CN107760660B

CN107760660B - Tissue type plasminogen activator mutant and application thereof

Info

Publication number: CN107760660B
Application number: CN201711332797.5A
Authority: CN
Inventors: 黄明东; 彭双周; 袁彩; 雪光浦; 李金宇
Original assignee: Fuzhou University
Current assignee: Fuzhou University
Priority date: 2017-12-13
Filing date: 2017-12-13
Publication date: 2020-10-02
Anticipated expiration: 2037-12-13
Also published as: CN107760660A

Abstract

The invention provides a tissue plasminogen activator mutant and application thereof, wherein the mutant comprises an A146 site which is a brand-new mutation site, and comprises substitution, deletion or addition of at least one or more amino acid residues in the A146. The mutant of the invention has the capacity of obviously resisting the inhibition by an endogenous inhibitor (PAI-1) and the enhanced capacity of activating plasminogen. Can be used for preparing medicines for treating thrombotic diseases, such as acute myocardial infarction, acute pulmonary embolism, cerebral apoplexy, venous thrombosis, etc.

Description

Tissue type plasminogen activator mutant and application thereof

Technical Field

The invention belongs to the field of biological medicines, and particularly relates to a tissue-type plasminogen activator mutant and application thereof.

Background

With the rapid development of society and economy, the quality of life of people is increasingly improved. Among them, high-sugar, high-protein and high-fat foods account for an increasingly high proportion of daily nutrient intake of people, so that diseases such as hypertension, hyperlipidemia, coronary heart disease, myocardial infarction, cerebral infarction and the like are caused, and great threat is brought to the health of the whole human. Currently, cardiovascular diseases have become the first leading killer of human health, especially thromboembolic diseases. It mainly includes three types: (1) coronary thrombosis, mainly Acute Myocardial Infarction (AMI), (2) cerebrovascular thrombosis, i.e., acute ischemic stroke; (3) venous thrombosis, such as acute pulmonary embolism. According to statistics, approximately 900,000 people in the united states suffer AMI annually, with up to 225,000 deaths, and with a particularly rapid time to death due to morbidity, with approximately 125,000 deaths occurring without immediate treatment. In China, 300 million people need thrombolytic drug treatment every year according to statistics. Moreover, most acute myocardial infarction results from insufficient blood flow and myocardial death due to occlusion and embolism of coronary arteries. Thrombolytic therapy is an important means for treating thrombotic diseases, and thrombolytic drugs are used for greatly improving clinical treatment by dissolving thrombus, increasing myocardial blood flow, improving oxygen supply, reducing infarction range and improving cerebral nerve cell injury in ischemic areas. International multiple large-scale clinical experiments prove that the thrombolytic therapy can reduce the mortality of AMI by more than 30%.

Tissue plasminogen activator (tPA) is a physiological activator of the fibrinolytic system in blood. Because tPA has stronger specific affinity with thrombus matrix fibrin, plasminogen can be effectively activated at the local part of thrombus to be plasmin so as to dissolve the thrombus. Compared with thrombolytic agents such as streptokinase and urokinase, tPA has the advantages of quick action, no systemic fibrinolysis, high treatment rate and the like. Native tPA consists of 527 amino acids, which comprise five domains: 1. the finger-type region (region F, amino acids 4-49) is associated with fibrin binding. 2. The epidermal growth factor region (region E, amino acids 50-86) is involved in the binding of cell membrane receptors. 3. kringle 1 (region K1, amino acids 87-175) is the liver receptor binding site. 4. kringle 2 (region K2, amino acids 176-261) contains a fibrin binding site. 5. The hydrolase domain region (SPD region, 262-527 amino acid) catalyzes the conversion of plasminogen to plasmin, and is the binding site for PAI-1.

Tissue plasminogen activator (tPA) was the first genetically engineered thrombolytic drug approved by the FDA in 1987 for the treatment of acute myocardial infarction in the united states. In 1990 the us FDA again approved it for the treatment of acute pulmonary embolism. In 1999 the us FDA re-approved it for the treatment of acute ischemic stroke. And is the only thrombolytic drug for acute ischemic stroke at present.

However, tPA also exhibits certain limitations in its clinical use. Wherein, a large amount of plasminogen activator inhibitor (PAI-1) is enriched at the focus part, thereby leading the therapeutic drug tPA to be easily inhibited by PAI-1 irreversibility and rapidly lose the activity. Clinically, in order to ensure the therapeutic effect, it is common to administer a dose of up to 100mg/50kg to the patient. High doses of tPA not only cause a fatal risk of intracranial hemorrhage, but also cause neurotoxic side effects, thereby increasing patient mortality. In addition, the first and second substrates are,in the process of forming a thrombus, a large number of platelets are contained in the thrombus. Under the stimulation of thrombin, platelets are continuously activated to release a large amount of PAI-1, and the titer of tPA medicines in blood is greatly reduced. Although a mutant of TNK-tPA has been developed which has the ability to resist PAI-1, the TNK-tPA mutant contains KHRR^296-299The mutation to AAAA is not sufficiently resistant to PAI-1 and has not been shown to enhance plasminogen activation. Therefore, in clinical practice, there is still a great need to develop new tPA drugs, which can be used for treating diseases such as acute myocardial infarction, cerebral thrombosis, pulmonary embolism, etc., and further improve the application value thereof in medicine.

Disclosure of Invention

The invention aims to provide a tissue plasminogen activator mutant and application thereof, which have the capacity of obviously resisting the inhibition by an endogenous inhibitor (PAI-1) and the enhanced capacity of activating plasminogen.

In order to achieve the purpose, the invention adopts the following technical scheme:

this mutation point is located in the hydrolase domain A146 (amino acid nomenclature Chymotrypsinogenumbering) site of tPA. The tPA mutant comprises substitution, deletion or addition of at least one or more amino acid residues in A146.

An example is the mutation of A146 to Y based on the hydrolase domain of tPA (i.e.; tPA (A146Y)), wherein the amino acid sequence SEQ ID NO.1 is: IKGGLF ADIAS HPWQA AIFAK HRRSP GERFL CGGIL ISSCW ILSAAHCFQE RFPPH HLTVI LGRTY RVVPG EEEQK FEVEK YIVHK EFDDD TYDND IALLQ LKSDS SRCAQESSVV RTVCLPPAD LQLPD WTECE LSGYG KHEYL SPFYS ERLKE AHVRL YPSSR CTSQH LLNRTVTD NMLCA GDTRS GGPQA NLHDA CQGDS GGPLV CLNDG RMTLV GIISW GLGCG QKDVP GVYTKVTNYL DWIRD NMRP are provided.

The obtained tPA (A146Y) mutant recombinant protein has 75% increased PAI-1 resistance and 5 times enhanced plasminogen activating capacity compared with wild type.

The above-mentioned 146-position amino acid Ala may be substituted by any one of Tyr, Gly, Val, Leu, Met, IIe, Ser, Thr, Pro, Asn, Gln, Phe, Trp, Lys, Arg, His, Asp and Glu. In the examples of the present invention, it has been demonstrated that substitution of amino acid Ala146 with Tyr not only significantly improves the resistance against PAI-1, but also enhances the plasminogen-activating ability.

The invention has the advantages that:

the mutant of tissue plasminogen activator (tPA) has the capacity of obviously resisting the inhibition by endogenous inhibitor (PAI-1) and the enhanced capacity of activating plasminogen. The mutant including A146 (amino acid naming mode is Chymotrypsinogen number) site is a brand new mutation site, and has not been reported before. We have demonstrated by example experiments that the tPA (A146Y) mutant recombinant protein not only has a PAI-1 resistance capacity improved by 75% remarkably, but also shows a new function, namely, the plasminogen activation capacity is enhanced by 5 times. The mutant can be used for preparing medicines for treating thrombotic diseases, including acute myocardial infarction, acute pulmonary embolism, cerebral apoplexy, venous thrombosis and other diseases.

Drawings

FIG. 1: SDS-PAGE electrophoresis picture after protein purification, wherein M is marker, 1 is tPA protein, and 2 is tPA (A146Y) mutant protein.

FIG. 2: the activity of tPA (A146Y) mutant enzyme was detected by chemiluminescence zymolyte method.

FIG. 3: evaluation of plasminogen activating ability of tPA (A146Y) mutant.

FIG. 4: testing PAI-1 resistance of tPA (A146Y) mutant.

FIG. 5: in vitro thrombolysis assay. A is a significantly stronger and faster thrombolytic capacity of tPA (a146Y) than tPA in normal blood. B is that in the case of exogenous active PAI-1, the thrombolysis capacity of tPA (A146Y) is not affected at all, while the activity of tPA-SPD is completely inhibited. The tPA (A146Y) mutant protein is proved to have very strong PAI-1 resistance capability to promote the dissolution of thrombus.

Detailed Description

The method and its advantages will be further illustrated by the following figures and examples, which should not be construed as limiting the scope of the claims. The present invention may be further modified and improved without departing from the scope of the main characteristics of the present invention, and such modifications and improvements are intended to be included within the scope of the present invention.

EXAMPLE 1 construction, expression and purification of tPA (A146Y) mutant

tPA (A146Y) is a mutation A146Y based on the hydrolase domain of tPA (tPA-SPD), also abbreviated as tPA (A146Y) or tPA-SPD (A146Y) (amino acid nomenclature is Chymotrypsigennumbering):

(1) and (3) constructing a tPA-SPD-pPICZ alpha A plasmid.

The tPA-SPD gene fragment is amplified by PCR method using human liver cell cDNA as template. The tPA-SPD fragment was cleaved with restriction enzymes XhoI and SacI, and the pPICZ α a plasmid (pPICZ α a plasmid purchased from Invitrogen) was cleaved with the same restriction enzymes XhoI and SacI, and the tPA-SPD fragment was ligated into the pPICZ α a plasmid with T4 ligase. The enzyme-linked product is transformed into escherichia coli DH5 alpha through thermal excitation at 42 ℃, a plate is coated, a single colony is selected, gene sequencing is carried out, DH5 alpha strain containing correct tPA-SPD sequence is subjected to amplification culture, and tPA-SPD-pPICZ alpha A plasmid is extracted by adopting a ZDNA plasmid small-extraction kit (OMEGA) for the following experiments.

(2) tPA (A146Y) -pPICZ alpha A mutant plasmid construction and protein expression.

The template for PCR to be carried out herein was the tPA-SPD-pPICZ. alpha.A plasmid obtained in (1) above.

The primer design is that the Sense is 5 '-CAAGCATGAGTACTTGTCTCCTTTCTATTC-3';

Antisense: 5＇－GAATAGAAAGGAGACAAGTACTCATGCTTG -3＇。

1 μ L of DpnI (Takara) was added to the PCR product and incubated overnight at 37 ℃. The PCR product was gel recovered using a ZDNA gel recovery kit (OMEGA). Thermally exciting and transforming to Escherichia coli DH5 alpha at 42 ℃, coating a plate, selecting a monoclonal for sequencing, performing 15% glycerol strain preservation on strains containing correct mutation, and storing in a refrigerator at-80 ℃ for later use.

The preserved glycerol strain is selected to be activated and expanded in an LB culture medium, and a tPA-A146Y-pPicZ alpha A plasmid is extracted by adopting a ZDNA plasmid miniprep kit (OMEGA). The extracted plasmid was linearized.

37 ℃ overnight. And (5) precipitating and recovering ethanol.

The recycled DNA fragment is electrically transferred into a Pichia pastoris X-33 strain with the voltage of 1.5KV and the voltage of 0.6S. The single colony is smeared on an YPD (containing 100 mu g/ml Zeocin) plate, and is picked up and expressed in small amount for verification.

A small amount of successfully expressed Pichia pastoris X-33 is inoculated into YPD (containing 100 mug/ml Zeocin) and cultured for 1 day at 28 ℃, and the culture temperature is 1: 10 in BMGY medium, and was grown for 1 day at 28 ℃ in 1: 4 inoculating the strain in a BMMY culture medium for induction expression, continuing to culture for 3 days, and supplementing 1% methanol every day. Collecting bacteria, centrifuging at 10000rpm for 30min, and vacuum filtering the supernatant with a filter membrane with a pore diameter of 0.45 μm to obtain filtrate. The filtrate was passed through a Ni-NTA column (GE, flow rate 5ml/min, column volume 25 ml) equilibrated with an equilibration solution (20 mM Tris-HCl pH7.4, 500 mM NaCl) at which time the tPA (A146Y) protein with 6 His tags in the filtrate bound to the Ni-NTA column. The Ni-NTA column was further washed with five column volumes of equilibration solution (20 mM Tris-HCl pH7.4, 500 mM NaCl) to remove the impure proteins. Finally, the proteins were eluted with an eluent (20 mM Tris-HCl pH7.4, 500 mM NaCl, 500 mM imidazole), and the collected proteins were dialyzed twice against a dialysate (20 mM Tris-HCl pH7.4, 150mM NaCl) for at least 2 hours each time. After dialysis, the precipitate was removed by centrifugation for 20 minutes (20000rpm, Hitachi Koki CR22N high speed refrigerated centrifuge, R20A2 rotor). The target protein is identified by SDS-PAGE electrophoresis, tPA (A146Y) has the molecular weight of 28KDa, and is shown in figure 1, and the sequence obtained by sequencing is shown in SEQ ID NO. 1. The resulting protein solution was analyzed and concentrated using Millipore ultrafiltration tubes (10000Da) and then aliquoted and stored at-80 ℃ until use.

(3) The rest of the tPA-based mutants were based on the above example, and based on tPA (A146Y), suitable primers were designed, denaturation temperature and annealing time were changed during PCR, and transformation and expression, purification processes were performed as in (2). At the same time, the tPA protein is obtained by the same methods of transformation, expression and purification.

Example 2 Activity assay of tPA (A146Y) mutant enzymes

The enzyme activity was measured by a reported color development method (chromogenic assay) [ Gorlatova NV (2003) [ Mapping of environmental aspect on sheet activator inhibitor-1 by random administration. The reaction principle is as follows, and tPA protein with certain concentration is added into a reaction system with the volume of 200 muL. Then adding luminescent substrate S2288(Chromogenix), tPA can specifically identify the enzyme cutting site and cut down the chromophoric group-p-nitroaniline (pNA), and finally detecting the absorbance value of 405nm by an enzyme-labeling instrument to determine the activity of the tPA enzyme.

The specific determination process comprises the following steps:

(a) material

tPA, tPA (A146Y), tPA substrate S-2288 obtained in example 1 above.

Buffer: 20mM Tris-HCl pH7.4, 150mM NaCl, 0.2% BSA 0.22 μm pore size filter filtration.

(b) Step (ii) of

The mass concentration of each protein was measured by using a BCA protein quantification kit and converted to a molar concentration. tPA and tPA (A146Y) were diluted to 200nM and formulated at 320. mu. M S-2288. Added into a 200-mu-l reaction system according to requirements to be prepared into final concentration required by experiments. The samples were all added in the following order:

①180μl buffer+10μl tPA+10μl 320μM S-2288

②180μl buffer +10μl tPA(A146Y)+10μl 320μM S-2288

at the end, the luminescent substrate S2288(Chromogenix) was added and immediately placed in a BioTek Synergy 4 microplate reader at 405nm for 30S/read for 30 min. Each test was repeated at least 3 times. Mean values were fitted linearly to the reaction using GraphPadPrism 5 software with PBS as blank.

The results are shown in fig. 2, and show that the cleavage reaction rates of mutant tPA (a146Y) and tPA on luminescent substrate S2288 are basically consistent, which indicates that mutant tPA (a146Y) and tPA have the same enzyme activity, and also indicates that the point mutation of a146Y does not affect the activity of tPA enzyme.

EXAMPLE 3 testing of the plasminogen activating Activity of tPA (A146Y) on the Natural substrate

The measurement was carried out by a reported color development method (chromogenic assay) [ Gorlatova NV (2003) [ Mapping of cosmetic on plasma activator inhibitor-1 by random chromatography. The reaction principle is as follows, tPA and Plasminogen (PLG) with certain concentration are added into a reaction system with the volume of 200 muL, the tPA activates the PLG to generate plasmin (Pn), then a Pn specific luminescent substrate S-2403 is added, Pn can specifically identify enzyme cutting sites therein and cut down chromophoric group-p-nitroaniline (pNA), and the tPA does not enzyme cut the luminescent substrate S2403. And finally, detecting the absorbance value of 405nm by using a microplate reader to determine the activation capability of the tPA to the PLG.

The specific determination process comprises the following steps:

(a) material

tPA, tPA (A146Y), and PLG, Pn substrate S-2403 obtained as described in example 1 above.

(b) Step (ii) of

The mass concentration of each protein was measured by using a BCA protein quantification kit and converted to a molar concentration. tPA-SPD and tPA-SPD (A146Y) were diluted to 200nM to formulate 1. mu.M PLG, 320. mu. M S-2403. Added into a 200-mu-l reaction system according to requirements to be prepared into final concentration required by experiments. The samples were all added in the following order:

①170μl buffer+10μl PLG+10μl tPA+10μl 320μM S-2403；

②170μl buffer+10μl PLG+10μl tPA(A146Y)+10μl 320μM S-2403；

at the end, the luminogenic substrate S2403(Chromogenix) was added and immediately placed in a BioTek Synergy 4 microplate reader at 405nm for 30S/read for 30 min. Each test was repeated at least 3 times. Data processing was performed using GraphPad Prism5 software with PBS as blank control.

The results are shown in fig. 3, and show that the activation capacity of tPA (A146Y) on PLG is improved by 5 times, which indicates that the mutation of A146Y remarkably enhances the activation capacity of tPA on natural substrate PLG.

EXAMPLE 4 testing of the ability of tPA (A146Y) to resist PAI-1

The measurement was carried out by a reported color development method (chromogenic assay) [ Gorlatova NV (2003) [ Mapping of cosmetic on plasma activator inhibitor-1 by random chromatography. The reaction principle is as follows, in a reaction system with the volume of 200 muL, tPA is added to react with PAI-1 with different concentrations for 10min, tPA is inhibited by PAI-1, S-2288 is then added, tPA which is not combined with PAI-1 can carry out enzyme digestion on S-2288 and release chromophoric group-p-nitroaniline (pNA), and finally enzyme activity of residual tPA can be measured by detecting absorbance value of 405nm through a microplate reader to indirectly calculate the PAI-1 resistance capability of tPA.

The specific determination process comprises the following steps:

(a) material

tPA, tPA (A146Y), and PAI-1, tPA substrate S-2444, obtained as described in example 1 above.

(b) Step (ii) of

The mass concentration of each protein was measured by using a BCA protein quantification kit and converted to a molar concentration. tPA and tPA (A146Y) were diluted to 200nM and formulated at 320. mu. M S-2288. PAI-1 is adopted at 8 concentrations respectively; 40nM, 80nM, 120nM, 160nM, 200nM, 4800nM, 560nM, 600 nM. Added into a 200-mu-l reaction system according to requirements to be prepared into final concentration required by experiments. The samples were all added in the following order:

①180μl buffer+10μl tPA+10μl 320μM S-2288；

②180μl buffer +10μl tPA(A146Y)+10μl 320μM S-2288；

③170μl buffer+10μl tPA+10μl PAI-1(40nM--600nM)+10μl 320μM S-2288；

④170μl buffer +10μl tPA(A146Y) +10μl PAI-1(40nM--600nM)+10μl 320μMS-2288；

wherein, tPA or tPA (A146Y) and PAI-1 are pre-incubated for 10min, then fully mixed and prevented from generating bubbles as much as possible, and finally luminescent substrate S2288(Chromogenix) is added and immediately placed into a BioTek Synergy 4 microplate reader for 30S/read for 30min at 405 nm. Each test was repeated at least 3 times. The data processing employed GraphPad Prism5 software.

The results, shown in fig. 4, show that tPA (a146Y) still has 75% activity when tPA is completely inhibited by PAI-1, suggesting that the a146Y mutation significantly improves the resistance of tPA to PAI-1.

Example 5tPA-SPD (A146Y) enhances clot dissolution by resisting inhibition of PAI-1

The reported clot lysis assay (clot lysis assay) [ Peng SZ (2017), A Long-acting PAI-1 inhibitor recovery, thrombocyte formation, Thromb Haemost.]And (5) carrying out thrombolysis capacity detection. Due to Ca²⁺The addition of the (D) can stimulate the blood coagulation reaction of blood circulation to form thrombus, thereby improving the turbidity of a reaction system and having the maximum change of an absorbance value at 405 nm. The reaction principle is as follows, in a reaction system with the volume of 200 muL, 30% human serum and tPA with certain concentration are added, a certain amount of PAI-1 is added for reaction for 10min, and then Ca is added²⁺. Finally, the change of the absorbance value at 405nm is detected by a microplate reader to evaluate the thrombus dissolving capacity of the tPA.

The specific determination process comprises the following steps:

(a) material

tPA, tPA (A146Y), and PAI-1, CaCl obtained as described in example 1 above₂And (3) solution.

Blood from healthy volunteers was obtained by centrifuging human serum (abbreviated as PPP) at 3500rpm for 10 min.

Buffer: 20mM Tris-HCl pH7.4, 150mM NaCl 0.22 μm pore size filter.

(b) Step (ii) of

The mass concentration of each protein was measured by using a BCA protein quantification kit and converted to a molar concentration. tPA and tPA (A146Y) were diluted to 100nM and 100mM CaCl was prepared₂And (3) solution. PAI-1 was used at a concentration of 120 nM. Added into a 100-mu-l reaction system according to requirements to be prepared into final concentration required by experiments. The samples were all added in the following order:

①65μl buffer+30μl PPP +5μl 100mM CaCl₂；

②55μl buffer+30μl PPP+10μl tPA+5μl 100mM CaCl₂；

③55μl buffer+30μl PPP+10μl tPA(A146Y)+5μl 100mM CaCl₂；

④45μl buffer+30μl PPP+10μl tPA+10μl PAI-1+5μl 100mM CaCl₂；

⑤45μl buffer+30μl PPP+10μl tPA(A146Y)+10μl PAI-1+5μl 100mM CaCl₂；

④⑤ incubating tPA/tPA (A146Y) with PAI-1 for 10min, mixing well while avoiding generation of bubbles, and adding Ca²⁺After being fully mixed, the mixture is put into a BioTek Synergy 4 enzyme-labeling instrument and is detected for 60min at the position of 405nm at 30 s/read. Each test was repeated at least 3 times and averaged. The data processing adopts GraphPad Prism5 software.

The results are shown in fig. 5, and show that tPA (a146Y) has a significantly faster and stronger thrombolytic capacity than tPA without the addition of exogenous PAI-1 in fig. 5A. Under the condition of adding exogenous PAI-1 in FIG. 5B, the thrombolysis capacity of tPA (A146Y) is not affected at all, but tPA is completely inhibited, which shows that tPA (A146Y) has significant PAI-1 resistance.

The above description is only a preferred embodiment of the present invention, and all equivalent changes and modifications made in accordance with the claims of the present invention should be covered by the present invention.

SEQUENCE LISTING

<110> Fuzhou university

<120> tissue type plasminogen activator mutant and application thereof

<130>1

<160>1

<170>PatentIn version 3.3

<210>1

<211>252

<212>PRT

<213> Artificial sequence

<400>1

Ile Lys Gly Gly Leu Phe Ala Asp Ile Ala Ser His Pro Trp Gln Ala

1 5 10 15

Ala Ile Phe Ala Lys His Arg Arg Ser Pro Gly Glu Arg Phe Leu Cys

20 25 30

Gly Gly Ile Leu Ile Ser Ser Cys Trp Ile Leu Ser Ala Ala His Cys

35 40 45

Phe Gln Glu Arg Phe Pro Pro His His Leu Thr Val Ile Leu Gly Arg

50 55 60

Thr Tyr Arg Val Val Pro Gly Glu Glu Glu Gln Lys Phe Glu Val Glu

65 70 75 80

Lys Tyr Ile Val His Lys Glu Phe Asp Asp Asp Thr Tyr Asp Asn Asp

85 90 95

Ile Ala Leu Leu Gln Leu Lys Ser Asp Ser Ser Arg Cys Ala Gln Glu

100 105 110

Ser Ser Val Val Arg Thr Val Cys Leu Pro Pro Ala Asp Leu Gln Leu

115 120 125

Pro Asp Trp Thr Glu Cys Glu Leu Ser Gly Tyr Gly Lys His Glu Tyr

130 135 140

Leu Ser Pro Phe Tyr Ser Glu Arg Leu Lys Glu Ala His Val Arg Leu

145 150 155 160

Tyr Pro Ser Ser Arg Cys Thr Ser Gln His Leu Leu Asn Arg Thr Val

165 170 175

Thr Asp Asn Met Leu Cys Ala Gly Asp Thr Arg Ser Gly Gly Pro Gln

180 185 190

Ala Asn Leu His Asp Ala Cys Gln Gly Asp Ser Gly Gly Pro Leu Val

195 200 205

Cys Leu Asn Asp Gly Arg Met Thr Leu Val Gly Ile Ile Ser Trp Gly

210 215 220

Leu Gly Cys Gly Gln Lys Asp Val Pro Gly Val Tyr Thr Lys Val Thr

225 230 235 240

Asn Tyr Leu Asp Trp Ile Arg Asp Asn Met Arg Pro

245 250

Claims

1. A tissue-type plasminogen activator mutant, characterized in that: the mutant has a mutation site positioned at the site of the hydrolase domain Ala146 of tPA, and the amino acid sequence of the mutant is shown in SEQ ID NO. 1.

2. The use of a mutant of tissue plasminogen activator according to claim 1 in the manufacture of a medicament for the treatment of thrombotic disorders.