CN107727860A - CIRP function and purposes - Google Patents
CIRP function and purposes Download PDFInfo
- Publication number
- CN107727860A CN107727860A CN201711217349.0A CN201711217349A CN107727860A CN 107727860 A CN107727860 A CN 107727860A CN 201711217349 A CN201711217349 A CN 201711217349A CN 107727860 A CN107727860 A CN 107727860A
- Authority
- CN
- China
- Prior art keywords
- cirp
- glioma
- expression
- treatment
- medicine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Hematology (AREA)
- Pharmacology & Pharmacy (AREA)
- Molecular Biology (AREA)
- Urology & Nephrology (AREA)
- Biomedical Technology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Food Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Biotechnology (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to field of medical technology, and in particular to CIRP function and purposes.The present invention is by in-depth study extensively, cold-induced associated proteins CIRP is disclosed first in glioma cell unconventionality expression, its expression is related to tumor grade and resistance, the relation of the pernicious biological property such as CIRP gene expression doses and the pernicious differentiation degree of glioma, transfer and recurrence at present, and its mechanism of action whole world there is no research to report.The project explores new gene function change and the relation of glioma malignant characteristics, there is provided provides new thinking for the personalized treatment of glioma.
Description
Technical field
The invention belongs to field of medical technology, and in particular to CIRP function and purposes.
Background technology
Glioma is most common primary tumor in adult human central nervous's system, still lacks effective treatment at present
Means, and the shortage of objective, effective diagnostic criteria is to limit the basic reason of glioma research.Medical field generally uses at present
Glioma classification diagnosis criterion (WHO standard in 2007) be largely based on morphological indexes.According to
In morphologic similitude, glioma is divided into star or oligopoly structure knurl for star or oligopoly structure, and
Under this framework, according to the morphology of tumour cell is heterogeneous, propagation and necrosis degree and the degree of angiogenesis etc., again
It is divided into I to IV level malignant grades.The classification system not only fails to disclose the biology essence of tumor development, and subjectivity
By force, inconsistency is up to 40%.
In recent years, scientific circles are directed to finding the parting scheme based on developed by molecule, according to glioma characterization of molecules
Targetedly prevented and treated with gene expression, to instruct the research of glioma and treatment.Operative treatment, radiotherapy and change
Learn the means such as treatment to continue to develop, the treatment of neuroimaging and glioma achieves certain progress, but the prognosis of glioma
Far from making one satisfied.It is clinical at present main reason is that glioma is the disease of molecule biology height heterogeneity
What conventional pathological analysis method was unable to entirely accurate carries out parting to it.Therefore, glioma study of pathogenesis obtain into
While exhibition, there is researcher's imagination to occur by detecting glioma, cell and specific gene table in development and relapsing course
Up to horizontal change, to be classified to glioma and be classified, and prognosis and the sensitivity of predicted treatment of glioma are assessed with this
Property.The molecular biology mark of substantial amounts of studies have shown that glioma is combined with clinical test, can preferably instruct to be directed to different diseases
The individualized treatment of people, so as to improve the diagnostic level of glioma and improve patient's prognosis.
But at present, relevant glioma occurs, the mechanism of development, and the especially changes in gene expression in evolution process is still known
It is very few, there is no a kind of molecular indexes to accurately distinguish glioma hypotype or judging prognosis.Substantial amounts of research shows, only exists
Fully realize and be possible to carry out glioma molecular classification exactly on the basis of glioma molecular pathology.It is therefore desirable to deeply
The new gene function of exploration change relation with glioma malignant characteristics, disclose the accurate molecular machine of glioma occurrence and development
System, make every effort to can the various gene expressions of accurate judgement relation and its influence to prognosis, and then it can be found that new therapeutic scheme.
The content of the invention
In order to overcome the problems of in the prior art, it is an object of the invention to provide CIRP function and purposes.
To achieve these goals and other related purposes, the present invention adopt the following technical scheme that：
The first aspect of the present invention, there is provided purposes of the adjustment in Treatment for Glioma medicine is prepared on CIRP.
Further, the medicine of the glioma at least has one of following function：Suppression glioma ability,
Suppress invasion of glioma cells power, suppress glioma cell adhesive force, suppress glioma cell migration force, suppress glioma cell
One-tenth knurl ability.
Further, adjusted on the CIRP and refer to improve the horizontal materials of CIRP.
Specifically, the raising CIRP levels can use various chemistry, physics, the method for biology.Including but not limited to：
(1) CIRP metabolic pathways are adjusted to improve CIRP expressions；
(2) CIRP levels are directly increased in intracellular.
CIRP or CIRP analogies can be sent into directly increases intracellular CIRP levels into the cell.
Regulation CIRP metabolic pathways can be using CIRP activators come improve CIRP activity or promote CIRP transcribe or
Expression, so as to raise CIRP levels.
The embodiment of the present invention have proven to by directly raise intracellular CIRP levels can suppress glioma ability,
Suppress invasion of glioma cells power, suppress glioma cell adhesive force, suppress glioma cell migration force, suppress glioma cell
One-tenth knurl ability, so as to treat glioma.And understood based on prior art, the method for foregoing regulation CIRP metabolic pathways can raise
CIRP is horizontal.Thus can deduce, the method for foregoing regulation CIRP metabolic pathways can also obtain the effect for the treatment of glioma, and then recognize
Glioma can be also treated for these methods.
Therefore, it can be CIRP, CIRP analogies or CIRP activators to be adjusted on CIRP.
As some embodiments of the invention are enumerated, it is CIRP albumen or CIRP high-expression vectors to be adjusted on CIRP.
The CIRP albumen can be obtained using bioengineering principle.
The CIRP high-expression vectors refer to the expression vector containing CIRP encoding genes.
For example, the CIRP encoding genes information can refer to NCBI Reference Sequence:NM_001280.2.
The sequence of CIRP encoding genes can be as shown in SEQ ID NO.1.
The Treatment for Glioma medicine necessarily includes adjusting on CIRP, and is adjusted using on CIRP and be used as the effective of foregoing function
Composition.
In the Treatment for Glioma medicine, the active ingredient for playing foregoing function can be only and be adjusted on CIRP, can also include
Other can play the molecule of similar function.
That is, adjusted on CIRP as one of the sole active ingredient of the Treatment for Glioma medicine or active ingredient.
The Treatment for Glioma medicine can be single composition material, also can be multi-component compound.
The form of the Treatment for Glioma medicine can be solid, liquid, gel, semi-fluid, aerosol etc. without specifically limited
Various material forms.
The Treatment for Glioma medicine mainly for object be mammal, such as rodent, primate.
The second aspect of the present invention, there is provided a kind of method for treating glioma, be to apply to adjust on CIRP to object.
The object can be mammal.The mammal is preferably rodent, artiodactylous animals, Perissodactyla
Animal, Lagomorph, primate etc..The primate is preferably monkey, ape or people.
The object can be suffered from the patient of glioma or expect prevention or alleviate the individual of glioma.
Being adjusted on CIRP can apply before, during and after Treatment for Glioma is received to object.
The third aspect of the present invention, there is provided a kind of Treatment for Glioma medicine, including adjusted on the CIRP of effective dose.
Further, the Treatment for Glioma medicine, including adjustment and pharmaceutical carrier on the CIRP of effective dose.
The Treatment for Glioma medicine necessarily includes adjusting on CIRP, and is adjusted using on CIRP and be used as the effective of foregoing function
Composition.
In the Treatment for Glioma medicine, the active ingredient for playing foregoing function can be only and be adjusted on CIRP, can also include
Other can play the molecule of similar function.
That is, adjusted on CIRP as one of the sole active ingredient of the Treatment for Glioma medicine or active ingredient.
The Treatment for Glioma medicine can be single composition material, also can be multi-component compound.
The form of the Treatment for Glioma medicine can be solid, liquid, gel, semi-fluid, aerosol etc. without specifically limited
Various material forms.
The Treatment for Glioma medicine mainly for object be mammal, such as rodent, primate.
The fourth aspect of the present invention, there is provided a kind of glioma therapeutic alliance drug regimen, including on the CIRP of effective dose
Adjust and other at least one Treatment for Glioma medicines.
The therapeutic alliance drug regimen can be any one in following form：
One) it will be adjusted on CIRP and independent preparation be respectively prepared in other Treatment for Glioma medicines, the formulation of preparation can phase
Same or different, method of administration also may be the same or different.
When other Treatment for Glioma medicines are antibody, typically parenteral type is used.When other Treatment for Glioma medicines
When thing is chemicals, form of medication can be relatively abundanter, can be that gastrointestinal administration can also be parenteral administration.Typically
The known method of administration for each chemicals is recommended to be administered.
Two) will be adjusted on CIRP and other Treatment for Glioma medicine ordinances are into compound preparation, will on CIRP adjustment and its
His Treatment for Glioma medicine is simultaneously applied using the administration of identical method of administration simultaneously when, it can use and both are configured to compound preparation
Form.
The fifth aspect of the present invention, there is provided a kind of method for treating glioma, be the CIRP that effective dose is applied to object
It is upper to adjust and apply other Treatment for Glioma medicines of effective dose to object and/or implement other Treatment for Glioma hands to object
Section.
Other gliomas adjusted on the CIRP of effective dose with least one effective dose can concurrently or sequentially be given
Medicine.
Be based on CIRP present invention firstly discovers that Treatment for Glioma target spot, with CIRP adjust beyond other colloids
In knurl medicine drug combination, the effect of curative effect addition can be at least played, further enhances the treatment effect for glioma
Fruit.
Other Treatment for Glioma medicines include but is not limited to：Antibody drug, chemicals or target medicinal etc..
It can be gastrointestinal administration or parenteral to be adjusted on the CIRP.Other described Treatment for Glioma medicines can
With gastrointestinal administration or parenteral.
The sixth aspect of the present invention, there is provided adjust and prepared with any one of following or multinomial effect medicine on CIRP
Purposes：Suppress glioma ability, suppress invasion of glioma cells power, suppress glioma cell adhesive force, suppress
Glioma cell migration force, suppress glioma cell one-tenth knurl ability.
The seventh aspect of the present invention, there is provided CIRP is used for the purposes for screening Treatment for Glioma medicine.
CIRP specifically refers to be applied to screening glioma using CIRP as action target for screening Treatment for Glioma medicine
Medicine.
CIRP is applied into screening Treatment for Glioma medicine as action target to specifically refer to using CIRP as effective object,
Candidate substances are screened, to find the material Treatment for Glioma medicine alternately that can improve CIRP expression.
The eighth aspect of the present invention, there is provided a kind of method for the medicine for screening Treatment for Glioma, methods described include：
(1) expression CIRP system is handled with candidate substances；With
(2) expression of CIRP in the system is detected；
Wherein, if the candidate substances can improve CIRP expression, it is to treat diving for glioma to show the candidate substances
In material.
The ninth aspect of the present invention, CIRP are used for the use for preparing or screening diagnosis of glioma reagent as biomarker
On the way.
The diagnosis of glioma reagent can be classified to glioma.
CIRP is used to preparing or screening diagnosis of glioma reagent, including both sides content as biomarker：
First, CIRP is used to prepare diagnosis of glioma reagent as biomarker, refer to examine CIRP as glioma
Severed finger mark is applied to the preparation of diagnosis of glioma reagent.In some embodiments, can be using CIRP as standard items or positive right
According to the detection horizontal for CIRP.
Second, CIRP is used to screen diagnosis of glioma reagent as biomarker, refer to know CIRP as glioma
Other target sieving specific recognition CIRP reagent,, can also be to colloid to detect glioma so as to be used as diagnosis of glioma reagent
Knurl is classified.
In some embodiments, based on described CIRP, screening specific recognition CIRP antibody or part is as glue
Matter knurl diagnostic reagent.
The tenth aspect of the present invention, there is provided specific recognition CIRP reagent is in diagnosis of glioma kit is prepared
Purposes.
The diagnosis of glioma kit can be classified to glioma.
In some embodiments, the antibody of the specific recognition CIRP or part can be used as diagnosis of glioma reagent.
In some embodiments, the antibody includes monoclonal antibody and polyclonal antibody.
The eleventh aspect of the present invention, there is provided a kind of diagnosis of glioma kit, at least containing spy in described kit
Opposite sex identification CIRP reagent.
The diagnosis of glioma kit can be classified to glioma.
In some embodiments, the reagent of the specific recognition CIRP can be the anti-of the specific recognition CIRP
Body or part.
In some embodiments, the antibody includes monoclonal antibody and polyclonal antibody.
In some embodiments, also contain in described kit：It is immune to combine (such as antigen-antibody combination) reagent；Or
Enzyme linked immunosorbent detection (ELISA) reagent.
Compared with prior art, the present invention has the advantages that：
It is different in glioma cell to disclose cold-induced associated proteins CIRP by in-depth study extensively first by the present invention
Often expression, its expression is related to tumor grade and resistance, at present CIRP gene expression doses and the pernicious differentiation journey of glioma
The relation of the pernicious biological properties such as degree, transfer and recurrence, and its mechanism of action whole world there is no research to report.The project is explored
New gene function changes the relation with glioma malignant characteristics, there is provided the personalized treatment of glioma provides new think of
Road.
Brief description of the drawings
Fig. 1：CIRP low expressions in samples of human glioma.
Fig. 2：CIRP albumen low expression in samples of human glioma, and its expression with the rise of malignancy and
Reduce.
Fig. 3：Stable expression CIRP cell U87 and U251 is obtained using flow sorting techniques.
Fig. 4：Western-bloting detects cell CIRP expressing quantities, it was demonstrated that the high expression CIRP of cell after sorting
Albumen.
Fig. 5：Tumor cell proliferation capacity result is found using the detection CIRP expression changes of CCK-8 methods, raises glue
CIRP expression can significantly inhibit the ex vivo growth capability of cell in matter oncocyte.
Fig. 6：CIRP expression changes are detected to invasion of glioma cells power, adhesive force and migration force using scratch experiment
Influence, the vitro invasion energy of cell can be significantly inhibited by as a result confirming the expression rise of CIRP in glioma cell of U251
Power.
Fig. 7：CIRP expression changes are observed to one-tenth knurl ability in glioma cell body using small animal living body imager
Influence, one-tenth knurl ability inside cell can be significantly inhibited by as a result finding the expression of CIRP in rise glioma cell.
Embodiment
Present inventor has made extensive and intensive studies, and finds cold-induced associated proteins CIRP in colloid first
Oncocyte unconventionality expression, its expression is related to tumor grade and resistance, and CIRP gene expression doses are disliked with glioma at present
Property the pernicious biological property such as differentiation degree, transfer and recurrence relation, and its mechanism of action whole world there is no research to report.Should
Project explores new gene function change and the relation of glioma malignant characteristics, there is provided the personalized treatment of glioma provides
New thinking.
Adjusted on CIRP
Refer to and improve the horizontal materials of CIRP.Various chemistry, physics, the method for biology can be used by improving CIRP levels.Bag
Include but be not limited to：
(1) CIRP metabolic pathways are adjusted to improve CIRP expressions；
(2) CIRP levels are directly increased in intracellular.
CIRP or CIRP analogies can be sent into directly increases intracellular CIRP levels into the cell.
Regulation CIRP metabolic pathways can be using CIRP activators come improve CIRP activity or promote CIRP transcribe or
Expression, so as to raise CIRP levels.
The activity for improving CIRP is to instigate CIRP activity to improve.Preferably, before compared to raising, CIRP activity improves at least
10%, at least 30%, then good raising at least 50% are preferably improved, more preferably improves 70%, optimal raising at least 90%.
CIRP transcriptions or expression is promoted to refer to：Make the high expression of CIRP, or improve CIRP transcriptional activities.
Those skilled in the art can use conventional method to be transcribed to CIRP or express.
Preferably, CIRP transcriptions or expression at least improve at least 10%, preferably improve at least 30%, then good raising is extremely
Few 50%, 70% is more preferably improved, optimal raising at least 90%.
Adjustment prepares medicine on CIRP
One of active component or main active is wanted to prepare medicine based on being adjusted on CIRP.Generally, in medicine except
Outside active ingredient, according to the needs of different dosage forms, one or more pharmaceutically acceptable carriers or auxiliary material will also include.
" pharmaceutically acceptable " refers to that they will not be produced when biomolecule ontology and composition suitably give animal or people
Raw unfavorable, allergy or other adverse reactions.
" pharmaceutically acceptable carrier or auxiliary material " should with adjusted on CIRP it is compatible, can be blended without logical
The effect of pharmaceutical composition is greatly lowered in the case of often.Can be as some of pharmaceutically acceptable carrier or auxiliary material materials
Specific example is carbohydrate, such as lactose, dextrose and saccharose；Starch, such as cornstarch and potato starch；Cellulose and its derivative
Thing, such as sodium carboxymethylcellulose pyce, ethyl cellulose and methylcellulose；Tragacanth powder；Malt；Gelatin；Talcum；Solid lubrication
Agent, such as stearic acid and magnesium stearate；Calcium sulfate；Vegetable oil, such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil and can
Can oil；Polyalcohol, such as the third two liquor-saturated, glycerine, D-sorbite, mannitol and polyethylene glycol；Alginic acid；Emulsifying agent, such as Tween；
Wetting agent, such as NaLS；Colouring agent；Flavor enhancement；Tablet agent, stabilizer；Antioxidant；Preservative；Apirogen water；Deng
Ooze salting liquid；With phosphate buffer etc..These materials are used to help the stability of formula or are favorably improved work as needed
Property or it biological effectiveness or produce acceptable mouthfeel or smell in the case of oral.
In the present invention, unless stated otherwise, pharmaceutical dosage form is not particularly limited, and can be made into injection, oral liquid, piece
The formulations such as agent, capsule, dripping pill, spray, it can be prepared by conventional method.The selection of pharmaceutical dosage form should be with administering mode phase
Match somebody with somebody.
Therapeutic alliance drug regimen and application process
The therapeutic alliance drug regimen can be any one in following form：
One) it will be adjusted on CIRP and independent preparation be respectively prepared in other Treatment for Glioma medicines, the formulation of preparation can phase
Same or different, method of administration also may be the same or different.In use, can several medicines use simultaneously, also can several medicines successively use.First
After when being administered, should be formerly with medicine still to applying other drugs to body in body effective period.
Two) will be adjusted on CIRP and other Treatment for Glioma medicine ordinances are into compound preparation, will on CIRP adjustment and its
His Treatment for Glioma medicine is simultaneously applied using the administration of identical method of administration simultaneously when, it can use and both are configured to compound preparation
Form.
Other gliomas adjusted on the CIRP of effective dose with least one effective dose can concurrently or sequentially be given
Medicine.
Used simultaneously with other Treatment for Glioma medicines of effective dose in use, will can be adjusted on the CIRP of effective dose,
It can will be adjusted on the CIRP of effective dose and other Treatment for Glioma medicines of effective dose successively use., should be during consecutive administration
First with medicine still to applying other drugs to organism in organism effective period.
Before the specific embodiment of the invention is further described, it should be appreciated that protection scope of the present invention is not limited to down
State specific specific embodiment；It is also understood that the term used in the embodiment of the present invention is specific specific in order to describe
Embodiment, the protection domain being not intended to be limiting of the invention.The test method of unreceipted actual conditions in the following example,
Generally according to normal condition, or the condition proposed by according to each manufacturer.
When embodiment provides number range, it should be appreciated that except non-invention is otherwise noted, two ends of each number range
Any one numerical value can be selected between point and two end points.Unless otherwise defined, in the present invention all technologies for using and
Scientific terminology is identical with the meaning that those skilled in the art of the present technique are generally understood that.Except used in embodiment specific method, equipment,
Outside material, according to grasp of the those skilled in the art to prior art and the record of the present invention, it can also use and this
Any method, equipment and the material of the similar or equivalent prior art of method, equipment described in inventive embodiments, material come real
The existing present invention.
Unless otherwise indicated, disclosed in this invention experimental method, detection method, preparation method using this technology lead
Domain conventional molecular biology, biochemistry, chromatin Structure and analysis, analytical chemistry, cell culture, recombinant DNA technology and
The routine techniques of association area.These technologies existing perfect explanation in the prior art, for details, reference can be made to Sambrook etc.
MOLECULAR CLONING：A LABORATORY MANUAL, Second edition, Cold Spring Harbor
Laboratory Press, 1989and Third edition, 2001；Ausubel etc., CURRENT PROTOCOLS IN
MOLECULAR BIOLOGY, John Wiley＆Sons, New York, 1987and periodic updates；the
Series METHODS IN ENZYMOLOGY, Academic Press, San Diego；Wolffe, CHROMATIN
STRUCTURE AND FUNCTION, Third edition, Academic Press, San Diego, 1998；METHODS IN
ENZYMOLOGY, Vol.304, Chromatin (P.M.Wassarman and A.P.Wolffe, eds.), Academic
Press, San Diego, 1999；With METHODS IN MOLECULAR BIOLOGY, Vol.119, Chromatin
Protocols (P.B.Becker, ed.) Humana Press, Totowa, 1999 etc..
Embodiment 1CIRP is in glioma generation, developing effect
First, CIRP expressions and malignant grade of gliomas has correlation
(1) many cases glioma clinical tissue sample is collected, CIRP albumen is studied in glioma group using real-time PCR
Expression in knitting, as a result confirm as shown in figure 1, CIRP low expressions in samples of human glioma.
(2) many cases glioma clinical tissue sample is collected, confirms CIRP albumen in samples of human glioma using Immunohistochemical Method
In expression, as a result confirm as shown in Fig. 2 CIRP albumen low expression in samples of human glioma, and its expression with
The rise of malignancy and reduce.
2nd, influence of the CIRP expression change to normal colloid and the general biological characteristics of glioma cell
A, the glioma cell of stable expression CIRP genes is obtained：
A) structure of recombined lentivirus vector：CIRP genes are cloned using PCR method, and it is electric with 10g/L Ago-Gels
Swimming identification amplified production simultaneously cuts glue reclaim purpose fragment.By PBPLV points of the PCR primer of CIRP genes and slow virus expression plasmid
Not Yong restriction enzymes double zyme cutting, by agarose gel electrophoresis separate digestion products, be separately recovered with glue reclaim kit
CIRP genes and carrier segments, recovery product 3: 1 mixing in molar ratio, were connected in 16 DEG C in the presence of T4DNA ligases
At night, CIRP recombinant plasmids are built, then convert and expanded into bacillus coli DH 5 alpha, the bacterium solution after conversion is applied to containing ampicillin
Overnight incubation on LB agar plates.Select through PCR be accredited as the positive single bacterium colony be inoculated in the LB culture mediums containing ampicillin,
37 DEG C of shaken overnights, next day extraction plasmid, digestion identification, and send Sangon companies to be sequenced positive bacterium solution, sequencing result and base
Yin Ku is compared, it is determined that the target gene fragment cloned.It will breed containing the bacterium solution correctly cloned, extraction recombinant plasmid freezes
It is standby in -20 DEG C.
B) virus packaging：By the SOCS-3 Lentivirals built and packaging plasmid pLP1, pLP2, envelope plasmid
PLP/VSVG, 42 μ L Lipo fectAMINE 2000 are mixed in serum-free DMEM in high glucose culture medium, are incubated at room temperature 20min,
Form DNA-LipofectAMINE2000 compounds；293FT cells are digested with pancreatin, about 6 × 106 cells is collected and is resuspended in 5mL
In growth medium, mixed with the compounds of DNA-Lipo fectAMINE 2000；The 10cm for adding the growth medium containing 5mL is thin
In born of the same parents' culture dish, the overnight incubation in 37 DEG C, 5%CO2 incubators, the complete medium of the secondary daily Sodium Pyruvate containing 1mmol/L changes
Liquid, supernatant is collected after transfecting 48~72h, 3000r/min centrifugations 15min removes cell fragment, frozen in -80 DEG C.Obtained
In CIRP high-expression vectors, the sequence of the CIRP encoding genes contained is (NCBI Reference Sequence:NM_
001280.2 Zhong CDS areas)：atggcatcaga tgaaggcaaa ctttttgttggagggctgag ttttgacacc
aatgagcagt cgctggagca ggtcttctca aagtacggac agatctctga agtggtggtt gtgaaagaca
gggagaccca gagatctcgg ggatttgggt ttgtcacctt tgagaacatt gacgacgcta aggatgccat
gatggccatg aatgggaagtctgtagatgg acggcagatc cgagtagacc aggcaggcaa gtcgtcagac
aaccgatccc gtgggtaccg tggtggctct gccgggggcc ggggcttctt ccgtgggggc
cgaggacggggccgtgggtt ctctagagga ggaggggacc gaggctatgg ggggaaccgg ttcgagtcca
ggagtggggg ctacggaggc tccagagact actatagcag ccggagtcag agtggtggctacagtgaccg
gagctcgggc gggtcctaca gagacagtta tgacagttac gctacacaca acgagtaa(SEQ ID NO.1)。
C) cell transfecting sorts with fluidic cell：In the glioma cell being incubated on six orifice plates, while add 2mL diseases
Cell is resuspended in venom and polybrene (final concentration of 6mg/L), and next day changes liquid, continues culture to 72h.24~72h is in glimmering after transfection
Viewed under light microscopy cell transfecting efficiency, collect the cell after transfection and carry out flow cytometry sorting, obtain high expression GFP's
Cell.
As shown in figure 3, successfully the stable expression height of structure expresses CIRP glioma cell line U87 and U251.Such as Fig. 4 institutes
Show, Western-bloting detection cell CIRP expressing quantities, it was demonstrated that the high expression CIRP albumen of cell after sorting.
B, using the detection CIRP expression changes of CCK-8 methods to tumor cell proliferation capacity：Collect exponential phase
Each group cell, 96 orifice plates are inoculated with, CCK-8 detects the cell growth proliferation rate of 1-6 days respectively, draws cell growth curve, compares
Proliferative ability changes.As shown in figure 5, tumor cell proliferation capacity result is sent out using the detection CIRP expression changes of CCK-8 methods
Existing, the ex vivo growth capability of cell can be significantly inhibited by raising the expression of CIRP in glioma cell.
C, CIRP expression changes are detected respectively using scratch experiment to invasion of glioma cells power, the change of migration force.Such as
Shown in Fig. 6, shadow of the CIRP expression change to invasion of glioma cells power, adhesive force and migration force is detected using scratch experiment
Ring, the vitro invasion ability of cell can be significantly inhibited by as a result confirming the expression rise of CIRP in glioma cell of U251.
2nd, influence of the CIRP expression change to glioma cell one-tenth knurl ability
A, the rat Glioma cells that stable expression luciferin gene expressed or disturbed gene with CIRP are obtained：Structure contains
The luciferase Lentiviral of GFP labels, by slow virus carrier plasmid with packaging plasmid altogether be incubated transfection 293FT it is thin
Born of the same parents, obtain viral supernatants；Stablize the glioma cell of expression/interference CIRP genes using virus infection, utilize streaming point afterwards
The cell of the stable expressing luciferase gene of choosing screening and CIRP (+/-).
B, influence of the small animal living body imager observation CIRP expression changes to one-tenth knurl ability in glioma cell body is utilized：
Will be with 1x106/ 100ul is inoculated in nude mouse, different time points after transplanted cells, gives animal injected fluorescein zymolyte, is led to
Cross living imaging instrument tracer transplanted cells into efflux velocity, tumorous size, the life cycle of metastases situation and animal.Such as Fig. 7
Shown, successfully the stable expression luciferin gene of structure and the rat Glioma cells system U251 of CIRP expressing genes, utilize petty action
Thing living imaging instrument observes influence of the CIRP expression changes to one-tenth knurl ability in glioma cell body, as a result finds rise colloid
CIRP expression can significantly inhibit one-tenth knurl ability inside cell in oncocyte, and the highest that animal experimental observation arrives suppresses
Rate is up to 50%.
It is described above, only presently preferred embodiments of the present invention, it is not any to the present invention in form and substantial limitation,
It should be pointed out that for those skilled in the art, on the premise of the inventive method is not departed from, can also make
Some improvement and supplement, these are improved and supplement also should be regarded as protection scope of the present invention.All those skilled in the art,
Without departing from the spirit and scope of the present invention, when made using disclosed above technology contents it is a little more
Dynamic, modification and the equivalent variations developed, it is the equivalent embodiment of the present invention；Meanwhile all substantial technologicals pair according to the present invention
The variation, modification and evolution for any equivalent variations that above-described embodiment is made, still fall within the scope of technical scheme
It is interior.
Sequence table
<110>No.1 Hospital attached to PLA Gen. Hospital
<120>CIRP function and purposes
<130> 174932
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 519
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
atggcatcag atgaaggcaa actttttgtt ggagggctga gttttgacac caatgagcag 60
tcgctggagc aggtcttctc aaagtacgga cagatctctg aagtggtggt tgtgaaagac 120
agggagaccc agagatctcg gggatttggg tttgtcacct ttgagaacat tgacgacgct 180
aaggatgcca tgatggccat gaatgggaag tctgtagatg gacggcagat ccgagtagac 240
caggcaggca agtcgtcaga caaccgatcc cgtgggtacc gtggtggctc tgccgggggc 300
cggggcttct tccgtggggg ccgaggacgg ggccgtgggt tctctagagg aggaggggac 360
cgaggctatg gggggaaccg gttcgagtcc aggagtgggg gctacggagg ctccagagac 420
tactatagca gccggagtca gagtggtggc tacagtgacc ggagctcggg cgggtcctac 480
agagacagtt atgacagtta cgctacacac aacgagtaa 519
Claims (10)
1.CIRP is used for the purposes for preparing or screening diagnosis of glioma reagent as biomarker.
2. purposes according to claim 1, it is characterised in that the diagnosis of glioma reagent can divide glioma
Level.
3. purposes of the specific recognition CIRP reagent in diagnosis of glioma kit is prepared.
4. a kind of diagnosis of glioma kit, the reagent in described kit at least containing specific recognition CIRP.
Purposes of the adjustment in Treatment for Glioma medicine is prepared on 5.CIRP.
6. purposes according to claim 5, it is characterised in that adjusted on the CIRP and refer to improve the horizontal things of CIRP
Matter.
7. a kind of Treatment for Glioma medicine, including adjusted on the CIRP of effective dose.
8. a kind of glioma therapeutic alliance drug regimen, including adjusted on the CIRP of effective dose and other at least one gliomas
Medicine.
9.CIRP is used for the purposes for screening Treatment for Glioma medicine.
10. a kind of method for screening Treatment for Glioma medicine, methods described include：
(1) expression CIRP system is handled with candidate substances；With
(2) expression of CIRP in the system is detected；
Wherein, if the candidate substances can improve CIRP expression, it is to treat the potential thing of glioma to show the candidate substances
Matter.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711217349.0A CN107727860A (en) | 2017-11-28 | 2017-11-28 | CIRP function and purposes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711217349.0A CN107727860A (en) | 2017-11-28 | 2017-11-28 | CIRP function and purposes |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107727860A true CN107727860A (en) | 2018-02-23 |
Family
ID=61220000
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711217349.0A Pending CN107727860A (en) | 2017-11-28 | 2017-11-28 | CIRP function and purposes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107727860A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114594271A (en) * | 2022-03-30 | 2022-06-07 | 唐颢 | Application of CIRBP gene or protein coded by CIRBP gene in treatment of myocardial injury |
-
2017
- 2017-11-28 CN CN201711217349.0A patent/CN107727860A/en active Pending
Non-Patent Citations (2)
| Title |
|---|
| 北京博尔迈生物技术有限公司: "CycLex推出4种新试剂盒", 《WWW.BIO-MED.COM.CN/NEWSINFO.PHP?ID=14&SID=499》 * |
| 张海涛: "冷休克蛋白参与神经保护作用的分子调控机制研究", 《中国博士学位论文全文数据库医药卫生科技辑》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114594271A (en) * | 2022-03-30 | 2022-06-07 | 唐颢 | Application of CIRBP gene or protein coded by CIRBP gene in treatment of myocardial injury |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107075473A (en) | The wherein cell mass of the removed induction of neoblast, its purposes and preparation method thereof | |
| CN107028957B (en) | Traditional Chinese medicine monomer toosendanin serving as STAT3 inhibitor and application thereof in preparation of anti-osteosarcoma drugs | |
| CN114920835A (en) | High-affinity fully human monoclonal antibody for resisting rabies virus and application thereof | |
| CN107727860A (en) | CIRP function and purposes | |
| CN110151758A (en) | Qinghaosu is in the application for preparing anti-human liver cancer HepG2 and Huh7 cell drug | |
| CN110337446A (en) | CCR2 in adoptive cellular therapy+The t cell activation that candidate stem cell mediates | |
| CN102596904A (en) | Protease inhibitors, compositions and methods of use | |
| CN106420791A (en) | Application of miR-145-3p in preparing medicines for preventing or treating multiple myeloma disease | |
| CN105063196A (en) | Application of combination of proteasome inhibitor and cell autophagy activator in bile duct cancer treatment | |
| CN112957357B (en) | Target KLF4 ubiquitination small molecule inhibitor and application thereof | |
| CN102746402A (en) | Fully-humanized anti-human prolactin receptor single-chain antibody and application thereof | |
| CN101113169B (en) | Use of sorting protein SNX10 for suppressing growth of tumour cell | |
| CN1687130A (en) | Nucleus factor-kB p50 subunit antagonist peptide, preparation and application thereof | |
| CN109223801B (en) | Novel gastric cancer tumor stem cell killing agent and application thereof | |
| CN108498800A (en) | Application of COPB2 inhibitor in preparation of bladder cancer treatment drug | |
| CN107303290B (en) | Novel application of aromatic cyclopropyl amine compound | |
| CN112587530B (en) | Novel pharmaceutical application of Baricitinib | |
| WO2024207679A1 (en) | Use of gpc3 and gpc3-car-t in diagnosis and treatment for idiopathic pulmonary fibrosis | |
| CN111139299B (en) | Application of JOSD2 protein in preparing medicine for treating malignant tumor | |
| CN116942645A (en) | Application of Phomopsterone B in preparation of drugs for treating hepatic fibrosis | |
| CN107868782A (en) | Nucleic acid molecules CTL4HSH3, its preparation method and application | |
| CN110420328A (en) | SYT14 inhibitor is preparing the purposes in lung cancer therapy drug | |
| CN107868783A (en) | Nucleic acid molecules CTL4HSH2, its preparation method and application | |
| CN110129276A (en) | A kind of construction method of LFF1 cell | |
| CN109679916A (en) | A kind of LFF1 cell |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20180223 |
|
| WD01 | Invention patent application deemed withdrawn after publication |