MicroSpin S-400HR splitter (GE Healthcare) balanced in advance with ribosomes extracting solution afterwards
In, 600~800rpm is centrifuged 2~5 minutes at room temperature, and 20 μ L 10% (W/V) SDS solution are added into filtrate, is mixed, then
Ribosomes marking segment is purified and recycled respectively with RNA purification enrichment the kit R1017 and R1015 of Zymo Research, is had
Steps are as follows for gymnastics work:
S31 carries out the purifying and recycling of ribosomes marking segment using kit R1017
The combination buffer of 2 times of volumes is added into ribosomes marking segment solution, mixes, then addition and mixed liquor etc.
The dehydrated alcohol of volume is transferred in filter column provisioned in kit after mixing, at room temperature 12000~16000g centrifugation 30 seconds~1
Minute, filtrate is transferred in filter column again, repeated centrifugation is primary, gives up filtrate；400 μ L RNA washing buffers are added into filter column
Liquid, 12000~16000g is centrifuged 30 seconds~1 minute at room temperature, gives up filtrate, 80 μ L DNaseI treatment fluids are added into filter column
(5 μ L DNaseI+75 μ L DNaseI buffer), is stored at room temperature 15~20 minutes, sufficiently to remove ribosomes marking RNA segment
In DNA that may be present residual；400 μ L RNA Pre buffers are added into filter column, at room temperature 12000~16000g centrifugation 30
Second~1 minute, give up filtrate；Filter column is successively cleaned with the RNA washing buffer of 700 μ L and 400 μ L, at room temperature 12000~
16000g is centrifuged 30~2 minutes respectively, gives up filtrate；50 μ L are added into filter column without RNA enzyme water, are stored at room temperature several minutes,
Filtrate, is then transferred in filter column by 12000~16000g room temperature centrifugation 1~several minutes again, and 12000~16000g centrifugation 1~
Several minutes, filtrate retains spare.(note: herein can termination test, ribosomes marking RNA sample can be reserved in -80~-65 DEG C
In ultra low temperature freezer.)
S32 carries out the purifying and recycling of ribosomes marking segment using kit R1015
2 times of volume combination buffers are added into sample obtained by S31, mix, are then added thereto and the bodies such as mixed liquor
Long-pending dehydrated alcohol is transferred in filter column provisioned in kit after mixing, and 12000~16000g is centrifuged 30 seconds~1 point at room temperature
Then filtrate is transferred in filter column by clock again, repeated centrifugation is primary, gives up filtrate；400 μ L RNA Pre buffers, room is added
Lower 12000~the 16000g of temperature is centrifuged 30 seconds~1 minute, gives up filtrate；RNA washing buffer with 700 μ L and 400 μ L is sequentially clear
Filter wash column, 12000~16000g is centrifuged 30 seconds~2 minutes respectively at room temperature, gives up filtrate；26 μ L are added into filter column without RNA
Enzyme water is stored at room temperature several minutes (preferably 2 minutes), 12000~16000g room temperature centrifugation 1~several minutes, then again by filtrate
Secondary to be transferred in filter column, 12000~16000g centrifugation 1~several minutes, micro-spectrophotometer measures ribosomes marking RNA in filtrate
Concentration retains spare.(note: herein can termination test, ribosomes marking RNA sample can be reserved in -80~-65 DEG C of ultralow temperature
In refrigerator.)
Further limit above-mentioned scheme: micro-spectrophotometer can be using the micro light splitting of Nanodrop production
Photometer.
To above scheme further explanation: two kinds of kits (R1017 and R1015) can purify small RNA fragments, but
It is the adsorption capacity difference of the two pillar, the adsorbable more marking segments of R1017；Furthermore eluent minimum flow used is not yet
Together, the volume of R1017 eluent is greater than equal to 25 microlitres, and R015 is then 6 microlitres.The first step is recycled using R1017, mainly
It is that recovery efficiency can be improved because RNA amount is larger in this step sample；R1015 is then used, print on the one hand can be further purified
Remember RNA, marking RNA is furthermore recycled using lesser volume, it is ensured that its concentration and volume meet subsequent operation.
S4 removes the rRNA in rice ribosomes marking RNA segment:
It is carried out referring to the introduced method of Ribo-Zero plant leaf blade rRNA removal kit (Illumina).Its work is former
Reason is nucleic acid probe in conjunction with the rRNA in marking sample, and subsequent magnetic capture probe is to remove the rRNA in sample.Specific behaviour
Steps are as follows for work:
S41, the rRNA for preparing purifying remove magnetic bead
It takes 225 μ L rRNA to remove magnetic bead at room temperature, is transferred to 1.5mL without in RNA enzyme centrifuge tube, it is quiet to be subsequently placed in magnetic frame
Liquid clarification is set into centrifuge tube, supernatant is removed, centrifuge tube is removed from magnetic frame；225 μ L are added without RNA enzyme water, concussion mixes,
Magnetic bead is cleaned, magnetic frame is placed in and stands to liquid clarification, remove supernatant, repeated washing is primary；65 μ are added into cleaned magnetic bead
Buffer is resuspended in L, and concussion mixes spare.
It should be understood that the effect of rRNA removal magnetic bead is rRNA of the capture in conjunction with probe, thus by sample
RRNA removal.In the present invention, rRNA, which removes magnetic bead, can also be called magnetic bead for short.
S42, the pretreatment of RNA sample
The preparation of table 1.rRNA removal premixed liquid
Above-mentioned table 1 discloses a kind of formula for removing premixed liquid, comprising: RNA sample, 5 μ g (26 μ L)；RRNA removal
Liquid, 10 μ L；RRNA removes buffer, 4 μ L；Totally 40 μ L after mixing.
To formula further instruction represented by above-mentioned table 1: the formula represented by table 1, RNA sample are 5 μ g (26 μ
L), it is meant that the RNA sample by 5 μ g is diluted to 26 μ L.RRNA removes buffer and removes kit (Illumina) by rRNA
There is provided and openly, the present invention not to rRNA removal buffer improve, rRNA removal buffer obtained by commercially available
, such as by purchase Ribo-Zero plant leaf blade rRNA removal kit (Illumina), take rRNA removal buffering therein
Liquid is realized for the formula in table 1.In short, the present invention is only using by Ribo-Zero plant leaf blade rRNA removal
RRNA disclosed in kit (Illumina) removes buffer, and rRNA removal kit (Illumina) has used disclosure.
RRNA removal premixed liquid is prepared in the PCR pipe of no RNA enzyme referring to table 1, pipettor piping and druming mixes, and is placed in PCR instrument
(Bio-Rad) it in, is reacted 10 minutes at 68 DEG C, takes out PCR pipe, the low-speed centrifugal several seconds is stored at room temperature several minutes (preferably 5
Minute).The purpose of this step operation is will to remove the nucleic acid probe in liquid in conjunction with rRNA in RNA sample, is the rRNA of next step
Removal is prepared.
To above content it should be noted that:
A) probe is the single nucleic acid strands molecule being equipped in kit (rRNA removes kit, Illumina), probe herein
The specifying information of sequence not yet discloses, but the kit can be bought by disclosed channel and be obtained, that is, probe has used
It is open.Also, according to the experience before us, probe herein may be it is a series of label have (biotin) or its
The single stranded DNA that he marks, can be with rRNA complementary pairing, and then the DNA/RNA containing mark molecule can be coupled on magnetic bead
Compound capture, to achieve the purpose that rRNA in the sample of place to go.
B) effect of probe herein is and the combination of rRNA specificity, consequently facilitating rRNA is removed.If to rRNA
Remove kit (Illumina) in probe sequence it is interested, the personnel for implementing this patent can to the probe in kit into
Row is sequenced and obtains the specifying information of sequence, and when kit can be obtained with open purchase, those skilled in the art are to therein
Probe sequence information is very easy to get.Using kit for the rRNA in removal system be in order to it is easier,
Reliably, cost is reduced.
C) in fact, the personnel for implementing this patent can go to redesign probe with oneself, then oneself synthesising probing needle is removed,
There is the label of specificity, convenient for then using the self-designed probe in conjunction with the compound on magnetic bead on the probe
It may be implemented to remove rRNA, but this undoubtedly increases the difficulty and cost of experimental implementation again.But the probe-of designed, designed
The stability of magnetic bead system, the effect for removing rRNA remain to be discussed.And use the scheme of kit just more preferably mature and reliable.
D) so the application is still preferably removed the rRNA in system using kit, and in this biology skill
Art, bioengineering field, using mature kit complete specific feature operation be it is very universal, kit can be public
Under the premise of opening purchase, the present invention no longer does the information of probe and more illustrates.By explanation above, rRNA is removed and is grasped
The description for making step, having had reached those skilled in the art can be with the level of detail of practical operation.
S43 is removed rRNA in RNA sample
By S42, treated that premixed liquid is transferred in 65 μ L magnetic beads in S41, and pipettor piping and druming mixes, and is stored at room temperature 10 points
Then centrifuge tube is placed in magnetic frame by clock or so, stand to liquid and clarify, and supernatant is transferred to new 1.5mL and is centrifuged without RNA enzyme
It is spare to be placed in ice bath by Guan Zhong.(note: herein can termination test, the sample after gained rRNA removal is placed in -25~-15 DEG C of ice
In case, save overnight；Or it is placed in longest in -80~-65 DEG C of ultra low temperature freezer and saves one month.)
S44 carried out column purification to ribosomes marking RNA sample
It is carried out referring to improved Zymo RNA concentration with the method for purification kit (R1015): with no RNA enzyme water by rRNA
Marking segment sample volume after removal is adjusted to 100 μ L, and 200 μ L combination buffers and 450 μ L dehydrated alcohols are then added, and mixes
It is transferred to after even in filter column provisioned in kit, at room temperature 12000~16000g centrifugation 30 seconds~1 minute, then again by filtrate
Secondary to be transferred in filter column, repeated centrifugation is primary, gives up filtrate；400 μ L RNA Pre buffers are added, at room temperature 12000~
16000g is centrifuged 30 seconds~1 minute, gives up filtrate；Filter column, room temperature are sequentially cleaned with the RNA washing buffer of 700 μ L and 400 μ L
Lower 12000~16000g is centrifuged 30 seconds~2 minutes respectively, gives up filtrate；11 μ L are added into filter column without RNA enzyme water, room temperature is quiet
It sets several minutes, then filtrate is transferred in filter column by 12000~16000g room temperature centrifugation 1~several minutes again, 12000~
16000g centrifugation 1~several minutes, filtrate retains spare.
Be illustrated to above-mentioned steps: the effect for adding dehydrated alcohol is precipitate nucleic acids, improves joint efficiency when column.
S45 carries out PAGE purifying to ribosomes marking RNA sample
Prepare 15% denaturation PAGE glue [6.3g urea (urea, SIGMA), 5.625mL 40% (W/V) of 1.00mm specification
Methylene diacrylamide (Acrylamide/Bis, Ambion) solution, 0.75ml 10 × Tris- borate-EDTA (TBE) are slow
Fliud flushing, 12 μ L 10% (W/V) ammonium persulfate (APS, SIGMA) solution, 9 μ L tetramethylethylenediamines (TEMED, SIGMA)/15mL
PAGE glue] it is spare；Taken from TruSeq Ribo Profile kit the 5 μ L marking RNA control [SEQ ID No.1:
NNGUACACGGAGUCGACCCGCAACGCNN (28 bases longs)；SEQ ID No.2:
NNGUACACGGAGUCAAGACCCGCAACGCNN (30 bases longs)], it is transferred to 1 μ L 6 × Blue/Orange nucleic acid loading dye
Liquid (Promega), while 2 μ L 6 × Blue/Orange nucleic acid are added in the ribosomes marking RNA (about 10 μ L) recycled into S41
Two samples are mixed respectively and are placed in 95 DEG C of metal baths processing 5 minutes or so by loading dye liquor, and being then transferred in ice bath rapidly makes sample
It is cooling；Control sample after cooling and ribosomes marking RNA sample are transferred to 15% denaturation PAGE glue electrophoretic separation, until bromophenol blue
Stop electrophoresis close to PAGE glue bottom；Denaturation glue is removed, is transferred in SYBRGold (Thermo) nucleic acid dye liquor of pre-cooling, in low temperature
It is placed 10 minutes or so under (preferably 4 DEG C), under blue light electrophoresis visualizer (TGreen), cuts and compare and contain 28~30
The blob of viscose of bases longs ribosomes marking RNA is transferred to 2mL without RNA enzyme centrifuge tube respectively, grinds blob of viscose, 2 μ L, 10% (W/ is added
V) SDS solution, 40 μ L 5M ammonium acetates and 400 μ L are mixed without RNA enzyme water, are placed in rotation vortex mixer (MIULAB), low temperature is (excellent
Be selected as 4 DEG C) under 20~40rpm (preferably 30rpm) rotation overnight；Then the mixed liquor in centrifuge tube is transferred to 0.45 μm of aperture
COSTAR Spin-X filter column (Corning), at room temperature 12000~16000g be centrifuged 5~15 minutes, 2uL is added into filtrate
Glycogen (Invitrogen) and 700 μ L isopropanols are placed in -25~-15 DEG C of refrigerator overnight precipitating, then under low temperature
12000~16000g is centrifuged 30 minutes~1 hour, abandons supernatant, is cleaned and is precipitated with 70~80% ethyl alcohol, and supernatant, room temperature leeward are abandoned
Control and ribosomes marking RNA is resuspended in 8uL and 20uL without in RNA enzyme water in dry precipitating.
It should be noted that: when the purpose that glycogen is added is recycling micro nucleic acid samples, convenient for observation centrifuge tube bottom
The deposition location in portion avoids the operations such as washing after being centrifuged from accidentally abandoning precipitating.It is for precipitating marking piece that isopropanol, which is added,
Section；Isopropanol can be replaced with dehydrated alcohol, but volume will become 1mL from 700 μ L.
S5 repairs the end of rice ribosomes marking RNA segment:
Repair reaction system in 2 end of table
Be illustrated to table 2: ribosomes marking RNA is using the finally obtained sample of S45.
End is prepared by table 2 and repairs reaction solution, is mixed, and is reacted 1 hour for 37 DEG C in PCR instrument, with Zymo Research's
The ribosomes marking RNA that RNA concentration is repaired with purification kit (R1015) recycling end: first with no RNA enzyme water by ribosomes
Marking RNA repairs reaction solution volume and is adjusted to 100 μ L, and 200 μ L combination buffers and 450 μ L dehydrated alcohols are then added, and mixes
It is transferred in filter column provisioned in kit afterwards, at room temperature 12000~16000g centrifugation 30 seconds~1 minute, then again by filtrate
It is transferred in filter column, repeated centrifugation is primary, gives up filtrate；400 μ L RNA Pre buffers are added, at room temperature 12000~16000g
Centrifugation 30 seconds~1 minute, gives up filtrate；Filter column is sequentially cleaned with the RNA washing buffer of 700 μ L and 400 μ L, at room temperature
12000~16000g is centrifuged 30 seconds~2 minutes respectively, gives up filtrate；11 μ L are added into filter column without RNA enzyme water, are stored at room temperature
Several minutes (preferably 2 minutes), then filtrate is transferred in filter column by 12000~16000g room temperature centrifugation 1~several minutes again,
12000~16000g centrifugation 1~several minutes, it is spare that filtrate is placed in ice bath.
Rice ribosomes marking RNA segment is connect by S6 with 3 ' termination header sequences:
1 μ L TruSeq Ribo is added in ribosomes marking sample obtained in the control sample and S5 into S45 respectively
3 ' end connector of Profile (SEQ ID No.3:AGATCGGAAGAGCACACGTCT) is subsequently placed in 65 DEG C of PCR instrument and handles 2 points
Clock cools to 4 DEG C (cooling herein is the fast cooling in PCR instrument), then respectively into control and ribosomes marking sample
3.5 μ L TruSeq Ribo Profile connection buffers, 1 μ L 100mM DTT and 1.5 μ L TruSeq Ribo are added
Profile ligase mixes, and reacts 2 hours for 23 DEG C in PCR instrument, 2 μ L are then separately added into two sample reaction solutions
TruSeq Ribo Profile AR enzyme, 30 DEG C incubation 2 hours in PCR instrument, it is spare to be placed in ice bath after mixing.
It should further be noted that: being placed in that ice bath is spare can be by being placed in spare replacement in 4 DEG C of refrigerators, can also be by being placed in it
It is spare under its cryogenic conditions to substitute.
S7 obtains rice ribosomes marking DNA library by reverse transcription:
TruSeq Ribo Profile reverse transcription reaction is separately added into gained control and ribosomes marking sample into S6
4.5 μ L of mixed liquor, 1.5 μ L 100mM DTT, 1 μ L EpiScript reverse transcriptase and 6 μ L are mixed, PCR instrument 50 without RNA enzyme water
DEG C reaction 30 minutes；Then it is separately added into 1 μ L TruSeq Ribo Profile excision enzyme into two samples, mixes, in PCR instrument
37 DEG C react react 15 minutes within 30 minutes, 80 DEG C, be cooled to 4 DEG C it is spare (note: herein can termination test, gained sample is placed in-
It is saved for a long time in 20 DEG C or less refrigerators)；Then to control and two sample of the ribosomes marking in add 1 μ L TruSeq Ribo
Profile RNA enzyme premixed liquid, 55 DEG C processing 5 minutes in PCR instrument, it is spare to be placed in ice bath after mixing.
S8, the purifying in ribosomes marking library:
S81 purifies rice ribosomes marking library using kit R1015
Into S7,18 μ L nuclease-free waters, which are added, in products therefrom makes total volume reach 50 μ L, then adds 100 μ L combination
Buffer and 150 μ L dehydrated alcohols, are transferred in filter column provisioned in R1015 kit, at room temperature 12000~16000g after mixing
Filtrate, is then transferred in filter column, repeated centrifugation is primary, gives up filtrate by centrifugation 30 seconds~1 minute again；It is added into filter column
400 μ L RNA Pre buffers, 12000~16000g is centrifuged 30 seconds~1 minute at room temperature, gives up filtrate；With 700 μ L and 400 μ
The RNA washing buffer of L sequentially cleans filter column, and 12000~16000g is centrifuged 30 seconds~2 minutes respectively at room temperature, gives up filtrate；
11 μ L are added into filter column without RNA enzyme water, are stored at room temperature several minutes, 12000~16000g room temperature centrifugation 1~several minutes, then
Filtrate is transferred in filter column again, 12000~16000g centrifugation 1~several minutes, it is spare that filtrate is placed in ice bath.
S82 purifies rice ribosomes marking library using 10% denaturation PAGE glue
Prepare 10% denaturation PAGE glue [6.3g urea, 3.75mL 40% (W/V) Acrylamide/ of 1.00mm specification
Bis solution, 10 × tbe buffer liquid of 0.75ml, 12 μ L, 10% (W/V) APS solution, 9 μ L TEMED/15mL gels] it is spare；To
2 μ L 6 × Blue/Orange nucleic acid loading dye liquors are added respectively in control and ribosomes marking cDNA, are mixed, at 95 DEG C of PCR instrument
Reason 5 minutes or so, is subsequently placed in cooled on ice；Sample is transferred to 10% denaturation PAGE glue electrophoretic separation after cooling, until bromophenol blue is complete
Stop electrophoresis after running out of denaturation glue entirely；Denaturation glue is removed, is transferred in the SYBR Gold nucleic acid dye liquor of pre-cooling, places at low temperature
10 minutes or so, under blue light electrophoresis visualizer, control and the ribosomes marking cDNA blob of viscose of 70~90 base sizes are cut, point
It is not transferred to 2mL without RNA enzyme centrifuge tube, grinds blob of viscose, 2 μ L, 10% (W/V) SDS solution, 40 μ L 5M ammonium acetates and 400 μ L is added
It without RNA enzyme water, mixes, is placed in rotation vortex mixer, 20~40rpm rotation at low temperature is stayed overnight；Then by the mixing in centrifuge tube
Liquid is transferred to COSTAR Spin-X filter column, and 12000~16000g is centrifuged 5~15 minutes at room temperature, and 2 μ L glycogen are added into filtrate
(Invitrogen) and 700 μ L isopropanols, be placed in -25~-15 DEG C of refrigerator overnight precipitating, then 12000 under low temperature~
16000g is centrifuged 30 minutes~1 hour, abandons supernatant, is cleaned and is precipitated with 70~80% (V/V) ethyl alcohol, is abandoned supernatant, is air-dried at room temperature
Control and ribosomes marking cDNA is resuspended in 10uL nuclease-free water in precipitating.(note: herein can termination test, by gained sample
It is placed in -20 DEG C or less refrigerators and saves for a long time.)
S9 carries out cyclisation to ribosomes marking DNA library and PCR is enriched with:
3. cyclization system of table
4. library of table is enriched with PCR reaction system
Wherein, the 0 μ μ of L, Y >=0 L of X+Y=21 μ L, X >.
It is also noted for above-mentioned table 4:
1, TruSeq Ribo Profile forward primer are as follows:
SEQ ID No.4(AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACG)
2, TruSeq Ribo Profile Index primer are as follows:
SEQ ID No.5(CAAGCAGAAGACGGCATACGAGATATCACGGTGACTGGAGTTCAGACGTGTGCTCT
) or SEQ ID No.6 TCCGATCT
(CAAGCAGAAGACGGCATACGAGAT
) or SEQ ID No.7 CGATGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
(CAAGCA
GAAGACGGCATACGAGATTTAGGCGTGACTGGAGTTCAGACGTGTGCTCTTCCGAT CT) or SEQ ID
No.8
(CAAGCAGAAGACGGCATACGAGATTGACCAGTGACTGGAGTTCAGACGTGTGCTCT TCCGATCT) or
SEQ ID No.9
(CAAGCAGAAGACGGCATACGAGATACAG
) or SEQ ID No.10 TGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
(CAAGCAGAAGA
) or SEQ ID No.11 CGGCATACGAGATGCCAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
(CAAGCAGAAGACGGCATACGAGATCAGATCGTGACTGGAGTTCAGACGTGTGCTCT TCCGATCT) or
SEQ ID No.12
(CAAGCAGAAGACGGCATACGAGATACTTGAGTG
) or SEQ ID No.13 ACTGGAGTTCAGACGTGTGCTCTTCCGATCT
(CAAGCAGAAGACGGC
) or SEQ ID No.14 ATACGAGATGATCAGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
(CAAGCAGAAGACGGCATACGAGATTAGCTTGTGACTGGAGTTCAGACGTGTGCTCT TCCGATCT) or
SEQ ID No.15
(CAAGCAGAAGACGGCATACGAGATGGCTACGTGACTGG
) or SEQ ID No.16 AGTTCAGACGTGTGCTCTTCCGATCT
(CAAGCAGAAGACGGCATACG
AGATCTTGTAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT)
It is noted that the 25th to the 30th sequence of SEQ ID No.5~SEQ ID No.16 is after being sequenced
It is characteristic sequence general in Illumina microarray dataset, the specifying information source of sequence for splitting the characteristic sequence of data
The incidental specification of Yu Jianku used kit.Those listed above very little one that characteristic sequence is available combination,
It can also be by reconfiguring base to obtain new characteristic sequence.Further, non-characteristic sequence part herein
It is possible, the base replacement such as to non-characteristic sequence part progress single locus for having transformation.In short, SEQ ID No.5~
SEQ ID No.16 only merely provides the example of some Index primers, to the spy of SEQ ID No.5~SEQ ID No.16
It levies sequence and carries out other permutation and combination (characteristic sequence of permutation and combination and the feature of SEQ ID No.5~SEQ ID No.16
Sequence is different), simple base replacement is carried out to non-characteristic sequence, and the other primer sequences formed are also that can be adapted for
State step.
Cyclization liquid is prepared referring to table 3, is mixed, 60 DEG C of PCR instrument are reacted 2 hours, and ice bath placement is then gone to；Referring to table
4 prepare PCR reaction system, and wherein cDNA used in amounts is most suitably used with determination according to the several concentration gradients of experiment concrete condition setting
The dosage of amount, nuclease-free water is adjusted according to cDNA amount, and prepared reaction system is mixed, is placed in PCR instrument, according to
Following procedure runs PCR reaction:
S10, the purifying in library after enrichment:
S101, DNA combination magnetic beads for purifying
By in S9 gained PCR product be transferred to containing 90 μ L DNA combination magnetic beads (Agencourt AMPure XP,
Beckman in 1.5mL centrifuge tube), pipettor piping and druming mix, be stored at room temperature 5~10 minutes, be subsequently placed in magnetic frame until from
The clarification of heart liquid in pipe, abandons supernatant, and the ethyl alcohol cleaning magnetic bead of 200 μ L 70~80% (V/V) is then added into centrifuge tube, sets
In magnetic frame until liquid is clarified, abandoning supernatant, repeated washing one time；Centrifuge tube is stood 5 minutes or so at room temperature and air-dries magnetic bead,
16 μ L nuclease-free waters are added, magnetic bead is resuspended, then centrifuge tube is placed in by elution of bound in the ribosomes marking library on magnetic bead
Supernatant is transferred to new 1.5mL centrifuge tube, it is spare to be placed in ice bath by magnetic frame until liquid in pipe clarification.
S102,8%Native PAGE purifying
Prepare 1.00mm specification 8%Native PAGE glue [(W/V) Acrylamide/Bis of 3mL 40% solution,
10 × tbe buffer liquid of 0.75ml, 12 μ L, 10% (W/V) APS solution and 9 μ L TEMED/15mL gels] it is spare；To through S101
3 μ L 6 × Blue/Orange nucleic acid loading dye liquors are added respectively in the control of purifying gained and ribosomes marking library, are mixed, and are turned
Enter 8%Native PAGE glue electrophoretic separation, bromophenol blue stops electrophoresis after being moved to gel bottom；Gel is removed, pre-cooling is transferred to
In SYBR Gold nucleic acid dye liquor, places 10 minutes or so at low temperature, under blue light electrophoresis visualizer, cut 140~160 alkali
The ribosomes marking library blob of viscose of base size is transferred to 2mL nuclease free centrifuge tube, grinds blob of viscose, and 400 μ L 0.4N NaCl are added
Solution mixes, and is placed on rotation vortex mixer, and 20~40rpm rotation at low temperature is stayed overnight；Then the mixed liquor in centrifuge tube is turned
Enter in COSTAR Spin-X filter column, 12000~16000g is centrifuged 5~15 minutes at room temperature, and 2 μ L glycogen, 40 are added into filtrate
μ L 3M sodium acetate (pH5.2) and 1mL dehydrated alcohol mix, are placed in overnight precipitation in -80~-65 DEG C of ultra low temperature freezer, so
12000~16000g is centrifuged 30 minutes~1 hour under low temperature afterwards, abandons supernatant, is cleaned and is precipitated with 70~80% ethyl alcohol, in abandoning
Clearly, precipitating is air-dried at room temperature, ribosomes marking cDNA is resuspended in suitable nuclease-free water, sequencing analysis.
Embodiment 2
Nutrient fluid cultivation OryzasativaLcv.Nipponbare and extra large rice 86, condition of culture are 12 hours photoperiods, 28 DEG C of daytime temperature, night in the incubator
Warm 25 DEG C and relative air humidity 60~70%., until seedling is long to tri-leaf period, 150mM NaCl is handled 24 hours, is taken respectively
Two kind normal growths and 24 hours salt treatment seedling overground parts, two biology repeat, liquid nitrogen flash freezer, referring to the present invention
The process separation ribosomes/RNA compound extracts ribosomes marking RNA, goes rRNA, purifying, adjunction head, then reverse transcription
Obtain rice ribosomes marking library, purifying, cyclisation library cDNA, last PCR enriched library, sequence verification Library Quality, knot
Fruit display is using the rice ribosomes marking library of the building of process shown in the present invention, and marking fragment length is more concentrated and peak value is big
Mostly in 28 base of ideal length, minority is located at 27 or 29 base positions, but all has significant 3 base periodicity, and library matter
Amount is stablized, and is not influenced and (is please referred to Fig.1 to Fig.4) by material and growth conditions difference.Below to being contained in FIG. 1 to FIG. 4
Information is further illustrated:
Fig. 1: the figure shows using OryzasativaLcv.Nipponbare rice seedling overground part under normal growth and salt stress as material, using this
Marking fragment length distribution situation in the ribosomes marking library of the process building is invented, 28 base of ideal value is concentrated mainly on
Or slightly deviation (29 base), Fig. 1 show the high quality marking segment that this building process help to obtain 28 bases longs.
Fig. 2: the figure shows using OryzasativaLcv.Nipponbare rice seedling overground part under normal growth and salt stress as material, using this
The marking 3 base periodicity in the ribosomes marking library of the process building is invented, vertical and horizontal dotted lines are marked respectively in Fig. 2
The threshold value for having shown 3 base periodic locations and its conspicuousness, all libraries known to result in Fig. 2 all have significant 3 base
Periodically, show that this building process is help to obtain with the periodic high quality ribosomes marking library of significant 3 base.
Fig. 3: the figure, which shows, plunges into the commercial sea 86 rice seedling overground part of rice as material, using this using normal growth and salt stress
Marking fragment length distribution situation in the ribosomes marking library of the process building is invented, 28 base of ideal value is concentrated mainly on
Or slightly deviation (27 base), Fig. 3 show that this building process help to obtain the high quality marking segment of 28 bases longs.
Fig. 4: the figure, which shows, plunges into the commercial sea 86 rice seedling overground part of rice as material, using this using normal growth and salt stress
The marking 3 base periodicity in the ribosomes marking library of the process building is invented, vertical and horizontal dotted lines are marked respectively in figure
The threshold value for having shown 3 base periodic locations and its conspicuousness, all libraries known to result in figure all have significant 3 base week
Phase property, Fig. 4 show that this building process is help to obtain with the periodic high quality ribosomes marking library of significant 3 base.
Embodiment 2 is the specific implementation to the provided construction method of embodiment 1.
Embodiment 3
Can also include S2 after step S1: the ultraviolet detection of rice ribosomes spectrum:
Using density gradient preparing instrument (Lead Fluid) in the polypropylene ultracentrifugation pipe that specification is 13 × 51mm
15~60% (W/V) gradient sucroses are prepared in (Beckman, article No. 326819), then take gained in the S1 of 1000A260 unit
Ribosomes/RNA sample is placed on gradient sucrose liquid, and using SW55 horizontal rotor, 170000g is centrifuged 1.5 hours at 4 DEG C
(Beckman), centrifugation product is placed in the density gradient separation instrument (BRANDEL) for being associated with UA-6 ultraviolet absorption detector, from upper
And lower separation product and detect record its absorbance value at 254nm.
Step S2 is an optional step, and for construction method of the invention, S2 is not essential step.
The case where more can intuitively observing S1 obtained rice ribosomes/RNA sample by S2, such as its ribosomes marking segment
The dispersion of length if the density gradient image by the obtained ribosomes/RNA sample of S1 is more concentrated, and is concentrated
In the corresponding position for being equivalent to the segment containing 28 bases, that more can intuitively prove the ribosomes of the improvement of the application
Extract recipe has good effect.
The other parts of the present embodiment 3 and embodiment 1 are all identical, and difference is only that the introducing of S2.
The points for attention in the application also noted:
1. solution, reagent, pipette tips and centrifuge tube used in building process etc. will ensure no DNA/RNA enzyme.
2. ribosomes extracting solution wants matching while using, each constituent concentration strict control, especially deoxycholic acid's
Concentration will lead to ion releasing when excessively high, lead to the failure of an experiment.
3. the ribosomes extracted /RNA sample saves, ultra low temperature freezer preservation is transferred to after most handy liquid nitrogen flash freezer.
4. pair ribosomes/RNA sample carries out nucleic acid enzymatic treatment, enzyme dosage and processing time may be because of the differences of tissue
It is different to be slightly different, therefore can be adjusted as the case may be when necessary.
5.PAGE has to when purifying plus control, convenient for judging the recycling of stripe size and sample.
When 6.PCR enriched library, template concentrations and PCR cycle number need appropriate adjustment as the case may be, template concentrations
And PCR cycle number can not be excessively high.
Although the embodiments of the present invention has been shown and described above, it is to be understood that above-described embodiment is example
Property, it is not considered as limiting the invention, those skilled in the art are not departing from the principle of the present invention and objective
In the case where can make changes, modifications, alterations, and variations to the above described embodiments within the scope of the invention.
Sequence table
<110>Shenzhen University
Longhua biological industry innovation research institute, Shenzhen University
<120>construction method in a kind of high quality rice ribosomes marking library
<130> WK19--CN1-1943
<141> 2019-05-07
<160> 16
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213>artificial sequence (unknown)
<400> 1
agatcggaag agcacacgtc t 21
<210> 2
<211> 28
<212> RNA
<213>artificial sequence (unknown)
<400> 2
nnguacacgg agucgacccg caacgcnn 28
<210> 3
<211> 30
<212> RNA
<213>artificial sequence (unknown)
<400> 3
nnguacacgg agucaagacc cgcaacgcnn 30
<210> 4
<211> 52
<212> DNA
<213>artificial sequence (unknown)
<400> 4
aatgatacgg cgaccaccga gatctacacg ttcagagttc tacagtccga cg 52
<210> 5
<211> 64
<212> DNA
<213>artificial sequence (unknown)
<220>
<221> unsure
<222> (25)..(30)
<400> 5
caagcagaag acggcatacg agatatcacg gtgactggag ttcagacgtg tgctcttccg 60
atct 64
<210> 6
<211> 64
<212> DNA
<213>artificial sequence (unknown)
<220>
<221> unsure
<222> (25)..(30)
<400> 6
caagcagaag acggcatacg agatcgatgt gtgactggag ttcagacgtg tgctcttccg 60
atct 64
<210> 7
<211> 64
<212> DNA
<213>artificial sequence (unknown)
<220>
<221> unsure
<222> (25)..(30)
<400> 7
caagcagaag acggcatacg agatttaggc gtgactggag ttcagacgtg tgctcttccg 60
atct 64
<210> 8
<211> 64
<212> DNA
<213>artificial sequence (unknown)
<220>
<221> unsure
<222> (25)..(30)
<400> 8
caagcagaag acggcatacg agattgacca gtgactggag ttcagacgtg tgctcttccg 60
atct 64
<210> 9
<211> 64
<212> DNA
<213>artificial sequence (unknown)
<220>
<221> unsure
<222> (25)..(30)
<400> 9
caagcagaag acggcatacg agatacagtg gtgactggag ttcagacgtg tgctcttccg 60
atct 64
<210> 10
<211> 64
<212> DNA
<213>artificial sequence (unknown)
<220>
<221> unsure
<222> (25)..(30)
<400> 10
caagcagaag acggcatacg agatgccaat gtgactggag ttcagacgtg tgctcttccg 60
atct 64
<210> 11
<211> 64
<212> DNA
<213>artificial sequence (unknown)
<220>
<221> unsure
<222> (25)..(30)
<400> 11
caagcagaag acggcatacg agatcagatc gtgactggag ttcagacgtg tgctcttccg 60
atct 64
<210> 12
<211> 64
<212> DNA
<213>artificial sequence (unknown)
<400> 12
caagcagaag acggcatacg agatacttga gtgactggag ttcagacgtg tgctcttccg 60
atct 64
<210> 13
<211> 64
<212> DNA
<213>artificial sequence (unknown)
<220>
<221> unsure
<222> (25)..(30)
<400> 13
caagcagaag acggcatacg agatgatcag gtgactggag ttcagacgtg tgctcttccg 60
atct 64
<210> 14
<211> 64
<212> DNA
<213>artificial sequence (unknown)
<220>
<221> unsure
<222> (25)..(30)
<400> 14
caagcagaag acggcatacg agattagctt gtgactggag ttcagacgtg tgctcttccg 60
atct 64
<210> 15
<211> 64
<212> DNA
<213>artificial sequence (unknown)
<220>
<221> unsure
<222> (25)..(30)
<400> 15
caagcagaag acggcatacg agatggctac gtgactggag ttcagacgtg tgctcttccg 60
atct 64
<210> 16
<211> 64
<212> DNA
<213>artificial sequence (unknown)
<220>
<221> unsure
<222> (25)..(30)
<400> 16
caagcagaag acggcatacg agatcttgta gtgactggag ttcagacgtg tgctcttccg 60
atct 64
Claims (10)
1. a kind of ribosomes extract recipe of improvement, which is characterized in that including following component:
Trishydroxymethylaminomethane-hydrochloric acid (Tris-HCl, pH8.0) of 0.05~0.15M；
The potassium chloride (KCl) of 30~50mM；
Magnesium chloride (the MgCl of 10~30mM2)；
Polyoxyethylene (10) tridecyl ether (polyoxyethylene (10) tridecyl of 1.5~2.5% (V/V)
ether)；
The deoxycholic acid (deoxycholic acid) of 0.1~0.3% (W/V)；
The dithiothreitol (DTT) (DL-Dithiothreitol, DTT) of 0.5~1.5mM；
The cycloheximide (cycloheximide) of 50~100 μ g/mL；
And the deoxyribonuclease I (DNaseI) of 5~15U/mL.
2. a kind of construction method in the high quality ribosomes marking library of rice, which comprises the steps of:
S1 isolates ribosomes/RNA sample by the ribosomes extracting solution of improvement from rice material；
S3 carries out nucleic acid enzymatic treatment, the extracting of SDS method to ribosomes/RNA sample, obtains rice ribosomes marking RNA segment；
S4 removes the rRNA in rice ribosomes marking RNA segment；
S5 repairs the end of rice ribosomes marking RNA segment；
Rice ribosomes marking RNA segment is connect by S6 with 3 ' termination header sequences；
S7 obtains rice ribosomes marking DNA library by reverse transcription；
S9 carries out cyclisation to ribosomes marking DNA library and PCR is enriched with.
3. the construction method in the high quality ribosomes marking library of rice according to claim 2, which is characterized in that upper
After stating any one step, further include the steps that purifying intermediate product.
4. the construction method in the high quality ribosomes marking library for the rice stated according to claim 3, which is characterized in that in S3,
Nucleic acid enzymatic treatment is specifically: nucleic acid is added into ribosomes/RNA sample using 15~40U nuclease/40 μ g RNA ratio
Enzyme, metal bath, 600~800rpm concussion are handled 1~2 hour under room temperature.
5. the construction method in the high quality ribosomes marking library for the rice stated according to claim 4, which is characterized in that in S3,
Nucleic acid enzymatic treatment, the extracting of SDS method are carried out to ribosomes/RNA sample；Then purified with purification enrichment kit and be enriched with behaviour
Make, is filtered at this point, filter core is added in sample and with the nucleic acid samples of no RNA enzyme water elution of bound from filter core, repeated
Column is for several times.
6. the construction method in the high quality ribosomes marking library for the rice stated according to claim 5, which is characterized in that in S3,
Purifying is carried out with purification enrichment kit and enrichment procedure includes purifying the ribosomes marking with RNA purification enrichment kit R1017
The operation of RNA, the operation include: that sample is crossed after the completion of column, 400 μ L RNA washing buffers are added into filter column, at room temperature
12000~16000g is centrifuged 30 seconds~1 minute, gives up filtrate, 80 μ L DNaseI treatment fluids are added into filter column, described
DNaseI treatment fluid specifically includes 5 μ L DNaseI and 75 μ L DNaseI buffers, is stored at room temperature 15~20 minutes.
7. the construction method in the high quality ribosomes marking library for the rice stated according to claim 2, which is characterized in that S4, tool
Body is: using the rRNA in rRNA removal kit removal ribosomes marking RNA.
8. the construction method in the high quality ribosomes marking library for the rice stated according to claim 7, which is characterized in that S4, tool
Body includes:
S41, the rRNA for preparing purifying remove magnetic bead；
S42 pre-processes RNA sample；
S43 is removed rRNA in RNA sample；
S44 carried out column purification to ribosomes marking RNA sample；
S45 carries out PAGE purifying to ribosomes marking RNA sample.
9. the construction method in the high quality ribosomes marking library for the rice stated according to claim 8, which is characterized in that S45,
When PAGE purification of nucleic acid sample, gel sample is placed in 20~40rpm rotation under rotation vortex mixer, low temperature and stays overnight；Utilize 0.45 μm
The filter column separating gel in aperture.
10. the construction method in the high quality ribosomes marking library for the rice stated according to claim 8, which is characterized in that S9 it
After further include S10, after completing the enrichment of ribosomes marking DNA library, ribosomes marking DNA library is purified again, it is specific to wrap
It includes:
S101, DNA combination magnetic beads for purifying；
S102, Native PAGE purifying, specific: Native PAGE purified pcr product cuts ribosomes marking library glue
Block after grinding, is resuspended in 400 μ L 0.4N NaCl solutions；Filtering；2 μ L glycogen, 40 μ L 3M sodium acetates are added into filtrate
(pH5.2) and 1mL dehydrated alcohol it, is precipitated.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910376020.1A CN110317771A (en) | 2019-05-07 | 2019-05-07 | A kind of construction method in high quality rice ribosomes marking library |
| PCT/CN2019/086055 WO2020223936A1 (en) | 2019-05-07 | 2019-05-08 | Construction method for high-quality rice ribosome imprint library |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910376020.1A CN110317771A (en) | 2019-05-07 | 2019-05-07 | A kind of construction method in high quality rice ribosomes marking library |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110317771A true CN110317771A (en) | 2019-10-11 |
Family
ID=68118867
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910376020.1A Pending CN110317771A (en) | 2019-05-07 | 2019-05-07 | A kind of construction method in high quality rice ribosomes marking library |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN110317771A (en) |
| WO (1) | WO2020223936A1 (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111243665A (en) * | 2020-01-07 | 2020-06-05 | 广州基迪奥生物科技有限公司 | Analysis method and system for ribosome imprinting sequencing data |
| CN111518870A (en) * | 2020-02-04 | 2020-08-11 | 广东美格基因科技有限公司 | Reverse transcription primer pool and kit for removing ribosomal RNA and method for removing ribosomal RNA |
| CN111635935A (en) * | 2020-06-10 | 2020-09-08 | 华中农业大学 | Low-cost and high-throughput method for indirectly quantifying protein expression level and application thereof |
| CN112899345A (en) * | 2019-12-03 | 2021-06-04 | 暨南大学 | Construction method of ribosome blot sequencing library |
| CN113832182A (en) * | 2021-09-13 | 2021-12-24 | 深圳大学 | Preparation method of rice Osspear2 mutant plant |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115612718A (en) * | 2021-07-13 | 2023-01-17 | 中国科学院北京基因组研究所(国家生物信息中心) | Single cell translation group sequencing method |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103571821A (en) * | 2012-07-19 | 2014-02-12 | 杜权 | Nucleic acid separation method and its application |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108624651B (en) * | 2018-05-14 | 2022-01-07 | 深圳承启生物科技有限公司 | Method for constructing Ribo-seq sequencing library |
-
2019
- 2019-05-07 CN CN201910376020.1A patent/CN110317771A/en active Pending
- 2019-05-08 WO PCT/CN2019/086055 patent/WO2020223936A1/en active Application Filing
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103571821A (en) * | 2012-07-19 | 2014-02-12 | 杜权 | Nucleic acid separation method and its application |
Non-Patent Citations (2)
| Title |
|---|
| NICHOLAS T. INGOLIA1 ET AL.: "The ribosome profiling strategy for monitoring translation in vivo by deep sequencing of ribosome-protected mRNA fragments", 《NAT PROTOC.》 * |
| POLLY YINGSHAN HSU ET AL.: "Super-resolution ribosome profiling reveals unannotated translation events in Arabidopsis", 《PNAS》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112899345A (en) * | 2019-12-03 | 2021-06-04 | 暨南大学 | Construction method of ribosome blot sequencing library |
| CN111243665A (en) * | 2020-01-07 | 2020-06-05 | 广州基迪奥生物科技有限公司 | Analysis method and system for ribosome imprinting sequencing data |
| CN111518870A (en) * | 2020-02-04 | 2020-08-11 | 广东美格基因科技有限公司 | Reverse transcription primer pool and kit for removing ribosomal RNA and method for removing ribosomal RNA |
| CN111635935A (en) * | 2020-06-10 | 2020-09-08 | 华中农业大学 | Low-cost and high-throughput method for indirectly quantifying protein expression level and application thereof |
| CN113832182A (en) * | 2021-09-13 | 2021-12-24 | 深圳大学 | Preparation method of rice Osspear2 mutant plant |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2020223936A1 (en) | 2020-11-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110317771A (en) | A kind of construction method in high quality rice ribosomes marking library | |
| US20180126383A1 (en) | Microorganism nucleic acid purification from host samples | |
| US20210214783A1 (en) | Method for constructing sequencing library, obtained sequencing library and sequencing method | |
| CN107760773A (en) | A kind of method that scRRBS analyses are carried out to embryo medium | |
| CN106591285B (en) | A method of constructing the library Hi-C of high availability data rate | |
| WO2022161294A1 (en) | Construction method and use of medium-throughput single-cell copy number library | |
| CN108841934A (en) | A kind of method and kit of the N7- methylguanosine modification of the full inside transcript profile range single base resolution ratio detection RNA | |
| CN104630211B (en) | A kind of construction method of Small RNA cDNA libraries | |
| CN110343754A (en) | A method of it is quickly detected for hematopoietic stem cell transplantation donor pathogenic microorganism | |
| CN112410403A (en) | Preparation method and kit of ATAC-seq library with accurate quantification | |
| CN111471677A (en) | Sputum pathogenic microorganism metagenome de-hosting extraction system and method | |
| CN109750031A (en) | Using the library constructing method of high throughput sequencing technologies detection transcription initiation site | |
| CN111607588A (en) | Annular RNA rapid enrichment kit and method | |
| CN113637668A (en) | Kit for simultaneously extracting pathogenic bacteria DNA of blood plasma and blood cells and application thereof | |
| CN106567133A (en) | Metatranscriptomics library establishment method | |
| CN111560423B (en) | Method for detecting RNA m6A with high flux and high sensitivity and single base resolution and application thereof | |
| CN116926218B (en) | Probe combination, gene chip, kit and method for detecting ascophyllum sp | |
| Powers et al. | Performing ribosome profiling to assess translation in vegetative and meiotic yeast cells | |
| WO2020135347A1 (en) | Method for detecting dna methylation, test kit, device and application | |
| CN104560950A (en) | MDA (Multiple Displacement Amplification)-based whole-genome amplification method | |
| CN108333159B (en) | Method for detecting relative content of sample strains | |
| ES2645418T3 (en) | Amplification of a sequence of a ribonucleic acid | |
| CN115197997A (en) | CUT & Tag method applied to plant pollen | |
| Gupta et al. | In Vivo RNA Structure Probing with DMS-MaPseq | |
| CN106755337A (en) | A kind of cell chromosome analyzes quick banking process and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20191011 |
|
| WD01 | Invention patent application deemed withdrawn after publication |